version

Summary of OsREG428 (All List)

OrganismOryza sativa  
IDOsREG428  
SequenceAAGCCCAG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count858  

Entry Sequences (858 entries)

LocusGene modelSequenceDescription
Os01g0141600016-051-A03ATCTGGGCTTTNONE 
AK066922ATCTGGGCTTTProtein of unknown function DUF647 family protein. 
Os01g0172400AK065102TAAGCCCAGNONE 
AK100365TAAGCCCAGNONE 
AK119523TAAGCCCAGNONE 
D73411TAAGCCCAGPhospholipase D alpha 1 precursor (EC 3.1.4.4) (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1). 
J013001N03TAAGCCCAGNONE 
J013052B12TAAGCCCAGNONE 
J013071F15TAAGCCCAGNONE 
J013108F19TAAGCCCAGNONE 
J023025E17TAAGCCCAGNONE 
J023083O10TAAGCCCAGNONE 
J023084M17TAAGCCCAGNONE 
J023100D16TAAGCCCAGNONE 
J023107O10TAAGCCCAGNONE 
J023119F08TAAGCCCAGNONE 
J033035B07TAAGCCCAGNONE 
J033052C18TAAGCCCAGNONE 
J033092H11TAAGCCCAGNONE 
J033096D02TAAGCCCAGNONE 
J033117A16TAAGCCCAGNONE 
J043010E08TAAGCCCAGNONE 
J043013C12TAAGCCCAGNONE 
J065001M15TAAGCCCAGNONE 
J065021O11TAAGCCCAGNONE 
J065089O20TAAGCCCAGNONE 
J065117N05TAAGCCCAGNONE 
J065129L11TAAGCCCAGNONE 
J065170F18TAAGCCCAGNONE 
J090066E11TAAGCCCAGNONE 
J090076N24TAAGCCCAGNONE 
J090093G21TAAGCCCAGNONE 
J100041H17TAAGCCCAGNONE 
J100050D07TAAGCCCAGNONE 
J100063A06TAAGCCCAGNONE 
Os01g0191100009-011-A02CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-028-D05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-058-B11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-151-D09CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-026-G03CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-063-F04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-069-B05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-029-E04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-072-H04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-089-E09CCACCTGTGGGCCTTCTGGGCTTTTNONE 
015-047-G05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
016-033-G06CCACCTGTGGGCCTTCTGGGCTTTTNONE 
AK058815CCACCTGTGGGCCTTCTGGGCTTTTSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023077K21CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023081F19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033052N11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033058N11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033114G05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033114O17CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033129L14CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J053029I12CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065067N19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065084I19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065099O03CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065201I08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075035B08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075037B22CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075054L16CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075059D15CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075164I08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075185J01CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090042O06CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090044F12CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090063L02CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090073I10CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090078E18CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J100072K16CCACCTGTGGGCCTTCTGGGCTTTTNONE 
Os01g0357400012-030-F01CAAGCCCAGCCNONE 
012-045-H02CAAGCCCAGCCNONE 
AK063489CAAGCCCAGCCSimilar to Alpha-amylase. 
D10417CAAGCCCAGCCNONE 
Os01g0571200014-074-A10GGCTGGGCTTGNONE 
AK121299GGCTGGGCTTGSimilar to Ribosomal protein L34. 
J023110L12GGCTGGGCTTGNONE 
Os01g0590300014-089-E04AAAAGCCCAGCNONE 
AK063740AAAAGCCCAGCConserved hypothetical protein. 
Os01g0623600011-011-B08CAAGCCCAGNONE 
011-052-G08CAAGCCCAGNONE 
AK103106CAAGCCCAGNONE 
J033023J06CAAGCCCAGNONE 
J033036F02CAAGCCCAGNONE 
J033057J05CAAGCCCAGNONE 
J033074C10CAAGCCCAGNONE 
J033106K18CAAGCCCAGNONE 
J033118O22CAAGCCCAGNONE 
J033120G01CAAGCCCAGNONE 
J033120P07CAAGCCCAGSimilar to Polygalacturonase precursor (EC 3.2.1.15) (PG) (Pectinase). 
J033132C08CAAGCCCAGNONE 
J033136L24CAAGCCCAGNONE 
Os01g0633000006-075-A01AAAGCCCAGCCNONE 
009-064-A11AAAGCCCAGCCNONE 
009-153-F07AAAGCCCAGCCNONE 
AK062051AAAGCCCAGCCSimilar to 50S ribosomal protein L31. 
J013073B08AAAGCCCAGCCNONE 
J065006K19AAAGCCCAGCCNONE 
J065053P08AAAGCCCAGCCNONE 
J065057D08AAAGCCCAGCCNONE 
J065086P07AAAGCCCAGCCNONE 
J065095C14AAAGCCCAGCCNONE 
J065116B05AAAGCCCAGCCNONE 
J065164L20AAAGCCCAGCCNONE 
J065185K19AAAGCCCAGCCNONE 
J065191E21AAAGCCCAGCCNONE 
J065199P21AAAGCCCAGCCNONE 
J065216M12AAAGCCCAGCCNONE 
J075002M09AAAGCCCAGCCNONE 
J075016N10AAAGCCCAGCCNONE 
J075041K05AAAGCCCAGCCNONE 
J075094E04AAAGCCCAGCCNONE 
J075154O04AAAGCCCAGCCNONE 
J075176D22AAAGCCCAGCCNONE 
J075186M09AAAGCCCAGCCNONE 
J075191H20AAAGCCCAGCCNONE 
Os01g0640800AK065688CAAGCCCAGConserved hypothetical protein 48 family protein. 
J013042L10CAAGCCCAGNONE 
J013121H08CAAGCCCAGNONE 
Os01g0643900AK108288TAAGCCCAGTAOleosin family protein. 
