version

Summary of OsREG426 (All List)

OrganismOryza sativa  
IDOsREG426  
SequenceAAGCCCAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1718  

Entry Sequences (1718 entries)

LocusGene modelSequenceDescription
Os01g0104800AK067602GAAGCCCAATASas10/Utp3 family protein. 
J013109E04GAAGCCCAATANONE 
J033057M05GAAGCCCAATANONE 
J043021M24GAAGCCCAATANONE 
J090014N05GAAGCCCAATANONE 
J090077H23GAAGCCCAATANONE 
J090084H08GAAGCCCAATANONE 
Os01g0134200AK102394TTGGCCCAAGCAAGCCCAACAConserved hypothetical protein. 
Os01g0142500AK067964CAAGCCCAAGHomeodomain-like containing protein. 
Os01g0158900AK066765AAAAGCCCAATZinc finger, RING-type domain containing protein. 
Os01g0190400AK064011AAAAGCCCAACSimilar to Hexokinase. 
AK099119AAAAGCCCAACNONE 
Os01g0214300AK060604GAAGCCCAAGConserved hypothetical protein. 
Os01g0220300009-063-C12TATTGGGCTTTNONE 
AK105167TATTGGGCTTTConserved hypothetical protein. 
J065124E17TATTGGGCTTTNONE 
J090096L11TATTGGGCTTTNONE 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
AK069972CCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075090M12CCAAGCCCAAAANONE 
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075146A12CCAAGCCCAAAANONE 
Os01g0276000009-162-D08AGCCCAAGCCCAACANONE 
009-162-D08GAAGCCCAACANONE 
AK058917AGCCCAAGCCCAACASimilar to 60S ribosomal protein L30. 
AK058917GAAGCCCAACASimilar to 60S ribosomal protein L30. 
AK119715AGCCCAAGCCCAACANONE 
AK119715GAAGCCCAACANONE 
AK122128AGCCCAAGCCCAACANONE 
AK122128GAAGCCCAACANONE 
J033132L17AGCCCAAGCCCAACANONE 
J033132L17GAAGCCCAACANONE 
J065019G15AGCCCAAGCCCAACANONE 
J065019G15GAAGCCCAACANONE 
J065033O12AGCCCAAGCCCAACANONE 
J065033O12GAAGCCCAACANONE 
J065058J19AGCCCAAGCCCAACANONE 
J065058J19GAAGCCCAACANONE 
J065069L03AGCCCAAGCCCAACANONE 
J065069L03GAAGCCCAACANONE 
J065072E03AGCCCAAGCCCAACANONE 
J065072E03GAAGCCCAACANONE 
J065112J06AGCCCAAGCCCAACANONE 
J065112J06GAAGCCCAACANONE 
J065163C18AGCCCAAGCCCAACANONE 
J065163C18GAAGCCCAACANONE 
J065170L20AGCCCAAGCCCAACANONE 
J065170L20GAAGCCCAACANONE 
J065184O11AGCCCAAGCCCAACANONE 
J065184O11GAAGCCCAACANONE 
J065199M19AGCCCAAGCCCAACANONE 
J065199M19GAAGCCCAACANONE 
J065207P22AGCCCAAGCCCAACANONE 
J065207P22GAAGCCCAACANONE 
J065211C12AGCCCAAGCCCAACANONE 
J065211C12GAAGCCCAACANONE 
J075072K20AGCCCAAGCCCAACANONE 
J075072K20GAAGCCCAACANONE 
J075100B16AGCCCAAGCCCAACANONE 
J075100B16GAAGCCCAACANONE 
J075173F02AGCCCAAGCCCAACANONE 
J075173F02GAAGCCCAACANONE 
J090083E15AGCCCAAGCCCAACANONE 
J090083E15GAAGCCCAACANONE 
J100022F06AGCCCAAGCCCAACANONE 
J100022F06GAAGCCCAACANONE 
J100064C04AGCCCAAGCCCAACANONE 
J100064C04GAAGCCCAACANONE 
J100068F11AGCCCAAGCCCAACANONE 
J100068F11GAAGCCCAACANONE 
Os01g0303300J053035N19AAAGCCCAACCNONE 
J075042F02AAAGCCCAACCNONE 
J075068E10AAAGCCCAACCNONE 
J075116E19AAAGCCCAACCNONE 
J075131C10AAAGCCCAACCNONE 
J075145J11AAAGCCCAACCNONE 
J075157P20AAAGCCCAACCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12AAAGCCCAACCNONE 
Os01g0349000AK108540TAAGCCCAAAAConserved hypothetical protein. 
J065059M15TAAGCCCAAAANONE 
Os01g0350900AK070217GGTTGGGCTTGSimilar to VIP2 protein. 
J065165D23GGTTGGGCTTGNONE 
Os01g0358300AK060388GTGGTGGGCCGGTTTGGGCTTTTNONE 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-C09AAAAGCCCAAACCGGCCCACCACNONE 
006-088-H03AAAAGCCCAAACCGGCCCACCACNONE 
006-102-H05AAAAGCCCAAACCGGCCCACCACNONE 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
J013105M07AAAAGCCCAAACCGGCCCACCACNONE 
J013155A16AAAAGCCCAAACCGGCCCACCACNONE 
J033025C03AAAAGCCCAAACCGGCCCACCACNONE 
J033072L20AAAAGCCCAAACCGGCCCACCACNONE 
J033095I15AAAAGCCCAAACCGGCCCACCACNONE 
J033105E03AAAAGCCCAAACCGGCCCACCACNONE 
J033112G18AAAAGCCCAAACCGGCCCACCACNONE 
J033125D09AAAAGCCCAAACCGGCCCACCACNONE 
J065100L16AAAAGCCCAAACCGGCCCACCACNONE 
J065176I05AAAAGCCCAAACCGGCCCACCACNONE 
J090001C14AAAAGCCCAAACCGGCCCACCACNONE 
J090058E15AAAAGCCCAAACCGGCCCACCACNONE 
J090068F07AAAAGCCCAAACCGGCCCACCACNONE 
Os01g0512200J013067C10ATCCCCCACAAGCCCAACTNONE 
Os01g0585400AK103584AGCCCAAAGCCCAATConserved hypothetical protein. 
J033133B01AGCCCAAAGCCCAATNONE 
Os01g0639600005-018-A02GAAGCCCAAACNONE 
AK067056GAAGCCCAAACProtein of unknown function DUF1645 family protein. 
J013066M03GAAGCCCAAACNONE 
J013066O05GAAGCCCAAACNONE 
J013088M21GAAGCCCAAACNONE 
J065045F04GAAGCCCAAACNONE 
J080018F22GAAGCCCAAACNONE 
J080037B10GAAGCCCAAACNONE 
J080042G23GAAGCCCAAACNONE 
J080052B21GAAGCCCAAACNONE 
J080060H13GAAGCCCAAACNONE 
J100024A05GAAGCCCAAACNONE 
J100071A09GAAGCCCAAACNONE 
J100080K14GAAGCCCAAACNONE 
Os01g0649900AK068077TTTTGGGCTTTTLipolytic enzyme, G-D-S-L family protein. 
Os01g0679600009-061-F03AAAGCCCAATAGGCCCAATANONE 
014-055-H04AAAGCCCAATAGGCCCAATANONE 
AK062530AAAGCCCAATAGGCCCAATAConserved hypothetical protein. 
J065015E10AAAGCCCAATAGGCCCAATANONE 
J065061F21AAAGCCCAATAGGCCCAATANONE 
J065128F13AAAGCCCAATAGGCCCAATANONE 
J065189E14AAAGCCCAATAGGCCCAATANONE 
J075006F04AAAGCCCAATAGGCCCAATANONE 
J075017A20AAAGCCCAATAGGCCCAATANONE 
J075075H02AAAGCCCAATAGGCCCAATANONE 
J075104C06AAAGCCCAATAGGCCCAATANONE 
J075154F23AAAGCCCAATAGGCCCAATANONE 
J075168N01AAAGCCCAATAGGCCCAATANONE 
J075189L15AAAGCCCAATAGGCCCAATANONE 
J075192J18AAAGCCCAATAGGCCCAATANONE 
J100062M10AAAGCCCAATAGGCCCAATANONE 
J100064C23AAAGCCCAATAGGCCCAATANONE 
J100080M16AAAGCCCAATAGGCCCAATANONE 
Os01g0688200AK120982AAAGCCCAATAAlpha/beta hydrolase family protein. 
Os01g0704700AK100296AAAGCCCAATSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2. 
Os01g0707300AK059962TAAGCCCAACANONE 
AK104463TAAGCCCAACASimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0710800013-097-E05GGTTGGGCTTGAAGCCCAACNONE 
AK069973GGTTGGGCTTGAAGCCCAACNONE 
AK071099GGTTGGGCTTGAAGCCCAACConserved hypothetical protein. 
J023081K01GGTTGGGCTTGAAGCCCAACNONE 
J023123E16GGTTGGGCTTGAAGCCCAACNONE 
J033066B11GGTTGGGCTTGAAGCCCAACNONE 
J065144G11GGTTGGGCTTGAAGCCCAACNONE 
Os01g0736100011-091-H04TTTTGGGCTTTTNONE 
015-004-D10TTTTGGGCTTTTNONE 
AK064298TTTTGGGCTTTTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK099365TTTTGGGCTTTTNONE 
AK103355TTTTGGGCTTTTNONE 
J033044B20TTTTGGGCTTTTNONE 
J033094G06TTTTGGGCTTTTNONE 
J033111N02TTTTGGGCTTTTNONE 
J033111P10TTTTGGGCTTTTNONE 
J033126K03TTTTGGGCTTTTNONE 
J043034D12TTTTGGGCTTTTNONE 
Os01g0781000006-077-C12GTTGGGCTTANONE 
009-156-E02GTTGGGCTTANONE 
AK059870GTTGGGCTTAVacuolar protein sorting-associated, VPS28 family protein. 
AK099116GTTGGGCTTANONE 
AK104274GTTGGGCTTANONE 
J023034E12GTTGGGCTTANONE 
J075074G06GTTGGGCTTANONE 
J090041H03GTTGGGCTTANONE 
J100045K08GTTGGGCTTANONE 
Os01g0798800016-068-H08TTTGGGCTTTNONE 
AK064257TTTGGGCTTTProtein of unknown function DUF594 family protein. 
Os01g0829400AK109566AAAAGCCCAAAAGlutaredoxin domain containing protein. 
Os01g0838300J090017B22CCAAGCCCAACTNONE 
J090061B04CCAAGCCCAACTNONE 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0850900009-089-D11AAAGCCCAAANONE 
AK063822AAAGCCCAAANONE 
AK102887AAAGCCCAAASOUL heme-binding protein family protein. 
J033112K22AAAGCCCAAANONE 
J065087B10AAAGCCCAAANONE 
J065100A05AAAGCCCAAANONE 
J075077M10AAAGCCCAAANONE 
Os01g0908100AK072293TGTTGGGCTTGRabGAP/TBC domain containing protein. 
J065010B13TGTTGGGCTTGNONE 
J065010M12TGTTGGGCTTGNONE 
J065047C19TGTTGGGCTTGNONE 
J065069B18TGTTGGGCTTGNONE 
J065071K24TGTTGGGCTTGNONE 
J065142P04TGTTGGGCTTGNONE 
J065170E11TGTTGGGCTTGNONE 
Os01g0915800AK103859AAAGCCCAAAASimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20AAAGCCCAAAANONE 
J090056H03AAAGCCCAAAANONE 
J090058L14AAAGCCCAAAANONE 
J090058P16AAAGCCCAAAANONE 
J090076C19AAAGCCCAAAANONE 
J100086P14AAAGCCCAAAANONE 
Os01g0960400AK111512CCAAGCCCAACTProtein kinase-like domain containing protein. 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
Os01g0972000006-090-C11AAAGCCCAAGNONE 
AK106003AAAGCCCAAGZinc finger, RING-type domain containing protein. 
J065184F12AAAGCCCAAGNONE 
J075085O21AAAGCCCAAGNONE 
Os01g0974500015-047-H07ATTGGGCTTCNONE 
AK064109ATTGGGCTTCPectinacetylesterase family protein. 
Os01g0976100AK069646AGTTGGGCTTGABC transporter, transmembrane region domain containing protein. 
Os02g0119700AK108777AAAGCCCAACAProtein prenyltransferase domain containing protein. 
