version

Summary of OsREG429 (All List)

OrganismOryza sativa  
IDOsREG429  
SequenceAAGCCCAT  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2230  

Entry Sequences (2230 entries)

LocusGene modelSequenceDescription
Os01g0104000AK072087TAGGCCCACAGAAGCCCATAANONE 
AK103808TAGGCCCACAGAAGCCCATAAC-type lectin domain containing protein. 
Os01g0104100AK072797TTATGGGCTTCTGTGGGCCTAZinc finger, RING-type domain containing protein. 
AK104280TTATGGGCTTCTGTGGGCCTANONE 
Os01g0104600AK058683AAAAGCCCATTAGTGGCCCAATANONE 
AK100613AAAAGCCCATTAGTGGCCCAATASimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
Os01g0104800AK067602AAAAGCCCATGTSas10/Utp3 family protein. 
J013109E04AAAAGCCCATGTNONE 
J033057M05AAAAGCCCATGTNONE 
J043021M24AAAAGCCCATGTNONE 
J090014N05AAAAGCCCATGTNONE 
J090077H23AAAAGCCCATGTNONE 
J090084H08AAAAGCCCATGTNONE 
Os01g0155600006-048-F03AAAGCCCATATNONE 
AK060171AAAGCCCATATNONE 
AK071635AAAGCCCATATSimilar to Splicing factor RSZ33. 
J023080A03AAAGCCCATATNONE 
J023100L15AAAGCCCATATNONE 
J033075I17AAAGCCCATATNONE 
J033085O09AAAGCCCATATNONE 
J033105E15AAAGCCCATATNONE 
J033132N10AAAGCCCATATNONE 
J033132P12AAAGCCCATATNONE 
J033149H12AAAGCCCATATNONE 
J043026M03AAAGCCCATATNONE 
J080305J10AAAGCCCATATNONE 
J080308K03AAAGCCCATATNONE 
J090023M04AAAGCCCATATNONE 
J090078F24AAAGCCCATATNONE 
J100066P05AAAGCCCATATNONE 
Os01g0196600AK101742TATGGGCTTTNONE 
U25430TATGGGCTTTSimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
Os01g0203300015-045-F03ACATGGGCTTCNONE 
015-045-F03CCATGGGCTTCNONE 
AK106329ACATGGGCTTCConserved hypothetical protein. 
AK106329CCATGGGCTTCConserved hypothetical protein. 
Os01g0212100AK065467AAAAGCCCATTTNONE 
AK101456AAAAGCCCATTTATP-dependent helicase, DEAH-box family protein. 
Os01g0231700012-002-F11TCATGGGCTTTTNONE 
013-082-F05TCATGGGCTTTTNONE 
AK107453TCATGGGCTTTTSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22TCATGGGCTTTTNONE 
J065023E21TCATGGGCTTTTNONE 
J065036H21TCATGGGCTTTTNONE 
J065037M24TCATGGGCTTTTNONE 
J065049L04TCATGGGCTTTTNONE 
J065072F17TCATGGGCTTTTNONE 
J065085H10TCATGGGCTTTTNONE 
J065109N19TCATGGGCTTTTNONE 
J065117M19TCATGGGCTTTTNONE 
J065144C15TCATGGGCTTTTNONE 
J065159G24TCATGGGCTTTTNONE 
J065164N14TCATGGGCTTTTNONE 
J075025K16TCATGGGCTTTTNONE 
J075057L05TCATGGGCTTTTNONE 
J075070I16TCATGGGCTTTTNONE 
J075089D10TCATGGGCTTTTNONE 
J075138F10TCATGGGCTTTTNONE 
J090018C11TCATGGGCTTTTNONE 
J100018L19TCATGGGCTTTTNONE 
J100024B14TCATGGGCTTTTNONE 
J100048L02TCATGGGCTTTTNONE 
J100055A22TCATGGGCTTTTNONE 
J100069K01TCATGGGCTTTTNONE 
Os01g0254000006-037-A11GAAGCCCATANONE 
006-059-H09GAAGCCCATANONE 
006-088-D11GAAGCCCATANONE 
006-112-B06GAAGCCCATANONE 
006-120-E12GAAGCCCATANONE 
AK111904GAAGCCCATANONE 
AK111979GAAGCCCATANONE 
AK119548GAAGCCCATANONE 
AY620417GAAGCCCATASimilar to NTGB2 (Fragment). 
J023112F13GAAGCCCATANONE 
J053066C19GAAGCCCATANONE 
J065006L12GAAGCCCATANONE 
J065019L17GAAGCCCATANONE 
J065081J05GAAGCCCATANONE 
J065085D02GAAGCCCATANONE 
J065203D03GAAGCCCATANONE 
J065210O20GAAGCCCATANONE 
J090062P06GAAGCCCATANONE 
J090063N07GAAGCCCATANONE 
J100061H24GAAGCCCATANONE 
Os01g0327600AK120216AAATGGGCTTGGNONE 
AK121799AAATGGGCTTGGConserved hypothetical protein. 
J065081I07AAATGGGCTTGGNONE 
J065082D04AAATGGGCTTGGNONE 
J065082G10AAATGGGCTTGGNONE 
J065085G24AAATGGGCTTGGNONE 
J065105J24AAATGGGCTTGGNONE 
J065128D18AAATGGGCTTGGNONE 
J065155D13AAATGGGCTTGGNONE 
J065200C11AAATGGGCTTGGNONE 
Os01g0328400006-092-H09GAAGCCCATAANONE 
009-085-A02GAAGCCCATAANONE 
012-078-B03GAAGCCCATAANONE 
AK061988GAAGCCCATAAUbiquitin. 
J013073B13GAAGCCCATAANONE 
J023135L09GAAGCCCATAANONE 
J023135O07GAAGCCCATAANONE 
J033027B12GAAGCCCATAANONE 
J033084P17GAAGCCCATAANONE 
J065010M05GAAGCCCATAANONE 
J065021N11GAAGCCCATAANONE 
J065021N12GAAGCCCATAANONE 
J065031K11GAAGCCCATAANONE 
J065072P04GAAGCCCATAANONE 
J065098D05GAAGCCCATAANONE 
J065122N23GAAGCCCATAANONE 
J065129L13GAAGCCCATAANONE 
J065135N13GAAGCCCATAANONE 
J065215N10GAAGCCCATAANONE 
J075120N22GAAGCCCATAANONE 
J090011G23GAAGCCCATAANONE 
J090014F06GAAGCCCATAANONE 
J090040G23GAAGCCCATAANONE 
J090075I20GAAGCCCATAANONE 
J090075N01GAAGCCCATAANONE 
J090089B04GAAGCCCATAANONE 
J090090F08GAAGCCCATAANONE 
J090091M17GAAGCCCATAANONE 
J090094L03GAAGCCCATAANONE 
J090099L06GAAGCCCATAANONE 
J100018A18GAAGCCCATAANONE 
J100027H13GAAGCCCATAANONE 
J100069C05GAAGCCCATAANONE 
J100086L10GAAGCCCATAANONE 
Os01g0495900AK065221TAATGGGCTTTTSimilar to CRS2-associated factor 1. 
Os01g0508300AK101435TGATGGGCTTANONE 
AK111287TGATGGGCTTAConserved hypothetical protein. 
J065096N08TGATGGGCTTANONE 
J075003F13TGATGGGCTTANONE 
J075014I16TGATGGGCTTANONE 
J075022D23TGATGGGCTTANONE 
J075040N19TGATGGGCTTANONE 
J075121O06TGATGGGCTTANONE 
J075131E17TGATGGGCTTANONE 
J075136N22TGATGGGCTTANONE 
J075147D01TGATGGGCTTANONE 
J075173C07TGATGGGCTTANONE 
J075196L22TGATGGGCTTANONE 
Os01g0513800012-032-E11GGCCGAAAAGCCCATANONE 
AK100776GGCCGAAAAGCCCATASimilar to Brix domain containing protein 1 homolog. 
J023120C10GGCCGAAAAGCCCATANONE 
J033044A22GGCCGAAAAGCCCATANONE 
J033048H13GGCCGAAAAGCCCATANONE 
J033118F03GGCCGAAAAGCCCATANONE 
J065176B05GGCCGAAAAGCCCATANONE 
J075026B19GGCCGAAAAGCCCATANONE 
J075048I23GGCCGAAAAGCCCATANONE 
J075141A19GGCCGAAAAGCCCATANONE 
J075148E05GGCCGAAAAGCCCATANONE 
J090031M12GGCCGAAAAGCCCATANONE 
Os01g0558500AK099982TAATGGGCTTTTGGGCCCAGCCPWWP domain containing protein. 
J065096J12TAATGGGCTTTTGGGCCCAGCCNONE 
Os01g0661400AK073113CCAAGCCCATANucleic acid-binding, OB-fold domain containing protein. 
J023014C20CCAAGCCCATANONE 
J033022G03CCAAGCCCATANONE 
J065050H15CCAAGCCCATANONE 
J065059J19CCAAGCCCATANONE 
J065085I24CCAAGCCCATANONE 
J065166G12CCAAGCCCATANONE 
J065182C18CCAAGCCCATANONE 
Os01g0681900AB008845AATGGGCTTANADH dependent Glutamate Synthase precursor (EC 1.4.1.14). 