Os01g0663400016-054-B01CAAGCCCAGNONE 
AK072283CAAGCCCAGSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
AK072645CAAGCCCAGNONE 
J065180A21CAAGCCCAGNONE 
J075026E13CAAGCCCAGNONE 
J075109M23CAAGCCCAGNONE 
J075151A02CAAGCCCAGNONE 
J090004B07CAAGCCCAGNONE 
J090023O22CAAGCCCAGNONE 
J090054G09CAAGCCCAGNONE 
J090058H13CAAGCCCAGNONE 
J090076G13CAAGCCCAGNONE 
J100057F11CAAGCCCAGNONE 
Os01g0686300014-073-D12AAAGCCCAGNONE 
016-075-E10AAAGCCCAGNONE 
AK109457AAAGCCCAGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os01g0706400AK065826CTGGGCTTCNONE 
AK066981CTGGGCTTCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK068355CTGGGCTTCNONE 
J013036F01CTGGGCTTCNONE 
J013049K18CTGGGCTTCNONE 
J013092D23CTGGGCTTCNONE 
J013100B17CTGGGCTTCNONE 
J033096D22CTGGGCTTCNONE 
J033108P15CTGGGCTTCNONE 
J033119E24CTGGGCTTCNONE 
J075169P09CTGGGCTTCNONE 
Os01g0736400AK069723GGCTGGGCTTGGNONE 
AK100689GGCTGGGCTTGGAminotransferase, class I and II domain containing protein. 
Os01g0749200006-074-H04TGTGGGCTGCAAAGCCCAGCNONE 
AK072760TGTGGGCTGCAAAGCCCAGCNONE 
AK099041TGTGGGCTGCAAAGCCCAGCNONE 
AK104146TGTGGGCTGCAAAGCCCAGCSimilar to 50S ribosomal protein L13. 
AK119189TGTGGGCTGCAAAGCCCAGCNONE 
Os01g0773600AK067004CAAGCCCAGGlycoside hydrolase, family 47 protein. 
J013091F09CAAGCCCAGNONE 
J013134K14CAAGCCCAGNONE 
J013158J15CAAGCCCAGNONE 
J033060O20CAAGCCCAGNONE 
J033074C16CAAGCCCAGNONE 
J075086F05CAAGCCCAGNONE 
J075150H08CAAGCCCAGNONE 
J090006E02CAAGCCCAGNONE 
J090074E02CAAGCCCAGNONE 
J100030M05CAAGCCCAGNONE 
J100036M16CAAGCCCAGNONE 
J100063H18CAAGCCCAGNONE 
Os01g0874800016-042-F01AAAAGCCCAGCNONE 
AK065916AAAAGCCCAGCNONE 
AK065991AAAAGCCCAGCNONE 
AK103577AAAAGCCCAGCNONE 
AK105063AAAAGCCCAGC5'-3' exonuclease domain containing protein. 
AK119315AAAAGCCCAGCNONE 
J023106C06AAAAGCCCAGCNONE 
J053023A11AAAAGCCCAGCNONE 
J053068H13AAAAGCCCAGCNONE 
J053071O13AAAAGCCCAGCNONE 
J053074M10AAAAGCCCAGCNONE 
Os01g0897300006-029-B03GAAGCCCAGNONE 
006-047-G03GAAGCCCAGNONE 
AK061032GAAGCCCAGRibonuclease T2 family protein. 
AK106167GAAGCCCAGNONE 
J065166D04GAAGCCCAGNONE 
J065195J12GAAGCCCAGNONE 
J075069K20GAAGCCCAGNONE 
Os01g0929500AK111399GAAGCCCAGTASimilar to Carbonyl reductase-like protein. 
AK120263GAAGCCCAGTANONE 
Os01g0939700AK059803CTGGGCTTCNONE 
AK070588CTGGGCTTCSimilar to Esterase D (EC 3.1.1.1). 
AK111469CTGGGCTTCNONE 
J090021L11CTGGGCTTCNONE 
Os01g0949500006-054-G03TACTGGGCTTANONE 
006-095-H01TACTGGGCTTANONE 
006-101-D08TACTGGGCTTANONE 
006-110-A10TACTGGGCTTANONE 
AK068769TACTGGGCTTANONE 
AK070662TACTGGGCTTASimilar to Calmodulin (CaM). 
AK104094TACTGGGCTTANONE 
AK104159TACTGGGCTTANONE 
J065045M16TACTGGGCTTANONE 
J075112E20TACTGGGCTTANONE 
J100074O04TACTGGGCTTANONE 
J100078F05TACTGGGCTTANONE 
Os01g0971600AK070366GAAGCCCAGCSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
Os02g0148600AK059287GCTGGGCTTCConserved hypothetical protein. 
Os02g0150100AK060595GAAGCCCAGCCSimilar to DEAD-box protein abstrakt. 
Os02g0175800009-083-C02CAAGCCCAGNONE 
009-184-H07CAAGCCCAGNONE 
009-199-D07CAAGCCCAGNONE 
AK058292CAAGCCCAGNONE 
AK120215CAAGCCCAGConserved hypothetical protein. 
J013040G12CAAGCCCAGNONE 
J065050N21CAAGCCCAGNONE 
J065077O07CAAGCCCAGNONE 
J065102G05CAAGCCCAGNONE 
J065197A04CAAGCCCAGNONE 
J075024L24CAAGCCCAGNONE 
J075038K01CAAGCCCAGNONE 
J075044L04CAAGCCCAGNONE 
J075063D23CAAGCCCAGNONE 
J075079P13CAAGCCCAGNONE 
J075084G03CAAGCCCAGNONE 
J075135G07CAAGCCCAGNONE 
J075148D17CAAGCCCAGNONE 
J075150F13CAAGCCCAGNONE 
J075157F06CAAGCCCAGNONE 
J090054A05CAAGCCCAGNONE 
J090085O04CAAGCCCAGNONE 
J100023C04CAAGCCCAGNONE 
J100023H23CAAGCCCAGNONE 
J100026A16CAAGCCCAGNONE 
J100035K13CAAGCCCAGNONE 
Os02g0251900AK109286AAAGCCCAGCCCSimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0252100AF139211TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AK062577TACGGCCCATTAAAGCCCAGGCCCAAAASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J013156E01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065001D02TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065042A05TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065116H01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065167P13TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065168N07TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075093G21TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075109H15TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075194P17TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
Os02g0517333AK105573GCTGGGCTTTNONE 
AK111331GCTGGGCTTTConserved hypothetical protein. 