Os02g0133800006-092-D12CCTGGGCCAAAGCCCAATTNONE 
006-111-G01CCTGGGCCAAAGCCCAATTNONE 
AK103646CCTGGGCCAAAGCCCAATTNONE 
AK109376CCTGGGCCAAAGCCCAATTProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886CCTGGGCCAAAGCCCAATTNONE 
J033135B19CCTGGGCCAAAGCCCAATTNONE 
J065200F01CCTGGGCCAAAGCCCAATTNONE 
J065213J11CCTGGGCCAAAGCCCAATTNONE 
J075031N16CCTGGGCCAAAGCCCAATTNONE 
J075032N17CCTGGGCCAAAGCCCAATTNONE 
J075047P04CCTGGGCCAAAGCCCAATTNONE 
J075063D01CCTGGGCCAAAGCCCAATTNONE 
J075105F23CCTGGGCCAAAGCCCAATTNONE 
J075121E16CCTGGGCCAAAGCCCAATTNONE 
J075176F10CCTGGGCCAAAGCCCAATTNONE 
J075182M16CCTGGGCCAAAGCCCAATTNONE 
J075190E09CCTGGGCCAAAGCCCAATTNONE 
J075191B14CCTGGGCCAAAGCCCAATTNONE 
J100055J24CCTGGGCCAAAGCCCAATTNONE 
J100066H24CCTGGGCCAAAGCCCAATTNONE 
J100073N01CCTGGGCCAAAGCCCAATTNONE 
Os02g0167700AK069128AAAAGCCCAACCGCCCACCTArmadillo-like helical domain containing protein. 
Os02g0168500011-010-B05TAAGCCCAAGNONE 
AJ831493TAAGCCCAAGNONE 
AK073338TAAGCCCAAGNONE 
AK073486TAAGCCCAAGConserved hypothetical protein. 
J100059F05TAAGCCCAAGNONE 
J100082K14TAAGCCCAAGNONE 
J100090P09TAAGCCCAAGNONE 
Os02g0176300AK066588TGTTGGGCTTGGGCCTCGGCCCAGGConserved hypothetical protein. 
J013072N24TGTTGGGCTTGGGCCTCGGCCCAGGNONE 
Os02g0186700AK064492AAAGCCCAACTConserved hypothetical protein. 
AK064492CTTGGGCTTGConserved hypothetical protein. 
J065210K09AAAGCCCAACTNONE 
J065210K09CTTGGGCTTGNONE 
J075006A17AAAGCCCAACTNONE 
J075006A17CTTGGGCTTGNONE 
J075108C18AAAGCCCAACTNONE 
J075108C18CTTGGGCTTGNONE 
J075153E08AAAGCCCAACTNONE 
J075153E08CTTGGGCTTGNONE 
Os02g0193600AK060499AAAAGCCCAATTMad3/BUB1 homology region 1 domain containing protein. 
AK060499CCAAGCCCAACTMad3/BUB1 homology region 1 domain containing protein. 
Os02g0198600005-012-D12TTTTGGGCTTGNONE 
AK058299TTTTGGGCTTGNONE 
Os02g0205000AK060003TGTTGGGCTTTNONE 
AK073514TGTTGGGCTTTRibosomal protein L19 family protein. 
J065106I07TGTTGGGCTTTNONE 
Os02g0209900Os02g0209900AAAGCCCAAAASyntaxin/epimorphin family protein. 
Os02g0235600009-009-H04ATTTGGGCTTTTGGCCCATTTNONE 
009-165-G06ATTTGGGCTTTTGGCCCATTTNONE 
AK120417ATTTGGGCTTTTGGCCCATTTSimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14ATTTGGGCTTTTGGCCCATTTNONE 
J023106P11ATTTGGGCTTTTGGCCCATTTNONE 
J033080L09ATTTGGGCTTTTGGCCCATTTNONE 
J033123O05ATTTGGGCTTTTGGCCCATTTNONE 
J065197A18ATTTGGGCTTTTGGCCCATTTNONE 
J065216P16ATTTGGGCTTTTGGCCCATTTNONE 
J075017F02ATTTGGGCTTTTGGCCCATTTNONE 
J075025L16ATTTGGGCTTTTGGCCCATTTNONE 
J075027P04ATTTGGGCTTTTGGCCCATTTNONE 
J075039N01ATTTGGGCTTTTGGCCCATTTNONE 
J075101F24ATTTGGGCTTTTGGCCCATTTNONE 
J075132J15ATTTGGGCTTTTGGCCCATTTNONE 
J075164K16ATTTGGGCTTTTGGCCCATTTNONE 
J075174E19ATTTGGGCTTTTGGCCCATTTNONE 
J100043C23ATTTGGGCTTTTGGCCCATTTNONE 
J100067B11ATTTGGGCTTTTGGCCCATTTNONE 
Os02g0287000006-107-B10CTTGGGCTTANONE 
006-120-E07CTTGGGCTTANONE 
AF052503CTTGGGCTTANONE 
AK059647CTTGGGCTTASimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK099131CTTGGGCTTANONE 
J023048M05CTTGGGCTTANONE 
J033107L10CTTGGGCTTANONE 
J065019A12CTTGGGCTTANONE 
J065064J21CTTGGGCTTANONE 
J065071D15CTTGGGCTTANONE 
J065094L12CTTGGGCTTANONE 
J065095L06CTTGGGCTTANONE 
J065097J11CTTGGGCTTANONE 
J065099M08CTTGGGCTTANONE 
J065104D01CTTGGGCTTANONE 
J065107L02CTTGGGCTTANONE 
J065110D14CTTGGGCTTANONE 
J065135J07CTTGGGCTTANONE 
J065137C16CTTGGGCTTANONE 
J065150C07CTTGGGCTTANONE 
J065165I10CTTGGGCTTANONE 
J065189F07CTTGGGCTTANONE 
J065205L22CTTGGGCTTANONE 
J065214C09CTTGGGCTTANONE 
J065217G17CTTGGGCTTANONE 
J075029E17CTTGGGCTTANONE 
J075054O16CTTGGGCTTANONE 
J075068N23CTTGGGCTTANONE 
J075135N18CTTGGGCTTANONE 
J075152G09CTTGGGCTTANONE 
J075162D10CTTGGGCTTANONE 
J075164F11CTTGGGCTTANONE 
J080036L12CTTGGGCTTANONE 
J080049K18CTTGGGCTTANONE 
J080060P03CTTGGGCTTANONE 
J080062G16CTTGGGCTTANONE 
J080062G21CTTGGGCTTANONE 
J080064N07CTTGGGCTTANONE 
J080075I22CTTGGGCTTANONE 
J080086F20CTTGGGCTTANONE 
J080087G07CTTGGGCTTANONE 
J080088I06CTTGGGCTTANONE 
J080302B20CTTGGGCTTANONE 
J080303L14CTTGGGCTTANONE 
J080309O12CTTGGGCTTANONE 
J080317F12CTTGGGCTTANONE 
J080317P18CTTGGGCTTANONE 
J090013L15CTTGGGCTTANONE 
J090043N04CTTGGGCTTANONE 
J090085G01CTTGGGCTTANONE 
J090085G19CTTGGGCTTANONE 
Os02g0468200AK103767CCAGGCCCATCAAAGCCCAAATProtein of unknown function DUF652 family protein. 
J033071N12CCAGGCCCATCAAAGCCCAAATNONE 
J033143I02CCAGGCCCATCAAAGCCCAAATNONE 
J100019J22CCAGGCCCATCAAAGCCCAAATNONE 
J100075O13CCAGGCCCATCAAAGCCCAAATNONE 
Os02g0499300AK106994CAAGCCCAATTConserved hypothetical protein. 
Os02g0580700AK073664AGTTGGGCTTCConserved hypothetical protein. 
J090060F24AGTTGGGCTTCNONE 
Os02g0639800006-081-G07GGTTGGGCTTTNONE 
012-042-E02GGTTGGGCTTTNONE 
AK070367GGTTGGGCTTTNONE 
AK071904GGTTGGGCTTTZinc finger, RING-type domain containing protein. 
AK105980GGTTGGGCTTTNONE 
Os02g0672700AK059611AAGGCCCAACAAGCCCAACTDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179AAGGCCCAACAAGCCCAACTNONE 
J023098L23AAGGCCCAACAAGCCCAACTNONE 
J065042J21AAGGCCCAACAAGCCCAACTNONE 
J065187L09AAGGCCCAACAAGCCCAACTNONE 
J065190O10AAGGCCCAACAAGCCCAACTNONE 
J080041G14AAGGCCCAACAAGCCCAACTNONE 
J080078K08AAGGCCCAACAAGCCCAACTNONE 
J080089D20AAGGCCCAACAAGCCCAACTNONE 
J080094D04AAGGCCCAACAAGCCCAACTNONE 
Os02g0673000AK108650TAAGCCCAAGProtein of unknown function UPF0005 family protein. 
Os02g0688900AK066093GAAGCCCAACTGPI transamidase subunit PIG-U family protein. 
J065007D18GAAGCCCAACTNONE 
J065040G21GAAGCCCAACTNONE 
J065103G03GAAGCCCAACTNONE 
J065175F18GAAGCCCAACTNONE 
J065202A07GAAGCCCAACTNONE 
J075006C01GAAGCCCAACTNONE 
J075178F24GAAGCCCAACTNONE 
Os02g0708300009-007-C06TTTGGGCTTTTNONE 
009-162-G06TTTGGGCTTTTNONE 
014-048-F12TTTGGGCTTTTNONE 
AK066348TTTGGGCTTTTConserved hypothetical protein. 
J013059F24TTTGGGCTTTTNONE 
J023104H14TTTGGGCTTTTNONE 
J053052O22TTTGGGCTTTTNONE 
J053063A05TTTGGGCTTTTNONE 
J053093P09TTTGGGCTTTTNONE 
J065012F24TTTGGGCTTTTNONE 
J065063P09TTTGGGCTTTTNONE 
J065088F12TTTGGGCTTTTNONE 
J065094I11TTTGGGCTTTTNONE 
J065099H19TTTGGGCTTTTNONE 
J065116H07TTTGGGCTTTTNONE 
J065137N07TTTGGGCTTTTNONE 
J065137N11TTTGGGCTTTTNONE 
J065159L22TTTGGGCTTTTNONE 
J065159P11TTTGGGCTTTTNONE 
J065178F17TTTGGGCTTTTNONE 
J065181E07TTTGGGCTTTTNONE 
J075014L16TTTGGGCTTTTNONE 
J075030P11TTTGGGCTTTTNONE 
J075042K24TTTGGGCTTTTNONE 
J075077I15TTTGGGCTTTTNONE 
J075087P06TTTGGGCTTTTNONE 
J075089F20TTTGGGCTTTTNONE 
J075093B07TTTGGGCTTTTNONE 
J075115J23TTTGGGCTTTTNONE 
J075176O19TTTGGGCTTTTNONE 
J075178A04TTTGGGCTTTTNONE 
J075178J02TTTGGGCTTTTNONE 
J090027L02TTTGGGCTTTTNONE 
J100033M12TTTGGGCTTTTNONE 
J100065O08TTTGGGCTTTTNONE 
Os02g0721100AK108167TAAGCCCAACASimilar to E2 ubiquitin-conjugating enzyme UbcH5B (Fragment). 
Os02g0736500AK065166AAGGCCCATAAAAGCCCAACNicastrin family protein. 
J013099D16AAGGCCCATAAAAGCCCAACNONE 
Os02g0744000AK064898CCAAGCCCAAAAConserved hypothetical protein. 
AK104827CCAAGCCCAAAANONE 
J013000L12CCAAGCCCAAAANONE 
J013156N02CCAAGCCCAAAANONE 
J065001H14CCAAGCCCAAAANONE 
J065038D18CCAAGCCCAAAANONE 
J065039I18CCAAGCCCAAAANONE 
J065047C13CCAAGCCCAAAANONE 
J065053J09CCAAGCCCAAAANONE 
J065064G03CCAAGCCCAAAANONE 
J065066M05CCAAGCCCAAAANONE 
J065068O10CCAAGCCCAAAANONE 
J065090H22CCAAGCCCAAAANONE 
J065113L19CCAAGCCCAAAANONE 
J065121M02CCAAGCCCAAAANONE 
J065122K23CCAAGCCCAAAANONE 
J065138C12CCAAGCCCAAAANONE 
J065153E14CCAAGCCCAAAANONE 
J065156N12CCAAGCCCAAAANONE 
J065158L20CCAAGCCCAAAANONE 
J065166I06CCAAGCCCAAAANONE 
J065174L15CCAAGCCCAAAANONE 
J065175N03CCAAGCCCAAAANONE 
J090092C23CCAAGCCCAAAANONE 
Os02g0754700AK066904TCAGCCCAAGCCCAAGSimilar to Histidyl-tRNA synthetase (EC 6.1.1.21). 
AK099136TCAGCCCAAGCCCAAGNONE 
Os02g0769800009-140-D12TTTTGGGCTTGNONE 
AK062956TTTTGGGCTTGSimilar to Mitogen-activated protein kinase kinase kinase 1 (EC 2.7.1.-) (Arabidospsis NPK1-related protein kinase 1). Splice isoform 1S. 
Os02g0775300AK111093CCAAGCCCAAGConserved hypothetical protein. 
J100039N18CCAAGCCCAAGNONE 
Os02g0782500013-043-A07ATTTGGGCTTTNONE 
013-068-B10ATTTGGGCTTTNONE 
013-093-A08ATTTGGGCTTTNONE 
014-083-C12ATTTGGGCTTTNONE 
AK063602ATTTGGGCTTTNONE 
AK119261ATTTGGGCTTTSimilar to Small heat stress protein class CIII. 
