version

Summary of OsREG427 (All List)

OrganismOryza sativa  
IDOsREG427  
SequenceAAGCCCAC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1226  

Entry Sequences (1226 entries)

LocusGene modelSequenceDescription
Os01g0139600AK073130TTGTGGGCTTGGSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0162400AK108484GTGGGCTTCConserved hypothetical protein. 
Os01g0186900AK106168TAAGCCCACCTNONE 
J075116O22TAAGCCCACCTNONE 
J100060H12TAAGCCCACCTNONE 
Os01g0196600AK101742CCAAGCCCACGCNONE 
U25430CCAAGCCCACGCSimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
Os01g0206600J065041P19TAATGGGCCTGAAGCCCACATGGCCCATAConserved hypothetical protein. 
Os01g0220300009-063-C12AGGTGGGCTTTNONE 
AK105167AGGTGGGCTTTConserved hypothetical protein. 
J065124E17AGGTGGGCTTTNONE 
J090096L11AGGTGGGCTTTNONE 
Os01g0261500AK072194GTTGGTGGTGTGGGCTTTTNONE 
AK101899GTTGGTGGTGTGGGCTTTTConserved hypothetical protein. 
J065041N17GTTGGTGGTGTGGGCTTTTNONE 
Os01g0283000AK073165GAAGCCCACAConserved hypothetical protein. 
J033023G08GAAGCCCACANONE 
Os01g0283100004-018-B01TGTGGGCTTCNONE 
AK060908TGTGGGCTTCNONE 
AK071713TGTGGGCTTCSimilar to Ferripyochelin-binding protein-like. 
AK104205TGTGGGCTTCNONE 
AK122051TGTGGGCTTCNONE 
J023109L19TGTGGGCTTCNONE 
Os01g0588200006-052-E10CCAGGCCCAACCAAGCCCACGGNONE 
AJ251563CCAGGCCCAACCAAGCCCACGGNONE 
AK070745CCAGGCCCAACCAAGCCCACGGVoltage-dependent anion channel. 
AK104055CCAGGCCCAACCAAGCCCACGGNONE 
AK104419CCAGGCCCAACCAAGCCCACGGNONE 
J023057A07CCAGGCCCAACCAAGCCCACGGNONE 
J023068C08CCAGGCCCAACCAAGCCCACGGNONE 
J023148E24CCAGGCCCAACCAAGCCCACGGNONE 
J090045O22CCAGGCCCAACCAAGCCCACGGNONE 
J090045P03CCAGGCCCAACCAAGCCCACGGNONE 
J090050C18CCAGGCCCAACCAAGCCCACGGNONE 
J100023F01CCAGGCCCAACCAAGCCCACGGNONE 
J100051I18CCAGGCCCAACCAAGCCCACGGNONE 
J100060P17CCAGGCCCAACCAAGCCCACGGNONE 
Os01g0620100AK070122TAAGCCCACAWD40-like domain containing protein. 
J023044A10TAAGCCCACANONE 
J033023C13TAAGCCCACANONE 
J033045E16TAAGCCCACANONE 
J033111H03TAAGCCCACANONE 
Os01g0698300AK058744TGTGGGCTTCNONE 
J090068O06TGTGGGCTTCNONE 
Os01g0714800AK108555GAAGCCCACCWRKY transcription factor 26. 
AY870609GAAGCCCACCNONE 
Os01g0739000AK069568CCAAGCCCACAASimilar to Mitochondrial processing peptidase. 
AK073810CCAAGCCCACAANONE 
J013042N17CCAAGCCCACAANONE 
J023128N16CCAAGCCCACAANONE 
J033024F18CCAAGCCCACAANONE 
J033037D09CCAAGCCCACAANONE 
J033050E17CCAAGCCCACAANONE 
J033065K22CCAAGCCCACAANONE 
J033070E13CCAAGCCCACAANONE 
J033087A13CCAAGCCCACAANONE 
Os01g0847300AK071164AAAGCCCACCAProtein of unknown function DUF588 family protein. 
AK104027AAAGCCCACCANONE 
Os01g0857250J100049D24TGTGGGCTTTConserved hypothetical protein. 
Os01g0878400AK073884AAAGCCCACAmino acid/polyamine transporter II family protein. 
J065163K23AAAGCCCACNONE 
J065207H17AAAGCCCACNONE 
Os01g0897200AK061505GAAGCCCACNONE 
AK065055GAAGCCCACNONE 
AK100403GAAGCCCACSimilar to Ribonuclease 2 precursor (EC 3.1.27.1). 
AK105061GAAGCCCACNONE 
AK121862GAAGCCCACNONE 
J013001J04GAAGCCCACNONE 
J033103A19GAAGCCCACNONE 
J075005P18GAAGCCCACNONE 
J090027D12GAAGCCCACNONE 
J090032M01GAAGCCCACNONE 
J090079K10GAAGCCCACNONE 
J100018O17GAAGCCCACNONE 
J100080H14GAAGCCCACNONE 
J100088D08GAAGCCCACNONE 
Os01g0908100AK072293GAAGCCCACARabGAP/TBC domain containing protein. 
J065010B13GAAGCCCACANONE 
J065010M12GAAGCCCACANONE 
J065047C19GAAGCCCACANONE 
J065069B18GAAGCCCACANONE 
J065071K24GAAGCCCACANONE 
J065142P04GAAGCCCACANONE 
J065170E11GAAGCCCACANONE 
Os01g0913400AK099881TGGTGGGCTTCProtein prenyltransferase domain containing protein. 
Os01g0914000AK101364TTGTGGGCTTTConserved hypothetical protein. 
J080302O10TTGTGGGCTTTNONE 
J080305G04TTGTGGGCTTTNONE 
J080316B11TTGTGGGCTTTNONE 
J090049A14TTGTGGGCTTTNONE 
J090066O10TTGTGGGCTTTNONE 
Os01g0924000004-020-C09GAAGCCCACAANONE 
005-014-A06GAAGCCCACAANONE 
009-085-G12GAAGCCCACAANONE 
009-123-A08GAAGCCCACAANONE 
009-134-A05GAAGCCCACAANONE 
009-137-F06GAAGCCCACAANONE 
016-016-B08GAAGCCCACAANONE 
AF050674GAAGCCCACAANONE 
AK061690GAAGCCCACAASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797GAAGCCCACAANONE 
J013040A15GAAGCCCACAANONE 
J013104L20GAAGCCCACAANONE 
J013127E12GAAGCCCACAANONE 
J013158O05GAAGCCCACAANONE 
J023012E09GAAGCCCACAANONE 
J023126L23GAAGCCCACAANONE 
J023143B03GAAGCCCACAANONE 
J065005B16GAAGCCCACAANONE 
J065101J15GAAGCCCACAANONE 
J065105K16GAAGCCCACAANONE 
J065155K16GAAGCCCACAANONE 
J065171M17GAAGCCCACAANONE 
J065182F07GAAGCCCACAANONE 
J065187D10GAAGCCCACAANONE 
J065194I24GAAGCCCACAANONE 
J065207E24GAAGCCCACAANONE 
J075001C24GAAGCCCACAANONE 
J075090O10GAAGCCCACAANONE 
J075095H17GAAGCCCACAANONE 
J075109M24GAAGCCCACAANONE 
J075123C18GAAGCCCACAANONE 
J075148G22GAAGCCCACAANONE 
J090009B09GAAGCCCACAANONE 
J090075K17GAAGCCCACAANONE 
J090081H23GAAGCCCACAANONE 
J090097H21GAAGCCCACAANONE 
J100063P14GAAGCCCACAANONE 
Os01g0935700AK069403AAAGCCCACGTSimilar to Cytochrome c1 (Fragment). 
AK073125AAAGCCCACGTNONE 
J023013M20AAAGCCCACGTNONE 
Os01g0951800AK069239TCGTGGGCTTAProtein prenyltransferase domain containing protein. 
Os01g0952600AK067525GTTGGTGGGCTTANONE 
AK070047GTTGGTGGGCTTASimilar to LacZ (Fragment). 
Os01g0958100AK058574CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
Os01g0966200009-079-H11GTGGGCTTANONE 
009-124-G10GTGGGCTTANONE 
AK058564GTGGGCTTAProtein of unknown function YGGT family protein. 
AK098935GTGGGCTTANONE 
Os01g0971200014-071-B08AAAAGCCCACNONE 
AK064075AAAAGCCCACNONE 
Os02g0121000AK099931CGCGTGGGCTTTGTTGGGCCCCSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0200900J090088F16CCGTGGGCTTCNONE 
Os02g0255200AK121591AAAGCCCACCASimilar to Ribosomal protein S15a homolog. 
J033023N03AAAGCCCACCANONE 
J033031C22AAAGCCCACCANONE 
J033037P22AAAGCCCACCANONE 
J090013J10AAAGCCCACCANONE 
J090030I04AAAGCCCACCANONE 
Os02g0316800009-104-A11AAAGCCCACCANONE 
AK062767AAAGCCCACCASimilar to MRNA binding protein precursor. 
Os02g0326700AK064977AAAGCCCACARhomboid-like protein family protein. 