AK105755AATGGGCTTANONE 
Os01g0686800006-098-B12GGATGGGCTTANONE 
006-113-H04GGATGGGCTTANONE 
AK060428GGATGGGCTTANONE 
AK098877GGATGGGCTTANONE 
AK098893GGATGGGCTTANONE 
AK121587GGATGGGCTTAGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231GGATGGGCTTANONE 
J013001E12GGATGGGCTTANONE 
J013001N15GGATGGGCTTANONE 
J013098G22GGATGGGCTTANONE 
J023004P15GGATGGGCTTANONE 
J023014D09GGATGGGCTTANONE 
J023020G09GGATGGGCTTANONE 
J023034A19GGATGGGCTTANONE 
J023050I11GGATGGGCTTANONE 
J023079D13GGATGGGCTTANONE 
J023091B11GGATGGGCTTANONE 
J023099M03GGATGGGCTTANONE 
J023101H20GGATGGGCTTANONE 
J023106P14GGATGGGCTTANONE 
J023111F19GGATGGGCTTANONE 
J023132C22GGATGGGCTTANONE 
J023139O03GGATGGGCTTANONE 
J023146O10GGATGGGCTTANONE 
J033022G16GGATGGGCTTANONE 
J033030C10GGATGGGCTTANONE 
J033032G18GGATGGGCTTANONE 
J033034N09GGATGGGCTTANONE 
J033037K24GGATGGGCTTANONE 
J033038B22GGATGGGCTTANONE 
J033061E06GGATGGGCTTANONE 
J033065F08GGATGGGCTTANONE 
J033065I24GGATGGGCTTANONE 
J033069L01GGATGGGCTTANONE 
J033086N21GGATGGGCTTANONE 
J033102I06GGATGGGCTTANONE 
J033111N07GGATGGGCTTANONE 
J033118K11GGATGGGCTTANONE 
J033125D08GGATGGGCTTANONE 
J033129P22GGATGGGCTTANONE 
J033131L12GGATGGGCTTANONE 
J033139D08GGATGGGCTTANONE 
J033141J08GGATGGGCTTANONE 
J043024B14GGATGGGCTTANONE 
J053048G19GGATGGGCTTANONE 
J065023B15GGATGGGCTTANONE 
J065082C15GGATGGGCTTANONE 
J065087D24GGATGGGCTTANONE 
J065122D11GGATGGGCTTANONE 
J065128P13GGATGGGCTTANONE 
J065149I19GGATGGGCTTANONE 
J065154E16GGATGGGCTTANONE 
J065156K21GGATGGGCTTANONE 
J065166H09GGATGGGCTTANONE 
J065169F24GGATGGGCTTANONE 
J065194I16GGATGGGCTTANONE 
J065213M20GGATGGGCTTANONE 
J075020F19GGATGGGCTTANONE 
J075051J16GGATGGGCTTANONE 
J075093C18GGATGGGCTTANONE 
J075119H02GGATGGGCTTANONE 
J075120J11GGATGGGCTTANONE 
J075173A15GGATGGGCTTANONE 
J080302B05GGATGGGCTTANONE 
J080304G10GGATGGGCTTANONE 
J080305E13GGATGGGCTTANONE 
J080315L11GGATGGGCTTANONE 
J090005H15GGATGGGCTTANONE 
J090021C24GGATGGGCTTANONE 
J090025H24GGATGGGCTTANONE 
J090025M11GGATGGGCTTANONE 
J090026C22GGATGGGCTTANONE 
J090027H15GGATGGGCTTANONE 
J090034B17GGATGGGCTTANONE 
J090045G11GGATGGGCTTANONE 
J090048H02GGATGGGCTTANONE 
J090051N04GGATGGGCTTANONE 
J090052I06GGATGGGCTTANONE 
J090054L17GGATGGGCTTANONE 
J090060M22GGATGGGCTTANONE 
J090075N17GGATGGGCTTANONE 
J090079K13GGATGGGCTTANONE 
J090086H08GGATGGGCTTANONE 
J090094N20GGATGGGCTTANONE 
J100021F03GGATGGGCTTANONE 
J100031M01GGATGGGCTTANONE 
J100033I18GGATGGGCTTANONE 
J100034P07GGATGGGCTTANONE 
J100043M16GGATGGGCTTANONE 
J100046J12GGATGGGCTTANONE 
J100055F09GGATGGGCTTANONE 
J100057D19GGATGGGCTTANONE 
J100060O10GGATGGGCTTANONE 
J100064G09GGATGGGCTTANONE 
J100077F24GGATGGGCTTANONE 
J100080E12GGATGGGCTTANONE 
J100089J04GGATGGGCTTANONE 
Os01g0688200AK120982TAAGCCCATCTGGGCCCAACAAlpha/beta hydrolase family protein. 
Os01g0700200AK100961TAGGCCCAAGCCCATCCASimilar to Chromosome condensation regulator protein (Fragment). 
J023141C11TAGGCCCAAGCCCATCCANONE 
Os01g0745400AK107872AAAGCCCATGTGGGACCCACSec34-like protein family protein. 
Os01g0752300AK121755ATATGGGCTTCGGCCCATGASimilar to 60S ribosomal protein L18a-1. 
J013049F10ATATGGGCTTCGGCCCATGANONE 
J013088L10ATATGGGCTTCGGCCCATGANONE 
J023020B21ATATGGGCTTCGGCCCATGANONE 
J023038M01ATATGGGCTTCGGCCCATGANONE 
J033058H15ATATGGGCTTCGGCCCATGANONE 
J033088C04ATATGGGCTTCGGCCCATGANONE 
J033115N19ATATGGGCTTCGGCCCATGANONE 
J033131H04ATATGGGCTTCGGCCCATGANONE 
J065067E05ATATGGGCTTCGGCCCATGANONE 
J065085C07ATATGGGCTTCGGCCCATGANONE 
J065095D12ATATGGGCTTCGGCCCATGANONE 
J065124B19ATATGGGCTTCGGCCCATGANONE 
J065181H07ATATGGGCTTCGGCCCATGANONE 
J065197B09ATATGGGCTTCGGCCCATGANONE 
J075090K22ATATGGGCTTCGGCCCATGANONE 
J075101P17ATATGGGCTTCGGCCCATGANONE 
J075181F13ATATGGGCTTCGGCCCATGANONE 
J075190H19ATATGGGCTTCGGCCCATGANONE 
J090004P17ATATGGGCTTCGGCCCATGANONE 
J090066I03ATATGGGCTTCGGCCCATGANONE 
Os01g0782300AK109175AAAAGCCCATAConserved hypothetical protein. 
Os01g0798500006-106-C11CCAAGCCCATGNONE 
AK061244CCAAGCCCATGNONE 
AK068219CCAAGCCCATGMalate synthase-like family protein. 
J065199O16CCAAGCCCATGNONE 
Os01g0850400AJ575220AAAAGCCCATTTNONE 
AK108582AAAAGCCCATTTSimilar to MYBY1 protein (Fragment). 
Os01g0852200AK063954GGGCCGTATGGGCTTTNONE 
Os01g0861000AK058707CAAGCCCATATConserved hypothetical protein. 
AK058707GAAGCCCATCAConserved hypothetical protein. 
Os01g0874800016-042-F01AAATGGGCTTTTGGCCCATAANONE 
AK065916AAATGGGCTTTTGGCCCATAANONE 
AK065991AAATGGGCTTTTGGCCCATAANONE 
AK103577AAATGGGCTTTTGGCCCATAANONE 
AK105063AAATGGGCTTTTGGCCCATAA5'-3' exonuclease domain containing protein. 
AK119315AAATGGGCTTTTGGCCCATAANONE 
J023106C06AAATGGGCTTTTGGCCCATAANONE 
J053023A11AAATGGGCTTTTGGCCCATAANONE 
J053068H13AAATGGGCTTTTGGCCCATAANONE 
J053071O13AAATGGGCTTTTGGCCCATAANONE 
J053074M10AAATGGGCTTTTGGCCCATAANONE 
Os01g0889800003-107-A06GAAGCCCATGGGCCTCNONE 
005-016-H12GAAGCCCATGGGCCTCNONE 
AK070087GAAGCCCATGGGCCTCRhodanese-like domain containing protein. 
AK104708GAAGCCCATGGGCCTCNONE 
J013035D13GAAGCCCATGGGCCTCNONE 
J013068K01GAAGCCCATGGGCCTCNONE 
J023042J18GAAGCCCATGGGCCTCNONE 
J053023F13GAAGCCCATGGGCCTCNONE 
J053026M13GAAGCCCATGGGCCTCNONE 
J053033N15GAAGCCCATGGGCCTCNONE 
J053035I16GAAGCCCATGGGCCTCNONE 
J053039A11GAAGCCCATGGGCCTCNONE 
J053039K22GAAGCCCATGGGCCTCNONE 
J053043B08GAAGCCCATGGGCCTCNONE 
J053068K09GAAGCCCATGGGCCTCNONE 
J053082D11GAAGCCCATGGGCCTCNONE 
J053092N12GAAGCCCATGGGCCTCNONE 
J053099A19GAAGCCCATGGGCCTCNONE 
J065027F17GAAGCCCATGGGCCTCNONE 
J065039B13GAAGCCCATGGGCCTCNONE 
J065139N16GAAGCCCATGGGCCTCNONE 
J065205B22GAAGCCCATGGGCCTCNONE 
Os01g0891400J065077E24AAAGCCCATTConserved hypothetical protein. 
J065206I07AAAGCCCATTNONE 
Os01g0907300015-031-F03AGATGGGCTTTNONE 
AK103626AGATGGGCTTTConserved hypothetical protein. 
AK108617AGATGGGCTTTNONE 
J013094D23AGATGGGCTTTNONE 
J013106G24AGATGGGCTTTNONE 
J013120M13AGATGGGCTTTNONE 
J023056M16AGATGGGCTTTNONE 
J023092M24AGATGGGCTTTNONE 
J033133N22AGATGGGCTTTNONE 
J043010O12AGATGGGCTTTNONE 
Os01g0926400AK063916TCATGGGCTTANONE 
AK073976TCATGGGCTTASimilar to Pectin-glucuronyltransferase. 
Os01g0945300003-104-D07TCATGGGCTTTTNONE 
AK065371TCATGGGCTTTTAmino acid/polyamine transporter I family protein. 
AK072189TCATGGGCTTTTNONE 
J013023D09TCATGGGCTTTTNONE 
J013055J18TCATGGGCTTTTNONE 
J013146P21TCATGGGCTTTTNONE 
J075109G14TCATGGGCTTTTNONE 
J075158O19TCATGGGCTTTTNONE 
Os01g0954400003-009-F12ACATGGGCTTTNONE 
012-080-B09ACATGGGCTTTNONE 
AK065709ACATGGGCTTTSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335ACATGGGCTTTNONE 
J013039J02ACATGGGCTTTNONE 
J033081E17ACATGGGCTTTNONE 
J075058B02ACATGGGCTTTNONE 
J075067K19ACATGGGCTTTNONE 
J075120E23ACATGGGCTTTNONE 
J075147I16ACATGGGCTTTNONE 
Os02g0163600AK068043TCATGGGCTTAConserved hypothetical protein. 
J013131O20TCATGGGCTTANONE 
J065006E03TCATGGGCTTANONE 
Os02g0178400009-151-B08AGATGGGCTTANONE 
AK063815AGATGGGCTTAProtein transport protein SEC61 gamma subunit. 
AK121516AGATGGGCTTANONE 
J033026A17AGATGGGCTTANONE 
J065011K14AGATGGGCTTANONE 
J065056D01AGATGGGCTTANONE 
J065061L22AGATGGGCTTANONE 
J065076M01AGATGGGCTTANONE 
J075092E14AGATGGGCTTANONE 
Os02g0250600J075143F23AAATGGGCTTCATGGGCCGCLate embryogenesis abundant protein repeat containing protein. 