Os02g0519900006-057-B12GGCTGGGCTTTNONE 
006-113-G04GGCTGGGCTTTNONE 
006-119-D01GGCTGGGCTTTNONE 
AK060953GGCTGGGCTTTNONE 
AK068869GGCTGGGCTTTNONE 
AK121453GGCTGGGCTTTNONE 
D21277GGCTGGGCTTTNONE 
D21278GGCTGGGCTTTNONE 
J023002E06GGCTGGGCTTTNONE 
J023106L15GGCTGGGCTTTNONE 
J023142O06GGCTGGGCTTTNONE 
J053089A15GGCTGGGCTTTNONE 
J053091H05GGCTGGGCTTTNONE 
J080303F06GGCTGGGCTTTNONE 
J090003E12GGCTGGGCTTTNONE 
Os02g0577400003-116-C07CTGGGCTTANONE 
AK062584CTGGGCTTAConserved hypothetical protein. 
Os02g0610700014-008-A03GCTGGGCTTGGNONE 
AK059205GCTGGGCTTGGConserved hypothetical protein. 
AK100281GCTGGGCTTGGNONE 
J023074H03GCTGGGCTTGGNONE 
J065002J16GCTGGGCTTGGNONE 
J065032I20GCTGGGCTTGGNONE 
J065076A07GCTGGGCTTGGNONE 
J065142O21GCTGGGCTTGGNONE 
J065203A03GCTGGGCTTGGNONE 
J075017F24GCTGGGCTTGGNONE 
J075017G24GCTGGGCTTGGNONE 
Os02g0677700AK119947AAAGCCCAGNONE 
Os02g0700100AK102954AAAGCCCATAAAGCCCAGCSimilar to WD-repeat protein. 
Os02g0741500AK068867GAAGCCCAGCRibbon-helix-helix domain containing protein. 
Os02g0761100AK070404TAAGCCCAGTASimilar to Cyclophilin-40 (Expressed protein). 
Os02g0765600011-044-C02CAAGCCCAGCCNONE 
011-059-H12CAAGCCCAGCCNONE 
012-010-G07CAAGCCCAGCCNONE 
012-040-D02CAAGCCCAGCCNONE 
012-048-F02CAAGCCCAGCCNONE 
012-055-C12CAAGCCCAGCCNONE 
012-065-C04CAAGCCCAGCCNONE 
012-086-D01CAAGCCCAGCCNONE 
012-099-G02CAAGCCCAGCCNONE 
015-002-D01CAAGCCCAGCCNONE 
015-067-D08CAAGCCCAGCCNONE 
016-060-E08CAAGCCCAGCCNONE 
AK101744CAAGCCCAGCCAlpha-amylase precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase) (Isozyme 1B). 
J033023N15CAAGCCCAGCCNONE 
J033061O03CAAGCCCAGCCNONE 
J033107J03CAAGCCCAGCCNONE 
J033119C02CAAGCCCAGCCNONE 
J043001H07CAAGCCCAGCCNONE 
J043003H07CAAGCCCAGCCNONE 
J043003I05CAAGCCCAGCCNONE 
J043009K22CAAGCCCAGCCNONE 
J043009L08CAAGCCCAGCCNONE 
J043012J02CAAGCCCAGCCNONE 
J043015P13CAAGCCCAGCCNONE 
J043016H11CAAGCCCAGCCNONE 
J043020F17CAAGCCCAGCCNONE 
J053027C06CAAGCCCAGCCNONE 
J053099F07CAAGCCCAGCCNONE 
J065025M06CAAGCCCAGCCNONE 
J065029M17CAAGCCCAGCCNONE 
J065044H20CAAGCCCAGCCNONE 
J065089P12CAAGCCCAGCCNONE 
J065098N21CAAGCCCAGCCNONE 
J065143N20CAAGCCCAGCCNONE 
J065161C24CAAGCCCAGCCNONE 
J065170A09CAAGCCCAGCCNONE 
J065197N16CAAGCCCAGCCNONE 
J065214E11CAAGCCCAGCCNONE 
J065216J23CAAGCCCAGCCNONE 
J100026D11CAAGCCCAGCCNONE 
J100062F01CAAGCCCAGCCNONE 
J100080O15CAAGCCCAGCCNONE 
J100082F09CAAGCCCAGCCNONE 
M24286CAAGCCCAGCCNONE 
Os02g0793000AK070242AAAGCCCAGNONE 
AK099173AAAGCCCAGNONE 
AK105863AAAGCCCAGZinc finger, CCCH-type domain containing protein. 
Os02g0797600004-004-A08CAAGCCCAGNONE 
006-050-H07CAAGCCCAGNONE 
006-092-B02CAAGCCCAGNONE 
006-100-B08CAAGCCCAGNONE 
013-037-D09CAAGCCCAGNONE 
013-068-H02CAAGCCCAGNONE 
AK060857CAAGCCCAGNONE 
AK098882CAAGCCCAGNONE 
AK104474CAAGCCCAGNONE 
AK120644CAAGCCCAGConserved hypothetical protein. 