J065013N12ATTTGGGCTTTNONE 
J075136E01ATTTGGGCTTTNONE 
J075149G04ATTTGGGCTTTNONE 
Os02g0787100Os02g0787100CAAGCCCAATAProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0791400009-106-F11CTTGGGCTTANONE 
009-106-F11TATTGGGCTTCNONE 
AK062787CTTGGGCTTACytochrome oxidase c, subunit VIb family protein. 
AK062787TATTGGGCTTCCytochrome oxidase c, subunit VIb family protein. 
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein. 
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE 
Os02g0830100J013032G02TAAGCCCAAAANONE 
J013052O21TAAGCCCAAAANONE 
J023078A05TAAGCCCAAAANONE 
J033114C07TAAGCCCAAAANONE 
J033125M07TAAGCCCAAAANONE 
J053045C11TAAGCCCAAAANONE 
J100055G05TAAGCCCAAAANONE 
J100080J22TAAGCCCAAAANONE 
Os02g0832700AK099439TGTTGGGCCTTTGGGCTTCSimilar to Metal tolerance protein C2 (AtMTPc2). 
Os03g0108600AK065776CAAGCCCAAACDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013038N14CAAGCCCAAACNONE 
Os03g0111800AK121627AAAGCCCAAAGCCCAAGWD40-like domain containing protein. 
Os03g0116500AF106844TAGGCCCATGAAAGCCCAAACNONE 
AK101870TAGGCCCATGAAAGCCCAAACConstitutive photomorphogenic 11. 
J023055L16TAGGCCCATGAAAGCCCAAACNONE 
J023088I16TAGGCCCATGAAAGCCCAAACNONE 
J033070E21TAGGCCCATGAAAGCCCAAACNONE 
J065124N22TAGGCCCATGAAAGCCCAAACNONE 
J075152A19TAGGCCCATGAAAGCCCAAACNONE 
J075181J21TAGGCCCATGAAAGCCCAAACNONE 
J090011F23TAGGCCCATGAAAGCCCAAACNONE 
Os03g0124300AK069148CAAGCCCAACCConserved hypothetical protein. 
AK106076CAAGCCCAACCNONE 
J023003G19CAAGCCCAACCNONE 
Os03g0148000AK110468ATTTGGGCTTCProtein of unknown function DUF677 family protein. 
Os03g0148400AK072852GAAGCCCAAAProtein of unknown function DUF740 family protein. 
J023138H13GAAGCCCAAANONE 
Os03g0149400AK111396CTTGGGCTTTCAAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os03g0159100AK065635AAAAGCCCAAAASimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
Os03g0167600AK121254TAAGCCCAAAASimilar to Male sterility protein 2. 
Os03g0175600AK059981AAAGCCCAAGSimilar to Nit protein 2 (CUA002). 
Os03g0181400012-051-B05CAAGCCCAATANONE 
015-065-E09CAAGCCCAATANONE 
AK064006CAAGCCCAATAProtein of unknown function DUF860, plant family protein. 
Os03g0248000AK070612CAAGCCCAAGCCCNONE 
AK071419CAAGCCCAAGCCCNONE 
AK100304CAAGCCCAAGCCCAutophagy protein Apg9 family protein. 
Os03g0262400014-013-D09AAAAGCCCAAAAGGCCGAAANONE 
AK059989AAAAGCCCAAAAGGCCGAAASimilar to Eukaryotic translation initiation factor 4E type 3 (eIF4E type 3) (eIF-4E type 3) (mRNA cap-binding protein type 3) (Novel cap-binding protein) (nCBP). 
J023036I18AAAAGCCCAAAAGGCCGAAANONE 
J033025J23AAAAGCCCAAAAGGCCGAAANONE 
J065047G10AAAAGCCCAAAAGGCCGAAANONE 
J065153H03AAAAGCCCAAAAGGCCGAAANONE 
J065155J08AAAAGCCCAAAAGGCCGAAANONE 
J075025C05AAAAGCCCAAAAGGCCGAAANONE 
Os03g0268300AK102684TAGGCCCAAGCCCAACCSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22TAGGCCCAAGCCCAACCNONE 
J013057J23TAGGCCCAAGCCCAACCNONE 
J013149I10TAGGCCCAAGCCCAACCNONE 
J013149M20TAGGCCCAAGCCCAACCNONE 
J013151D14TAGGCCCAAGCCCAACCNONE 
J013162O11TAGGCCCAAGCCCAACCNONE 
J023001F12TAGGCCCAAGCCCAACCNONE 
J023031B21TAGGCCCAAGCCCAACCNONE 
J023080A07TAGGCCCAAGCCCAACCNONE 
J023081N04TAGGCCCAAGCCCAACCNONE 
J023090C08TAGGCCCAAGCCCAACCNONE 
J023134G05TAGGCCCAAGCCCAACCNONE 
J023139G17TAGGCCCAAGCCCAACCNONE 
J023143I10TAGGCCCAAGCCCAACCNONE 
J023147D04TAGGCCCAAGCCCAACCNONE 
J023147O15TAGGCCCAAGCCCAACCNONE 
J033102K23TAGGCCCAAGCCCAACCNONE 
J033106C17TAGGCCCAAGCCCAACCNONE 
J075033G19TAGGCCCAAGCCCAACCNONE 
J075039J18TAGGCCCAAGCCCAACCNONE 
J075050K20TAGGCCCAAGCCCAACCNONE 
J075075J03TAGGCCCAAGCCCAACCNONE 
J075080E16TAGGCCCAAGCCCAACCNONE 
J075086L08TAGGCCCAAGCCCAACCNONE 
J075091K19TAGGCCCAAGCCCAACCNONE 
J075099O20TAGGCCCAAGCCCAACCNONE 
J075104I06TAGGCCCAAGCCCAACCNONE 
J075137C16TAGGCCCAAGCCCAACCNONE 
J075152G03TAGGCCCAAGCCCAACCNONE 
J075176N12TAGGCCCAAGCCCAACCNONE 
J100086K11TAGGCCCAAGCCCAACCNONE 
Os03g0274000AK060769AAAAGCCCAAGOxysterol-binding protein family protein. 
Os03g0288400Os03g0288400GAAGCCCAAACConserved hypothetical protein. 
Os03g0309800004-019-H07CTTGGGCCCAAGCCCAACNONE 
AK060922CTTGGGCCCAAGCCCAACNONE 
AK098942CTTGGGCCCAAGCCCAACNONE 
AK106141CTTGGGCCCAAGCCCAACNONE 
AK111530CTTGGGCCCAAGCCCAACNONE 
AK111624CTTGGGCCCAAGCCCAACSimilar to PPR2. 
J013024C10CTTGGGCCCAAGCCCAACNONE 
J013043D15CTTGGGCCCAAGCCCAACNONE 
J013108I11CTTGGGCCCAAGCCCAACNONE 
J100058L07CTTGGGCCCAAGCCCAACNONE 
J100071I19CTTGGGCCCAAGCCCAACNONE 
Os03g0331900AK063044ATTTGGGCTTGNONE 
AK099570ATTTGGGCTTGConserved hypothetical protein. 
J065064G01ATTTGGGCTTGNONE 
Os03g0335300AK098846TAAGCCCAACCNONE 
AK098891TAAGCCCAACCNONE 
AK111509TAAGCCCAACCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847TAAGCCCAACCNONE 
AK121413TAAGCCCAACCNONE 
Os03g0355800AK069271AATTGGGCTTTNONE 
AK103902AATTGGGCTTTSimilar to Diphthine synthase (EC 2.1.1.98) (Diphthamide biosynthesis methyltransferase). 
Os03g0372700AK064323AGTTGGGCTTANONE 
AK073312AGTTGGGCTTALow temperature viability protein family protein. 
Os03g0393900AK069809TATTGGGCTTCCATGGGCCTCSimilar to S.tuberosum patatin (Fragment). 
J023030J03TATTGGGCTTCCATGGGCCTCNONE 
Os03g0395000AK073283CCAAGCCCAAAASimilar to Heme oxygenase 2 (Fragment). 
Os03g0438400AK070383AAGGCCCAAGCCCAATAConserved hypothetical protein. 
J023054E02AAGGCCCAAGCCCAATANONE 
Os03g0577000012-055-F04AAAGCCCAATGGGCTTTNONE 
AK061051AAAGCCCAATGGGCTTTSimilar to Ribosomal protein S3 (Fragment). 
AK099146AAAGCCCAATGGGCTTTNONE 
J065060A01AAAGCCCAATGGGCTTTNONE 
J075079B17AAAGCCCAATGGGCTTTNONE 
J075134K12AAAGCCCAATGGGCTTTNONE 
J090048F23AAAGCCCAATGGGCTTTNONE 
J090072I19AAAGCCCAATGGGCTTTNONE 
J100087C19AAAGCCCAATGGGCTTTNONE 
J100090C21AAAGCCCAATGGGCTTTNONE 
Os03g0588200011-005-E04AAAAGCCCAAGNONE 
AK120221AAAAGCCCAAGFrigida-like family protein. 
J100086E17AAAAGCCCAAGNONE 
Os03g0604600J090093K23AAAAGCCCAATAConserved hypothetical protein. 
Os03g0612600009-073-H01CCAAGCCCAACTNONE 
AK071403CCAAGCCCAACTRibosomal protein L25-like domain containing protein. 
Os03g0625900AK101109AAAAGCCCAACAGGGCCCATATWD40-like domain containing protein. 
Os03g0626250J075100A11AGTTGGGCTTTNONE 
J075134H15AGTTGGGCTTTNONE 
J075142J02AGTTGGGCTTTNONE 
J075181A14AGTTGGGCTTTNONE 
J075192K17AGTTGGGCTTTNONE 
J090046B06AGTTGGGCTTTNONE 
Os03g0655700AK120254AAAGCCCAAGCCCACCACSimilar to 3-isopropylmalate dehydrogenase, chloroplast precursor (EC 1.1.1.85) (Beta-IPM dehydrogenase) (IMDH) (3-IPM-DH). 
Os03g0685700AK066043CGATGGGCCTTGGGCTTTProtein prenyltransferase domain containing protein. 
J013048F08CGATGGGCCTTGGGCTTTNONE 
Os03g0698900013-074-A08AAAGCCCAACANONE 
AK073303AAAGCCCAACAAlkaline phytoceramidase family protein. 
AK103953AAAGCCCAACANONE 
J033024P22AAAGCCCAACANONE 
J065194N16AAAGCCCAACANONE 
J065195O11AAAGCCCAACANONE 
J075020F03AAAGCCCAACANONE 
J075032P18AAAGCCCAACANONE 
J075037H13AAAGCCCAACANONE 
J075147I01AAAGCCCAACANONE 
J075187B13AAAGCCCAACANONE 
J100043G08AAAGCCCAACANONE 
J100060L06AAAGCCCAACANONE 
J100063O21AAAGCCCAACANONE 
J100066O13AAAGCCCAACANONE 
J100072K20AAAGCCCAACANONE 
J100083G21AAAGCCCAACANONE 
J100085D07AAAGCCCAACANONE 
Os03g0708600AK069199CAAGCCCAAACDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069658CAAGCCCAAACNONE 
J023008E04CAAGCCCAAACNONE 
J023030D22CAAGCCCAAACNONE 
J033027E16CAAGCCCAAACNONE 
J033046D09CAAGCCCAAACNONE 
J033068I10CAAGCCCAAACNONE 
J033135A12CAAGCCCAAACNONE 
J065027E22CAAGCCCAAACNONE 
J065191K23CAAGCCCAAACNONE 
J090054D15CAAGCCCAAACNONE 
J090058J15CAAGCCCAAACNONE 
Os03g0712200AK073205AAAAGCCCAATZinc finger, RanBP2-type domain containing protein. 
AK098968AAAAGCCCAATNONE 
Os03g0719100AK065127TAGGCCCATCCAAGCCCAACADNA-binding SAP domain containing protein. 
J013001P07TAGGCCCATCCAAGCCCAACANONE 
J065102J01TAGGCCCATCCAAGCCCAACANONE 
J065205K05TAGGCCCATCCAAGCCCAACANONE 
Os03g0725400015-060-D03AAAAGCCCAACTNONE 
AK105499AAAAGCCCAACTSimilar to WD-repeat protein 5 (BMP2-induced 3-kb gene protein) (WD-repeat protein BIG-3). 
AK111860AAAAGCCCAACTNONE 
AK112085AAAAGCCCAACTNONE 
J100068K06AAAAGCCCAACTNONE 
J100073K24AAAAGCCCAACTNONE 
J100084M24AAAAGCCCAACTNONE 
Os03g0736700006-022-F08AAAGCCCAAAANONE 
006-042-H09AAAGCCCAAAANONE 
006-053-H02AAAGCCCAAAANONE 
009-127-A06AAAGCCCAAAANONE 
013-089-C06AAAGCCCAAAANONE 
AK060947AAAGCCCAAAAGRAM domain containing protein. 