Os02g0467200014-053-H06CACGTCACAAAAGCCCATTNONE 
014-053-H06GAAGCCCATAANONE 
AK063704CACGTCACAAAAGCCCATTConserved hypothetical protein. 
AK063704GAAGCCCATAAConserved hypothetical protein. 
J065197J05CACGTCACAAAAGCCCATTNONE 
J065197J05GAAGCCCATAANONE 
Os02g0618250009-115-E10CAAGCCCATCANONE 
009-115-E10CCAAGCCCATGTNONE 
014-076-A03CAAGCCCATCANONE 
014-076-A03CCAAGCCCATGTNONE 
J065096D10CAAGCCCATCASimilar to H/ACA ribonucleoprotein complex subunit 3-like protein. 
J065096D10CCAAGCCCATGTSimilar to H/ACA ribonucleoprotein complex subunit 3-like protein. 
J075045G01CAAGCCCATCANONE 
J075045G01CCAAGCCCATGTNONE 
J075092J11CAAGCCCATCANONE 
J075092J11CCAAGCCCATGTNONE 
J075134F02CAAGCCCATCANONE 
J075134F02CCAAGCCCATGTNONE 
Os02g0618700AK070657CCCAGCCCATCAAGCCCATATLung seven transmembrane receptor family protein. 
J023056H15CCCAGCCCATCAAGCCCATATNONE 
Os02g0629900AK108563TAAGCCCATAAConserved hypothetical protein. 
J065138O07TAAGCCCATAANONE 
Os02g0643500AK068423CATGGGCTTTPentapeptide repeat containing protein. 
Os02g0681100AK100584AAAGCCCATGAProtein of unknown function DUF604 family protein. 
J023106A15AAAGCCCATGANONE 
Os02g0700100AK102954AAAGCCCATAAAGCCCAGCSimilar to WD-repeat protein. 
Os02g0740300AK067833TAAGCCCATTTTGGGCCTGAAA ATPase domain containing protein. 
Os02g0744100006-070-H12ATATGGGCTTTNONE 
006-115-C05ATATGGGCTTTNONE 
AK061274ATATGGGCTTTSAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0751600006-048-C01GGGAAAGCCCATGGNONE 
006-059-E07GGGAAAGCCCATGGNONE 
AK060441GGGAAAGCCCATGGNONE 
AK061027GGGAAAGCCCATGGNONE 
AK072946GGGAAAGCCCATGGPeptidylprolyl isomerase, FKBP-type domain containing protein. 
AK104401GGGAAAGCCCATGGNONE 
J023150D22GGGAAAGCCCATGGNONE 
J075005E17GGGAAAGCCCATGGNONE 
J075019F10GGGAAAGCCCATGGNONE 
J075047K24GGGAAAGCCCATGGNONE 
J075052B13GGGAAAGCCCATGGNONE 
J075063M19GGGAAAGCCCATGGNONE 
J075136P10GGGAAAGCCCATGGNONE 
J075139E24GGGAAAGCCCATGGNONE 
J075152K11GGGAAAGCCCATGGNONE 
J075161A10GGGAAAGCCCATGGNONE 
J075187F20GGGAAAGCCCATGGNONE 
Os02g0771200011-006-B07AGATGGGCTTTNONE 
AK066823AGATGGGCTTTConserved hypothetical protein. 
AK071059AGATGGGCTTTNONE 
J013075K03AGATGGGCTTTNONE 
Os02g0780800J090080O19AAAGCCCATATNONE 
J090091I06AAAGCCCATATNONE 
Os02g0785800005-017-E01TGGATGGGCTTTNONE 
009-104-F05TGGATGGGCTTTNONE 
009-149-A09TGGATGGGCTTTNONE 
009-192-D08TGGATGGGCTTTNONE 
AK063859TGGATGGGCTTTNONE 
AK121768TGGATGGGCTTTSimilar to Ribosomal protein L35A. 
J013037M21TGGATGGGCTTTNONE 
J023009A11TGGATGGGCTTTNONE 
J023010P14TGGATGGGCTTTNONE 
J033092B03TGGATGGGCTTTNONE 
J065009O06TGGATGGGCTTTNONE 
J065024K14TGGATGGGCTTTNONE 
J065053F16TGGATGGGCTTTNONE 
J065056D18TGGATGGGCTTTNONE 
J065056N12TGGATGGGCTTTNONE 
J065071L21TGGATGGGCTTTNONE 
J065075M21TGGATGGGCTTTNONE 
J065087D19TGGATGGGCTTTNONE 
J065111N01TGGATGGGCTTTNONE 
J065172M05TGGATGGGCTTTNONE 
J065176E03TGGATGGGCTTTNONE 
J065184D08TGGATGGGCTTTNONE 
J065188K21TGGATGGGCTTTNONE 
J065194I05TGGATGGGCTTTNONE 
J065196E09TGGATGGGCTTTNONE 
J065196O21TGGATGGGCTTTNONE 
J065204O06TGGATGGGCTTTNONE 
J065212J02TGGATGGGCTTTNONE 
J075066H03TGGATGGGCTTTNONE 
J075067C04TGGATGGGCTTTNONE 
J075070I09TGGATGGGCTTTNONE 
J075081J03TGGATGGGCTTTNONE 
J075086I05TGGATGGGCTTTNONE 
J075092E09TGGATGGGCTTTNONE 
J075096D13TGGATGGGCTTTNONE 
J075098A12TGGATGGGCTTTNONE 
J075110B18TGGATGGGCTTTNONE 
J075116E14TGGATGGGCTTTNONE 
J075117J23TGGATGGGCTTTNONE 
J075117O16TGGATGGGCTTTNONE 
J075130H10TGGATGGGCTTTNONE 
J075151B07TGGATGGGCTTTNONE 
J075156C02TGGATGGGCTTTNONE 
J075159C07TGGATGGGCTTTNONE 
J075172O12TGGATGGGCTTTNONE 
J075181K16TGGATGGGCTTTNONE 
J075185J05TGGATGGGCTTTNONE 
J075186D14TGGATGGGCTTTNONE 
J075187F23TGGATGGGCTTTNONE 
J075193B15TGGATGGGCTTTNONE 
J075194P20TGGATGGGCTTTNONE 
J090002B21TGGATGGGCTTTNONE 
J090018E03TGGATGGGCTTTNONE 
J090029I04TGGATGGGCTTTNONE 
J090065F12TGGATGGGCTTTNONE 
J090066M05TGGATGGGCTTTNONE 
J090078A20TGGATGGGCTTTNONE 
J090084O15TGGATGGGCTTTNONE 
J090088P20TGGATGGGCTTTNONE 
J090098L20TGGATGGGCTTTNONE 
J100025B19TGGATGGGCTTTNONE 
J100038H15TGGATGGGCTTTNONE 
J100045H17TGGATGGGCTTTNONE 
J100058E17TGGATGGGCTTTNONE 
J100060O16TGGATGGGCTTTNONE 
J100067I10TGGATGGGCTTTNONE 
J100082N24TGGATGGGCTTTNONE 
J100083C17TGGATGGGCTTTNONE 
J100085I24TGGATGGGCTTTNONE 
J100087K20TGGATGGGCTTTNONE 
Os02g0788400AK060351AAAAGCCCATCANONE 
AK103497AAAAGCCCATCASimilar to Eukaryotic translation initiation factor 3 subunit-like protein. 
Os02g0813700Os02g0813700CAAGCCCATGANONE 
Os02g0824400AK121390AACTGGGCCTTTGATGGGCTTTConserved hypothetical protein. 
J023128P21AACTGGGCCTTTGATGGGCTTTNONE 
J053097O16AACTGGGCCTTTGATGGGCTTTNONE 
J065012I02AACTGGGCCTTTGATGGGCTTTNONE 
J065049C06AACTGGGCCTTTGATGGGCTTTNONE 
J065051H02AACTGGGCCTTTGATGGGCTTTNONE 
J065069A13AACTGGGCCTTTGATGGGCTTTNONE 
J065082E04AACTGGGCCTTTGATGGGCTTTNONE 
J065102N09AACTGGGCCTTTGATGGGCTTTNONE 
J065157O10AACTGGGCCTTTGATGGGCTTTNONE 
J065188N23AACTGGGCCTTTGATGGGCTTTNONE 
J065190J11AACTGGGCCTTTGATGGGCTTTNONE 
J065202M09AACTGGGCCTTTGATGGGCTTTNONE 
Os03g0110300006-043-D12AAAAGCCCATANONE 
009-061-E04AAAAGCCCATANONE 
009-181-H02AAAAGCCCATANONE 
009-193-F10AAAAGCCCATANONE 
AK066190AAAAGCCCATANONE 
AK066769AAAAGCCCATANONE 
AK106206AAAAGCCCATAConserved hypothetical protein. 
J065163L08AAAAGCCCATANONE 
J080034A14AAAAGCCCATANONE 
J080052E14AAAAGCCCATANONE 
J090012J01AAAAGCCCATANONE 
J100045M01AAAAGCCCATANONE 
J100065N06AAAAGCCCATANONE 
Os03g0125700009-132-G03AAATGGGCCTTAAAGCCCATTTNONE 
AK062913AAATGGGCCTTAAAGCCCATTTConserved hypothetical protein. 
J075046C16AAATGGGCCTTAAAGCCCATTTNONE 
J075115L05AAATGGGCCTTAAAGCCCATTTNONE 
J075143I05AAATGGGCCTTAAAGCCCATTTNONE 
J075197O07AAATGGGCCTTAAAGCCCATTTNONE 
Os03g0128100003-107-E07TTATGGGCTTCNONE 
AK062279TTATGGGCTTCSimilar to Callose synthase 1 catalytic subunit. 
AK105008TTATGGGCTTCNONE 
Os03g0135600J065183G03TTATGGGCTTCAnkyrin repeat containing protein. 
Os03g0137500006-040-G01GAAGCCCATATNONE 
015-054-G04GAAGCCCATATNONE 
AK060148GAAGCCCATATNONE 
AK073584GAAGCCCATATNONE 
AK100231GAAGCCCATATSimilar to VDAC3.1. 
J013146L24GAAGCCCATATNONE 
J023022O09GAAGCCCATATNONE 
J023049J19GAAGCCCATATNONE 
J023133L05GAAGCCCATATNONE 
J023143P12GAAGCCCATATNONE 
J033040B12GAAGCCCATATNONE 
J033050O14GAAGCCCATATNONE 
J033066G05GAAGCCCATATNONE 
J065007J18GAAGCCCATATNONE 
J100067H13GAAGCCCATATNONE 
Os03g0138600Os03g0138600AGTTGGGCCGAAGAAGCCCATAProtein of unknown function DUF810 family protein. 