Os02g0461200012-026-A12GAAGCCCACACGNONE 
AK063459GAAGCCCACACGConserved hypothetical protein. 
J065183F11GAAGCCCACACGNONE 
J075190G18GAAGCCCACACGNONE 
Os02g0543200AK100963AAAAGCCCACGCGCyclin-like F-box domain containing protein. 
Os02g0549600009-119-C10TAAGCCCACNONE 
AK066564TAAGCCCACSimilar to 40S ribosomal protein S10-1. 
J013073I17TAAGCCCACNONE 
J013104F19TAAGCCCACNONE 
J013104K21TAAGCCCACNONE 
J013110E05TAAGCCCACNONE 
J023020L11TAAGCCCACNONE 
J023130D08TAAGCCCACNONE 
J033041D03TAAGCCCACNONE 
J033105K14TAAGCCCACNONE 
J065040N14TAAGCCCACNONE 
J065157A09TAAGCCCACNONE 
J075123A20TAAGCCCACNONE 
J075129F06TAAGCCCACNONE 
J075135E04TAAGCCCACNONE 
J075173A10TAAGCCCACNONE 
J080301E09TAAGCCCACNONE 
J080306D10TAAGCCCACNONE 
J080310M21TAAGCCCACNONE 
J080312M09TAAGCCCACNONE 
J080319J08TAAGCCCACNONE 
J090036L14TAAGCCCACNONE 
J090051D01TAAGCCCACNONE 
J090066K07TAAGCCCACNONE 
Os02g0555000015-020-G02AAAGCCCACCACNONE 
AK065270AAAGCCCACCACNONE 
AK121253AAAGCCCACCACProtein of unknown function, ATP binding family protein. 
J013002L01AAAGCCCACCACNONE 
J023060A02AAAGCCCACCACNONE 
J023101O11AAAGCCCACCACNONE 
J023140A15AAAGCCCACCACNONE 
J033042H19AAAGCCCACCACNONE 
J033046C02AAAGCCCACCACNONE 
J033080N19AAAGCCCACCACNONE 
J065026I02AAAGCCCACCACNONE 
J065040C18AAAGCCCACCACNONE 
J090004I16AAAGCCCACCACNONE 
Os02g0558300Os02g0558300AAAGCCCACAMolybdopterin converting factor, subunit 1 family protein. 
Os02g0595800Os02g0595800AAAGCCCACCCSimilar to Eukaryotic initiation factor 4B (Fragment). 
Os02g0610700014-008-A03TAAGCCCACGTAGGCCCAAACNONE 
AK059205TAAGCCCACGTAGGCCCAAACConserved hypothetical protein. 
AK100281TAAGCCCACGTAGGCCCAAACNONE 
J023074H03TAAGCCCACGTAGGCCCAAACNONE 
J065002J16TAAGCCCACGTAGGCCCAAACNONE 
J065032I20TAAGCCCACGTAGGCCCAAACNONE 
J065076A07TAAGCCCACGTAGGCCCAAACNONE 
J065142O21TAAGCCCACGTAGGCCCAAACNONE 
J065203A03TAAGCCCACGTAGGCCCAAACNONE 
J075017F24TAAGCCCACGTAGGCCCAAACNONE 
J075017G24TAAGCCCACGTAGGCCCAAACNONE 
Os02g0616100006-043-E12GAAGCCCACGGNONE 
006-043-G11GAAGCCCACGGNONE 
006-053-C05GAAGCCCACGGNONE 
006-059-C04GAAGCCCACGGNONE 
006-068-F02GAAGCCCACGGNONE 
006-071-B10GAAGCCCACGGNONE 
006-084-A03GAAGCCCACGGNONE 
006-086-F07GAAGCCCACGGNONE 
006-105-B05GAAGCCCACGGNONE 
006-109-A06GAAGCCCACGGNONE 
009-105-B10GAAGCCCACGGNONE 
009-153-H09GAAGCCCACGGNONE 
AK060972GAAGCCCACGGConserved hypothetical protein. 
AK104643GAAGCCCACGGNONE 
J075074K09GAAGCCCACGGNONE 
Os02g0643500AK068423GAAGCCCACPentapeptide repeat containing protein. 
Os02g0679500AK067772GGTGGGCTTGSimilar to Rac GTPase activating protein 1. 
AY364311GGTGGGCTTGNONE 
Os02g0681100AK100584GAAGCCCACGAAProtein of unknown function DUF604 family protein. 
J023106A15GAAGCCCACGAANONE 
Os02g0681200006-024-F11CCAAGCCCACGACCCGCACCGCNONE 
006-051-H06CCAAGCCCACGACCCGCACCGCNONE 
006-062-F08CCAAGCCCACGACCCGCACCGCNONE 
009-172-G01CCAAGCCCACGACCCGCACCGCNONE 
AK071853CCAAGCCCACGACCCGCACCGCZinc finger, RING-type domain containing protein. 
AK099314CCAAGCCCACGACCCGCACCGCNONE 
AK104122CCAAGCCCACGACCCGCACCGCNONE 
Os02g0689200011-024-D04TGTGGGCTTGGNONE 
AK065336TGTGGGCTTGGNONE 
AK071254TGTGGGCTTGGNONE 
J013000O22TGTGGGCTTGGNONE 
J023087G23TGTGGGCTTGGNONE 
J033095E21TGTGGGCTTGGNONE 
J033113F12TGTGGGCTTGGNONE 
J033124F02TGTGGGCTTGGNONE 
J065070A01TGTGGGCTTGGNONE 
J065129C05TGTGGGCTTGGNONE 
J065165M19TGTGGGCTTGGNONE 
J090015K07TGTGGGCTTGGNONE 
J090016L11TGTGGGCTTGGNONE 
J090066D21TGTGGGCTTGGNONE 
J090075M20TGTGGGCTTGGNONE 
Os02g0744100006-070-H12AAAGCCCACACNONE 
006-115-C05AAAGCCCACACNONE 
AK061274AAAGCCCACACSAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0754500AK069965AGCCCATGACAAGCCCACGGNONE 
AK105696AGCCCATGACAAGCCCACGGAmidase family protein. 
Os02g0762300AK106684GAAGCCCACAAProtein of unknown function UPF0021 family protein. 
J090060M09GAAGCCCACAANONE 
J100083E05GAAGCCCACAANONE 
Os02g0768200006-059-D06AAAGCCCACCTNONE 
AK070007AAAGCCCACCTemp24/gp25L/p24 family protein. 
J033050A21AAAGCCCACCTNONE 
Os02g0802400J065054M13GAAGCCCACGTNONE 
J065061I04GAAGCCCACGTNONE 
J065112M15GAAGCCCACGTEF-Hand type domain containing protein. 
J100050L24GAAGCCCACGTNONE 
J100059D20GAAGCCCACGTNONE 
Os02g0819100AK100156AAAGCCCACAZinc finger, DHHC-type domain containing protein. 
J013088C21AAAGCCCACANONE 
Os02g0823800AK120318AAAGCCCACConserved hypothetical protein. 
J075055J16AAAGCCCACNONE 
Os03g0116800012-097-D10GAAGCCCACCACNONE 
016-024-H10GAAGCCCACCACNONE 
AK066955GAAGCCCACCACConserved hypothetical protein. 
AK068678GAAGCCCACCACNONE 
AK104839GAAGCCCACCACNONE 
J013033G16GAAGCCCACCACNONE 
J013091C10GAAGCCCACCACNONE 
J013158H22GAAGCCCACCACNONE 
J023106K11GAAGCCCACCACNONE 
J065051O15GAAGCCCACCACNONE 
J065129G22GAAGCCCACCACNONE 
J075001K02GAAGCCCACCACNONE 
J075011O03GAAGCCCACCACNONE 
J075024K04GAAGCCCACCACNONE 
J075026E07GAAGCCCACCACNONE 
J075037O14GAAGCCCACCACNONE 
J075071D17GAAGCCCACCACNONE 
J075084M05GAAGCCCACCACNONE 
J075114B06GAAGCCCACCACNONE 
J075128C23GAAGCCCACCACNONE 
J075153A13GAAGCCCACCACNONE 
J075158A15GAAGCCCACCACNONE 
J075165P09GAAGCCCACCACNONE 
J075167M21GAAGCCCACCACNONE 
J075170F11GAAGCCCACCACNONE 
J075186F12GAAGCCCACCACNONE 
J075186L13GAAGCCCACCACNONE 
J075189A01GAAGCCCACCACNONE 
J075192D19GAAGCCCACCACNONE 
Os03g0124300AK069148AAAAGCCCACGCConserved hypothetical protein. 
AK106076AAAAGCCCACGCNONE 
J023003G19AAAAGCCCACGCNONE 
Os03g0125000006-032-D09AAAGCCCACCTGNONE 
006-033-B05AAAGCCCACCTGNONE 
006-048-G06AAAGCCCACCTGNONE 
006-048-G09AAAGCCCACCTGNONE 
006-052-D09AAAGCCCACCTGNONE 
006-072-A04AAAGCCCACCTGNONE 
006-076-F12AAAGCCCACCTGNONE 
006-080-B03AAAGCCCACCTGNONE 
006-092-H03AAAGCCCACCTGNONE 
006-103-G04AAAGCCCACCTGNONE 
009-079-E01AAAGCCCACCTGNONE 
009-150-F03AAAGCCCACCTGNONE 
AF095708AAAGCCCACCTGNONE 
AK059557AAAGCCCACCTGNONE 
AK070779AAAGCCCACCTGSimilar to 50S ribosomal protein L5, chloroplast. 