AK073026AAAGCCCAAAANONE 
AK104415AAAGCCCAAAANONE 
AK104642AAAGCCCAAAANONE 
J065027H19AAAGCCCAAAANONE 
J065059K06AAAGCCCAAAANONE 
J065065I02AAAGCCCAAAANONE 
J065085E10AAAGCCCAAAANONE 
J065140M09AAAGCCCAAAANONE 
J075115M21AAAGCCCAAAANONE 
Os03g0744700AK071178GAAGCCCAAACConserved hypothetical protein. 
J075006D24GAAGCCCAAACNONE 
J075165F21GAAGCCCAAACNONE 
Os03g0746400AK063445TGTTGGGCTTGProtein prenyltransferase domain containing protein. 
AK070923TGTTGGGCTTGNONE 
J065008K24TGTTGGGCTTGNONE 
Os03g0751400AK069033TATTGGGCTTCSimilar to 50S ribosomal protein l6. 
J023004G24TATTGGGCTTCNONE 
J065176D08TATTGGGCTTCNONE 
Os03g0758700AK106620AAAGCCCAACAWD40-like domain containing protein. 
Os03g0784400AK103474CAAGCCCAATGGGCCGAGAProtein of unknown function DUF1692 domain containing protein. 
J023135I15CAAGCCCAATGGGCCGAGANONE 
J033130D12CAAGCCCAATGGGCCGAGANONE 
J043035E20CAAGCCCAATGGGCCGAGANONE 
J065206K15CAAGCCCAATGGGCCGAGANONE 
J075053J20CAAGCCCAATGGGCCGAGANONE 
J075129B11CAAGCCCAATGGGCCGAGANONE 
J090003E22CAAGCCCAATGGGCCGAGANONE 
J100023E23CAAGCCCAATGGGCCGAGANONE 
Os03g0807200011-031-F07GAAGCCCAAGNONE 
AK063932GAAGCCCAAGNONE 
AK103496GAAGCCCAAGProtein of unknown function DUF1639 family protein. 
J033131A04GAAGCCCAAGNONE 
J065109O03GAAGCCCAAGNONE 
J080001M11GAAGCCCAAGNONE 
J080002H18GAAGCCCAAGNONE 
J080005I08GAAGCCCAAGNONE 
J080006B05GAAGCCCAAGNONE 
J080006D17GAAGCCCAAGNONE 
J080007M19GAAGCCCAAGNONE 
J080011E07GAAGCCCAAGNONE 
J080012H06GAAGCCCAAGNONE 
J080014D08GAAGCCCAAGNONE 
J080017D06GAAGCCCAAGNONE 
J080017K17GAAGCCCAAGNONE 
J080020B17GAAGCCCAAGNONE 
J080021O05GAAGCCCAAGNONE 
J080021O15GAAGCCCAAGNONE 
J080023I18GAAGCCCAAGNONE 
J080025A21GAAGCCCAAGNONE 
J080027P22GAAGCCCAAGNONE 
J080028M22GAAGCCCAAGNONE 
J080029B09GAAGCCCAAGNONE 
J080029M07GAAGCCCAAGNONE 
J080029M17GAAGCCCAAGNONE 
J080030H23GAAGCCCAAGNONE 
J080030K16GAAGCCCAAGNONE 
J080030L19GAAGCCCAAGNONE 
J080031A12GAAGCCCAAGNONE 
J080031N21GAAGCCCAAGNONE 
J080032G05GAAGCCCAAGNONE 
J080032P20GAAGCCCAAGNONE 
J080033H20GAAGCCCAAGNONE 
J080034H22GAAGCCCAAGNONE 
J080034J03GAAGCCCAAGNONE 
J080034J16GAAGCCCAAGNONE 
J080034N01GAAGCCCAAGNONE 
J080035K20GAAGCCCAAGNONE 
J080036I04GAAGCCCAAGNONE 
J080036I19GAAGCCCAAGNONE 
J080036O21GAAGCCCAAGNONE 
J080038D06GAAGCCCAAGNONE 
J080039J15GAAGCCCAAGNONE 
J080039P18GAAGCCCAAGNONE 
J080041H20GAAGCCCAAGNONE 
J080041M11GAAGCCCAAGNONE 
J080042F14GAAGCCCAAGNONE 
J080043G10GAAGCCCAAGNONE 
J080043J02GAAGCCCAAGNONE 
J080044C19GAAGCCCAAGNONE 
J080044G11GAAGCCCAAGNONE 
J080045M03GAAGCCCAAGNONE 
J080045N07GAAGCCCAAGNONE 
J080047K14GAAGCCCAAGNONE 
J080049I21GAAGCCCAAGNONE 
J080050A06GAAGCCCAAGNONE 
J080050I16GAAGCCCAAGNONE 
J080050N16GAAGCCCAAGNONE 
J080052C23GAAGCCCAAGNONE 
J080052D18GAAGCCCAAGNONE 
J080052F20GAAGCCCAAGNONE 
J080052F23GAAGCCCAAGNONE 
J080053M03GAAGCCCAAGNONE 
J080054G13GAAGCCCAAGNONE 
J080054H12GAAGCCCAAGNONE 
J080055N03GAAGCCCAAGNONE 
J080056E07GAAGCCCAAGNONE 
J080057L04GAAGCCCAAGNONE 
J080063O19GAAGCCCAAGNONE 
J080064E21GAAGCCCAAGNONE 
J080065D18GAAGCCCAAGNONE 
J080065F18GAAGCCCAAGNONE 
J080065H14GAAGCCCAAGNONE 
J080065K15GAAGCCCAAGNONE 
J080065M24GAAGCCCAAGNONE 
J080066B18GAAGCCCAAGNONE 
J080066B19GAAGCCCAAGNONE 
J080071H19GAAGCCCAAGNONE 
J080072E18GAAGCCCAAGNONE 
J080074K21GAAGCCCAAGNONE 
J080075B06GAAGCCCAAGNONE 
J080076H07GAAGCCCAAGNONE 
J080079D16GAAGCCCAAGNONE 
J080082B20GAAGCCCAAGNONE 
J080084N16GAAGCCCAAGNONE 
J080085L07GAAGCCCAAGNONE 
J080086L04GAAGCCCAAGNONE 
J080086M07GAAGCCCAAGNONE 
J080087D02GAAGCCCAAGNONE 
J080087D15GAAGCCCAAGNONE 
J080087J19GAAGCCCAAGNONE 
J080088G20GAAGCCCAAGNONE 
J080092M15GAAGCCCAAGNONE 
J080093O10GAAGCCCAAGNONE 
J080095L09GAAGCCCAAGNONE 
J080096A18GAAGCCCAAGNONE 
J080097C03GAAGCCCAAGNONE 
J090019J07GAAGCCCAAGNONE 
J090024N12GAAGCCCAAGNONE 
J090049I09GAAGCCCAAGNONE 
Os03g0809300011-024-C02TATTGGGCTTANONE 
016-071-E09TATTGGGCTTANONE 
AK103140TATTGGGCTTAProtein phosphatase 2C-like domain containing protein. 
J013030O08TATTGGGCTTANONE 
J013108D19TATTGGGCTTANONE 
J013124D15TATTGGGCTTANONE 
J013128F17TATTGGGCTTANONE 
J013146J06TATTGGGCTTANONE 
J013149D12TATTGGGCTTANONE 
J013154P12TATTGGGCTTANONE 
J013162N01TATTGGGCTTANONE 
J013170G15TATTGGGCTTANONE 
J013170H16TATTGGGCTTANONE 
J023022I09TATTGGGCTTANONE 
J023072B19TATTGGGCTTANONE 
J023106H09TATTGGGCTTANONE 
J023135C03TATTGGGCTTANONE 
J023141C09TATTGGGCTTANONE 
J033091K23TATTGGGCTTANONE 
J033107I05TATTGGGCTTANONE 
J033112M18TATTGGGCTTANONE 
J033120G10TATTGGGCTTANONE 
J033144G06TATTGGGCTTANONE 
J043017L21TATTGGGCTTANONE 
J043024O10TATTGGGCTTANONE 
J053023K04TATTGGGCTTANONE 
J053035D01TATTGGGCTTANONE 
J053037P10TATTGGGCTTANONE 
J053042K15TATTGGGCTTANONE 
J053047C14TATTGGGCTTANONE 
J053054A06TATTGGGCTTANONE 
J053071H03TATTGGGCTTANONE 
J053073G08TATTGGGCTTANONE 
J053090D04TATTGGGCTTANONE 
J053095E17TATTGGGCTTANONE 
J090007O03TATTGGGCTTANONE 
J090024G24TATTGGGCTTANONE 
J090042M08TATTGGGCTTANONE 
J090045I16TATTGGGCTTANONE 
J090051E13TATTGGGCTTANONE 
J090073B15TATTGGGCTTANONE 
J090096F19TATTGGGCTTANONE 
J100030M23TATTGGGCTTANONE 
Os03g0837300AK111243AAAGCCCAATTNONE 
AK121140AAAGCCCAATTNicotinate phosphoribosyltransferase and related family protein. 
AY214337AAAGCCCAATTNONE 
J023077G12AAAGCCCAATTNONE 
J023078M10AAAGCCCAATTNONE 
J033031B10AAAGCCCAATTNONE 
J033067L18AAAGCCCAATTNONE 
J043005P09AAAGCCCAATTNONE 
J090013J15AAAGCCCAATTNONE 
J090042E10AAAGCCCAATTNONE 
J090045A20AAAGCCCAATTNONE 
J100022H02AAAGCCCAATTNONE 
Os03g0861300AK109024TTTGGGCTTTSimilar to Aquaporin. 
Os04g0132500AK112081GAAGCCCAATNONE 
AK121779GAAGCCCAATProtein kinase-like domain containing protein. 
Os04g0259200AK119366CCAAGCCCAAGHypothetical protein. 
Os04g0337500AK061807GGTTGGGCTTANONE 
Os04g0381100AK121764TAAGCCCAATTBile acid:sodium symporter family protein. 
Os04g0389800AK109628GAAGCCCAACASimilar to Acetohydroxyacid synthase. 
Os04g0447400AK070858CTTGGGCTTTTATATGGGCCGGTSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09CTTGGGCTTTTATATGGGCCGGTNONE 
J023003G16CTTGGGCTTTTATATGGGCCGGTNONE 
J023006F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023008D10CTTGGGCTTTTATATGGGCCGGTNONE 
J023010A01CTTGGGCTTTTATATGGGCCGGTNONE 
J023012M16CTTGGGCTTTTATATGGGCCGGTNONE 
J023023H17CTTGGGCTTTTATATGGGCCGGTNONE 
J023029B12CTTGGGCTTTTATATGGGCCGGTNONE 
J023030F09CTTGGGCTTTTATATGGGCCGGTNONE 
J023034K03CTTGGGCTTTTATATGGGCCGGTNONE 
J023045A16CTTGGGCTTTTATATGGGCCGGTNONE 
J023048I04CTTGGGCTTTTATATGGGCCGGTNONE 
J023056C09CTTGGGCTTTTATATGGGCCGGTNONE 
J023056F05CTTGGGCTTTTATATGGGCCGGTNONE 
J023058B21CTTGGGCTTTTATATGGGCCGGTNONE 
J023058N06CTTGGGCTTTTATATGGGCCGGTNONE 
J023059F03CTTGGGCTTTTATATGGGCCGGTNONE 
J023059M19CTTGGGCTTTTATATGGGCCGGTNONE 
J023060P05CTTGGGCTTTTATATGGGCCGGTNONE 
J023062D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023063F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023068K15CTTGGGCTTTTATATGGGCCGGTNONE 
J023069L04CTTGGGCTTTTATATGGGCCGGTNONE 
J023075I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023086H01CTTGGGCTTTTATATGGGCCGGTNONE 
J023086I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023091M08CTTGGGCTTTTATATGGGCCGGTNONE 
J023095A07CTTGGGCTTTTATATGGGCCGGTNONE 
J023110K06CTTGGGCTTTTATATGGGCCGGTNONE 
J023113D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023126J05CTTGGGCTTTTATATGGGCCGGTNONE 
J023140F04CTTGGGCTTTTATATGGGCCGGTNONE 
J023141N19CTTGGGCTTTTATATGGGCCGGTNONE 
Os04g0461100009-136-H10GCTGGGCCATATTGGGCTTTNONE 
009-147-H12GCTGGGCCATATTGGGCTTTNONE 
AK068022GCTGGGCCATATTGGGCTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24GCTGGGCCATATTGGGCTTTNONE 
J065019D10GCTGGGCCATATTGGGCTTTNONE 
J065168O21GCTGGGCCATATTGGGCTTTNONE 
J075051G06GCTGGGCCATATTGGGCTTTNONE 
J075148G11GCTGGGCCATATTGGGCTTTNONE 
Os04g0475300AK066351TATTGGGCTTTGAGGCCCATAConserved hypothetical protein. 