Os03g0142900011-054-A05GAAGCCCATCTNONE 
AK067103GAAGCCCATCTNONE 
AK120438GAAGCCCATCTProtein of unknown function DUF946, plant family protein. 
J013097D18GAAGCCCATCTNONE 
J013098E18GAAGCCCATCTNONE 
J013099I17GAAGCCCATCTNONE 
J013108C09GAAGCCCATCTNONE 
J023045J15GAAGCCCATCTNONE 
J033034E13GAAGCCCATCTNONE 
J033095F07GAAGCCCATCTNONE 
J033102N22GAAGCCCATCTNONE 
J065016C14GAAGCCCATCTNONE 
J065034E13GAAGCCCATCTNONE 
J065065F21GAAGCCCATCTNONE 
J065159M09GAAGCCCATCTNONE 
J075012C13GAAGCCCATCTNONE 
J075017P18GAAGCCCATCTNONE 
J075018M03GAAGCCCATCTNONE 
J075021H19GAAGCCCATCTNONE 
J075070K23GAAGCCCATCTNONE 
J075077B18GAAGCCCATCTNONE 
J075085E20GAAGCCCATCTNONE 
J075090N23GAAGCCCATCTNONE 
J075137M16GAAGCCCATCTNONE 
J075151E03GAAGCCCATCTNONE 
J090042L02GAAGCCCATCTNONE 
J090060C21GAAGCCCATCTNONE 
J090089I17GAAGCCCATCTNONE 
J100024L19GAAGCCCATCTNONE 
J100025A06GAAGCCCATCTNONE 
J100033C24GAAGCCCATCTNONE 
J100052J17GAAGCCCATCTNONE 
J100063H10GAAGCCCATCTNONE 
J100073P04GAAGCCCATCTNONE 
J100075D01GAAGCCCATCTNONE 
J100077J17GAAGCCCATCTNONE 
J100087F03GAAGCCCATCTNONE 
J100087F09GAAGCCCATCTNONE 
Os03g0143400AK073999AAAGCCCATTTSimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21AAAGCCCATTTNONE 
J033073C08AAAGCCCATTTNONE 
J033094C19AAAGCCCATTTNONE 
J065017L10AAAGCCCATTTNONE 
J065070H22AAAGCCCATTTNONE 
J065079M09AAAGCCCATTTNONE 
J065091N18AAAGCCCATTTNONE 
J065109N03AAAGCCCATTTNONE 
J065113F05AAAGCCCATTTNONE 
J065135D23AAAGCCCATTTNONE 
J065156L16AAAGCCCATTTNONE 
J065207O04AAAGCCCATTTNONE 
J065208F03AAAGCCCATTTNONE 
J090010M15AAAGCCCATTTNONE 
J090056J18AAAGCCCATTTNONE 
Os03g0192400009-081-A03TAAGCCCATTANONE 
009-159-B02TAAGCCCATTANONE 
AK070573TAAGCCCATTAGRIM-19 family protein. 
J023056B01TAAGCCCATTANONE 
J023075G06TAAGCCCATTANONE 
J033048K16TAAGCCCATTANONE 
J033048L16TAAGCCCATTANONE 
J053031H23TAAGCCCATTANONE 
J065002H14TAAGCCCATTANONE 
J065006G22TAAGCCCATTANONE 
J065032G13TAAGCCCATTANONE 
J065056A09TAAGCCCATTANONE 
J065078I01TAAGCCCATTANONE 
J065095G01TAAGCCCATTANONE 
J065095I18TAAGCCCATTANONE 
J065134M18TAAGCCCATTANONE 
J065158P07TAAGCCCATTANONE 
J065165K17TAAGCCCATTANONE 
J065181J12TAAGCCCATTANONE 
J065189N09TAAGCCCATTANONE 
J065200D13TAAGCCCATTANONE 
J065202H20TAAGCCCATTANONE 
J065215K20TAAGCCCATTANONE 
J075049N19TAAGCCCATTANONE 
J075147J16TAAGCCCATTANONE 
J090081E19TAAGCCCATTANONE 
J100017C16TAAGCCCATTANONE 
J100039M16TAAGCCCATTANONE 
J100043E23TAAGCCCATTANONE 
J100063L12TAAGCCCATTANONE 
J100079F22TAAGCCCATTANONE 
Os03g0231950J075103H14AAAGCCCATTConserved hypothetical protein. 
Os03g0248300009-063-H02AAAGCCCATCANONE 
AK062535AAAGCCCATCASimilar to Cytochrome P450 76C4 (EC 1.14.-.-). 
Os03g0270200012-009-A03GAAGCCCATTNONE 
AK066896GAAGCCCATTNONE 
AK102826GAAGCCCATTSplicing factor PWI domain containing protein. 
J013042L05GAAGCCCATTNONE 
J013091L22GAAGCCCATTNONE 
J013096P13GAAGCCCATTNONE 
J013118M15GAAGCCCATTNONE 
J013151N20GAAGCCCATTNONE 
J033061D07GAAGCCCATTNONE 
J033086L04GAAGCCCATTNONE 
J033099J11GAAGCCCATTNONE 
J033109C10GAAGCCCATTNONE 
J033116F13GAAGCCCATTNONE 
J065019F13GAAGCCCATTNONE 
J065089O14GAAGCCCATTNONE 
J065158D07GAAGCCCATTNONE 
J065160G19GAAGCCCATTNONE 
J065168N10GAAGCCCATTNONE 
J065208E17GAAGCCCATTNONE 
J075001A15GAAGCCCATTNONE 
J075010G15GAAGCCCATTNONE 
J075016L23GAAGCCCATTNONE 
J075019A06GAAGCCCATTNONE 
J075023B13GAAGCCCATTNONE 
J075032P15GAAGCCCATTNONE 
J075045F05GAAGCCCATTNONE 
J075053O13GAAGCCCATTNONE 
J075057P06GAAGCCCATTNONE 
J075061C19GAAGCCCATTNONE 
J075078B10GAAGCCCATTNONE 
J075086A20GAAGCCCATTNONE 
J075127A16GAAGCCCATTNONE 
J075128E07GAAGCCCATTNONE 
J075129C06GAAGCCCATTNONE 
J075130M14GAAGCCCATTNONE 
J075136H13GAAGCCCATTNONE 
J075149M17GAAGCCCATTNONE 
J075156L08GAAGCCCATTNONE 
J075160P12GAAGCCCATTNONE 
J075164J01GAAGCCCATTNONE 
J075173N05GAAGCCCATTNONE 
J075177O03GAAGCCCATTNONE 
J075188K11GAAGCCCATTNONE 
J090009A02GAAGCCCATTNONE 
J090019O12GAAGCCCATTNONE 
J090065H05GAAGCCCATTNONE 
J090067E24GAAGCCCATTNONE 
J090080C03GAAGCCCATTNONE 
J090090A04GAAGCCCATTNONE 
J090098D13GAAGCCCATTNONE 
J100060D03GAAGCCCATTNONE 
J100062D05GAAGCCCATTNONE 
J100074A08GAAGCCCATTNONE 
Os03g0272400009-134-B08CAAGCCCATCANONE 
AK070454CAAGCCCATCAHypothetical protein. 
J023050K07CAAGCCCATCANONE 
J075075P06CAAGCCCATCANONE 
J090098L07CAAGCCCATCANONE 
Os03g0273800AK059223CGCGACGCCATGGGCTTCNONE 
AK067356CGCGACGCCATGGGCTTCNONE 
AK100173CGCGACGCCATGGGCTTCPyrimidine 5-nucleotidase family protein. 
Os03g0276800015-062-A05TTATGGGCTTGNONE 
AK106371TTATGGGCTTGHeat shock protein Hsp70 family protein. 
Os03g0305400009-198-D04GAAGCCCATCANONE 
013-012-C06GAAGCCCATCANONE 
014-034-D01GAAGCCCATCANONE 
AK071397GAAGCCCATCAUniversal stress protein (Usp) family protein. 
J023012O22GAAGCCCATCANONE 
J023097A13GAAGCCCATCANONE 
J023107P16GAAGCCCATCANONE 
J023113C14GAAGCCCATCANONE 
Os03g0308100AB116073TAAGCCCATGAPeptidase S14, ClpP family protein. 
AK060518TAAGCCCATGANONE 
AK099107TAAGCCCATGANONE 
AK105977TAAGCCCATGANONE 
J065005O19TAAGCCCATGANONE 
J065007L02TAAGCCCATGANONE 
J065128G15TAAGCCCATGANONE 
J065128N14TAAGCCCATGANONE 
J075010E21TAAGCCCATGANONE 
J075101J24TAAGCCCATGANONE 
J075124O14TAAGCCCATGANONE 
J075126O07TAAGCCCATGANONE 
Os03g0332700AK072820TAAGCCCATTAGGCCCATAASimilar to ABC Transporter, ATP binding component. 
Os03g0577000012-055-F04AAAGCCCAATGGGCTTTNONE 
AK061051AAAGCCCAATGGGCTTTSimilar to Ribosomal protein S3 (Fragment). 
AK099146AAAGCCCAATGGGCTTTNONE 
J065060A01AAAGCCCAATGGGCTTTNONE 
J075079B17AAAGCCCAATGGGCTTTNONE 
J075134K12AAAGCCCAATGGGCTTTNONE 
J090048F23AAAGCCCAATGGGCTTTNONE 
J090072I19AAAGCCCAATGGGCTTTNONE 
J100087C19AAAGCCCAATGGGCTTTNONE 
J100090C21AAAGCCCAATGGGCTTTNONE 
Os03g0581800009-177-G11TAAGCCCATCCGGCCCAAATNONE 
AK059201TAAGCCCATCCGGCCCAAATNONE 
AK121839TAAGCCCATCCGGCCCAAATHypothetical protein. 
J023022K06TAAGCCCATCCGGCCCAAATNONE 
J023110K21TAAGCCCATCCGGCCCAAATNONE 
J033100N18TAAGCCCATCCGGCCCAAATNONE 
J033120D11TAAGCCCATCCGGCCCAAATNONE 
J065044P15TAAGCCCATCCGGCCCAAATNONE 
J065102G22TAAGCCCATCCGGCCCAAATNONE 
J065149N14TAAGCCCATCCGGCCCAAATNONE 
J065201L18TAAGCCCATCCGGCCCAAATNONE 
J065205K10TAAGCCCATCCGGCCCAAATNONE 
J075035D19TAAGCCCATCCGGCCCAAATNONE 
J075073E06TAAGCCCATCCGGCCCAAATNONE 
J075134M11TAAGCCCATCCGGCCCAAATNONE 
J090004P12TAAGCCCATCCGGCCCAAATNONE 
J090070H20TAAGCCCATCCGGCCCAAATNONE 
J090087B04TAAGCCCATCCGGCCCAAATNONE 
J100028F10TAAGCCCATCCGGCCCAAATNONE 
J100036M18TAAGCCCATCCGGCCCAAATNONE 
J100065C24TAAGCCCATCCGGCCCAAATNONE 
J100080O13TAAGCCCATCCGGCCCAAATNONE 
Os03g0610800AK107194CAAGCCCATACSimilar to Protein zx. 