AK098999AAAGCCCACCTGNONE 
AK104137AAAGCCCACCTGNONE 
J065002D07AAAGCCCACCTGNONE 
J065167E24AAAGCCCACCTGNONE 
J075199O14AAAGCCCACCTGNONE 
J100083L01AAAGCCCACCTGNONE 
Os03g0127000AK068479TAGGCCCAGCAAAGCCCACGTConserved hypothetical protein. 
J013152D10TAGGCCCAGCAAAGCCCACGTNONE 
J075167I20TAGGCCCAGCAAAGCCCACGTNONE 
J090067O04TAGGCCCAGCAAAGCCCACGTNONE 
Os03g0151900009-084-F09TAAGCCCACNONE 
AB032761TAAGCCCACNONE 
AK105389TAAGCCCACNONE 
AK121527TAAGCCCACSimilar to Small GTP-binding protein. 
J075028M03TAAGCCCACNONE 
J075031H15TAAGCCCACNONE 
J075045L24TAAGCCCACNONE 
J075055K14TAAGCCCACNONE 
J075100O08TAAGCCCACNONE 
J075112B20TAAGCCCACNONE 
J075188D21TAAGCCCACNONE 
Os03g0178400AK108257GAAGCCCACCACCAACEpoxide hydrolase family protein. 
Os03g0181600AK067807TAAGCCCACCAACGGCTSimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TAAGCCCACCAACGGCTNONE 
Os03g0186800AK100356AAAGCCCACCTModifier of rudimentary, Modr family protein. 
Os03g0192400009-081-A03CAAGCCCACTCTNONE 
009-081-A03GAAGCCCACNONE 
009-159-B02CAAGCCCACTCTNONE 
009-159-B02GAAGCCCACNONE 
AK070573CAAGCCCACTCTGRIM-19 family protein. 
AK070573GAAGCCCACGRIM-19 family protein. 
J023056B01CAAGCCCACTCTNONE 
J023056B01GAAGCCCACNONE 
J023075G06CAAGCCCACTCTNONE 
J023075G06GAAGCCCACNONE 
J033048K16CAAGCCCACTCTNONE 
J033048K16GAAGCCCACNONE 
J033048L16CAAGCCCACTCTNONE 
J033048L16GAAGCCCACNONE 
J053031H23CAAGCCCACTCTNONE 
J053031H23GAAGCCCACNONE 
J065002H14CAAGCCCACTCTNONE 
J065002H14GAAGCCCACNONE 
J065006G22CAAGCCCACTCTNONE 
J065006G22GAAGCCCACNONE 
J065032G13CAAGCCCACTCTNONE 
J065032G13GAAGCCCACNONE 
J065056A09CAAGCCCACTCTNONE 
J065056A09GAAGCCCACNONE 
J065078I01CAAGCCCACTCTNONE 
J065078I01GAAGCCCACNONE 
J065095G01CAAGCCCACTCTNONE 
J065095G01GAAGCCCACNONE 
J065095I18CAAGCCCACTCTNONE 
J065095I18GAAGCCCACNONE 
J065134M18CAAGCCCACTCTNONE 
J065134M18GAAGCCCACNONE 
J065158P07CAAGCCCACTCTNONE 
J065158P07GAAGCCCACNONE 
J065165K17CAAGCCCACTCTNONE 
J065165K17GAAGCCCACNONE 
J065181J12CAAGCCCACTCTNONE 
J065181J12GAAGCCCACNONE 
J065189N09CAAGCCCACTCTNONE 
J065189N09GAAGCCCACNONE 
J065200D13CAAGCCCACTCTNONE 
J065200D13GAAGCCCACNONE 
J065202H20CAAGCCCACTCTNONE 
J065202H20GAAGCCCACNONE 
J065215K20CAAGCCCACTCTNONE 
J065215K20GAAGCCCACNONE 
J075049N19CAAGCCCACTCTNONE 
J075049N19GAAGCCCACNONE 
J075147J16CAAGCCCACTCTNONE 
J075147J16GAAGCCCACNONE 
J090081E19CAAGCCCACTCTNONE 
J090081E19GAAGCCCACNONE 
J100017C16CAAGCCCACTCTNONE 
J100017C16GAAGCCCACNONE 
J100039M16CAAGCCCACTCTNONE 
J100039M16GAAGCCCACNONE 
J100043E23CAAGCCCACTCTNONE 
J100043E23GAAGCCCACNONE 
J100063L12CAAGCCCACTCTNONE 
J100063L12GAAGCCCACNONE 
J100079F22CAAGCCCACTCTNONE 
J100079F22GAAGCCCACNONE 
Os03g0249200009-103-B08AAAGCCCACATAGGCCCAAATNONE 
AK069944AAAGCCCACATAGGCCCAAATClass I peptide chain release factor domain containing protein. 
J065166E13AAAGCCCACATAGGCCCAAATNONE 
Os03g0259600AK108532GAAGCCCACAUbiquitin domain containing protein. 
J065064G04GAAGCCCACANONE 
J065116I06GAAGCCCACANONE 
J065165C14GAAGCCCACANONE 
J075173K24GAAGCCCACANONE 
Os03g0263500006-112-E09GTGGGCTTGGGCCCAAAANONE 
009-122-C01GTGGGCTTGGGCCCAAAANONE 
AK106060GTGGGCTTGGGCCCAAAASimilar to Splicing factor 3A subunit 2 (Spliceosome associated protein 62) (SAP 62) (SF3a66). 
Os03g0279600006-070-A07TAAGCCCACCANONE 
AK061080TAAGCCCACCAConserved hypothetical protein. 
AK071043TAAGCCCACCANONE 
AK103191TAAGCCCACCANONE 
J065077E22TAAGCCCACCANONE 
J065208F22TAAGCCCACCANONE 
J075156K12TAAGCCCACCANONE 
Os03g0295500009-083-F02AAAAGCCCACGAANONE 
J053029J05AAAAGCCCACGAANONE 
J053054B07AAAAGCCCACGAACHCH domain containing protein. 
J065024G23AAAAGCCCACGAANONE 
J065036F08AAAAGCCCACGAANONE 
J065066M11AAAAGCCCACGAANONE 
J065143G19AAAAGCCCACGAANONE 
Os03g0300600003-125-G06AAAGCCCACGCNONE 
006-048-C04AAAGCCCACGCNONE 
009-044-A09AAAGCCCACGCNONE 
AK059801AAAGCCCACGCNONE 
AK066250AAAGCCCACGCSimilar to Chaperone protein dnaJ. 
AK069897AAAGCCCACGCNONE 
AK104186AAAGCCCACGCNONE 
J065197D15AAAGCCCACGCNONE 
J090031C11AAAGCCCACGCNONE 
J100024C23AAAGCCCACGCNONE 
J100030B16AAAGCCCACGCNONE 
J100033K12AAAGCCCACGCNONE 
J100043M19AAAGCCCACGCNONE 
J100056N09AAAGCCCACGCNONE 
J100058E12AAAGCCCACGCNONE 
J100084J08AAAGCCCACGCNONE 
Os03g0321000AK103653CAAGCCCACAASimilar to Steroid membrane binding protein-like. 
Os03g0334800AK101595TTGTGGGCTTTLung seven transmembrane receptor family protein. 
J023110B03TTGTGGGCTTTNONE 
J065102E22TTGTGGGCTTTNONE 
J065102F24TTGTGGGCTTTNONE 
J065140O22TTGTGGGCTTTNONE 
J075001N09TTGTGGGCTTTNONE 
J075057F24TTGTGGGCTTTNONE 
J075197K01TTGTGGGCTTTNONE 
J090080D05TTGTGGGCTTTNONE 
Os03g0335100AK107094TAAGCCCACAConserved hypothetical protein. 
Os03g0372900AK100417GAAGCCCACGGGCyclin-like F-box domain containing protein. 
Os03g0390700AB110190GAAGCCCACAANONE 
AK103600GAAGCCCACAASimilar to Transthyretin-like protein. 
J065188H06GAAGCCCACAANONE 
Os03g0421400J075194I21AAAGCCCACGTNONE 
Os03g0438000AK119977GTGGGCTTConserved hypothetical protein. 
Os03g0438900AK111048GAAGCCCACAHypothetical protein. 
Os03g0563300006-086-B06TTGTGGGCTTTNONE 
006-102-B09TTGTGGGCTTTNONE 
AK060389TTGTGGGCTTTNONE 
AK070720TTGTGGGCTTTSimilar to Mg-chelatase subunit (Fragment). 