J065138J21TATTGGGCTTTGAGGCCCATANONE 
Os04g0480900AK109889AGTTGGGCTTTGGGCCCCAGlycoside hydrolase, family 5 protein. 
Os04g0481100AK119297ATTTGGGCTTGNONE 
Os04g0552700AK121993GGTTGGGCTTGGZinc finger, C2H2-type domain containing protein. 
J053047K15GGTTGGGCTTGGNONE 
Os04g0566900AK072344AAAGCCCAAACConserved hypothetical protein. 
Os04g0581000AK061337TTTTGGGCTTTSimilar to Flavanone 3-hydroxylase-like protein. 
AK104142TTTTGGGCTTTNONE 
Os04g0609200AK103652TAAGCCCAAGMajor facilitator superfamily protein. 
Os04g0641300AK071780TAAGCCCAACTGlutaredoxin domain containing protein. 
J023114E02TAAGCCCAACTNONE 
Os04g0658300AK067399AAAGCCCAAAASimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0661900006-090-F11GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J053077D04GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J090095N01GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J100039F24GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
Os04g0665700013-084-D06GAGGCCCAAAGCCCAACTNONE 
013-084-D06GTGGCCCAAAGCCCAAGNONE 
AK121951GAGGCCCAAAGCCCAACTZinc finger, CCCH-type domain containing protein. 
AK121951GTGGCCCAAAGCCCAAGZinc finger, CCCH-type domain containing protein. 
J013020L20GAGGCCCAAAGCCCAACTNONE 
J013020L20GTGGCCCAAAGCCCAAGNONE 
J033034K12GAGGCCCAAAGCCCAACTNONE 
J033034K12GTGGCCCAAAGCCCAAGNONE 
J033107K04GAGGCCCAAAGCCCAACTNONE 
J033107K04GTGGCCCAAAGCCCAAGNONE 
J065044C03GAGGCCCAAAGCCCAACTNONE 
J065044C03GTGGCCCAAAGCCCAAGNONE 
J065103I10GAGGCCCAAAGCCCAACTNONE 
J065103I10GTGGCCCAAAGCCCAAGNONE 
J065106P15GAGGCCCAAAGCCCAACTNONE 
J065106P15GTGGCCCAAAGCCCAAGNONE 
J075061O20GAGGCCCAAAGCCCAACTNONE 
J075061O20GTGGCCCAAAGCCCAAGNONE 
J075091P11GAGGCCCAAAGCCCAACTNONE 
J075091P11GTGGCCCAAAGCCCAAGNONE 
J075095A18GAGGCCCAAAGCCCAACTNONE 
J075095A18GTGGCCCAAAGCCCAAGNONE 
J075117C22GAGGCCCAAAGCCCAACTNONE 
J075117C22GTGGCCCAAAGCCCAAGNONE 
J075166B22GAGGCCCAAAGCCCAACTNONE 
J075166B22GTGGCCCAAAGCCCAAGNONE 
J075198L04GAGGCCCAAAGCCCAACTNONE 
J075198L04GTGGCCCAAAGCCCAAGNONE 
J090032K13GAGGCCCAAAGCCCAACTNONE 
J090032K13GTGGCCCAAAGCCCAAGNONE 
J090045E22GAGGCCCAAAGCCCAACTNONE 
J090045E22GTGGCCCAAAGCCCAAGNONE 
Os04g0669300AK071148GAAGCCCAACADynamin family protein. 
Os05g0100500AK071466GCAGCCCAAAAAGCCCAAGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0101400009-126-G06AGTTGGGCTTGGGCCGCNONE 
AK067481AGTTGGGCTTGGGCCGCSimilar to 50S ribosomal protein L28, chloroplast precursor. 
J065124O10AGTTGGGCTTGGGCCGCNONE 
J065186D05AGTTGGGCTTGGGCCGCNONE 
J065193A14AGTTGGGCTTGGGCCGCNONE 
J075082A02AGTTGGGCTTGGGCCGCNONE 
J075100F11AGTTGGGCTTGGGCCGCNONE 
J075111O16AGTTGGGCTTGGGCCGCNONE 
J075172I24AGTTGGGCTTGGGCCGCNONE 
Os05g0103500AK060306AAAAGCCCAATACHCH domain containing protein. 
AK102829AAAAGCCCAATANONE 
J033109D16AAAAGCCCAATANONE 
J043016E20AAAAGCCCAATANONE 
J065001C14AAAAGCCCAATANONE 
J065116L24AAAAGCCCAATANONE 
J075018E04AAAAGCCCAATANONE 
J075045E18AAAAGCCCAATANONE 
J075093G20AAAAGCCCAATANONE 
J075171A09AAAAGCCCAATANONE 
J100029F18AAAAGCCCAATANONE 
J100046I24AAAAGCCCAATANONE 
Os05g0110700AK102486ATCTGGGCCTAAGCCCAATAKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12ATCTGGGCCTAAGCCCAATANONE 
Os05g0111000AK073598CTTGGGCTTASimilar to Gag polyprotein [Contains: Core protein p15 (Matrix protein); Core protein p24; Core protein p12]. 
Os05g0128100009-051-B07ATTGGGCTTGNONE 
009-127-B08ATTGGGCTTGNONE 
009-144-H03ATTGGGCTTGNONE 
009-176-B05ATTGGGCTTGNONE 
AK108556ATTGGGCTTGNONE 
AK119308ATTGGGCTTGNONE 
AK120934ATTGGGCTTGConserved hypothetical protein. 
J023036J15ATTGGGCTTGNONE 
J065122L01ATTGGGCTTGNONE 
J075104P10ATTGGGCTTGNONE 
Os05g0137600AK099427TGTTGGGCTTCConserved hypothetical protein. 
Os05g0161400AK105485AAAAGCCCAACTPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0170800AK068085TAAGCCCAAACUvrB/UvrC protein domain containing protein. 
J100063G14TAAGCCCAAACNONE 
Os05g0178100AK120915CAAGCCCAAATGA 3beta-hydroxylase. 
Os05g0186000006-103-D10AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-047-D06AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-073-G05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-084-G09AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-097-G04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-111-D11AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-115-G01AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-131-B04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-144-F05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-154-D08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
014-004-H02AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK058675AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK060420AAAGCCCAATCCATGGGCCTGGGCTTCSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J065155C08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J075143K12AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
Os05g0194600AK102487TTTTGGGCTTAAGGGCCCAATTPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01TTTTGGGCTTAAGGGCCCAATTNONE 
J100041A08TTTTGGGCTTAAGGGCCCAATTNONE 
Os05g0224800AK111685GAAGCCCAAATSimilar to Modification methyltransferase, cytosine-specific. 
J013170M08GAAGCCCAAATNONE 
Os05g0227100009-045-C06TAAGCCCAATANONE 
009-109-A08TAAGCCCAATANONE 
J075072D22TAAGCCCAATAHypothetical protein. 
Os05g0227300Os05g0227300TAAGCCCAATANONE 
Os05g0227700AK067567AGTTGGGCTTGGACCGGCCCGTTConserved hypothetical protein. 
AK068760AGTTGGGCTTGGACCGGCCCGTTNONE 
J013108C14AGTTGGGCTTGGACCGGCCCGTTNONE 
Os05g0227800AK110997AACGGGCCGGTCCAAGCCCAAHomeodomain-like containing protein. 
Os05g0323100AK109472AAAGCCCAATARhodanese-like domain containing protein. 
Os05g0335800AK108393CCAAGCCCAACATGF-beta receptor, type I/II extracellular region family protein. 
Os05g0346300009-033-C06AGATGGGCTTGGGCTTTNONE 
AF529175AGATGGGCTTGGGCTTTNONE 
AK061627AGATGGGCTTGGGCTTTSimilar to 40S ribosomal protein S7. 
AK103081AGATGGGCTTGGGCTTTNONE 
AK104191AGATGGGCTTGGGCTTTNONE 
J013049B09AGATGGGCTTGGGCTTTNONE 
J023142E24AGATGGGCTTGGGCTTTNONE 
J033052M14AGATGGGCTTGGGCTTTNONE 
J033089N04AGATGGGCTTGGGCTTTNONE 
J033118F01AGATGGGCTTGGGCTTTNONE 
J065054E07AGATGGGCTTGGGCTTTNONE 
J065066L18AGATGGGCTTGGGCTTTNONE 
J065078C21AGATGGGCTTGGGCTTTNONE 
J065127G23AGATGGGCTTGGGCTTTNONE 
J065128N24AGATGGGCTTGGGCTTTNONE 
J065144P17AGATGGGCTTGGGCTTTNONE 
J065147P14AGATGGGCTTGGGCTTTNONE 
J065170E16AGATGGGCTTGGGCTTTNONE 
J065175D17AGATGGGCTTGGGCTTTNONE 
J065176M05AGATGGGCTTGGGCTTTNONE 
J065218G20AGATGGGCTTGGGCTTTNONE 
J090074J12AGATGGGCTTGGGCTTTNONE 
J100019H16AGATGGGCTTGGGCTTTNONE 
J100031N24AGATGGGCTTGGGCTTTNONE 
J100072G08AGATGGGCTTGGGCTTTNONE 
J100086I23AGATGGGCTTGGGCTTTNONE 
Os05g0358500AK060575CTTGGGCTTANONE 
AK100777CTTGGGCTTAProtein phosphatase 2C-like domain containing protein. 
Os05g0383100AK121835TATTGGGCTTCClathrin adaptor complex, medium chain family protein. 
Os05g0387200AK060744CAAGCCCACCAAAAGCCCAAGSimilar to UDP-sulfoquinovose synthase, chloroplast precursor (EC 3.13.1.1) (Sulfite:UDP-glucose sulfotransferase) (Sulfolipid biosynthesis protein) (SoSQD1). 
AK065310CAAGCCCACCAAAAGCCCAAGNONE 
Os05g0414300AK120513TTTTGGGCTTGDisease resistance protein family protein. 
AK120791TTTTGGGCTTGNONE 
Os05g0429900AK066834CCAAGCCCAATANONE 
AK099108CCAAGCCCAATANONE 
AK104053CCAAGCCCAATANONE 
D88617CCAAGCCCAATASimilar to MybHv5 (Fragment). 
J090031E22CCAAGCCCAATANONE 
Os05g0447000AK108280AATTGGGCTTTTAGCCCATGTSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0450600016-072-G10AAAGCCCAAGNONE 
AK064266AAAGCCCAAGProtein of unknown function DUF740 family protein. 
Os05g0459300009-006-D08ATTTGGGCTTCNONE 
AK062312ATTTGGGCTTCNONE 
AK119604ATTTGGGCTTCNONE 
AK121463ATTTGGGCTTCConserved hypothetical protein. 
J023145E12ATTTGGGCTTCNONE 
Os05g0461000006-113-A06GAAGCCCAACNONE 
AB042259GAAGCCCAACNONE 
AK059189GAAGCCCAACNONE 
AK066739GAAGCCCAACClathrin adaptor complex, small chain family protein. 
AK099044GAAGCCCAACNONE 
AK104166GAAGCCCAACNONE 
Os05g0506900AK106697TAAGCCCAAAABrix domain containing protein. 
Os05g0524200AK071990CTTGGGCTTADual specificity protein phosphatase domain containing protein. 
AK071990GAAGCCCAATDual specificity protein phosphatase domain containing protein. 
Os05g0535700009-067-F01GCAGCCCAAGCCCAAGCCCAAGNONE 
AK061590GCAGCCCAAGCCCAAGCCCAAGNONE 
AK062545GCAGCCCAAGCCCAAGCCCAAGConserved hypothetical protein. 
Os05g0539300Os05g0539300AGTTGGGCTTAProtein of unknown function DUF295 family protein. 
Os05g0541500AK101190CTTGGGCTTCCyclin-like F-box domain containing protein. 
AK101531CTTGGGCTTCNONE 
J033030F10CTTGGGCTTCNONE 
Os05g0545500AK101095TATTGGGCTTTConserved hypothetical protein. 
AK119499TATTGGGCTTTNONE 
Os05g0553700006-100-D08AAAGCCCAAATNONE 
AK099747AAAGCCCAAATNONE 
AK101606AAAGCCCAAATNONE 
AK103396AAAGCCCAAATSimilar to Syntaxin 71 (AtSYP71). 
J033022M23AAAGCCCAAATNONE 
J090086G01AAAGCCCAAATNONE 
Os05g0559900AK067197GAAGCCCAAGGCCCAAACtRNA-binding arm domain containing protein. 
J013074C15GAAGCCCAAGGCCCAAACNONE 
J013098O16GAAGCCCAAGGCCCAAACNONE 
J033030M01GAAGCCCAAGGCCCAAACNONE 
J090058H12GAAGCCCAAGGCCCAAACNONE 
J090075M06GAAGCCCAAGGCCCAAACNONE 
Os05g0571100006-092-E08TATTGGGCTTANONE 
006-120-A03TATTGGGCTTANONE 
015-030-F01TATTGGGCTTANONE 
AK068658TATTGGGCTTAProtein of unknown function DUF860, plant family protein. 