J013001F21CAAGCCCAGNONE 
J013074D07CAAGCCCAGNONE 
J013096H23CAAGCCCAGNONE 
J013098H07CAAGCCCAGNONE 
J013132L13CAAGCCCAGNONE 
J013134K05CAAGCCCAGNONE 
J013155B15CAAGCCCAGNONE 
J023002L17CAAGCCCAGNONE 
J023013B08CAAGCCCAGNONE 
J023087I01CAAGCCCAGNONE 
J033071O04CAAGCCCAGNONE 
J065161N23CAAGCCCAGNONE 
J075055G11CAAGCCCAGNONE 
J075106J02CAAGCCCAGNONE 
J080009D06CAAGCCCAGNONE 
J080009N22CAAGCCCAGNONE 
J080016L03CAAGCCCAGNONE 
J080023E17CAAGCCCAGNONE 
J080027A12CAAGCCCAGNONE 
J080036M24CAAGCCCAGNONE 
J080038N07CAAGCCCAGNONE 
J080041A04CAAGCCCAGNONE 
J080042K11CAAGCCCAGNONE 
J080050A04CAAGCCCAGNONE 
J080053G16CAAGCCCAGNONE 
J080063D03CAAGCCCAGNONE 
J080063F07CAAGCCCAGNONE 
J080067H13CAAGCCCAGNONE 
J080068F12CAAGCCCAGNONE 
J080072G17CAAGCCCAGNONE 
J080072I06CAAGCCCAGNONE 
J080072J24CAAGCCCAGNONE 
J080076G09CAAGCCCAGNONE 
J080085H10CAAGCCCAGNONE 
J080092I17CAAGCCCAGNONE 
J080092N20CAAGCCCAGNONE 
J080093G10CAAGCCCAGNONE 
J090074C23CAAGCCCAGNONE 
J090083O18CAAGCCCAGNONE 
J100046M05CAAGCCCAGNONE 
J100050N16CAAGCCCAGNONE 
J100054D07CAAGCCCAGNONE 
J100054O11CAAGCCCAGNONE 
J100055F04CAAGCCCAGNONE 
J100055H22CAAGCCCAGNONE 
J100063A05CAAGCCCAGNONE 
J100063I24CAAGCCCAGNONE 
J100067I12CAAGCCCAGNONE 
J100074A22CAAGCCCAGNONE 
J100078B22CAAGCCCAGNONE 
J100079B03CAAGCCCAGNONE 
Os02g0818900AK107997CCAAGCCCAGCHeavy metal transport/detoxification protein domain containing protein. 
J065112M01CCAAGCCCAGCNONE 
J065152N01CCAAGCCCAGCNONE 
J100052D19CCAAGCCCAGCNONE 
J100085M12CCAAGCCCAGCNONE 
J100087A05CCAAGCCCAGCNONE 
J100088H04CCAAGCCCAGCNONE 
Os03g0109600005-005-D08TACTGGGCTTGNONE 
AK061661TACTGGGCTTGNONE 
Os03g0116500AF106844CTGGGCTTCNONE 
AK101870CTGGGCTTCConstitutive photomorphogenic 11. 
J023055L16CTGGGCTTCNONE 
J023088I16CTGGGCTTCNONE 
J033070E21CTGGGCTTCNONE 
J065124N22CTGGGCTTCNONE 
J075152A19CTGGGCTTCNONE 
J075181J21CTGGGCTTCNONE 
J090011F23CTGGGCTTCNONE 
Os03g0169700AK066912TACTGGGCTTGConserved hypothetical protein. 
Os03g0199000J023145E02CTGGGCTTCNONE 
J065046E14CTGGGCTTCNONE 
Os03g0262400014-013-D09CAAGCCCAGTANONE 
AK059989CAAGCCCAGTASimilar to Eukaryotic translation initiation factor 4E type 3 (eIF4E type 3) (eIF-4E type 3) (mRNA cap-binding protein type 3) (Novel cap-binding protein) (nCBP). 
J023036I18CAAGCCCAGTANONE 
J033025J23CAAGCCCAGTANONE 
J065047G10CAAGCCCAGTANONE 
J065153H03CAAGCCCAGTANONE 
J065155J08CAAGCCCAGTANONE 
J075025C05CAAGCCCAGTANONE 
Os03g0279600006-070-A07GAAGCCCAGCCNONE 
AK061080GAAGCCCAGCCConserved hypothetical protein. 
AK071043GAAGCCCAGCCNONE 
AK103191GAAGCCCAGCCNONE 
J065077E22GAAGCCCAGCCNONE 
J065208F22GAAGCCCAGCCNONE 
J075156K12GAAGCCCAGCCNONE 
Os03g0289200016-011-H02CTGGGCTTCNONE 
AK064364CTGGGCTTCSimilar to H/ACA ribonucleoprotein complex subunit 1-like protein (GCR 101 snRNP). 
AK073108CTGGGCTTCNONE 
J043024P22CTGGGCTTCNONE 
J100074J04CTGGGCTTCNONE 
Os03g0442400Os03g0442400TAAGCCCAGTTNONE 
Os03g0604600J090093K23GAAGCCCAGTAConserved hypothetical protein. 
Os03g0734500AK108001AAAAGCCCAGCConserved hypothetical protein. 
J080013F05AAAAGCCCAGCNONE 
J080030B16AAAAGCCCAGCNONE 
J080074G16AAAAGCCCAGCNONE 
J100062F08AAAAGCCCAGCNONE 
Os03g0737600014-094-E01CCAAGCCCAGCNONE 
AB038234CCAAGCCCAGCNONE 
AK101854CCAAGCCCAGCCyclin H-1. 
AK105468CCAAGCCCAGCNONE 
J033069N12CCAAGCCCAGCNONE 
J043017A22CCAAGCCCAGCNONE 
J065154A20CCAAGCCCAGCNONE 
Os03g0774200AK065851AAAAGCCCAGCCCACCAACNONE 
AK119532AAAAGCCCAGCCCACCAACSimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AAAAGCCCAGCCCACCAACNONE 
J023107I03AAAAGCCCAGCCCACCAACNONE 
J065156I19AAAAGCCCAGCCCACCAACNONE 
J065176L07AAAAGCCCAGCCCACCAACNONE 
J100066F15AAAAGCCCAGCCCACCAACNONE 
Os03g0774600AK066871GAAGCCCAGHypothetical protein. 