Os03g0656900AK066416AGATGGGCTTGNusB/RsmB/TIM44 domain containing protein. 
J065157L23AGATGGGCTTGNONE 
J065166P22AGATGGGCTTGNONE 
Os03g0668000AK111705TAAGCCCATGGNONE 
AK111783TAAGCCCATGGCyclin-like F-box domain containing protein. 
J023087J12TAAGCCCATGGNONE 
Os03g0701100014-015-E11GTATGGGCTTTNONE 
AK109455GTATGGGCTTTNONE 
AK110740GTATGGGCTTTNONE 
Os03g0701900AK068404AAATGGGCTTTTConserved hypothetical protein. 
Os03g0725300011-085-E09TAATGGGCTTCNONE 
AK063969TAATGGGCTTCSimilar to Dbr1-prov protein. 
AK073636TAATGGGCTTCNONE 
J033050L15TAATGGGCTTCNONE 
J053082G03TAATGGGCTTCNONE 
Os03g0752700011-093-A02AAAAGCCCATAANONE 
AK122157AAAAGCCCATAAHeat shock protein DnaJ, N-terminal domain containing protein. 
J013135C03AAAAGCCCATAANONE 
J033096O19AAAAGCCCATAANONE 
J033145P19AAAAGCCCATAANONE 
J065008K09AAAAGCCCATAANONE 
J065027J08AAAAGCCCATAANONE 
J065073H12AAAAGCCCATAANONE 
J065078G14AAAAGCCCATAANONE 
J065092L12AAAAGCCCATAANONE 
J065108D11AAAAGCCCATAANONE 
J065140G10AAAAGCCCATAANONE 
J065161D24AAAAGCCCATAANONE 
J065170F04AAAAGCCCATAANONE 
J075004K20AAAAGCCCATAANONE 
J075069F16AAAAGCCCATAANONE 
J075085B12AAAAGCCCATAANONE 
J075087D24AAAAGCCCATAANONE 
J075102G15AAAAGCCCATAANONE 
J075123M06AAAAGCCCATAANONE 
J090058D24AAAAGCCCATAANONE 
J090068I12AAAAGCCCATAANONE 
J090094A19AAAAGCCCATAANONE 
Os03g0758800AJ252135AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AJ312906AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AK060387AAAAGCCCATCCCACGGCCCGCTCTCCGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J023109G09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J033038B14AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J043013C09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J053096E21AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065026B08AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065062B16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065066E03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065091J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065164A06AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075014I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075117N07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075142M03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075175D04AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075188M01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075199I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090010J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090025O16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090041H05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090078P07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100031K10AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100055F23AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100064G05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080C24AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080O07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100090F01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
Os03g0766000AK070596CCAAGCCCATGANONE 
AK070596GAAGCCCATTANONE 
AK104743CCAAGCCCATGANONE 
AK104743GAAGCCCATTANONE 
AK106079CCAAGCCCATGANONE 
AK106079GAAGCCCATTANONE 
J013063M09CCAAGCCCATGANONE 
J013063M09GAAGCCCATTANONE 
J023056A03CCAAGCCCATGANONE 
J023056A03GAAGCCCATTANONE 
J043038L07CCAAGCCCATGANONE 
J043038L07GAAGCCCATTANONE 
J053067N16CCAAGCCCATGANONE 
J053067N16GAAGCCCATTANONE 
J053073G09CCAAGCCCATGANONE 
J053073G09GAAGCCCATTANONE 
J053075I19CCAAGCCCATGANONE 
J053075I19GAAGCCCATTANONE 
Os03g0784400AK103474AAAAGCCCATCGProtein of unknown function DUF1692 domain containing protein. 
J023135I15AAAAGCCCATCGNONE 
J033130D12AAAAGCCCATCGNONE 
J043035E20AAAAGCCCATCGNONE 
J065206K15AAAAGCCCATCGNONE 
J075053J20AAAAGCCCATCGNONE 
J075129B11AAAAGCCCATCGNONE 
J090003E22AAAAGCCCATCGNONE 
J100023E23AAAAGCCCATCGNONE 
Os03g0786700AK067936AAAAGCCCATAN2,N2-dimethylguanosine tRNA methyltransferase family protein. 
Os03g0797000AK073440ACATGGGCTTCSimilar to Indole synthase. 
Os03g0807800AK064984AATGGGCTTASimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14AATGGGCTTANONE 
J065015J20AATGGGCTTANONE 
J065122L11AATGGGCTTANONE 
J065217E10AATGGGCTTANONE 
J075023C02AATGGGCTTANONE 
J075102O04AATGGGCTTANONE 
J080024G24AATGGGCTTANONE 
J080033F02AATGGGCTTANONE 
J080047M13AATGGGCTTANONE 
J080048A22AATGGGCTTANONE 
J080056E06AATGGGCTTANONE 
J080064O11AATGGGCTTANONE 
Os03g0809300011-024-C02AAAGCCCATTTNONE 
016-071-E09AAAGCCCATTTNONE 
AK103140AAAGCCCATTTProtein phosphatase 2C-like domain containing protein. 
J013030O08AAAGCCCATTTNONE 
J013108D19AAAGCCCATTTNONE 
J013124D15AAAGCCCATTTNONE 
J013128F17AAAGCCCATTTNONE 
J013146J06AAAGCCCATTTNONE 
J013149D12AAAGCCCATTTNONE 
J013154P12AAAGCCCATTTNONE 
J013162N01AAAGCCCATTTNONE 
J013170G15AAAGCCCATTTNONE 
J013170H16AAAGCCCATTTNONE 
J023022I09AAAGCCCATTTNONE 
J023072B19AAAGCCCATTTNONE 
J023106H09AAAGCCCATTTNONE 
J023135C03AAAGCCCATTTNONE 
J023141C09AAAGCCCATTTNONE 
J033091K23AAAGCCCATTTNONE 
J033107I05AAAGCCCATTTNONE 
J033112M18AAAGCCCATTTNONE 
J033120G10AAAGCCCATTTNONE 
J033144G06AAAGCCCATTTNONE 
J043017L21AAAGCCCATTTNONE 
J043024O10AAAGCCCATTTNONE 
J053023K04AAAGCCCATTTNONE 
J053035D01AAAGCCCATTTNONE 
J053037P10AAAGCCCATTTNONE 
J053042K15AAAGCCCATTTNONE 
J053047C14AAAGCCCATTTNONE 
J053054A06AAAGCCCATTTNONE 
J053071H03AAAGCCCATTTNONE 
J053073G08AAAGCCCATTTNONE 
J053090D04AAAGCCCATTTNONE 
J053095E17AAAGCCCATTTNONE 
J090007O03AAAGCCCATTTNONE 
J090024G24AAAGCCCATTTNONE 
J090042M08AAAGCCCATTTNONE 
J090045I16AAAGCCCATTTNONE 
J090051E13AAAGCCCATTTNONE 
J090073B15AAAGCCCATTTNONE 
J090096F19AAAGCCCATTTNONE 
J100030M23AAAGCCCATTTNONE 
Os03g0811800AK063320ACTGGGCCACTAATGGGCTTGGRibosomal protein L36 family protein. 
J065094F18ACTGGGCCACTAATGGGCTTGGNONE 
J090029B04ACTGGGCCACTAATGGGCTTGGNONE 
Os03g0855600006-029-G09TAATGGGCTTTNONE 
006-033-E02TAATGGGCTTTNONE 
006-069-G07TAATGGGCTTTNONE 
006-083-A02TAATGGGCTTTNONE 
006-098-H04TAATGGGCTTTNONE 
009-054-C04TAATGGGCTTTNONE 
AK060030TAATGGGCTTTNONE 
AK061467TAATGGGCTTTConserved hypothetical protein. 
AK067858TAATGGGCTTTNONE 
AK106030TAATGGGCTTTNONE 
J013123A10TAATGGGCTTTNONE 
J065001I24TAATGGGCTTTNONE 
J065015N21TAATGGGCTTTNONE 
J065016H07TAATGGGCTTTNONE 
J065040A05TAATGGGCTTTNONE 
J065040F01TAATGGGCTTTNONE 
J065066G17TAATGGGCTTTNONE 
J065077I09TAATGGGCTTTNONE 
J065099M22TAATGGGCTTTNONE 
J065135B13TAATGGGCTTTNONE 
J065144H19TAATGGGCTTTNONE 
J065146I03TAATGGGCTTTNONE 
J065169E02TAATGGGCTTTNONE 
J065177D21TAATGGGCTTTNONE 
J065189L20TAATGGGCTTTNONE 
J065207H13TAATGGGCTTTNONE 
J065210D24TAATGGGCTTTNONE 
J065212I03TAATGGGCTTTNONE 
J075007E21TAATGGGCTTTNONE 
J075013H07TAATGGGCTTTNONE 
J075023K06TAATGGGCTTTNONE 
J075031D23TAATGGGCTTTNONE 
J075038K09TAATGGGCTTTNONE 
J075084C08TAATGGGCTTTNONE 
J075098K20TAATGGGCTTTNONE 
J090028E04TAATGGGCTTTNONE 
J090031E20TAATGGGCTTTNONE 
J090042F06TAATGGGCTTTNONE 
J090049L05TAATGGGCTTTNONE 
J090086G03TAATGGGCTTTNONE 
J090096J04TAATGGGCTTTNONE 
J100035O03TAATGGGCTTTNONE 
J100053H24TAATGGGCTTTNONE 
J100056L17TAATGGGCTTTNONE 
J100058K06TAATGGGCTTTNONE 
J100059G09TAATGGGCTTTNONE 
J100081C15TAATGGGCTTTNONE 
Os03g0861700AK066129CGATGGGCTTARhodanese-like domain containing protein. 
J013051M12CGATGGGCTTANONE 
J013104N13CGATGGGCTTANONE 
J065052E12CGATGGGCTTANONE 
Os03g0861800AF358762TAAGCCCATCGNONE 
AK068434TAAGCCCATCGCyclin-like F-box domain containing protein. 