AK104438TATTGGGCTTANONE 
Os05g0592600011-064-D09GTTTGGGCTTTTNONE 
015-032-B11GTTTGGGCTTTTNONE 
AK073484GTTTGGGCTTTTInitiation factor 2 family protein. 
AK099632GTTTGGGCTTTTNONE 
Os05g0597100011-044-C10TCAGCCCAAGCCCAATNONE 
AF255711TCAGCCCAAGCCCAATNONE 
AK072845TCAGCCCAAGCCCAATSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16TCAGCCCAAGCCCAATNONE 
J023135M22TCAGCCCAAGCCCAATNONE 
J023141B21TCAGCCCAAGCCCAATNONE 
J023142J09TCAGCCCAAGCCCAATNONE 
J033025E09TCAGCCCAAGCCCAATNONE 
J033111A20TCAGCCCAAGCCCAATNONE 
J033126I01TCAGCCCAAGCCCAATNONE 
Os06g0115400AK111656GAAGCCCAAAGCCCACASimilar to Superoxide dismutase [Fe], chloroplast (EC 1.15.1.1) (Fragment). 
Os06g0124900009-128-B12CCAGGCCCAAGCCCAACCNONE 
009-186-H09CCAGGCCCAAGCCCAACCNONE 
AK062901CCAGGCCCAAGCCCAACCConserved hypothetical protein. 
J013056D13CCAGGCCCAAGCCCAACCNONE 
J013056D17CCAGGCCCAAGCCCAACCNONE 
J013066A13CCAGGCCCAAGCCCAACCNONE 
J013066C03CCAGGCCCAAGCCCAACCNONE 
J013066F01CCAGGCCCAAGCCCAACCNONE 
J023078D03CCAGGCCCAAGCCCAACCNONE 
J033113N02CCAGGCCCAAGCCCAACCNONE 
J065019F09CCAGGCCCAAGCCCAACCNONE 
J065048C21CCAGGCCCAAGCCCAACCNONE 
J065077L13CCAGGCCCAAGCCCAACCNONE 
J065082J09CCAGGCCCAAGCCCAACCNONE 
J065113H16CCAGGCCCAAGCCCAACCNONE 
J065147A20CCAGGCCCAAGCCCAACCNONE 
J065180A13CCAGGCCCAAGCCCAACCNONE 
J065198M18CCAGGCCCAAGCCCAACCNONE 
J065207K19CCAGGCCCAAGCCCAACCNONE 
J075109H13CCAGGCCCAAGCCCAACCNONE 
Os06g0139700006-052-C07AAAGCCCAAACNONE 
009-009-A08AAAGCCCAAACNONE 
015-020-D09AAAGCCCAAACNONE 
015-087-H06AAAGCCCAAACNONE 
016-078-A03AAAGCCCAAACNONE 
AK067884AAAGCCCAAACNONE 
AK103245AAAGCCCAAACConserved hypothetical protein. 
AK106116AAAGCCCAAACNONE 
AK106220AAAGCCCAAACNONE 
Os06g0152800003-125-D04AAAGCCCAACANONE 
AK099578AAAGCCCAACAConserved hypothetical protein. 
Os06g0159400AK101286GGTTGGGCTTTU box domain containing protein. 
J033033F04GGTTGGGCTTTNONE 
Os06g0187900009-171-C09CAAGCCCAACCNONE 
AK063879CAAGCCCAACCNONE 
AK071765CAAGCCCAACCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023112N11CAAGCCCAACCNONE 
J033098E13CAAGCCCAACCNONE 
J100036J11CAAGCCCAACCNONE 
J100047B19CAAGCCCAACCNONE 
Os06g0202400009-101-G07CAAGCCCAAAANONE 
AK062755CAAGCCCAAAAConserved hypothetical protein. 
Os06g0219600AK060429CCAAGCCCAAGSimilar to Poly(A)-binding protein II-like. 
AK099019CCAAGCCCAAGNONE 
J013118A14CCAAGCCCAAGNONE 
Os06g0222900AK109820AAAAGCCCAAAASimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase 2 (EC 3.1.3.56) (At5PTase2). 
AK109820CTTGGGCTTGGSimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase 2 (EC 3.1.3.56) (At5PTase2). 
Os06g0268700AK120783AAAAGCCCAAACPeptidase A1, pepsin family protein. 
Os06g0274200009-090-A02AAAGCCCAAGCCCAGNONE 
AK073155AAAGCCCAAGCCCAGSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065001C08AAAGCCCAAGCCCAGNONE 
J065061C07AAAGCCCAAGCCCAGNONE 
J065105L08AAAGCCCAAGCCCAGNONE 
J075013C12AAAGCCCAAGCCCAGNONE 
J090010N17AAAGCCCAAGCCCAGNONE 
J090068K07AAAGCCCAAGCCCAGNONE 
J100058A21AAAGCCCAAGCCCAGNONE 
J100066C07AAAGCCCAAGCCCAGNONE 
Os06g0286228AK069113AAAGCCCAAATCupredoxin domain containing protein. 
Os06g0291100J043017O10CTTGGGCTTCCGGCCCAGCHypothetical protein. 
Os06g0484600009-122-D10ATGGCCCAAGCCCAAGNONE 
AK062871ATGGCCCAAGCCCAAGSimilar to Pherophorin-S precursor. 
J075017F14ATGGCCCAAGCCCAAGNONE 
J075021E06ATGGCCCAAGCCCAAGNONE 
J075054C10ATGGCCCAAGCCCAAGNONE 
Os06g0546500AK073833CAAGCCCAAGSimilar to Class III peroxidase GvPx2b (Fragment). 
J065042H02CAAGCCCAAGNONE 
Os06g0590301J033139K16TTGGCCCAAGCCCAAGNONE 
J065011M13TTGGCCCAAGCCCAAGNONE 
J065027D20TTGGCCCAAGCCCAAGNONE 
J065039O05TTGGCCCAAGCCCAAGGlucose/ribitol dehydrogenase family protein. 
J065051O10TTGGCCCAAGCCCAAGNONE 
J065128I21TTGGCCCAAGCCCAAGNONE 
J065163P10TTGGCCCAAGCCCAAGNONE 
J065169H02TTGGCCCAAGCCCAAGNONE 
Os06g0600100AK065619AAAAGCCCACGAAGCCCAACASimilar to TAT-binding protein homolog (Fragment). 
Os06g0644800006-051-A11AGTTGGGCTTCNONE 
006-061-C06AGTTGGGCTTCNONE 
006-086-A03AGTTGGGCTTCNONE 
006-091-B11AGTTGGGCTTCNONE 
AK105643AGTTGGGCTTCNONE 
AK109442AGTTGGGCTTCMannose-6-phosphate receptor, binding domain containing protein. 
J065083E17AGTTGGGCTTCNONE 
Os06g0656800AK109762AAAGCCCAATGGGCCAGABeta-Ig-H3/fasciclin domain containing protein. 
Os06g0670100AK102577GAAGCCCAAACHypothetical protein. 
Os06g0682800011-092-E01GTTTGGGCTTGNONE 
AK064816GTTTGGGCTTGZinc finger, CCCH-type domain containing protein. 
J013000E13GTTTGGGCTTGNONE 
J013035J22GTTTGGGCTTGNONE 
J013045M06GTTTGGGCTTGNONE 
J013120A07GTTTGGGCTTGNONE 
J033144H15GTTTGGGCTTGNONE 
J033145H15GTTTGGGCTTGNONE 
J033145N16GTTTGGGCTTGNONE 
J090019J02GTTTGGGCTTGNONE 
Os06g0710300AK121344TAAGCCCAACAUncharacterized protein UPF0114 family protein. 
J043016B12TAAGCCCAACANONE 
J065104H21TAAGCCCAACANONE 
Os06g0714100AK121079GAAGCCCAAATComplex 1 LYR protein family protein. 
J023062M13GAAGCCCAAATNONE 
J043020D18GAAGCCCAAATNONE 
J065073A17GAAGCCCAAATNONE 
J065158D09GAAGCCCAAATNONE 
J065195H04GAAGCCCAAATNONE 
J065214P13GAAGCCCAAATNONE 
J080079I22GAAGCCCAAATNONE 
J100031M06GAAGCCCAAATNONE 
J100036I12GAAGCCCAAATNONE 
Os06g0731700J065089G16GAAGCCCAAGNONE 
J065157E16GAAGCCCAAGNONE 
Os07g0110100009-059-D11AAAGCCCAAAANONE 
AK071499AAAGCCCAAAAConserved hypothetical protein. 
J065064P17AAAGCCCAAAANONE 
J065111B09AAAGCCCAAAANONE 
J075099A14AAAGCCCAAAANONE 
J075139C23AAAGCCCAAAANONE 
Os07g0110800009-107-B11ATTTGGGCTTTNONE 
AK062792ATTTGGGCTTTConserved hypothetical protein. 
J053026P09ATTTGGGCTTTNONE 
J053074L17ATTTGGGCTTTNONE 
J065057E24ATTTGGGCTTTNONE 
J065149B18ATTTGGGCTTTNONE 
J075002O20ATTTGGGCTTTNONE 
J090002C13ATTTGGGCTTTNONE 
Os07g0110900AK058987AAAGCCCAAATConserved hypothetical protein. 
J065032L02AAAGCCCAAATNONE 
J065074H06AAAGCCCAAATNONE 
J065168M23AAAGCCCAAATNONE 
Os07g0113200AK108787TTTTGGGCTTTConserved hypothetical protein. 
J065090J04TTTTGGGCTTTNONE 
J065116K24TTTTGGGCTTTNONE 
J065161F14TTTTGGGCTTTNONE 
J065203E23TTTTGGGCTTTNONE 
Os07g0187300AK103069AAAAGCCCAAAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12AAAAGCCCAAAANONE 
J033117P16AAAAGCCCAAAANONE 
Os07g0231500AK109283CAAGCCCAAATCyclin-like domain containing protein. 
J075001D10CAAGCCCAAATNONE 
J075088P14CAAGCCCAAATNONE 
J075115C22CAAGCCCAAATNONE 
J075199L15CAAGCCCAAATNONE 
Os07g0290800AK071498GCAGCCCATGGCCGAAAAAGCCCAACTic22-like family protein. 
J075099P10GCAGCCCATGGCCGAAAAAGCCCAACNONE 
Os07g0486000AK069343TATTGGGCTTCSimilar to MSH4. 
Os07g0564700AK059018TTTTGGGCTTGHypothetical protein. 
Os07g0565600AK071983TATTGGGCTTTGGGCTSimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481TATTGGGCTTTGGGCTNONE 
Os07g0565700006-106-C01AAAGCCCAACANONE 
AK111937AAAGCCCAACANONE 
AK112115AAAGCCCAACAAlpha/beta hydrolase family protein. 
Os07g0568100AK099778AAAGCCCAACCSimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0568900009-083-H02TAATGGGCCTTATTGGGCTTANONE 
AK062660TAATGGGCCTTATTGGGCTTAConserved hypothetical protein. 
Os07g0569000AK073915TAAGCCCAATAAGGCCCATTAConserved hypothetical protein. 
Os07g0626600Os07g0626600AAAGCCCAAATSimilar to Embryogenic callus protein-like. 
Os07g0644300AK066726TAAGCCCAATTSimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483TAAGCCCAATTNONE 
Os07g0653100J065130E21AATTGGGCTTCConserved hypothetical protein. 
J065186P07AATTGGGCTTCNONE 
Os07g0668200AK059051CAAGCCCAAATNONE 
AK101682CAAGCCCAAATConserved hypothetical protein. 
AK102839CAAGCCCAAATNONE 
Os07g0673100AK060100AAAGCCCAAGNONE 
AK103678AAAGCCCAAGRibosomal protein S8E family protein. 
AK104794AAAGCCCAAGNONE 
Os07g0682000AK110569CTTGGGCTTCHeavy metal transport/detoxification protein domain containing protein. 
Os07g0687300AK073043CAAGCCCAAACSimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0113800J033069I12TAAGCCCAATTNONE 
J053050I07TAAGCCCAATTNONE 
J065006J11TAAGCCCAATTNONE 
J065013D02TAAGCCCAATTNONE 
J065055L24TAAGCCCAATTNONE 
J065071I11TAAGCCCAATTConserved hypothetical protein. 
J065093G12TAAGCCCAATTNONE 
J065101N03TAAGCCCAATTNONE 
Os08g0116800AK063695CAAGCCCAAGExoribonuclease domain containing protein. 
Os08g0158900AK067062AAAAGCCCAATTGTP1/OBG domain containing protein. 