AK071134TTGTGGGCTTTNONE 
AK104435TTGTGGGCTTTNONE 
J013128N14TTGTGGGCTTTNONE 
J023041F09TTGTGGGCTTTNONE 
J023056M13TTGTGGGCTTTNONE 
J023078K03TTGTGGGCTTTNONE 
J023132N12TTGTGGGCTTTNONE 
J023134B01TTGTGGGCTTTNONE 
J033093B14TTGTGGGCTTTNONE 
Os03g0574300AK072541CCAAGCCCACGGCCHypothetical protein. 
J023134M10CCAAGCCCACGGCCNONE 
Os03g0655700AK120254AAAGCCCAAGCCCACCACSimilar to 3-isopropylmalate dehydrogenase, chloroplast precursor (EC 1.1.1.85) (Beta-IPM dehydrogenase) (IMDH) (3-IPM-DH). 
Os03g0673600009-011-C08CGTGTGGGCTTTTNONE 
009-033-C05CGTGTGGGCTTTTNONE 
AK062334CGTGTGGGCTTTTNONE 
AK068539CGTGTGGGCTTTTConserved hypothetical protein. 
Os03g0701500009-150-F12CCAAGCCCACTCCNONE 
AK063166CCAAGCCCACTCCGNS1/SUR4 membrane protein family protein. 
Os03g0739700003-104-A04TTCGTGGGCTTTNONE 
AK062272TTCGTGGGCTTTUncharacterized protein UPF0114 family protein. 
Os03g0747700AK058795AAAAGCCCACConserved hypothetical protein. 
Os03g0752800AB041020TCGGCCCAGAAAAGCCCACGANONE 
AF058697TCGGCCCAGAAAAGCCCACGAMADS14 protein. 
AF139664TCGGCCCAGAAAAGCCCACGANONE 
AK121171TCGGCCCAGAAAAGCCCACGANONE 
AY332478TCGGCCCAGAAAAGCCCACGANONE 
AY551916TCGGCCCAGAAAAGCCCACGANONE 
J023081C04TCGGCCCAGAAAAGCCCACGANONE 
Os03g0772800009-023-E05AAAGCCCACGAANONE 
009-023-E05GAAGCCCACAANONE 
009-059-F12AAAGCCCACGAANONE 
009-059-F12GAAGCCCACAANONE 
009-114-B08AAAGCCCACGAANONE 
009-114-B08GAAGCCCACAANONE 
009-115-G09AAAGCCCACGAANONE 
009-115-G09GAAGCCCACAANONE 
009-151-D08AAAGCCCACGAANONE 
009-151-D08GAAGCCCACAANONE 
009-158-A10AAAGCCCACGAANONE 
009-158-A10GAAGCCCACAANONE 
009-191-H02AAAGCCCACGAANONE 
009-191-H02GAAGCCCACAANONE 
009-192-E05AAAGCCCACGAANONE 
009-192-E05GAAGCCCACAANONE 
009-197-F11AAAGCCCACGAANONE 
009-197-F11GAAGCCCACAANONE 
AK059576AAAGCCCACGAANONE 
AK059576GAAGCCCACAANONE 
AK121608AAAGCCCACGAACytochrome c oxidase, subunit VIa family protein. 
AK121608GAAGCCCACAACytochrome c oxidase, subunit VIa family protein. 
J023087H20AAAGCCCACGAANONE 
J023087H20GAAGCCCACAANONE 
J023105P14AAAGCCCACGAANONE 
J023105P14GAAGCCCACAANONE 
J033026P15AAAGCCCACGAANONE 
J033026P15GAAGCCCACAANONE 
J033042K10AAAGCCCACGAANONE 
J033042K10GAAGCCCACAANONE 
J033133C09AAAGCCCACGAANONE 
J033133C09GAAGCCCACAANONE 
J065123K13AAAGCCCACGAANONE 
J065123K13GAAGCCCACAANONE 
J075190D03AAAGCCCACGAANONE 
J075190D03GAAGCCCACAANONE 
J080310M14AAAGCCCACGAANONE 
J080310M14GAAGCCCACAANONE 
J080317L14AAAGCCCACGAANONE 
J080317L14GAAGCCCACAANONE 
J100067J19AAAGCCCACGAANONE 
J100067J19GAAGCCCACAANONE 
J100079H21AAAGCCCACGAANONE 
J100079H21GAAGCCCACAANONE 
Os03g0784400AK103474TGGTGGGCTTTProtein of unknown function DUF1692 domain containing protein. 
J023135I15TGGTGGGCTTTNONE 
J033130D12TGGTGGGCTTTNONE 
J043035E20TGGTGGGCTTTNONE 
J065206K15TGGTGGGCTTTNONE 
J075053J20TGGTGGGCTTTNONE 
J075129B11TGGTGGGCTTTNONE 
J090003E22TGGTGGGCTTTNONE 
J100023E23TGGTGGGCTTTNONE 
Os03g0786000AK061286CCAAGCCCACCTConserved hypothetical protein. 
AK073187CCAAGCCCACCTNONE 
Os03g0787200AK103438CAAGCCCACCIQ calmodulin-binding region domain containing protein. 
J065009F06CAAGCCCACCNONE 
J065046F02CAAGCCCACCNONE 
J065127L12CAAGCCCACCNONE 
Os03g0808300006-053-B11AAAGCCCACANONE 
006-057-A01AAAGCCCACANONE 
006-090-F05AAAGCCCACANONE 
006-106-G01AAAGCCCACANONE 
006-120-D10AAAGCCCACANONE 
009-139-H09AAAGCCCACANONE 
AK109389AAAGCCCACARemorin, C-terminal region domain containing protein. 
J033065F13AAAGCCCACANONE 
J053045H15AAAGCCCACANONE 
J065021C02AAAGCCCACANONE 
J065021D01AAAGCCCACANONE 
J065039B14AAAGCCCACANONE 
J065064J22AAAGCCCACANONE 
J065167I09AAAGCCCACANONE 
J065170A13AAAGCCCACANONE 
J065183J10AAAGCCCACANONE 
J065202K10AAAGCCCACANONE 
J065218F21AAAGCCCACANONE 
J075028D07AAAGCCCACANONE 
J100048J08AAAGCCCACANONE 
J100050H06AAAGCCCACANONE 
J100054M24AAAGCCCACANONE 
J100068G07AAAGCCCACANONE 
J100079F23AAAGCCCACANONE 
Os03g0821900AK070847AGTGGGCCTACCGGGCCAAAGCCCACASimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0825300AK072216AAAGCCCACCACNONE 
AK102693AAAGCCCACCACNONE 
AK105593AAAGCCCACCACProtein kinase-like domain containing protein. 
BT014687AAAGCCCACCACNONE 
Os03g0844700J090056L22GAAGCCCACASimilar to Inner membrane protein ALBINO3, chloroplast precursor. Splice isoform 2. 
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein. 
AK072577CCGTGGGCCGCACGTGGGCTTTTNONE 
AK099773CCGTGGGCCGCACGTGGGCTTTTNONE 
J013030L03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013042D23CCGTGGGCCGCACGTGGGCTTTTNONE 
J013050E17CCGTGGGCCGCACGTGGGCTTTTNONE 
J013051J21CCGTGGGCCGCACGTGGGCTTTTNONE 
J013055L09CCGTGGGCCGCACGTGGGCTTTTNONE 
J013064A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013095E06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013111A06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013118K01CCGTGGGCCGCACGTGGGCTTTTNONE 
J013119A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013134F07CCGTGGGCCGCACGTGGGCTTTTNONE 
J033132N23CCGTGGGCCGCACGTGGGCTTTTNONE 
Os04g0343900AK107841TAAGCCCACCCConserved hypothetical protein. 
Os04g0418500AK121255GTGGTGGGCTTTU box domain containing protein. 
J065172M13GTGGTGGGCTTTNONE 
J100026H21GTGGTGGGCTTTNONE 
J100032D22GTGGTGGGCTTTNONE 
Os04g0432600AK058925GAAGCCCACConserved hypothetical protein. 
AK103967GAAGCCCACNONE 
AK121724GAAGCCCACNONE 
J033081P13GAAGCCCACNONE 
J033128L11GAAGCCCACNONE 
J065038G19GAAGCCCACNONE 
J065129A21GAAGCCCACNONE 
J065131P11GAAGCCCACNONE 
J065166I03GAAGCCCACNONE 
J065181L05GAAGCCCACNONE 
J100018I15GAAGCCCACNONE 
J100019H22GAAGCCCACNONE 
J100037O10GAAGCCCACNONE 
Os04g0440100AK101324TTGTGGGCTTANONE 
AK105415TTGTGGGCTTANonsense-mediated decay UPF3 domain containing protein. 
Os04g0478600AK073788GGTGGGCTTTTConserved hypothetical protein. 
Os04g0486500AK111976GAAGCCCACTGGCCCACCGCCCACACGACCGTTGSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0577000AK073711CAAGTGGGCTTTUbiquitin fusion degradation protein UFD1 family protein. 