AK109388TAAGCCCATCGNONE 
J013154L15TAAGCCCATCGNONE 
J013170I23TAAGCCCATCGNONE 
J023031D05TAAGCCCATCGNONE 
J023082E07TAAGCCCATCGNONE 
J023095M10TAAGCCCATCGNONE 
J023127D14TAAGCCCATCGNONE 
J023138M15TAAGCCCATCGNONE 
J023138M16TAAGCCCATCGNONE 
J033060B18TAAGCCCATCGNONE 
J033060F13TAAGCCCATCGNONE 
J033096J11TAAGCCCATCGNONE 
J033122C07TAAGCCCATCGNONE 
J053029A10TAAGCCCATCGNONE 
J053062O16TAAGCCCATCGNONE 
J053064J08TAAGCCCATCGNONE 
J053086F22TAAGCCCATCGNONE 
J065036C04TAAGCCCATCGNONE 
J065072J23TAAGCCCATCGNONE 
J065120D04TAAGCCCATCGNONE 
J065161D04TAAGCCCATCGNONE 
J065172H02TAAGCCCATCGNONE 
J065207B01TAAGCCCATCGNONE 
J075019H18TAAGCCCATCGNONE 
J075082E16TAAGCCCATCGNONE 
J075089A10TAAGCCCATCGNONE 
J075099G02TAAGCCCATCGNONE 
J075134M04TAAGCCCATCGNONE 
J075144K19TAAGCCCATCGNONE 
J075147F17TAAGCCCATCGNONE 
J090004O14TAAGCCCATCGNONE 
J090013A07TAAGCCCATCGNONE 
J090047K14TAAGCCCATCGNONE 
Os04g0304200AB018443ACATGGGCTTTNONE 
AK067128ACATGGGCTTTSimilar to Nonphototropic hypocotyl protein 1 (EC 2.7.1.37) (Phototropin). 
Os04g0437600AK061622CAAGCCCATTNONE 
Os04g0451100AK106764GAAGCCCATCTConserved hypothetical protein. 
Os04g0473400AK067896GAAGCCCATTASimilar to 60S ribosomal protein L6-B (L17) (YL16) (RP18). 
J013123D20GAAGCCCATTANONE 
J033108A09GAAGCCCATTANONE 
J065196E24GAAGCCCATTANONE 
J100066B16GAAGCCCATTANONE 
Os04g0494600AK110895AGCCCATGGGCTTCProtein of unknown function DUF642 family protein. 
Os04g0527900AK108116AAAGCCCATASimilar to Tonoplast membrane integral protein ZmTIP3-2. 
J075013N09AAAGCCCATANONE 
J075023I21AAAGCCCATANONE 
Os04g0542900AK068610TCATGGGCTTAConserved hypothetical protein. 
Os04g0573900AK101618GGATGGGCCAAGCCCATGTSimilar to Cytochrome P450-like protein. 
AK103182GGATGGGCCAAGCCCATGTNONE 
AK119612GGATGGGCCAAGCCCATGTNONE 
AK120901GGATGGGCCAAGCCCATGTNONE 
Os04g0584600006-042-D11CAAGCCCATCANONE 
006-065-G07CAAGCCCATCANONE 
AB042550CAAGCCCATCANONE 
AK059786CAAGCCCATCANONE 
AK061881CAAGCCCATCANONE 
AK066495CAAGCCCATCASimilar to Calcium dependent protein kinase. 
J090067J05CAAGCCCATCANONE 
J100037I23CAAGCCCATCANONE 
Os04g0595000AK106907TCATGGGCTTGPeptidase A1, pepsin family protein. 
Os04g0600200AB004864AAAGCCCATCTNONE 
AB007452AAAGCCCATCTNONE 
AK064040AAAGCCCATCTSimilar to Alternative oxidase 1a (Fragment). 
Os04g0602900AK065982TATGGGCTTANONE 
AK100414TATGGGCTTAIsoprenylcysteine carboxyl methyltransferase family protein. 
J013045J05TATGGGCTTANONE 
J065196I21TATGGGCTTANONE 
J065205B13TATGGGCTTANONE 
J090017J24TATGGGCTTANONE 
Os04g0634500AK071656AAAGCCCATTASimilar to S-receptor kinase-like protein 2. 
Os04g0638800AK070319AAAGCCCATCAProtein of unknown function DUF617, plant family protein. 
AK071753AAAGCCCATCANONE 
Os04g0676100Os04g0676100AATGGGCTTCSimilar to Thioredoxin X, chloroplast precursor. 
Os04g0681600AK105243CAAGCCCATCAProtein of unknown function DUF580 family protein. 
Os05g0103100AK103317GGATGGGCTTGTranslocon-associated beta family protein. 
J033125H15GGATGGGCTTGNONE 
J065021L01GGATGGGCTTGNONE 
J065029M01GGATGGGCTTGNONE 
J065089F17GGATGGGCTTGNONE 
J065112N04GGATGGGCTTGNONE 
J065163L03GGATGGGCTTGNONE 
J065175B04GGATGGGCTTGNONE 
J065192E02GGATGGGCTTGNONE 
J075046C20GGATGGGCTTGNONE 
J075192A01GGATGGGCTTGNONE 
J100018H13GGATGGGCTTGNONE 
J100067K20GGATGGGCTTGNONE 
J100080N03GGATGGGCTTGNONE 
Os05g0116600AK109828AGGTGGGCCGCATGGGCTTTF-box associated type 1 domain containing protein. 
Os05g0128100009-051-B07TAATGGGCTTCNONE 
009-127-B08TAATGGGCTTCNONE 
009-144-H03TAATGGGCTTCNONE 
009-176-B05TAATGGGCTTCNONE 
AK108556TAATGGGCTTCNONE 
AK119308TAATGGGCTTCNONE 
AK120934TAATGGGCTTCConserved hypothetical protein. 
J023036J15TAATGGGCTTCNONE 
J065122L01TAATGGGCTTCNONE 
J075104P10TAATGGGCTTCNONE 
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein. 
Os05g0150300AK100732TAAGCCCATTSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
Os05g0186000006-103-D10TCATGGGCTTGGNONE 
009-047-D06TCATGGGCTTGGNONE 
009-073-G05TCATGGGCTTGGNONE 
009-084-G09TCATGGGCTTGGNONE 
009-097-G04TCATGGGCTTGGNONE 
009-111-D11TCATGGGCTTGGNONE 
009-115-G01TCATGGGCTTGGNONE 
009-131-B04TCATGGGCTTGGNONE 
009-144-F05TCATGGGCTTGGNONE 
009-154-D08TCATGGGCTTGGNONE 
014-004-H02TCATGGGCTTGGNONE 
AK058675TCATGGGCTTGGNONE 
AK060420TCATGGGCTTGGSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231TCATGGGCTTGGNONE 
J065155C08TCATGGGCTTGGNONE 
J075143K12TCATGGGCTTGGNONE 
Os05g0255600AK073067ATATGGGCTTAThioredoxin domain 2 containing protein. 
J033022A04ATATGGGCTTANONE 
J033022B03ATATGGGCTTANONE 
J033116F22ATATGGGCTTANONE 
J065017H13ATATGGGCTTANONE 
J065038G20ATATGGGCTTANONE 
J065076J16ATATGGGCTTANONE 
J065135D06ATATGGGCTTANONE 
J065168P22ATATGGGCTTANONE 
J065188G21ATATGGGCTTANONE 
J065207C14ATATGGGCTTANONE 
J080014C23ATATGGGCTTANONE 
J080018G12ATATGGGCTTANONE 
J080021F03ATATGGGCTTANONE 
J100068C14ATATGGGCTTANONE 
Os05g0267100009-106-H07ACATGGGCTTGNONE 
009-177-H02ACATGGGCTTGNONE 
AK062790ACATGGGCTTGNONE 
AK065811ACATGGGCTTGNONE 
J013026N17ACATGGGCTTGNONE 
J013039F07ACATGGGCTTGNONE 
Os05g0346300009-033-C06AGATGGGCTTGGGCTTTNONE 
AF529175AGATGGGCTTGGGCTTTNONE 
AK061627AGATGGGCTTGGGCTTTSimilar to 40S ribosomal protein S7. 
AK103081AGATGGGCTTGGGCTTTNONE 
AK104191AGATGGGCTTGGGCTTTNONE 
J013049B09AGATGGGCTTGGGCTTTNONE 
J023142E24AGATGGGCTTGGGCTTTNONE 
J033052M14AGATGGGCTTGGGCTTTNONE 
J033089N04AGATGGGCTTGGGCTTTNONE 
J033118F01AGATGGGCTTGGGCTTTNONE 
J065054E07AGATGGGCTTGGGCTTTNONE 
J065066L18AGATGGGCTTGGGCTTTNONE 
J065078C21AGATGGGCTTGGGCTTTNONE 
J065127G23AGATGGGCTTGGGCTTTNONE 
J065128N24AGATGGGCTTGGGCTTTNONE 
J065144P17AGATGGGCTTGGGCTTTNONE 
J065147P14AGATGGGCTTGGGCTTTNONE 
J065170E16AGATGGGCTTGGGCTTTNONE 
J065175D17AGATGGGCTTGGGCTTTNONE 
J065176M05AGATGGGCTTGGGCTTTNONE 
J065218G20AGATGGGCTTGGGCTTTNONE 
J090074J12AGATGGGCTTGGGCTTTNONE 
J100019H16AGATGGGCTTGGGCTTTNONE 
J100031N24AGATGGGCTTGGGCTTTNONE 
J100072G08AGATGGGCTTGGGCTTTNONE 
J100086I23AGATGGGCTTGGGCTTTNONE 
Os05g0346400AK058872CCAAGCCCATCTNONE 
AK102727CCAAGCCCATCTProtein of unknown function DUF538 family protein. 
J033105N07CCAAGCCCATCTNONE 
J100077I17CCAAGCCCATCTNONE 
Os05g0363600AK108572TAATGGGCTTCConserved hypothetical protein. 
Os05g0399700AB012855AAAAGCCCATACNONE 
AB018248AAAAGCCCATACNONE 
AB096139AAAAGCCCATACNONE 
AK071196AAAAGCCCATACChitinase (EC 3.2.1.14). 
J023012C04AAAAGCCCATACNONE 
J023086B11AAAAGCCCATACNONE 
J023143A20AAAAGCCCATACNONE 
J080040G15AAAAGCCCATACNONE 
J080306P19AAAAGCCCATACNONE 
J080307K24AAAAGCCCATACNONE 
J090040G17AAAAGCCCATACNONE 
J090047J17AAAAGCCCATACNONE 
J090075E21AAAAGCCCATACNONE 
J090088L05AAAAGCCCATACNONE 
Os05g0413000AK058277AAAAGCCCATGMitochodrial transcription termination factor-related family protein. 