J013089F04AAAAGCCCAATTNONE 
J013092D16AAAAGCCCAATTNONE 
J033120K14AAAAGCCCAATTNONE 
J033133F24AAAAGCCCAATTNONE 
J033145A10AAAAGCCCAATTNONE 
J033145A11AAAAGCCCAATTNONE 
J053048H24AAAAGCCCAATTNONE 
J053075H10AAAAGCCCAATTNONE 
Os08g0159000AK073617AATTGGGCTTTTNONE 
AK103973AATTGGGCTTTTSimilar to DnaJ homolog subfamily C member 1. 
J023130H14AATTGGGCTTTTNONE 
J033051J11AATTGGGCTTTTNONE 
J065101C10AATTGGGCTTTTNONE 
J065168B04AATTGGGCTTTTNONE 
J065184E22AATTGGGCTTTTNONE 
J080021D11AATTGGGCTTTTNONE 
J080025H10AATTGGGCTTTTNONE 
J080026N19AATTGGGCTTTTNONE 
J080034A12AATTGGGCTTTTNONE 
J080040L02AATTGGGCTTTTNONE 
J080042H19AATTGGGCTTTTNONE 
J080047B05AATTGGGCTTTTNONE 
J080047E09AATTGGGCTTTTNONE 
J080047I01AATTGGGCTTTTNONE 
J080052H19AATTGGGCTTTTNONE 
J080062K13AATTGGGCTTTTNONE 
J080063A22AATTGGGCTTTTNONE 
J080068G18AATTGGGCTTTTNONE 
J080068N19AATTGGGCTTTTNONE 
J080076G08AATTGGGCTTTTNONE 
J080077H13AATTGGGCTTTTNONE 
J080077K06AATTGGGCTTTTNONE 
J080093D15AATTGGGCTTTTNONE 
J080094D21AATTGGGCTTTTNONE 
J080097A20AATTGGGCTTTTNONE 
J080097E21AATTGGGCTTTTNONE 
J080097N17AATTGGGCTTTTNONE 
J100071K18AATTGGGCTTTTNONE 
J100072F09AATTGGGCTTTTNONE 
Os08g0176800AK111670GTTTGGGCTTASimilar to mRNA-associated protein mrnp 41 (Rae1 protein homolog). 
J013030D15GTTTGGGCTTANONE 
J013157K01GTTTGGGCTTANONE 
J023108A20GTTTGGGCTTANONE 
J033125F09GTTTGGGCTTANONE 
Os08g0178100AK101717TATTGGGCTTCPep3/Vps18/deep orange domain containing protein. 
Os08g0192900AK103422AAAAGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645AAAAGCCCAAACNONE 
Os08g0202400AK070769ATTGGGCTTTDisease resistance protein family protein. 
Os08g0236900AK109597CTTGGGCTTGConserved hypothetical protein. 
Os08g0243900011-052-H03TAAGCCCAATNONE 
AK102707TAAGCCCAATNONE 
AK121452TAAGCCCAATMu2 adaptin subunit (AP50) of AP2 domain containing protein. 
J023142L20TAAGCCCAATNONE 
J065168E04TAAGCCCAATNONE 
Os08g0278100014-004-D02TAAGCCCAAGNONE 
AK063626TAAGCCCAAGConserved hypothetical protein. 
Os08g0363000015-090-A07AAAGCCCAAATNONE 
AK103677AAAGCCCAAATNONE 
AK106532AAAGCCCAAATProtein of unknown function DUF295 family protein. 
J033136B21AAAGCCCAAATNONE 
J033136E01AAAGCCCAAATNONE 
J043029N11AAAGCCCAAATNONE 
J065071G13AAAGCCCAAATNONE 
J065105J22AAAGCCCAAATNONE 
J075084B18AAAGCCCAAATNONE 
Os08g0423400AK072922TTTGGGCTTAConserved hypothetical protein. 
J023146P06TTTGGGCTTANONE 
Os08g0447200AK067377TAAGCCCAAATSGT1 family protein. 
J013106M17TAAGCCCAAATNONE 
J033133D18TAAGCCCAAATNONE 
J033140B09TAAGCCCAAATNONE 
J100028I17TAAGCCCAAATNONE 
J100086C22TAAGCCCAAATNONE 
Os08g0456600AK059009AAAGCCCAAGConserved hypothetical protein. 
Os08g0485900AK110716AAAAGCCCAAAAHaloacid dehalogenase-like hydrolase domain containing protein. 
Os08g0517900015-019-D06AAAAGCCCAAAAAAGGCCCATATNONE 
015-019-D06AAAAGCCCAACANONE 
AK064304AAAAGCCCAAAAAAGGCCCATATSimilar to 30S ribosomal protein S16. 
AK064304AAAAGCCCAACASimilar to 30S ribosomal protein S16. 
Os08g0542100AK058490AAAAGCCCAACAGGCCCACTRibosomal protein L7, eukaryotic form family protein. 
AK101416AAAAGCCCAACAGGCCCACTNONE 
J033037N08AAAAGCCCAACAGGCCCACTNONE 
J033086B16AAAAGCCCAACAGGCCCACTNONE 
J043036J02AAAAGCCCAACAGGCCCACTNONE 
J065137E02AAAAGCCCAACAGGCCCACTNONE 
J090015L07AAAAGCCCAACAGGCCCACTNONE 
J100036D02AAAAGCCCAACAGGCCCACTNONE 
Os08g0558200AK069761TAAGCCCAAGGlutathione S-transferase, N-terminal domain containing protein. 
J013041N12TAAGCCCAAGNONE 
J013093H08TAAGCCCAAGNONE 
J023020B17TAAGCCCAAGNONE 
J023028D17TAAGCCCAAGNONE 
J023039B10TAAGCCCAAGNONE 
J065045O11TAAGCCCAAGNONE 
J065206N10TAAGCCCAAGNONE 
J075032G11TAAGCCCAAGNONE 
J075037C22TAAGCCCAAGNONE 
J075074J23TAAGCCCAAGNONE 
J090023A08TAAGCCCAAGNONE 
J090028N16TAAGCCCAAGNONE 
J100081G01TAAGCCCAAGNONE 
Os08g0563300009-007-B01TAAGCCCAAGNONE 
AK062315TAAGCCCAAGSimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
J065095F04TAAGCCCAAGNONE 
Os09g0103400016-041-C04GAAGCCCAAANONE 
016-041-C04GAAGCCCAAGNONE 
016-045-D02GAAGCCCAAANONE 
016-045-D02GAAGCCCAAGNONE 
AK064377GAAGCCCAAAConserved hypothetical protein. 
AK064377GAAGCCCAAGConserved hypothetical protein. 
J043010E20GAAGCCCAAANONE 
J043010E20GAAGCCCAAGNONE 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0115900009-055-E06TAAGCCCAAATNONE 
AK068597TAAGCCCAAATConserved hypothetical protein. 
J065136F11TAAGCCCAAATNONE 
J080023D14TAAGCCCAAATNONE 
Os09g0323000AK121426GAAGCCCAAGSimilar to UDP-galactose 4-epimerase-like protein. 
Os09g0343200AK064806GTTTGGGCTTTAnkyrin repeat containing protein. 
AK064994GTTTGGGCTTTNONE 
J013000D17GTTTGGGCTTTNONE 
J013001D17GTTTGGGCTTTNONE 
J013067O17GTTTGGGCTTTNONE 
J013097A16GTTTGGGCTTTNONE 
J013097H22GTTTGGGCTTTNONE 
J090014I04GTTTGGGCTTTNONE 
J090046D15GTTTGGGCTTTNONE 
Os09g0347900AK071224CAAGCCCAATTConserved hypothetical protein. 
J023087B12CAAGCCCAATTNONE 
Os09g0363700AK103667ATTGGGCTTTTConserved hypothetical protein. 
J075001L14ATTGGGCTTTTNONE 
J075049M23ATTGGGCTTTTNONE 
J075051I04ATTGGGCTTTTNONE 
J075073L04ATTGGGCTTTTNONE 
J075077E03ATTGGGCTTTTNONE 
J075083J11ATTGGGCTTTTNONE 
J075094J22ATTGGGCTTTTNONE 
J075112E08ATTGGGCTTTTNONE 
J075137J23ATTGGGCTTTTNONE 
J075192E02ATTGGGCTTTTNONE 
J100039K04ATTGGGCTTTTNONE 
Os09g0364500J100031B16AAAGCCCAACAGTP-binding protein, HSR1-related domain containing protein. 
J100031B16CAAGCCCAAAGTP-binding protein, HSR1-related domain containing protein. 
J100052H07AAAGCCCAACANONE 
J100052H07CAAGCCCAAANONE 
J100078G03AAAGCCCAACANONE 
J100078G03CAAGCCCAAANONE 
Os09g0381600AK107716AAAGCCCAATConserved hypothetical protein. 
J065046L11AAAGCCCAATNONE 
J075140N02AAAGCCCAATNONE 
J075156D10AAAGCCCAATNONE 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
AK101306CAAGCCCAACCSimilar to FEG protein. 
Os09g0424850J065006K24CAAGCCCAATConserved hypothetical protein. 
Os09g0438700006-093-A11AAAAGCCCAANONE 
AK061837AAAAGCCCAANONE 
AK098903AAAAGCCCAASimilar to 20 kDa chaperonin, chloroplast precursor (Protein Cpn21) (Chloroplast protein Cpn10) (Chloroplast chaperonin 10) (Ch-CPN10) (Chaperonin 20). 
J013002C22AAAAGCCCAANONE 
J065053C07AAAAGCCCAANONE 
J065118J22AAAAGCCCAANONE 
J065213B13AAAAGCCCAANONE 
J075065H24AAAAGCCCAANONE 
Os09g0439600AK100577GAAGCCCAAAExo70 exocyst complex subunit family protein. 
J090071K03GAAGCCCAAANONE 
Os09g0454900011-052-B02CCAAGCCCAACTNONE 
016-025-D09CCAAGCCCAACTNONE 
AK102152CCAAGCCCAACTCurculin-like (mannose-binding) lectin domain containing protein. 
J033086D22CCAAGCCCAACTNONE 
Os09g0463700016-008-D06AAAGCCCAAATNONE 
AK060708AAAGCCCAAATSimilar to AHM1. 
J090013G05AAAGCCCAAATNONE 
Os09g0465800009-106-E01AAAGCCCAAAANONE 
AK062785AAAGCCCAAAAConserved hypothetical protein. 
J065122K21AAAGCCCAAAANONE 
Os09g0516800009-017-A01AAAGCCCAACAConserved hypothetical protein. 
009-017-A01AAAGCCCAATAConserved hypothetical protein. 
Os09g0528100009-173-A08CCAAGCCCAATNONE 
009-190-G12CCAAGCCCAATNONE 
AK059096CCAAGCCCAATSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
Os09g0539100AK071977CCAAGCCCAACCTCTCCGCSimilar to 3-dehydroquinate synthase-like protein. 
AK098959CCAAGCCCAACCTCTCCGCNONE 
Os11g0127700AK103742AAAAGCCCAATAHypothetical protein. 
J090083M11AAAAGCCCAATANONE 
Os11g0146700AK065900GAAGCCCAATANONE 
AK072412GAAGCCCAATARED-like, C-terminal family protein. 
Os11g0153700AK058576AAAGCCCAATAGGGCCCATATSimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
Os11g0159000AK065738AAAAGCCCAAAAConserved hypothetical protein. 
Os11g0162200009-059-H04TCATGGGCCAAAAGCCCAAAANONE 
AK060396TCATGGGCCAAAAGCCCAAAASimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11TCATGGGCCAAAAGCCCAAAANONE 
J065105K09TCATGGGCCAAAAGCCCAAAANONE 
J075024G12TCATGGGCCAAAAGCCCAAAANONE 
J075040K04TCATGGGCCAAAAGCCCAAAANONE 
J075066D13TCATGGGCCAAAAGCCCAAAANONE 
J075108A11TCATGGGCCAAAAGCCCAAAANONE 
J100031D04TCATGGGCCAAAAGCCCAAAANONE 
J100060O05TCATGGGCCAAAAGCCCAAAANONE 
J100075M22TCATGGGCCAAAAGCCCAAAANONE 
Os11g0227600AK101375GAAGCCCAACAConserved hypothetical protein. 
AK102193GAAGCCCAACANONE 
J033087C03GAAGCCCAACANONE 
Os11g0298400AK068577AGAGTGGGTTGGGCTTTRibulose bisphosphate carboxylase, small chain family protein. 
Os11g0417400AK070536AAAGCCCAATProtein phosphatase 2C-like domain containing protein. 
Os11g0425800AK066603GAAGCCCAATTSimilar to 60S ribosomal protein L13a. 
J065063A20GAAGCCCAATTNONE 
J075021H08GAAGCCCAATTNONE 
J075058J10GAAGCCCAATTNONE 
J075088B15GAAGCCCAATTNONE 
J075099E15GAAGCCCAATTNONE 
J075110F13GAAGCCCAATTNONE 
J075150G18GAAGCCCAATTNONE 
J080312E14GAAGCCCAATTNONE 
Os11g0484300AK121422TTTTGGGCTTCSimilar to Mcm2-prov protein. 