J053033J17GAAGCCCAGNONE 
Os03g0823800AK058223ATCTGGGCTTGNONE 
Os03g0848100J013028M09TGTTGGGCTGGGCTTCNONE 
J065080L17TGTTGGGCTGGGCTTCNONE 
J065083C11TGTTGGGCTGGGCTTCNONE 
Os04g0382300AK071912AAAGCCCAGNONE 
AK101795AAAGCCCAGSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0416000J065041L09CCAAGCCCAGNONE 
J065041L09TCATGGGCTGGGCTTCNONE 
J065050F15CCAAGCCCAGNONE 
J065050F15TCATGGGCTGGGCTTCNONE 
J065053M14CCAAGCCCAGProtein of unknown function DUF1279 domain containing protein. 
J065053M14TCATGGGCTGGGCTTCProtein of unknown function DUF1279 domain containing protein. 
J065057I09CCAAGCCCAGNONE 
J065057I09TCATGGGCTGGGCTTCNONE 
J065132E14CCAAGCCCAGNONE 
J065132E14TCATGGGCTGGGCTTCNONE 
J065144L23CCAAGCCCAGNONE 
J065144L23TCATGGGCTGGGCTTCNONE 
J065154N13CCAAGCCCAGNONE 
J065154N13TCATGGGCTGGGCTTCNONE 
J065158P16CCAAGCCCAGNONE 
J065158P16TCATGGGCTGGGCTTCNONE 
J080302F01CCAAGCCCAGNONE 
J080302F01TCATGGGCTGGGCTTCNONE 
J080308G20CCAAGCCCAGNONE 
J080308G20TCATGGGCTGGGCTTCNONE 
Os04g0430100009-125-A01AACTGGGCCTGAAAAGCCCAGCCCNONE 
AK102190AACTGGGCCTGAAAAGCCCAGCCCSimilar to 40S ribosomal protein S10-1. 
J033087A06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J053032M06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065033D05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045D15AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045K10AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065049N05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065064N09AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065068F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065088F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065104N22AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065117B19AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065119O12AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065134G24AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065150G16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065176C03AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065212M23AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075009P18AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075019G06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075037H14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075057C13AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075100E14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075120I16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075130F07AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075156M16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J100043J03AACTGGGCCTGAAAAGCCCAGCCCNONE 
Os04g0439100J013026H11AAAGCCCAGNONE 
J013097L15AAAGCCCAGNONE 
J013112G22AAAGCCCAGNONE 
J013160E02AAAGCCCAGNONE 
J043026G08AAAGCCCAGNONE 
Os04g0445100014-052-B04GAAGCCCAGCAAACGGCCCATCANONE 
AK063700GAAGCCCAGCAAACGGCCCATCASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0451100AK106764CTGGGCTTAConserved hypothetical protein. 
Os04g0505700AK071138GAAGCCCAGLeucine-rich repeat, cysteine-containing subtype containing protein. 
J023081C03GAAGCCCAGNONE 
J033108O05GAAGCCCAGNONE 
J100079D03GAAGCCCAGNONE 
Os04g0559400AK106376AAAAGCCCAGCCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0564700AK111615GCTGGGCTTGNONE 
Os04g0577500006-039-C03TACTGGGCCGATAAGCCCAGNONE 
006-043-H01TACTGGGCCGATAAGCCCAGNONE 
AK061538TACTGGGCCGATAAGCCCAGNONE 
AK065648TACTGGGCCGATAAGCCCAGTatD-related deoxyribonuclease family protein. 
AK104763TACTGGGCCGATAAGCCCAGNONE 
J013035E21TACTGGGCCGATAAGCCCAGNONE 
J013066M11TACTGGGCCGATAAGCCCAGNONE 
J100026B02TACTGGGCCGATAAGCCCAGNONE 
Os04g0583101005-010-A06GCTGGGCTTGNONE 
AK065769GCTGGGCTTGProtein prenyltransferase domain containing protein. 
J013040G18GCTGGGCTTGNONE 
J023100E21GCTGGGCTTGNONE 
J075041E15GCTGGGCTTGNONE 
J075056L11GCTGGGCTTGNONE 
J075081F19GCTGGGCTTGNONE 
J075126J10GCTGGGCTTGNONE 
J075148G19GCTGGGCTTGNONE 
J075178A14GCTGGGCTTGNONE 
J100085H06GCTGGGCTTGNONE 
Os04g0602900AK065982GAAGCCCAGNONE 
AK100414GAAGCCCAGIsoprenylcysteine carboxyl methyltransferase family protein. 
J013045J05GAAGCCCAGNONE 
J065196I21GAAGCCCAGNONE 
J065205B13GAAGCCCAGNONE 
J090017J24GAAGCCCAGNONE 
Os04g0609700AK101763GCTGGGCTTCZinc finger, FYVE/PHD-type domain containing protein. 
Os04g0636400006-064-G07TAAGCCCAGCCNONE 
006-097-D05TAAGCCCAGCCNONE 
AK061848TAAGCCCAGCCSimilar to Senescence-associated protein 6. 
AK099573TAAGCCCAGCCNONE 
J013035J20TAAGCCCAGCCNONE 
Os04g0636900011-028-G03CAAGCCCAGCNONE 
012-040-G03CAAGCCCAGCNONE 
AK058405CAAGCCCAGCNONE 
AK065789CAAGCCCAGCNONE 
AK101408CAAGCCCAGCNONE 
AK119286CAAGCCCAGCNONE 
J013042J24CAAGCCCAGCNONE 
J033037I12CAAGCCCAGCNONE 
J043031B12CAAGCCCAGCNONE 
J065152N10CAAGCCCAGCNONE 
J090060K17CAAGCCCAGCNONE 
J090083K14CAAGCCCAGCNONE 
J100046O13CAAGCCCAGCNONE 
J100066G22CAAGCCCAGCNONE 
Os04g0659400AK070174ATCTGGGCTTTENT domain containing protein. 