AK119957CAAGTGGGCTTTNONE 
J013127H04CAAGTGGGCTTTNONE 
J033035G06CAAGTGGGCTTTNONE 
J033061G23CAAGTGGGCTTTNONE 
J033127L07CAAGTGGGCTTTNONE 
J065015F17CAAGTGGGCTTTNONE 
J065062G08CAAGTGGGCTTTNONE 
J065132M07CAAGTGGGCTTTNONE 
J065155C12CAAGTGGGCTTTNONE 
J075055I08CAAGTGGGCTTTNONE 
J075140D07CAAGTGGGCTTTNONE 
J090055B21CAAGTGGGCTTTNONE 
J100031D23CAAGTGGGCTTTNONE 
Os04g0581300009-171-H01ATGGCCCACGCCACAAGCCCACAANONE 
AK063093ATGGCCCACGCCACAAGCCCACAASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os05g0101600AK101021AGGTGGGCTTTTCytochrome P450 family protein. 
Os05g0110100009-015-D08AGGTGGGCTTGGNONE 
009-023-C09AGGTGGGCTTGGNONE 
009-031-B11AGGTGGGCTTGGNONE 
009-034-C02AGGTGGGCTTGGNONE 
009-050-B08AGGTGGGCTTGGNONE 
009-065-D12AGGTGGGCTTGGNONE 
009-090-G08AGGTGGGCTTGGNONE 
009-111-H07AGGTGGGCTTGGNONE 
009-136-F12AGGTGGGCTTGGNONE 
009-138-E06AGGTGGGCTTGGNONE 
009-138-G12AGGTGGGCTTGGNONE 
009-141-D08AGGTGGGCTTGGNONE 
009-143-D01AGGTGGGCTTGGNONE 
009-179-D09AGGTGGGCTTGGNONE 
009-179-E03AGGTGGGCTTGGNONE 
009-196-A09AGGTGGGCTTGGNONE 
009-199-F04AGGTGGGCTTGGNONE 
013-021-E05AGGTGGGCTTGGNONE 
013-076-C04AGGTGGGCTTGGNONE 
013-096-F06AGGTGGGCTTGGNONE 
014-071-A05AGGTGGGCTTGGNONE 
014-077-F09AGGTGGGCTTGGNONE 
AK099779AGGTGGGCTTGGNONE 
AK121142AGGTGGGCTTGGConserved hypothetical protein. 
J013095A16AGGTGGGCTTGGNONE 
J013111A17AGGTGGGCTTGGNONE 
J013132G04AGGTGGGCTTGGNONE 
J023077M04AGGTGGGCTTGGNONE 
J065001B11AGGTGGGCTTGGNONE 
J065001E11AGGTGGGCTTGGNONE 
J065057G10AGGTGGGCTTGGNONE 
J065057L08AGGTGGGCTTGGNONE 
J065080E07AGGTGGGCTTGGNONE 
J065087K10AGGTGGGCTTGGNONE 
J065091M15AGGTGGGCTTGGNONE 
J065167A15AGGTGGGCTTGGNONE 
J075018F02AGGTGGGCTTGGNONE 
J075063F20AGGTGGGCTTGGNONE 
J075064F18AGGTGGGCTTGGNONE 
J075066N19AGGTGGGCTTGGNONE 
J075073I02AGGTGGGCTTGGNONE 
J075080P17AGGTGGGCTTGGNONE 
J075081F11AGGTGGGCTTGGNONE 
J075085E03AGGTGGGCTTGGNONE 
J075101G18AGGTGGGCTTGGNONE 
J075149N08AGGTGGGCTTGGNONE 
J075158I21AGGTGGGCTTGGNONE 
J075161M20AGGTGGGCTTGGNONE 
J075190F12AGGTGGGCTTGGNONE 
J075194K16AGGTGGGCTTGGNONE 
J080001E08AGGTGGGCTTGGNONE 
J080001F21AGGTGGGCTTGGNONE 
J080001H19AGGTGGGCTTGGNONE 
J080001O15AGGTGGGCTTGGNONE 
J080005I22AGGTGGGCTTGGNONE 
J080006K23AGGTGGGCTTGGNONE 
J080014D20AGGTGGGCTTGGNONE 
J080014I05AGGTGGGCTTGGNONE 
J080014K21AGGTGGGCTTGGNONE 
J080017I24AGGTGGGCTTGGNONE 
J080017K11AGGTGGGCTTGGNONE 
J080018F11AGGTGGGCTTGGNONE 
J080022L18AGGTGGGCTTGGNONE 
J080024N23AGGTGGGCTTGGNONE 
J080027J23AGGTGGGCTTGGNONE 
J080029B14AGGTGGGCTTGGNONE 
J080032F14AGGTGGGCTTGGNONE 
J080032K19AGGTGGGCTTGGNONE 
J080032O21AGGTGGGCTTGGNONE 
J080033P17AGGTGGGCTTGGNONE 
J080034I06AGGTGGGCTTGGNONE 
J080039F24AGGTGGGCTTGGNONE 
J080040O13AGGTGGGCTTGGNONE 
J080042B02AGGTGGGCTTGGNONE 
J080043E12AGGTGGGCTTGGNONE 
J080043J15AGGTGGGCTTGGNONE 
J080043N09AGGTGGGCTTGGNONE 
J080052J08AGGTGGGCTTGGNONE 
J080053K01AGGTGGGCTTGGNONE 
J080053K19AGGTGGGCTTGGNONE 
J080055J09AGGTGGGCTTGGNONE 
J080058D07AGGTGGGCTTGGNONE 
J080062F11AGGTGGGCTTGGNONE 
J080063J24AGGTGGGCTTGGNONE 
J080066H04AGGTGGGCTTGGNONE 
J080066I09AGGTGGGCTTGGNONE 
J080067B02AGGTGGGCTTGGNONE 
J080067N09AGGTGGGCTTGGNONE 
J080068D22AGGTGGGCTTGGNONE 
J080068K13AGGTGGGCTTGGNONE 
J080069N19AGGTGGGCTTGGNONE 
J080070D07AGGTGGGCTTGGNONE 
J080070E05AGGTGGGCTTGGNONE 
J080071G04AGGTGGGCTTGGNONE 
J080077G05AGGTGGGCTTGGNONE 
J080077O06AGGTGGGCTTGGNONE 
J080085F05AGGTGGGCTTGGNONE 
J080086E07AGGTGGGCTTGGNONE 
J080089G16AGGTGGGCTTGGNONE 
J080092K15AGGTGGGCTTGGNONE 
J080094A08AGGTGGGCTTGGNONE 
J080097A09AGGTGGGCTTGGNONE 
J080097J07AGGTGGGCTTGGNONE 
J090027N01AGGTGGGCTTGGNONE 
J090081J05AGGTGGGCTTGGNONE 
Os05g0121000009-181-E02CAAGCCCACNONE 
AK058867CAAGCCCACNONE 
AK071341CAAGCCCACProtein of unknown function DUF1218 family protein. 
J023024H24CAAGCCCACNONE 
J023090B22CAAGCCCACNONE 
J023111G15CAAGCCCACNONE 
J023134K14CAAGCCCACNONE 
J033057C05CAAGCCCACNONE 
J033067J15CAAGCCCACNONE 
J033084L15CAAGCCCACNONE 
J033088B04CAAGCCCACNONE 
J043027A08CAAGCCCACNONE 
J043029L03CAAGCCCACNONE 
J053031K22CAAGCCCACNONE 
J053046I01CAAGCCCACNONE 
J053070B05CAAGCCCACNONE 
J053072C10CAAGCCCACNONE 
J065097M22CAAGCCCACNONE 
J065164I17CAAGCCCACNONE 
J075058I08CAAGCCCACNONE 
J075064C09CAAGCCCACNONE 
J080304C16CAAGCCCACNONE 
J080304H16CAAGCCCACNONE 
J080306E17CAAGCCCACNONE 
J080310L03CAAGCCCACNONE 
J080316J07CAAGCCCACNONE 
J080317L23CAAGCCCACNONE 
J080319A10CAAGCCCACNONE 
J090060F01CAAGCCCACNONE 
J100042N16CAAGCCCACNONE 
J100047F05CAAGCCCACNONE 
J100075J19CAAGCCCACNONE 
Os05g0129900AK060436GGTGGGCTTGGTetratricopeptide-like helical domain containing protein. 
AK102515GGTGGGCTTGGNONE 
Os05g0155300AK069217GTGGGCTTTTSimilar to HIRA interacting protein 5. 
Os05g0203800AK111723GAAGCCCACAASimilar to MADS box protein. 
J023023K24GAAGCCCACAANONE 
J023027E19GAAGCCCACAANONE 
Os05g0244600009-176-H11TTATGGGCCCAAATGAAGCCCACNONE 
AK073979TTATGGGCCCAAATGAAGCCCACNucleic acid-binding, OB-fold domain containing protein. 
J065085L13TTATGGGCCCAAATGAAGCCCACNONE 
J065086F22TTATGGGCCCAAATGAAGCCCACNONE 
J065124H03TTATGGGCCCAAATGAAGCCCACNONE 
J065170C22TTATGGGCCCAAATGAAGCCCACNONE 
J065197K01TTATGGGCCCAAATGAAGCCCACNONE 
J075110M09TTATGGGCCCAAATGAAGCCCACNONE 
J090074F17TTATGGGCCCAAATGAAGCCCACNONE 
J100071O17TTATGGGCCCAAATGAAGCCCACNONE 
Os05g0323100AK109472AAAGCCCACARhodanese-like domain containing protein. 