Os11g0497000AK111924CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATSimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065097A08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065123J10CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J075096F04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J080065C15CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090033J04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090072N23CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100021E08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100063H21CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
Os11g0580000AK119421AAGCCCAACTArmadillo-like helical domain containing protein. 
AK121905AAGCCCAACTNONE 
J033105I06AAGCCCAACTNONE 
J090022C10AAGCCCAACTNONE 
J090024J23AAGCCCAACTNONE 
J090044F24AAGCCCAACTNONE 
Os11g0616200AK069189ATTTGGGCCGAAAGCCCAAAAConserved hypothetical protein. 
J023004N19ATTTGGGCCGAAAGCCCAAAANONE 
Os11g0617800009-105-D10ATTGGGCTTANONE 
AK062778ATTGGGCTTAConserved hypothetical protein. 
Os11g0660500009-031-D10AAAAGCCCAAACNONE 
009-100-G09AAAAGCCCAAACNONE 
009-162-G10AAAAGCCCAAACNONE 
009-183-H11AAAAGCCCAAACNONE 
013-010-B11AAAAGCCCAAACNONE 
013-050-A05AAAAGCCCAAACNONE 
013-070-E10AAAAGCCCAAACNONE 
AK105453AAAAGCCCAAACSimilar to Translationally controlled tumor protein (Fragment). 
D12626AAAAGCCCAAACNONE 
J013128M15AAAAGCCCAAACNONE 
J023004I19AAAAGCCCAAACNONE 
J033114F08AAAAGCCCAAACNONE 
J033147I20AAAAGCCCAAACNONE 
J065031M04AAAAGCCCAAACNONE 
J065033J03AAAAGCCCAAACNONE 
J065038E01AAAAGCCCAAACNONE 
J065048O06AAAAGCCCAAACNONE 
J065054E01AAAAGCCCAAACNONE 
J065075N08AAAAGCCCAAACNONE 
J065080C07AAAAGCCCAAACNONE 
J065096A12AAAAGCCCAAACNONE 
J065115P22AAAAGCCCAAACNONE 
J065122I21AAAAGCCCAAACNONE 
J065127A13AAAAGCCCAAACNONE 
J065158B06AAAAGCCCAAACNONE 
J065162E04AAAAGCCCAAACNONE 
J065162E05AAAAGCCCAAACNONE 
J065163L06AAAAGCCCAAACNONE 
J065177B16AAAAGCCCAAACNONE 
J065181M15AAAAGCCCAAACNONE 
J065201G15AAAAGCCCAAACNONE 
J065202J06AAAAGCCCAAACNONE 
J075002B19AAAAGCCCAAACNONE 
J075008G19AAAAGCCCAAACNONE 
J075010P05AAAAGCCCAAACNONE 
J075018H23AAAAGCCCAAACNONE 
J075051E18AAAAGCCCAAACNONE 
J075053C24AAAAGCCCAAACNONE 
J075077B06AAAAGCCCAAACNONE 
J075080B11AAAAGCCCAAACNONE 
J075083M04AAAAGCCCAAACNONE 
J075085H01AAAAGCCCAAACNONE 
J075109E11AAAAGCCCAAACNONE 
J075111O09AAAAGCCCAAACNONE 
J075130D13AAAAGCCCAAACNONE 
J075132H13AAAAGCCCAAACNONE 
J075147H19AAAAGCCCAAACNONE 
J075148J01AAAAGCCCAAACNONE 
J075159A18AAAAGCCCAAACNONE 
J075166F03AAAAGCCCAAACNONE 
J075191F09AAAAGCCCAAACNONE 
J075192K09AAAAGCCCAAACNONE 
J080006P15AAAAGCCCAAACNONE 
J080013J18AAAAGCCCAAACNONE 
J080023O06AAAAGCCCAAACNONE 
J080024I17AAAAGCCCAAACNONE 
J080029P03AAAAGCCCAAACNONE 
J080030C14AAAAGCCCAAACNONE 
J080038K15AAAAGCCCAAACNONE 
J080042I15AAAAGCCCAAACNONE 
J080053L07AAAAGCCCAAACNONE 
J080061H12AAAAGCCCAAACNONE 
J080064H24AAAAGCCCAAACNONE 
J080066J20AAAAGCCCAAACNONE 
J080074N07AAAAGCCCAAACNONE 
J080079F16AAAAGCCCAAACNONE 
J080079O07AAAAGCCCAAACNONE 
J080092E15AAAAGCCCAAACNONE 
J080301F19AAAAGCCCAAACNONE 
J080302O21AAAAGCCCAAACNONE 
J080306L02AAAAGCCCAAACNONE 
J080307F16AAAAGCCCAAACNONE 
J080307G01AAAAGCCCAAACNONE 
J080307K01AAAAGCCCAAACNONE 
J080309O22AAAAGCCCAAACNONE 
J080311E17AAAAGCCCAAACNONE 
J080311N08AAAAGCCCAAACNONE 
J080312O12AAAAGCCCAAACNONE 
J080315C08AAAAGCCCAAACNONE 
J080316D07AAAAGCCCAAACNONE 
J080318C17AAAAGCCCAAACNONE 
J090004B08AAAAGCCCAAACNONE 
J090009K02AAAAGCCCAAACNONE 
J090025O15AAAAGCCCAAACNONE 
J090026L03AAAAGCCCAAACNONE 
J090036P17AAAAGCCCAAACNONE 
J090047A21AAAAGCCCAAACNONE 
J090053O03AAAAGCCCAAACNONE 
J090059C04AAAAGCCCAAACNONE 
J090062O21AAAAGCCCAAACNONE 
J090064M11AAAAGCCCAAACNONE 
J090070C14AAAAGCCCAAACNONE 
J090075I03AAAAGCCCAAACNONE 
J090081G22AAAAGCCCAAACNONE 
J090083E18AAAAGCCCAAACNONE 
J090084A05AAAAGCCCAAACNONE 
J100019L11AAAAGCCCAAACNONE 
J100022D16AAAAGCCCAAACNONE 
J100042F09AAAAGCCCAAACNONE 
J100051J12AAAAGCCCAAACNONE 
J100065G21AAAAGCCCAAACNONE 
J100066D08AAAAGCCCAAACNONE 
J100069H04AAAAGCCCAAACNONE 
J100078I16AAAAGCCCAAACNONE 
J100090D15AAAAGCCCAAACNONE 
Os11g0708000006-046-G03CCAAGCCCAATNONE 
AK072065CCAAGCCCAATNONE 
AK120102CCAAGCCCAATConserved hypothetical protein. 
J013022N13CCAAGCCCAATNONE 
J013062I09CCAAGCCCAATNONE 
J013066H01CCAAGCCCAATNONE 
J013067A19CCAAGCCCAATNONE 
J033107A16CCAAGCCCAATNONE 
J065068A18CCAAGCCCAATNONE 
J065118D08CCAAGCCCAATNONE 
J075056H13CCAAGCCCAATNONE 
J075156I15CCAAGCCCAATNONE 
J100045J12CCAAGCCCAATNONE 
Os12g0100050Os12g0100050TTTTGGGCTTTLight chain 3 (LC3) family protein. 
Os12g0100100006-036-G03AAAGCCCAAAANONE 
006-036-G03GGGCTTGGGCTTCNONE 
AK061492AAAGCCCAAAASimilar to ALY protein. 
AK061492GGGCTTGGGCTTCSimilar to ALY protein. 
AK068452AAAGCCCAAAANONE 
AK068452GGGCTTGGGCTTCNONE 
J013153E18AAAGCCCAAAANONE 
J013153E18GGGCTTGGGCTTCNONE 
J033140D06AAAGCCCAAAANONE 
J033140D06GGGCTTGGGCTTCNONE 
J065046A19AAAGCCCAAAANONE 
J065046A19GGGCTTGGGCTTCNONE 
J065061F08AAAGCCCAAAANONE 
J065061F08GGGCTTGGGCTTCNONE 
J065101I03AAAGCCCAAAANONE 
J065101I03GGGCTTGGGCTTCNONE 
J065158B05AAAGCCCAAAANONE 
J065158B05GGGCTTGGGCTTCNONE 
J065162H06AAAGCCCAAAANONE 
J065162H06GGGCTTGGGCTTCNONE 
J065195I23AAAGCCCAAAANONE 
J065195I23GGGCTTGGGCTTCNONE 
J065218E07AAAGCCCAAAANONE 
J065218E07GGGCTTGGGCTTCNONE 
Os12g0106000AF370029CAAGCCCAAAASimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
AF519571CAAGCCCAAAANONE 
AK102242CAAGCCCAAAANONE 
AY324879CAAGCCCAAAANONE 
J053063M21CAAGCCCAAAANONE 
J090080A16CAAGCCCAAAANONE 
Os12g0123900016-031-A06AAAAGCCCAACANONE 
AK061862AAAAGCCCAACAHypothetical protein. 
J013031P10AAAAGCCCAACANONE 
J053034P22AAAAGCCCAACANONE 
J053046O16AAAAGCCCAACANONE 
J053048D20AAAAGCCCAACANONE 
J090031I07AAAAGCCCAACANONE 
J100025B02AAAAGCCCAACANONE 
Os12g0146300J065162K17TGTTGGGCTTTACATGGGCCGAGHypothetical protein. 
Os12g0164300AK120100TTTTGGGCTTGCyclin-like F-box domain containing protein. 
J013022J17TTTTGGGCTTGNONE 
J013040L22TTTTGGGCTTGNONE 
J013041G05TTTTGGGCTTGNONE 
J013096I02TTTTGGGCTTGNONE 
J013156F05TTTTGGGCTTGNONE 
J023122E20TTTTGGGCTTGNONE 
J065008K06TTTTGGGCTTGNONE 
J065073G14TTTTGGGCTTGNONE 
J065105H07TTTTGGGCTTGNONE 
J065117A15TTTTGGGCTTGNONE 
J075025K21TTTTGGGCTTGNONE 
J075051A13TTTTGGGCTTGNONE 
J075119C17TTTTGGGCTTGNONE 
J075143A02TTTTGGGCTTGNONE 
J075149K04TTTTGGGCTTGNONE 
J080304A20TTTTGGGCTTGNONE 
J080305H17TTTTGGGCTTGNONE 
J080306D14TTTTGGGCTTGNONE 
J080306N01TTTTGGGCTTGNONE 
J080308P13TTTTGGGCTTGNONE 
J080310C04TTTTGGGCTTGNONE 
J090048B12TTTTGGGCTTGNONE 
J090092A18TTTTGGGCTTGNONE 
J090099G20TTTTGGGCTTGNONE 
Os12g0182200AK099737ATTGGGCTTASimilar to Dihydrolipoamide S-acetyltransferase. 
AK099737CAAGCCCAAAASimilar to Dihydrolipoamide S-acetyltransferase. 
Os12g0223700J075049J03CTTGGGCCAAAAGCCCAAGHypothetical protein. 
J075101F23CTTGGGCCAAAAGCCCAAGNONE 
Os12g0279600AK070295AAAGCCCAAGExodeoxyribonuclease III xth family protein. 
Os12g0479400AK065254AAAGCCCAAANONE 
AK065254AAAGCCCAAGCCCAGCCCAACCNONE 
AK067061AAAGCCCAAASimilar to Auxin response factor 1. 
AK067061AAAGCCCAAGCCCAGCCCAACCSimilar to Auxin response factor 1. 
Os12g0527500AK109836GAAGCCCAAGCyclin-like F-box domain containing protein. 
Os12g0554400AK104059TATTGGGCTTTNONE 
Os12g0554800AK105676CCAAGCCCAATTSimilar to Polygalacturonase-like protein. 
Os12g0564400009-069-F12GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
AK059949GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
Os12g0631100006-045-F12TTTTGGGCTTTTNONE 
006-077-C09TTTTGGGCTTTTNONE 
006-078-B11TTTTGGGCTTTTNONE 
AJ292320TTTTGGGCTTTTNONE 
AK061116TTTTGGGCTTTTNONE 
AK066784TTTTGGGCTTTTNONE 
AY029301TTTTGGGCTTTTRas small GTPase, Ras type family protein. 
J065015G13TTTTGGGCTTTTNONE 
J065035E22TTTTGGGCTTTTNONE 
J065037H03TTTTGGGCTTTTNONE 
J065065F12TTTTGGGCTTTTNONE 
J065078K22TTTTGGGCTTTTNONE 
J065081K09TTTTGGGCTTTTNONE 
J065121I23TTTTGGGCTTTTNONE 
J065127I03TTTTGGGCTTTTNONE 
J065130G24TTTTGGGCTTTTNONE 
J065134E23TTTTGGGCTTTTNONE 
J065154H14TTTTGGGCTTTTNONE 
J065183K16TTTTGGGCTTTTNONE 
J065209P13TTTTGGGCTTTTNONE 
J075087O18TTTTGGGCTTTTNONE 
J090065E06TTTTGGGCTTTTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.