Os05g0186000006-103-D10AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-047-D06AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-073-G05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-084-G09AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-097-G04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-111-D11AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-115-G01AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-131-B04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-144-F05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-154-D08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
014-004-H02AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK058675AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK060420AAAGCCCAATCCATGGGCCTGGGCTTCSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J065155C08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J075143K12AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
Os05g0194600AK102487CTGGGCTTCPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01CTGGGCTTCNONE 
J100041A08CTGGGCTTCNONE 
Os05g0205100AK111332CAAGCCCAGCNLI interacting factor domain containing protein. 
Os05g0297900AK071238TAAGCCCAGTGACGTGSimilar to Signal peptidase 18 subunit (Fragment). 
J013159C03TAAGCCCAGTGACGTGNONE 
J023041J06TAAGCCCAGTGACGTGNONE 
J023085B09TAAGCCCAGTGACGTGNONE 
J033031J11TAAGCCCAGTGACGTGNONE 
J065010C22TAAGCCCAGTGACGTGNONE 
J065032E10TAAGCCCAGTGACGTGNONE 
J065141O18TAAGCCCAGTGACGTGNONE 
J065155K04TAAGCCCAGTGACGTGNONE 
Os05g0490800J065037L19AAAAGCCCAGCCNONE 
Os05g0495100AK108028GGGCTGGGCTTTTConserved hypothetical protein. 
Os05g0566800AK065748CAAGCCCAGATCold acclimation protein COR413-TM1. 
AY181210CAAGCCCAGATNONE 
Os05g0594800AK058332GAAGCCCAGCCCACCAAdhesion regulating molecule family protein. 
AK068013GAAGCCCAGCCCACCANONE 
J013129L24GAAGCCCAGCCCACCANONE 
Os06g0105900AK072638CAAGCCCAGGCCCAATAConserved hypothetical protein. 
Os06g0116400006-082-G06GAAGCCCAGCCNONE 
AK058327GAAGCCCAGCCNONE 
AK105979GAAGCCCAGCCHigh-affinity nickel-transporter family protein. 
J065083I24GAAGCCCAGCCNONE 
J100072O18GAAGCCCAGCCNONE 
Os06g0116600AK103500CTGGGCTTCProteinase inhibitor, propeptide domain containing protein. 
J033131B10CTGGGCTTCNONE 
J075154F17CTGGGCTTCNONE 
J075169L23CTGGGCTTCNONE 
Os06g0119300AK067271CTGGGCTTAProtein of unknown function DUF594 family protein. 
Os06g0128500AK058563AAAGCCCAGTTRibosomal protein L47, mitochondrial family protein. 
AK122132AAAGCCCAGTTNONE 
J033133F04AAAGCCCAGTTNONE 
J065094M24AAAGCCCAGTTNONE 
J065122J07AAAGCCCAGTTNONE 
J065137G10AAAGCCCAGTTNONE 
J065178L09AAAGCCCAGTTNONE 
J080011E11AAAGCCCAGTTNONE 
J080020G21AAAGCCCAGTTNONE 
J080039H03AAAGCCCAGTTNONE 
J080039J04AAAGCCCAGTTNONE 
Os06g0134900AK103205GGATGGGCTGTGTTGGGCCAAGCCCAGConserved hypothetical protein. 
J033122E01GGATGGGCTGTGTTGGGCCAAGCCCAGNONE 
Os06g0135000J075008J15CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075166F23CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075185F03CTGGGCTTGGCCCAACACAGCCCATCCNONE 
Os06g0135340J065061D17GAAGCCCAGTANONE 
J065159A10GAAGCCCAGTAConserved hypothetical protein. 
Os06g0159600AK068486TAAGCCCAGCU box domain containing protein. 
AK108446TAAGCCCAGCNONE 
J065084J15TAAGCCCAGCNONE 
Os06g0274200009-090-A02AAAGCCCAAGCCCAGNONE 
AK073155AAAGCCCAAGCCCAGSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065001C08AAAGCCCAAGCCCAGNONE 
J065061C07AAAGCCCAAGCCCAGNONE 
J065105L08AAAGCCCAAGCCCAGNONE 
J075013C12AAAGCCCAAGCCCAGNONE 
J090010N17AAAGCCCAAGCCCAGNONE 
J090068K07AAAGCCCAAGCCCAGNONE 
J100058A21AAAGCCCAAGCCCAGNONE 
J100066C07AAAGCCCAAGCCCAGNONE 
Os06g0283300Os06g0283300CTGGGCTTGSimilar to Protein-serine/threonine kinase. 
Os06g0326500AK068142CTGGGCTTTMitochondrial glycoprotein family protein. 
AK071483CTGGGCTTTNONE 
J053065A20CTGGGCTTTNONE 
J065082D14CTGGGCTTTNONE 
Os06g0592500AK119729CTGGGCTTGGTGGGCCGGTSimilar to Ethylene-responsive transcriptional coactivator. 
AK122052CTGGGCTTGGTGGGCCGGTNONE 
Os06g0695400AK073198GAAGCCCAGCHaem peroxidase family protein. 
J033022I15GAAGCCCAGCNONE 
Os06g0714100AK121079AAAGCCCAGCCCAComplex 1 LYR protein family protein. 
J023062M13AAAGCCCAGCCCANONE 
J043020D18AAAGCCCAGCCCANONE 
J065073A17AAAGCCCAGCCCANONE 
J065158D09AAAGCCCAGCCCANONE 
J065195H04AAAGCCCAGCCCANONE 
J065214P13AAAGCCCAGCCCANONE 
J080079I22AAAGCCCAGCCCANONE 
J100031M06AAAGCCCAGCCCANONE 
J100036I12AAAGCCCAGCCCANONE 
Os06g0715400012-007-C01AAAAGCCCAGNONE 
012-038-G03AAAAGCCCAGNONE 
AK071262AAAAGCCCAGt-snare domain containing protein. 