Os05g0387200AK060744CAAGCCCACCAAAAGCCCAAGSimilar to UDP-sulfoquinovose synthase, chloroplast precursor (EC 3.13.1.1) (Sulfite:UDP-glucose sulfotransferase) (Sulfolipid biosynthesis protein) (SoSQD1). 
AK065310CAAGCCCACCAAAAGCCCAAGNONE 
Os05g0401300009-111-H03GTGGGCTTTNONE 
AK060678GTGGGCTTTTwin-arginine translocation pathway signal domain containing protein. 
Os05g0430200J090095K16CAAGCCCACCACNONE 
Os05g0459900AK058918CAAGCCCACAASimilar to 60S ribosomal protein L36-1. 
AK111268CAAGCCCACAANONE 
J013129N08CAAGCCCACAANONE 
J065191E01CAAGCCCACAANONE 
J065216P03CAAGCCCACAANONE 
J075089K21CAAGCCCACAANONE 
Os05g0486200009-099-B03CAAGCCCACACNONE 
AK121022CAAGCCCACACConserved hypothetical protein. 
J023049I09CAAGCCCACACNONE 
J033029N07CAAGCCCACACNONE 
J075074I18CAAGCCCACACNONE 
Os05g0534400AK101368GGTGGGCTTGSimilar to Calcineurin B-like protein 4 (SALT OVERLY SENSITIVE 3 protein). 
J033035L13GGTGGGCTTGNONE 
J065045H07GGTGGGCTTGNONE 
Os05g0554100AK073023GTGGGCTTCRibosomal protein L7/L12 family protein. 
AK101756GTGGGCTTCNONE 
Os05g0565000AK102673GAAGCCCACGGCCCATTASimilar to 60S ribosomal protein L18a-1. 
J033102C12GAAGCCCACGGCCCATTANONE 
J033124C13GAAGCCCACGGCCCATTANONE 
J043003L04GAAGCCCACGGCCCATTANONE 
J043006N08GAAGCCCACGGCCCATTANONE 
Os05g0568800006-084-D04CAGGTGGGCTTGGGCCGCANONE 
009-009-B11CAGGTGGGCTTGGGCCGCANONE 
009-014-E10CAGGTGGGCTTGGGCCGCANONE 
009-107-C04CAGGTGGGCTTGGGCCGCANONE 
009-133-H08CAGGTGGGCTTGGGCCGCANONE 
AK059883CAGGTGGGCTTGGGCCGCAProtein of unknown function DUF1645 family protein. 
Os05g0571600Os05g0571600GGTGGGCTTCConserved hypothetical protein. 
Os05g0593100AK061855AGGTGGGCTTANONE 
AK100119AGGTGGGCTTASimilar to Vacuolar ATP synthase subunit C (EC 3.6.3.14) (V-ATPase C subunit) (Vacuolar proton pump C subunit). 
AY224442AGGTGGGCTTANONE 
Os05g0596600AK107823GTGGGCTTCNONE 
AK121149GTGGGCTTCSimilar to SMC5 protein. 
Os06g0111700011-090-A02CAAGGCCCACCAAAGCCCACACNONE 
AK063401CAAGGCCCACCAAAGCCCACACTetratricopeptide-like helical domain containing protein. 
Os06g0112800J090052L21AGGTGGGCTTTNONE 
Os06g0115400AK111656GAAGCCCAAAGCCCACASimilar to Superoxide dismutase [Fe], chloroplast (EC 1.15.1.1) (Fragment). 
Os06g0187900009-171-C09TAAGCCCACNONE 
AK063879TAAGCCCACNONE 
AK071765TAAGCCCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023112N11TAAGCCCACNONE 
J033098E13TAAGCCCACNONE 
J100036J11TAAGCCCACNONE 
J100047B19TAAGCCCACNONE 
Os06g0298500AK108252AAAAGCCCACCAConserved hypothetical protein. 
J065144C04AAAAGCCCACCANONE 
J075054P09AAAAGCCCACCANONE 
J075165A13AAAAGCCCACCANONE 
J075172E10AAAAGCCCACCANONE 
Os06g0309000AK121021ACGTGGGCTTTTZinc finger, FYVE/PHD-type domain containing protein. 
Os06g0600100AK065619AAAAGCCCACGAAGCCCAACASimilar to TAT-binding protein homolog (Fragment). 
Os06g0603400AK060002TAAGCCCACANONE 
AK060002TAAGCCCACANONE 
AK102325TAAGCCCACANONE 
AK102325TAAGCCCACANONE 
AK106905TAAGCCCACASimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
AK106905TAAGCCCACASimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
J090039I22TAAGCCCACANONE 
J090039I22TAAGCCCACANONE 
J100022N15TAAGCCCACANONE 
J100022N15TAAGCCCACANONE 
J100023E09TAAGCCCACANONE 
J100023E09TAAGCCCACANONE 
J100052D21TAAGCCCACANONE 
J100052D21TAAGCCCACANONE 
Os06g0643000AK067701GTGTGGGCTTGPhox-like domain containing protein. 
J013032G04GTGTGGGCTTGNONE 
J013044B17GTGTGGGCTTGNONE 
J013114M13GTGTGGGCTTGNONE 
J023133A02GTGTGGGCTTGNONE 
J043022A07GTGTGGGCTTGNONE 
J075046O21GTGTGGGCTTGNONE 
J075142L01GTGTGGGCTTGNONE 
J090076I16GTGTGGGCTTGNONE 
J100056O17GTGTGGGCTTGNONE 
Os06g0644100006-034-H12GAAGCCCACAANONE 
009-111-A04GAAGCCCACAANONE 
009-153-H08GAAGCCCACAANONE 
AK059777GAAGCCCACAACarboxypeptidase regulatory region domain containing protein. 
J023011D18GAAGCCCACAANONE 
J043030D15GAAGCCCACAANONE 
J053079B12GAAGCCCACAANONE 
J053079F07GAAGCCCACAANONE 
J065006C11GAAGCCCACAANONE 
J065007D15GAAGCCCACAANONE 
J065012C09GAAGCCCACAANONE 
J065019J01GAAGCCCACAANONE 
J065034K17GAAGCCCACAANONE 
J065040M09GAAGCCCACAANONE 
J065059B09GAAGCCCACAANONE 
J065070A22GAAGCCCACAANONE 
J065099A13GAAGCCCACAANONE 
J065141F08GAAGCCCACAANONE 
J065152G12GAAGCCCACAANONE 
J065181I04GAAGCCCACAANONE 
J065198E17GAAGCCCACAANONE 
J065201N23GAAGCCCACAANONE 
J065202M07GAAGCCCACAANONE 
J065208F11GAAGCCCACAANONE 
J090031B20GAAGCCCACAANONE 
J090099B14GAAGCCCACAANONE 
J100032C05GAAGCCCACAANONE 
J100057O07GAAGCCCACAANONE 
J100077M07GAAGCCCACAANONE 
J100081E21GAAGCCCACAANONE 
Os06g0666800AK103209CCAAGCCCACATGGGCCAANONE 
AK107710CCAAGCCCACATGGGCCAAConserved hypothetical protein. 
Os06g0683400009-047-C07GAAGCCCACCACNONE 
009-060-B06GAAGCCCACCACNONE 
013-057-F12GAAGCCCACCACNONE 
AK111852GAAGCCCACCACNONE 
AK111897GAAGCCCACCACNONE 
AK112082GAAGCCCACCACSimilar to EF-hand Ca2+-binding protein CCD1. 
J065104C07GAAGCCCACCACNONE 
J065187J11GAAGCCCACCACNONE 
J065197L08GAAGCCCACCACNONE 
J100045K14GAAGCCCACCACNONE 
J100074M08GAAGCCCACCACNONE 
J100088H21GAAGCCCACCACNONE 
Os06g0709300AK108588ACGTGGGCTTGFAR1 domain containing protein. 
Os06g0711600016-047-G09GAAGCCCACCACNONE 
AK064384GAAGCCCACCACmRNA splicing factor SYF2 family protein. 
AK102831GAAGCCCACCACNONE 
J013072P18GAAGCCCACCACNONE 
J023049G01GAAGCCCACCACNONE 
J023088I01GAAGCCCACCACNONE 
J033023I22GAAGCCCACCACNONE 
J033106I12GAAGCCCACCACNONE 
J033109G07GAAGCCCACCACNONE 
J065030F22GAAGCCCACCACNONE 
J065132H19GAAGCCCACCACNONE 
J080301D07GAAGCCCACCACNONE 
J080305C09GAAGCCCACCACNONE 
J080312C03GAAGCCCACCACNONE 
J080313I15GAAGCCCACCACNONE 
J080315B09GAAGCCCACCACNONE 
J090056N21GAAGCCCACCACNONE 
J100027B07GAAGCCCACCACNONE 
Os07g0100200006-022-D06AAAGCCCACGGNONE 
011-025-B06AAAGCCCACGGNONE 
012-069-A07AAAGCCCACGGNONE 
AK060986AAAGCCCACGGNONE 
AK073305AAAGCCCACGGSimilar to PDX1-like protein 4. 