Os05g0447000AK108280TAAGCCCATACSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0458100006-084-A05AAAGCCCATACNONE 
009-091-H05AAAGCCCATACNONE 
AJ557547AAAGCCCATACNONE 
AK059467AAAGCCCATACNONE 
AK061127AAAGCCCATACNONE 
AK101652AAAGCCCATACSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06AAAGCCCATACNONE 
J033057B20AAAGCCCATACNONE 
J033087A05AAAGCCCATACNONE 
J043009C05AAAGCCCATACNONE 
J090009E10AAAGCCCATACNONE 
Os05g0461000006-113-A06AATGGGCTTGNONE 
AB042259AATGGGCTTGNONE 
AK059189AATGGGCTTGNONE 
AK066739AATGGGCTTGClathrin adaptor complex, small chain family protein. 
AK099044AATGGGCTTGNONE 
AK104166AATGGGCTTGNONE 
Os05g0500500AK110627ATATGGGCTTGHSP20-like chaperone domain containing protein. 
AK110627CGATGGGCTTCHSP20-like chaperone domain containing protein. 
Os05g0509200AK061566TAAGCCCATGANADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK099007TAAGCCCATGANONE 
AK100226TAAGCCCATGANONE 
J013114B12TAAGCCCATGANONE 
J023048D09TAAGCCCATGANONE 
Os05g0512500009-036-D05AAATGGGCTTCNONE 
AK062441AAATGGGCTTCCT20 family protein. 
J080003C10AAATGGGCTTCNONE 
J080046G11AAATGGGCTTCNONE 
Os05g0526300AK099438GAAGCCCATTANONE 
Os05g0558900AK101679TAAGCCCATCGSimilar to Frsb-prov protein. 
J013028M08TAAGCCCATCGNONE 
J013074E16TAAGCCCATCGNONE 
J013096L01TAAGCCCATCGNONE 
J023085M19TAAGCCCATCGNONE 
J033058I10TAAGCCCATCGNONE 
J033091D18TAAGCCCATCGNONE 
J033111H13TAAGCCCATCGNONE 
J033114C18TAAGCCCATCGNONE 
Os05g0567300013-039-F11CCATGGGCTTTGTTGGGCCGGTNONE 
AK112068CCATGGGCTTTGTTGGGCCGGTGTP-binding protein, HSR1-related domain containing protein. 
Os06g0106000006-086-D02TCATGGGCTTANONE 
AK059897TCATGGGCTTASeptum site-determining protein MinD family protein. 
AK105653TCATGGGCTTANONE 
J065059N03TCATGGGCTTANONE 
J065138F18TCATGGGCTTANONE 
J065158D02TCATGGGCTTANONE 
Os06g0116600AK103500AAAAGCCCATCTProteinase inhibitor, propeptide domain containing protein. 
J033131B10AAAAGCCCATCTNONE 
J075154F17AAAAGCCCATCTNONE 
J075169L23AAAAGCCCATCTNONE 
Os06g0128400AK064390AATGGGCTGATAAGCCCATGGNONE 
AK121983AATGGGCTGATAAGCCCATGGWD40-like domain containing protein. 
Os06g0135340J065061D17TAAGCCCATGANONE 
J065159A10TAAGCCCATGAConserved hypothetical protein. 
Os06g0137500AK072896AAAGCCCATCTBrix domain containing protein. 
AK121945AAAGCCCATCTNONE 
Os06g0139700006-052-C07TAAGCCCATCCACCNONE 
009-009-A08TAAGCCCATCCACCNONE 
015-020-D09TAAGCCCATCCACCNONE 
015-087-H06TAAGCCCATCCACCNONE 
016-078-A03TAAGCCCATCCACCNONE 
AK067884TAAGCCCATCCACCNONE 
AK103245TAAGCCCATCCACCConserved hypothetical protein. 
AK106116TAAGCCCATCCACCNONE 
AK106220TAAGCCCATCCACCNONE 
Os06g0168000AK059250TGATGGGCTTCNONE 
AK099356TGATGGGCTTCGlutathione S-transferase, C-terminal-like domain containing protein. 
J033040E19TGATGGGCTTCNONE 
J033097H04TGATGGGCTTCNONE 
J075087M11TGATGGGCTTCNONE 
J075146H06TGATGGGCTTCNONE 
J075188H11TGATGGGCTTCNONE 
J090071D03TGATGGGCTTCNONE 
J090097L20TGATGGGCTTCNONE 
J100051M05TGATGGGCTTCNONE 
J100082H13TGATGGGCTTCNONE 
Os06g0202900AK109607TAAGCCCATCGProtein kinase-like domain containing protein. 
Os06g0298400AK066952GAAGCCCATATWW/Rsp5/WWP domain containing protein. 
J013090J20GAAGCCCATATNONE 
J033024J05GAAGCCCATATNONE 
J033033H19GAAGCCCATATNONE 
J033057J15GAAGCCCATATNONE 
J065047L24GAAGCCCATATNONE 
J065198L23GAAGCCCATATNONE 
J065218N03GAAGCCCATATNONE 
J090001F10GAAGCCCATATNONE 
J090025N24GAAGCCCATATNONE 
J090073E16GAAGCCCATATNONE 
Os06g0304500AK119441GAAGCCCATTAAGGCCCACTCRS1/YhbY domain containing protein. 
J075143M24GAAGCCCATTAAGGCCCACTNONE 
J075194D03GAAGCCCATTAAGGCCCACTNONE 
Os06g0325500011-037-D06AAAGCCCATGTNONE 
011-093-G07AAAGCCCATGTNONE 
AK063974AAAGCCCATGTProtein of unknown function DUF89 family protein. 
AK099286AAAGCCCATGTNONE 
J065124G18AAAGCCCATGTNONE 
J065160K08AAAGCCCATGTNONE 
J065207O08AAAGCCCATGTNONE 
J075011D18AAAGCCCATGTNONE 
J075012D02AAAGCCCATGTNONE 
J075090F13AAAGCCCATGTNONE 
J075164A04AAAGCCCATGTNONE 
J075198I19AAAGCCCATGTNONE 
Os06g0608500AK060097TAAGCCCATTNONE 
AK070667TAAGCCCATTSnf7 family protein. 
Os06g0667600AK058606AAAAGCCCATTANONE 
AK058606AAAGCCCATTNONE 
AK071621AAAAGCCCATTASimilar to Glycine decarboxylase complex H-protein. 
AK071621AAAGCCCATTSimilar to Glycine decarboxylase complex H-protein. 
J023101D03AAAAGCCCATTANONE 
J023101D03AAAGCCCATTNONE 
J033095E17AAAAGCCCATTANONE 
J033095E17AAAGCCCATTNONE 
J065020B16AAAAGCCCATTANONE 
J065020B16AAAGCCCATTNONE 
Os06g0681000009-105-G11AGATGGGCTTGNONE 
AK062780AGATGGGCTTGConserved hypothetical protein. 
J100021E01AGATGGGCTTGNONE 
Os06g0694500AK067484CCATGGGCTGTATGGGCTTTTSimilar to Nitrogen fixation like protein. 
AK103983CCATGGGCTGTATGGGCTTTTNONE 
Os06g0701400013-010-G06ACATGGGCTTTTCATGGGCCAGANONE 
AK121229ACATGGGCTTTTCATGGGCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16ACATGGGCTTTTCATGGGCCAGANONE 
J033023L12ACATGGGCTTTTCATGGGCCAGANONE 
J065043I07ACATGGGCTTTTCATGGGCCAGANONE 
J065049E09ACATGGGCTTTTCATGGGCCAGANONE 
J065054I05ACATGGGCTTTTCATGGGCCAGANONE 
J065072H13ACATGGGCTTTTCATGGGCCAGANONE 
J065073L10ACATGGGCTTTTCATGGGCCAGANONE 
J065079P09ACATGGGCTTTTCATGGGCCAGANONE 
J065112I06ACATGGGCTTTTCATGGGCCAGANONE 
J065167C03ACATGGGCTTTTCATGGGCCAGANONE 
J065167I03ACATGGGCTTTTCATGGGCCAGANONE 
J065176P13ACATGGGCTTTTCATGGGCCAGANONE 
J065205M07ACATGGGCTTTTCATGGGCCAGANONE 
J075018E13ACATGGGCTTTTCATGGGCCAGANONE 
J075021E04ACATGGGCTTTTCATGGGCCAGANONE 
J075038F13ACATGGGCTTTTCATGGGCCAGANONE 
J075051E05ACATGGGCTTTTCATGGGCCAGANONE 
J075067C10ACATGGGCTTTTCATGGGCCAGANONE 
J075079A12ACATGGGCTTTTCATGGGCCAGANONE 
J075084A13ACATGGGCTTTTCATGGGCCAGANONE 
J075103E20ACATGGGCTTTTCATGGGCCAGANONE 
J075116E09ACATGGGCTTTTCATGGGCCAGANONE 
J075118F15ACATGGGCTTTTCATGGGCCAGANONE 
J075121I15ACATGGGCTTTTCATGGGCCAGANONE 
J075129B01ACATGGGCTTTTCATGGGCCAGANONE 
J075138A22ACATGGGCTTTTCATGGGCCAGANONE 
J075159B22ACATGGGCTTTTCATGGGCCAGANONE 
J075165I11ACATGGGCTTTTCATGGGCCAGANONE 
J075186E09ACATGGGCTTTTCATGGGCCAGANONE 
J075190J09ACATGGGCTTTTCATGGGCCAGANONE 
J075191I07ACATGGGCTTTTCATGGGCCAGANONE 
J080301C05ACATGGGCTTTTCATGGGCCAGANONE 
J080302L02ACATGGGCTTTTCATGGGCCAGANONE 
J100035C19ACATGGGCTTTTCATGGGCCAGANONE 
J100059P06ACATGGGCTTTTCATGGGCCAGANONE 
Os06g0712500AK068531AAATGGGCTTTTSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os07g0155200006-036-E03AAAGCCCATTTAGGCCCAGCCNONE 
006-036-E04AAAGCCCATTTAGGCCCAGCCNONE 
AK061006AAAGCCCATTTAGGCCCAGCCProtein of unknown function DUF150 family protein. 
AK104606AAAGCCCATTTAGGCCCAGCCNONE 
Os07g0179000AK100008TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
AK119398TTCGGCCCATTAAAGCCCATATAGGCCCACGAProtein prenyltransferase domain containing protein. 