AK073963AAAAGCCCAGNONE 
J023085J06AAAAGCCCAGNONE 
J033073I09AAAAGCCCAGNONE 
J080316N15AAAAGCCCAGNONE 
J090062N15AAAAGCCCAGNONE 
Os06g0716200J100070M15GAAGCCCAGTAThaumatin, pathogenesis-related family protein. 
J100082O07GAAGCCCAGTANONE 
Os07g0191700AK066389TAGGCCCAAAGCCCAGTASimilar to AT.I.24-9 protein (Fragment). 
AK103768TAGGCCCAAAGCCCAGTANONE 
Os07g0459200AK066819GCTGGGCTTGGGCCAACCGAGCCGNONE 
AK102099GCTGGGCTTGGGCCAACCGAGCCGSimilar to Possible kinase. 
Os07g0479200005-017-H08ATCTGGGCTTTNONE 
AK058326ATCTGGGCTTTSimilar to SL15-like (Fragment). 
J013092A08ATCTGGGCTTTNONE 
J033139E04ATCTGGGCTTTNONE 
J043016M16ATCTGGGCTTTNONE 
J053050O18ATCTGGGCTTTNONE 
J053098B03ATCTGGGCTTTNONE 
J065068G10ATCTGGGCTTTNONE 
J065091I17ATCTGGGCTTTNONE 
J065109A03ATCTGGGCTTTNONE 
J065168B17ATCTGGGCTTTNONE 
J065177A05ATCTGGGCTTTNONE 
J065180J01ATCTGGGCTTTNONE 
J075006F13ATCTGGGCTTTNONE 
J075022J03ATCTGGGCTTTNONE 
J075024N09ATCTGGGCTTTNONE 
J075114B12ATCTGGGCTTTNONE 
J080023M06ATCTGGGCTTTNONE 
J080081N24ATCTGGGCTTTNONE 
J090060N07ATCTGGGCTTTNONE 
Os07g0516900AK061900AACTGGGCTTCSimilar to RNA Binding Protein 45. 
Os07g0568100AK099778CAAGCCCAGTTSimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0598900015-040-C12GCTGGGCTTCNONE 
AK102627GCTGGGCTTCCobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK106521GCTGGGCTTCNONE 
J033087C18GCTGGGCTTCNONE 
J033099K03GCTGGGCTTCNONE 
J065054E02GCTGGGCTTCNONE 
J090055O05GCTGGGCTTCNONE 
Os07g0617800AK060481CAAGCCCAGCSimilar to Alanine aminotransferase. 
Os07g0628500AK059560CTGGGCTTCNONE 
AK070963CTGGGCTTCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AY222337CTGGGCTTCNONE 
J023068N18CTGGGCTTCNONE 
J023088M08CTGGGCTTCNONE 
J033072H21CTGGGCTTCNONE 
Os07g0638500AK108983TACTGGGCTTASimilar to Dirigent-like protein (Fragment). 
J100035F20TACTGGGCTTANONE 
Os07g0645400009-125-B12CTGGGCTTANONE 
015-038-A09CTGGGCTTANONE 
AK119179CTGGGCTTANONE 
Os07g0668200AK059051AAAGCCCAGCCCAATNONE 
AK101682AAAGCCCAGCCCAATConserved hypothetical protein. 
AK102839AAAGCCCAGCCCAATNONE 
Os07g0695400015-036-B08CTGGGCTTTNONE 
AK100615CTGGGCTTTNONE 
AK106304CTGGGCTTTKIP1-like domain containing protein. 
J023108B01CTGGGCTTTNONE 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J013149L10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075027H17ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075060F10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
Os08g0127700012-086-F03TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK059350TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK099242TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
J033027J18TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065012F22TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065046N17TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065197B02TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100018P04TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100052C14TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100083A12TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
Os08g0236900AK109597GAAGCCCAGCCCConserved hypothetical protein. 
Os08g0261000AK100590TAAGCCCAGDisease resistance protein family protein. 
Os08g0359500003-107-F09CCAAGCCCAGCCCATCCCCCNONE 
006-091-E08CCAAGCCCAGCCCATCCCCCNONE 
006-096-E12CCAAGCCCAGCCCATCCCCCNONE 
006-111-F11CCAAGCCCAGCCCATCCCCCNONE 
009-090-H10CCAAGCCCAGCCCATCCCCCNONE 
014-013-B02CCAAGCCCAGCCCATCCCCCNONE 
014-083-E03CCAAGCCCAGCCCATCCCCCNONE 
014-100-F05CCAAGCCCAGCCCATCCCCCNONE 
AK104798CCAAGCCCAGCCCATCCCCCNONE 
AK112034CCAAGCCCAGCCCATCCCCCHSP20-like chaperone domain containing protein. 
J013060J18CCAAGCCCAGCCCATCCCCCNONE 
J033042C22CCAAGCCCAGCCCATCCCCCNONE 
J065168I06CCAAGCCCAGCCCATCCCCCNONE 
J075077E12CCAAGCCCAGCCCATCCCCCNONE 
J075094M21CCAAGCCCAGCCCATCCCCCNONE 
J090068D17CCAAGCCCAGCCCATCCCCCNONE 
J100027E21CCAAGCCCAGCCCATCCCCCNONE 
J100058D21CCAAGCCCAGCCCATCCCCCNONE 
J100067B02CCAAGCCCAGCCCATCCCCCNONE 
Os08g0379300AK103923CTGGGCTTGNONE 
Os08g0387050J043038F21GAAGCCCAGCCGAGCCGGCCCACAGCCCAGCCConserved hypothetical protein. 
Os08g0430200AK064881CTGGGCTTCUV excision repair protein Rad23 family protein. 