J023055C05AAAGCCCACGGNONE 
J033024J11AAAGCCCACGGNONE 
J065045F14AAAGCCCACGGNONE 
J075097C22AAAGCCCACGGNONE 
Os07g0122300015-004-G08CTTGGGCCTCTGTGGGCTTGNONE 
AK103212CTTGGGCCTCTGTGGGCTTGNONE 
AK119295CTTGGGCCTCTGTGGGCTTGProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09CTTGGGCCTCTGTGGGCTTGNONE 
J090007P13CTTGGGCCTCTGTGGGCTTGNONE 
Os07g0185700012-040-A11CAAGCCCACCACNONE 
AK070572CAAGCCCACCACConserved hypothetical protein. 
J065116D10CAAGCCCACCACNONE 
J065122F20CAAGCCCACCACNONE 
Os07g0242600AK065752AGCCCATTTAAGCCCACACyclin-like F-box domain containing protein. 
J013037K22AGCCCATTTAAGCCCACANONE 
Os07g0272800AK107279GTTTGGGCCAAGCCCACGAAHypothetical protein. 
J065124H15GTTTGGGCCAAGCCCACGAANONE 
Os07g0296900J075050I18CCAAGCCCACGAConserved hypothetical protein. 
Os07g0569800AK108637CCAAGCCCACCACConcanavalin A-like lectin/glucanase domain containing protein. 
Os07g0570700AK065242AGTTGGGCCCAAGCCCACGTGRibosome recycling factor family protein. 
J013002I12AGTTGGGCCCAAGCCCACGTGNONE 
Os07g0577400AK100831TTGTGGGCTTGNONE 
J013095B12TTGTGGGCTTGNONE 
J023123D09TTGTGGGCTTGNONE 
J065002E19TTGTGGGCTTGNONE 
J065135H07TTGTGGGCTTGNONE 
J065150N01TTGTGGGCTTGNONE 
Os07g0594400J065137M02ACGTGGGCTTGGGCCACGGGCCGAConserved hypothetical protein. 
J065218E03ACGTGGGCTTGGGCCACGGGCCGANONE 
Os07g0607200AK065746CCAAGCCCACGGCCCAACCProtein of unknown function DUF751 family protein. 
J065037B15CCAAGCCCACGGCCCAACCNONE 
J065042E20CCAAGCCCACGGCCCAACCNONE 
J065161I08CCAAGCCCACGGCCCAACCNONE 
Os07g0618500AK068210GGTGTGTGGGCTTAGGGCCGTGNONE 
AK068975GGTGTGTGGGCTTAGGGCCGTGSimilar to Dihydropterin pyrophosphokinase /dihydropteroate synthase precursor (EC 2.5.1.15). 
J013147H17GGTGTGTGGGCTTAGGGCCGTGNONE 
J013170L10GGTGTGTGGGCTTAGGGCCGTGNONE 
J023061I07GGTGTGTGGGCTTAGGGCCGTGNONE 
J043024N01GGTGTGTGGGCTTAGGGCCGTGNONE 
Os07g0627700AK070893AAAAGCCCACAASterol desaturase family protein. 
AK110696AAAAGCCCACAANONE 
J065068I04AAAAGCCCACAANONE 
J065121P07AAAAGCCCACAANONE 
Os07g0673500005-016-H01TCTGGGCCCACGAAAGCCCACACGNONE 
AK072839TCTGGGCCCACGAAAGCCCACACGNONE 
AK106176TCTGGGCCCACGAAAGCCCACACGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J013030G14TCTGGGCCCACGAAAGCCCACACGNONE 
J013153M24TCTGGGCCCACGAAAGCCCACACGNONE 
J023129E21TCTGGGCCCACGAAAGCCCACACGNONE 
J023141I23TCTGGGCCCACGAAAGCCCACACGNONE 
J033069A22TCTGGGCCCACGAAAGCCCACACGNONE 
J075021G17TCTGGGCCCACGAAAGCCCACACGNONE 
J075022B06TCTGGGCCCACGAAAGCCCACACGNONE 
J075049O15TCTGGGCCCACGAAAGCCCACACGNONE 
J075060O14TCTGGGCCCACGAAAGCCCACACGNONE 
J075073G03TCTGGGCCCACGAAAGCCCACACGNONE 
J075095D13TCTGGGCCCACGAAAGCCCACACGNONE 
J075120M18TCTGGGCCCACGAAAGCCCACACGNONE 
J075130D09TCTGGGCCCACGAAAGCCCACACGNONE 
J075152C20TCTGGGCCCACGAAAGCCCACACGNONE 
J075158L19TCTGGGCCCACGAAAGCCCACACGNONE 
J075199P18TCTGGGCCCACGAAAGCCCACACGNONE 
J090011K21TCTGGGCCCACGAAAGCCCACACGNONE 
J090078O10TCTGGGCCCACGAAAGCCCACACGNONE 
Os08g0101600AB074260TGTTGGGCCGGCGTGGGCTTGSingle-strand DNA endonuclease-1. 
AK102542TGTTGGGCCGGCGTGGGCTTGNONE 
Os08g0133000006-050-B01AAAGCCCACNONE 
006-068-G03AAAGCCCACNONE 
AK061574AAAGCCCACNONE 
AK099391AAAGCCCACProtein of unknown function DUF1637 family protein. 
J065108C24AAAGCCCACNONE 
J075075K24AAAGCCCACNONE 
J075092A19AAAGCCCACNONE 
J100061O19AAAGCCCACNONE 
Os08g0172300AK111274AAAAGCCCACHAT dimerisation domain containing protein. 
J065184J06AAAAGCCCACNONE 
Os08g0327400AK070992AAAAGCCCACCSimilar to Enoyl-ACP reductase (Fragment). 
J023077K10AAAAGCCCACCNONE 
J065075F06AAAAGCCCACCNONE 
J065112N14AAAAGCCCACCNONE 
J090028K07AAAAGCCCACCNONE 
J090039C15AAAAGCCCACCNONE 
J090048I11AAAAGCCCACCNONE 
J090083M10AAAAGCCCACCNONE 
Os08g0379000AK105647CCAAGCCCACCProtein prenyltransferase domain containing protein. 
Os08g0416000AF145729TAAGCCCACGCHomeodomain leucine zipper protein. 
AK100634TAAGCCCACGCNONE 
AK101569TAAGCCCACGCNONE 
AK110561TAAGCCCACGCNONE 
J013074A01TAAGCCCACGCNONE 
J013159K22TAAGCCCACGCNONE 
J023028M01TAAGCCCACGCNONE 
J023033C15TAAGCCCACGCNONE 
J023107N23TAAGCCCACGCNONE 
J023110A12TAAGCCCACGCNONE 
J023122D02TAAGCCCACGCNONE 
J033050G15TAAGCCCACGCNONE 
J033107D17TAAGCCCACGCNONE 
J065082J21TAAGCCCACGCNONE 
J065165L21TAAGCCCACGCNONE 
J065171J17TAAGCCCACGCNONE 
J100026K13TAAGCCCACGCNONE 
J100039E16TAAGCCCACGCNONE 
J100056J11TAAGCCCACGCNONE 
J100070I19TAAGCCCACGCNONE 
J100073B16TAAGCCCACGCNONE 
J100081M19TAAGCCCACGCNONE 
J100088E09TAAGCCCACGCNONE 
Os08g0476000AK066585GAAGCCCACCCNONE 
Os08g0480400J065154C22TAAGCCCACGGNONE 
J065214F15TAAGCCCACGGProtein of unknown function DUF1637 family protein. 
Os08g0500900AK102314GGTGGGCTTGGSimilar to Phosphoribosylglycinamide formyltransferase, chloroplast precursor (EC 2.1.2.2) (GART) (GAR transformylase) (5'-phosphoribosylglycinamide transformylase). 
Os08g0525600AK103172GAAGCCCACCACSimilar to Peptidylprolyl isomerase; FK506-binding protein. 
Os08g0529400J100040D07GTGGGCTTCCyclin-like F-box domain containing protein. 
Os08g0548900006-043-D07GTGGGCTTCNONE 
006-043-H11GTGGGCTTCNONE 
006-081-G06GTGGGCTTCNONE 
006-109-E04GTGGGCTTCNONE 
011-033-E04GTGGGCTTCNONE 
AK061808GTGGGCTTCSimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK098875GTGGGCTTCNONE 
J013001D12GTGGGCTTCNONE 
J033126N14GTGGGCTTCNONE 
J053069M09GTGGGCTTCNONE 
J053098E10GTGGGCTTCNONE 
J053101C24GTGGGCTTCNONE 
J065002F21GTGGGCTTCNONE 
J065006C22GTGGGCTTCNONE 
J065076J02GTGGGCTTCNONE 
J065134M22GTGGGCTTCNONE 
J075007M19GTGGGCTTCNONE 
J075040I11GTGGGCTTCNONE 
J075047E20GTGGGCTTCNONE 
J075052D22GTGGGCTTCNONE 
J075076L13GTGGGCTTCNONE 
J075157P22GTGGGCTTCNONE 
J075161M18GTGGGCTTCNONE 
J075168P22GTGGGCTTCNONE 
J075181E04GTGGGCTTCNONE 
U92540GTGGGCTTCNONE 
Os09g0306700J023045A19AAAAGCCCACCTNONE 
Os09g0324300AK109691TTATGGGCCGCCGTGGGCTTTCyclin-like F-box domain containing protein. 