J013000J24CTGGGCTTCNONE 
Os08g0442300006-067-F05GCTGGGCTGGGCTTTNONE 
AK059843GCTGGGCTGGGCTTTNONE 
AK071719GCTGGGCTGGGCTTTSimilar to Calcineurin-like protein. 
AK102411GCTGGGCTGGGCTTTNONE 
J023108H11GCTGGGCTGGGCTTTNONE 
J033092P05GCTGGGCTGGGCTTTNONE 
J075109C09GCTGGGCTGGGCTTTNONE 
J090070B02GCTGGGCTGGGCTTTNONE 
J090076M14GCTGGGCTGGGCTTTNONE 
J100064B16GCTGGGCTGGGCTTTNONE 
Os08g0471900015-099-E10TAAGCCCAGCCCATTTNONE 
AK069434TAAGCCCAGCCCATTTZinc finger, ZPR1-type domain containing protein. 
Os08g0485600AK064883TAAGCCCAGNONE 
AK068243TAAGCCCAGMethyl-CpG binding domain containing protein. 
Os08g0485700AK068131CCAAGCCCAGATCCAACGGTCNONE 
AK069097CCAAGCCCAGATCCAACGGTCMethyl-CpG binding domain containing protein. 
J013130L03CCAAGCCCAGATCCAACGGTCNONE 
Os08g0504600AK064868TACTGGGCTTTTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013051G08TACTGGGCTTTTNONE 
Os08g0527400AK119389TAAGCCCAGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0550100AB070258CAAGCCCAGTTNONE 
AK061287CAAGCCCAGTTSimilar to 26S proteasome subunit RPN3a. 
Os09g0293900Os09g0293900AAAGCCCAGCCCACGAAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0397900AK101306GGCTGGGCTTTTTGGTGGGCCAASimilar to FEG protein. 
Os09g0487500AK108131AAAGCCCAGCCCATTTConserved hypothetical protein. 
J080062L16AAAGCCCAGCCCATTTNONE 
Os09g0498100015-046-G11TTGGCCCATGGGCTAAAGCCCAGNONE 
AK064108TTGGCCCATGGGCTAAAGCCCAGSimilar to 30S ribosomal protein S16. 
J065040H21TTGGCCCATGGGCTAAAGCCCAGNONE 
J065062F05TTGGCCCATGGGCTAAAGCCCAGNONE 
J065147B17TTGGCCCATGGGCTAAAGCCCAGNONE 
J075098J22TTGGCCCATGGGCTAAAGCCCAGNONE 
Os09g0516800009-017-A01TAAGCCCAGCCCAACCConserved hypothetical protein. 
Os09g0526800014-002-D10GAAGCCCAGCNONE 
AK060048GAAGCCCAGCNONE 
AK072174GAAGCCCAGCNONE 
AK105121GAAGCCCAGCNC domain containing protein. 
J013135P13GAAGCCCAGCNONE 
J033135C23GAAGCCCAGCNONE 
J043036C17GAAGCCCAGCNONE 
J065066N16GAAGCCCAGCNONE 
Os09g0539100AK071977GAAGCCCAGSimilar to 3-dehydroquinate synthase-like protein. 
AK098959GAAGCCCAGNONE 
Os09g0568000AK068829TACTGGGCTGGGCTTGNONE 
Os09g0571400AK103109AAATGGGCTGGGCTTGCyclophilin 1. 
J023011A12AAATGGGCTGGGCTTGNONE 
J033119A20AAATGGGCTGGGCTTGNONE 
J053034N16AAATGGGCTGGGCTTGNONE 
J053045N23AAATGGGCTGGGCTTGNONE 
J053052J12AAATGGGCTGGGCTTGNONE 
J053052K04AAATGGGCTGGGCTTGNONE 
J053099M15AAATGGGCTGGGCTTGNONE 
J065071H23AAATGGGCTGGGCTTGNONE 
J065131B16AAATGGGCTGGGCTTGNONE 
J075003F19AAATGGGCTGGGCTTGNONE 
J075116F02AAATGGGCTGGGCTTGNONE 
J075126G05AAATGGGCTGGGCTTGNONE 
J075145E09AAATGGGCTGGGCTTGNONE 
J075149O22AAATGGGCTGGGCTTGNONE 
J075163A09AAATGGGCTGGGCTTGNONE 
J075194A09AAATGGGCTGGGCTTGNONE 
L29471AAATGGGCTGGGCTTGNONE 
Os11g0127700AK103742CTGGGCTTGGGCCGGCCCACTHypothetical protein. 
J090083M11CTGGGCTTGGGCCGGCCCACTNONE 
Os11g0147600AK111127GCTGGGCTTCHypothetical protein. 
Os11g0153600AK065028CAAGCCCAGATGTP-binding signal recognition particle SRP54, G-domain containing protein. 
J013001G13CAAGCCCAGATNONE 
Os11g0593100AK070035TAAGCCCAGTAProtein of unknown function DUF295 family protein. 
J023038E14TAAGCCCAGTANONE 
J100062C21TAAGCCCAGTANONE 
Os12g0479400AK065254AAAGCCCAAGCCCAGCCCAACCNONE 
AK067061AAAGCCCAAGCCCAGCCCAACCSimilar to Auxin response factor 1. 
Os12g0517100012-071-A03CAAGCCCAGATNONE 
AK073020CAAGCCCAGATCyclin-like F-box domain containing protein. 
J023149K21CAAGCCCAGATNONE 
Os12g0573200AK111522AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
AK121943AGCCCAAGCCCAGCCCAGCCCAGCCCAAACGRAS transcription factor domain containing protein. 
J013002M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013151M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013159J22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J023087F18AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033107F03AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033125L09AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033126E12AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J043022I15AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J065176F05AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090034D17AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090075J06AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058D22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058P04AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
Os12g0630600J100033A04CAAGCCCAGTTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.