Os09g0344700J080011F14GAAGCCCACNONE 
J080011G13GAAGCCCACNONE 
J080016C06GAAGCCCACNONE 
J080034K13GAAGCCCACNONE 
J080043N08GAAGCCCACNONE 
J080068E01GAAGCCCACConserved hypothetical protein. 
J080068L12GAAGCCCACNONE 
J080071N01GAAGCCCACNONE 
J080075D11GAAGCCCACNONE 
J080076D14GAAGCCCACNONE 
J080093L23GAAGCCCACNONE 
J080093N22GAAGCCCACNONE 
Os09g0370300AK108199AAAGCCCACCSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0401200AK063980GGAGTGGGCTTTSimilar to HSP associated protein like. 
Os09g0461500006-107-E02AAAGCCCACCACNONE 
011-089-D02AAAGCCCACCACNONE 
AK063400AAAGCCCACCACNONE 
AK102328AAAGCCCACCACEsterase/lipase/thioesterase domain containing protein. 
J033090L22AAAGCCCACCACNONE 
J065031O14AAAGCCCACCACNONE 
J065083D22AAAGCCCACCACNONE 
J065182N14AAAGCCCACCACNONE 
J065190H22AAAGCCCACCACNONE 
J065219H11AAAGCCCACCACNONE 
J075007O22AAAGCCCACCACNONE 
J075025E09AAAGCCCACCACNONE 
J075041K24AAAGCCCACCACNONE 
J075046F11AAAGCCCACCACNONE 
J090032E12AAAGCCCACCACNONE 
Os09g0465800009-106-E01AAAAGCCCACNONE 
AK062785AAAAGCCCACConserved hypothetical protein. 
J065122K21AAAAGCCCACNONE 
Os09g0495200AK102989CTTGGGCCAAGTGGGCTTTConserved hypothetical protein. 
J075062H18CTTGGGCCAAGTGGGCTTTNONE 
J075098G06CTTGGGCCAAGTGGGCTTTNONE 
Os09g0502200AK102600AAAGCCCACASimilar to Beta-1,3-glucanase (Fragment). 
AK121879AAAGCCCACANONE 
J100061G20AAAGCCCACANONE 
Os09g0517800012-034-H10AAAGCCCACANONE 
AK121391AAAGCCCACACyclin-like F-box domain containing protein. 
J023129D04AAAGCCCACANONE 
J043012D11AAAGCCCACANONE 
Os09g0533900003-104-E05AAAGCCCACGCGAGCCCATCCNONE 
012-076-C03AAAGCCCACGCGAGCCCATCCNONE 
AK067774AAAGCCCACGCGAGCCCATCCNONE 
AK100449AAAGCCCACGCGAGCCCATCCSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07AAAGCCCACGCGAGCCCATCCNONE 
J023026E11AAAGCCCACGCGAGCCCATCCNONE 
J023028B20AAAGCCCACGCGAGCCCATCCNONE 
J023050P11AAAGCCCACGCGAGCCCATCCNONE 
J023052K08AAAGCCCACGCGAGCCCATCCNONE 
J023075J03AAAGCCCACGCGAGCCCATCCNONE 
J023078E15AAAGCCCACGCGAGCCCATCCNONE 
J023090P12AAAGCCCACGCGAGCCCATCCNONE 
J023120E01AAAGCCCACGCGAGCCCATCCNONE 
J023142K01AAAGCCCACGCGAGCCCATCCNONE 
J033027K23AAAGCCCACGCGAGCCCATCCNONE 
J033058A09AAAGCCCACGCGAGCCCATCCNONE 
J033058C12AAAGCCCACGCGAGCCCATCCNONE 
J033125A04AAAGCCCACGCGAGCCCATCCNONE 
J043040L01AAAGCCCACGCGAGCCCATCCNONE 
J053061D06AAAGCCCACGCGAGCCCATCCNONE 
J053096N13AAAGCCCACGCGAGCCCATCCNONE 
J065193H10AAAGCCCACGCGAGCCCATCCNONE 
J090075L17AAAGCCCACGCGAGCCCATCCNONE 
J100050D10AAAGCCCACGCGAGCCCATCCNONE 
Os11g0114700AK065865AAAAGCCCACGANONE 
AK066583AAAAGCCCACGANONE 
AK070834AAAAGCCCACGAPAP/25A core domain containing protein. 
AK072543AAAAGCCCACGANONE 
Os11g0127600015-021-H02TTGTGGGCTTCNONE 
016-038-B06TTGTGGGCTTCNONE 
016-079-H06TTGTGGGCTTCNONE 
016-085-G02TTGTGGGCTTCNONE 
016-086-C02TTGTGGGCTTCNONE 
AK067922TTGTGGGCTTCNo apical meristem (NAM) protein domain containing protein. 
J013121J10TTGTGGGCTTCNONE 
Os11g0132700AK103286TTGTGGGCTTCCGGCCCAAATCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0171700015-007-C07GAAGCCCACNONE 
AK064084GAAGCCCACNONE 
Os11g0207000AK062074TTGTGGGCTTGNONE 
Os11g0297900AK067692CAGGTGGGCTTASimilar to Txnl4b protein. 
J013118F01CAGGTGGGCTTANONE 
J023066E22CAGGTGGGCTTANONE 
J023066E24CAGGTGGGCTTANONE 
Os11g0481600AK109900GAAGCCCACGGConserved hypothetical protein. 
Os11g0575600AK073570TAAGCCCACAASimilar to Lipoxygenase (Fragment). 
Os12g0112250J013069O10GAAGCCCACASaposin B domain containing protein. 
J065206G04GAAGCCCACANONE 
J080302C06GAAGCCCACANONE 
J080306K06GAAGCCCACANONE 
J080307O09GAAGCCCACANONE 
J080310J07GAAGCCCACANONE 
J080311G18GAAGCCCACANONE 
J080318C07GAAGCCCACANONE 
Os12g0131300J090086B06TTGTGGGCTTCCGGCCCAAATHypothetical protein. 
Os12g0133600AK103096ACGTGGGCTTTConserved hypothetical protein. 
J033118M03ACGTGGGCTTTNONE 
Os12g0150100009-047-B11GAAGCCCACANONE 
009-047-B11GAAGCCCACAANONE 
AK105075GAAGCCCACASimilar to 60S ribosomal protein L26A. 
AK105075GAAGCCCACAASimilar to 60S ribosomal protein L26A. 
J013067G22GAAGCCCACANONE 
J013067G22GAAGCCCACAANONE 
J033103F08GAAGCCCACANONE 
J033103F08GAAGCCCACAANONE 
J065029P11GAAGCCCACANONE 
J065029P11GAAGCCCACAANONE 
J065043B18GAAGCCCACANONE 
J065043B18GAAGCCCACAANONE 
J065123E16GAAGCCCACANONE 
J065123E16GAAGCCCACAANONE 
J065141O20GAAGCCCACANONE 
J065141O20GAAGCCCACAANONE 
J065161O04GAAGCCCACANONE 
J065161O04GAAGCCCACAANONE 
J065201M07GAAGCCCACANONE 
J065201M07GAAGCCCACAANONE 
J075058I23GAAGCCCACANONE 
J075058I23GAAGCCCACAANONE 
J075172J08GAAGCCCACANONE 
J075172J08GAAGCCCACAANONE 
J100040L13GAAGCCCACANONE 
J100040L13GAAGCCCACAANONE 
Os12g0175700AK069143ATCCGACGGCCGTCCAAGCCCACCCGNonaspanin (TM9SF) family protein. 
Os12g0278900AK106816GAAGCCCACAAPeptidase C1A, papain family protein. 
Os12g0294100AK111535CAAGCCCACWD40-like domain containing protein. 
J013030D09CAAGCCCACNONE 
J013153J16CAAGCCCACNONE 
J033079N17CAAGCCCACNONE 
J090002M14CAAGCCCACNONE 
J090071M08CAAGCCCACNONE 
J090090E07CAAGCCCACNONE 
Os12g0442700AK111062AGGTGGGCTTTTHypothetical protein. 
J065080H14AGGTGGGCTTTTNONE 
J075019H22AGGTGGGCTTTTNONE 
J075088M09AGGTGGGCTTTTNONE 
Os12g0562300AK061984AGAGTGGGCTTTSmr protein/MutS2 C-terminal domain containing protein. 
Os12g0565800AK072828AAAGCCCACZinc finger, TTF-type domain containing protein. 
Os12g0569500AK066624CGTGGGCTTTThaumatin, pathogenesis-related family protein. 
J065041B03CGTGGGCTTTNONE 
J065046P11CGTGGGCTTTNONE 
J075140J11CGTGGGCTTTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.