AK119505TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
Os07g0191700AK066389CCAAGCCCATGSimilar to AT.I.24-9 protein (Fragment). 
AK103768CCAAGCCCATGNONE 
Os07g0202100AK101736AAAAGCCCATACSimilar to ATP-dependent RNA helicase ded1. 
Os07g0270900015-039-A02AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
AK068904AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J013169N21AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065039I11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065081J11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065162P04AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
Os07g0498300009-045-C02CCATGGGCTTCNONE 
009-045-C02TTTCGGCCCATGGGCTTTTNONE 
009-060-A09CCATGGGCTTCNONE 
009-060-A09TTTCGGCCCATGGGCTTTTNONE 
009-121-C04CCATGGGCTTCNONE 
009-121-C04TTTCGGCCCATGGGCTTTTNONE 
009-157-G09CCATGGGCTTCNONE 
009-157-G09TTTCGGCCCATGGGCTTTTNONE 
009-197-B02CCATGGGCTTCNONE 
009-197-B02TTTCGGCCCATGGGCTTTTNONE 
AK059124CCATGGGCTTCConserved hypothetical protein. 
AK059124TTTCGGCCCATGGGCTTTTConserved hypothetical protein. 
AK119800CCATGGGCTTCNONE 
AK119800TTTCGGCCCATGGGCTTTTNONE 
J065184M18CCATGGGCTTCNONE 
J065184M18TTTCGGCCCATGGGCTTTTNONE 
J075009G21CCATGGGCTTCNONE 
J075009G21TTTCGGCCCATGGGCTTTTNONE 
J075013O03CCATGGGCTTCNONE 
J075013O03TTTCGGCCCATGGGCTTTTNONE 
J075061C22CCATGGGCTTCNONE 
J075061C22TTTCGGCCCATGGGCTTTTNONE 
J075094E12CCATGGGCTTCNONE 
J075094E12TTTCGGCCCATGGGCTTTTNONE 
J075148C01CCATGGGCTTCNONE 
J075148C01TTTCGGCCCATGGGCTTTTNONE 
Os07g0516200AK061373ACATGGGCTTCSimilar to Endoribonuclease, L-PSP family. 
Os07g0530700AK060014CCATGGGCTTCNONE 
AK099533CCATGGGCTTCConserved hypothetical protein. 
Os07g0558000AK069272ACATGGGCTTANONE 
AK101867ACATGGGCTTAABC-1 domain containing protein. 
Os07g0558800AK100986CAAGCCCATGAMajor sperm protein domain containing protein. 
Os07g0568900009-083-H02AACTGGGCCCATTTTGGGCTAAGCCCATCGNONE 
AK062660AACTGGGCCCATTTTGGGCTAAGCCCATCGConserved hypothetical protein. 
Os07g0569000AK073915CGATGGGCTTAGCCCAAAATGGGCCCAGTTConserved hypothetical protein. 
Os07g0611700AK109158GAAGCCCATACTGGCCCAATTPeptidase C1A, papain family protein. 
Os07g0611800Os07g0611800GAAGCCCATACTGGCCCAATTNONE 
Os07g0687300AK073043AAATGGGCTTAGGCCCATTSimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os07g0688100AK101635TCATGGGCTTCProtein prenyltransferase domain containing protein. 
J033055B02TCATGGGCTTCNONE 
J090013O08TCATGGGCTTCNONE 
J090074A17TCATGGGCTTCNONE 
Os08g0113800J033069I12AAAAGCCCATTTNONE 
J033069I12AAAGCCCATCANONE 
J053050I07AAAAGCCCATTTNONE 
J053050I07AAAGCCCATCANONE 
J065006J11AAAAGCCCATTTNONE 
J065006J11AAAGCCCATCANONE 
J065013D02AAAAGCCCATTTNONE 
J065013D02AAAGCCCATCANONE 
J065055L24AAAAGCCCATTTNONE 
J065055L24AAAGCCCATCANONE 
J065071I11AAAAGCCCATTTConserved hypothetical protein. 
J065071I11AAAGCCCATCAConserved hypothetical protein. 
J065093G12AAAAGCCCATTTNONE 
J065093G12AAAGCCCATCANONE 
J065101N03AAAAGCCCATTTNONE 
J065101N03AAAGCCCATCANONE 
Os08g0117400006-086-A09GAAGCCCATCGNONE 
006-103-C02GAAGCCCATCGNONE 
AK059891GAAGCCCATCGSimilar to Calmodulin 1 (Fragment). 
AK103863GAAGCCCATCGNONE 
AY224521GAAGCCCATCGNONE 
J033149E23GAAGCCCATCGNONE 
J065062E05GAAGCCCATCGNONE 
J065083O05GAAGCCCATCGNONE 
J065116D14GAAGCCCATCGNONE 
J065158F16GAAGCCCATCGNONE 
J065179N16GAAGCCCATCGNONE 
J065206N23GAAGCCCATCGNONE 
Os08g0130500006-024-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-032-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-047-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-058-H06CCAAGCCCATCAGGCCCACCAACNONE 
006-062-D07CCAAGCCCATCAGGCCCACCAACNONE 
006-083-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-084-A11CCAAGCCCATCAGGCCCACCAACNONE 
006-096-F12CCAAGCCCATCAGGCCCACCAACNONE 
006-105-A04CCAAGCCCATCAGGCCCACCAACNONE 
006-110-D11CCAAGCCCATCAGGCCCACCAACNONE 
011-022-D11CCAAGCCCATCAGGCCCACCAACNONE 
AK064857CCAAGCCCATCAGGCCCACCAAC60S acidic ribosomal protein P0. 
D21130CCAAGCCCATCAGGCCCACCAACNONE 
J013000H12CCAAGCCCATCAGGCCCACCAACNONE 
J013024M17CCAAGCCCATCAGGCCCACCAACNONE 
J013028H09CCAAGCCCATCAGGCCCACCAACNONE 
J013045N22CCAAGCCCATCAGGCCCACCAACNONE 
J013092K19CCAAGCCCATCAGGCCCACCAACNONE 
J013106L12CCAAGCCCATCAGGCCCACCAACNONE 
J013107A03CCAAGCCCATCAGGCCCACCAACNONE 
J013109E12CCAAGCCCATCAGGCCCACCAACNONE 
J013114N08CCAAGCCCATCAGGCCCACCAACNONE 
J013120J12CCAAGCCCATCAGGCCCACCAACNONE 
J013121E21CCAAGCCCATCAGGCCCACCAACNONE 
J013135P20CCAAGCCCATCAGGCCCACCAACNONE 
J023006J08CCAAGCCCATCAGGCCCACCAACNONE 
J023014L16CCAAGCCCATCAGGCCCACCAACNONE 
J023020N03CCAAGCCCATCAGGCCCACCAACNONE 
J023027M24CCAAGCCCATCAGGCCCACCAACNONE 
J023029D18CCAAGCCCATCAGGCCCACCAACNONE 
J023030A14CCAAGCCCATCAGGCCCACCAACNONE 
J023041G23CCAAGCCCATCAGGCCCACCAACNONE 
J023049H05CCAAGCCCATCAGGCCCACCAACNONE 
J023060I23CCAAGCCCATCAGGCCCACCAACNONE 
J023099D07CCAAGCCCATCAGGCCCACCAACNONE 
J023104A20CCAAGCCCATCAGGCCCACCAACNONE 
J023105F18CCAAGCCCATCAGGCCCACCAACNONE 
J023112D21CCAAGCCCATCAGGCCCACCAACNONE 
J023122M18CCAAGCCCATCAGGCCCACCAACNONE 
J023139J20CCAAGCCCATCAGGCCCACCAACNONE 
J023149L20CCAAGCCCATCAGGCCCACCAACNONE 
J023150G04CCAAGCCCATCAGGCCCACCAACNONE 
J033036G02CCAAGCCCATCAGGCCCACCAACNONE 
J033045P13CCAAGCCCATCAGGCCCACCAACNONE 
J033046A22CCAAGCCCATCAGGCCCACCAACNONE 
J033086H16CCAAGCCCATCAGGCCCACCAACNONE 
J033087D07CCAAGCCCATCAGGCCCACCAACNONE 
J033089M14CCAAGCCCATCAGGCCCACCAACNONE 
J033095F14CCAAGCCCATCAGGCCCACCAACNONE 
J033108M01CCAAGCCCATCAGGCCCACCAACNONE 
J033117A17CCAAGCCCATCAGGCCCACCAACNONE 
J033122F03CCAAGCCCATCAGGCCCACCAACNONE 
J033126A04CCAAGCCCATCAGGCCCACCAACNONE 
J033144D13CCAAGCCCATCAGGCCCACCAACNONE 
J033145D13CCAAGCCCATCAGGCCCACCAACNONE 
J043022M09CCAAGCCCATCAGGCCCACCAACNONE 
J053025I11CCAAGCCCATCAGGCCCACCAACNONE 
J053027K06CCAAGCCCATCAGGCCCACCAACNONE 
J053029D15CCAAGCCCATCAGGCCCACCAACNONE 
J053048I22CCAAGCCCATCAGGCCCACCAACNONE 
J053055I01CCAAGCCCATCAGGCCCACCAACNONE 
J053079P07CCAAGCCCATCAGGCCCACCAACNONE 
J053090J23CCAAGCCCATCAGGCCCACCAACNONE 
J053094C24CCAAGCCCATCAGGCCCACCAACNONE 
J065023F18CCAAGCCCATCAGGCCCACCAACNONE 
J065029I12CCAAGCCCATCAGGCCCACCAACNONE 
J065044B18CCAAGCCCATCAGGCCCACCAACNONE 
J065045C07CCAAGCCCATCAGGCCCACCAACNONE 
J065063K22CCAAGCCCATCAGGCCCACCAACNONE 
J065093D11CCAAGCCCATCAGGCCCACCAACNONE 
J065096P09CCAAGCCCATCAGGCCCACCAACNONE 
J065099N04CCAAGCCCATCAGGCCCACCAACNONE 
J065103K24CCAAGCCCATCAGGCCCACCAACNONE 
J065110H12CCAAGCCCATCAGGCCCACCAACNONE 
J065132F24CCAAGCCCATCAGGCCCACCAACNONE 
J065157K16CCAAGCCCATCAGGCCCACCAACNONE 
J065185D11CCAAGCCCATCAGGCCCACCAACNONE 
J065202E16CCAAGCCCATCAGGCCCACCAACNONE 
J065217D07CCAAGCCCATCAGGCCCACCAACNONE 
J075053I19CCAAGCCCATCAGGCCCACCAACNONE 
J075055L24CCAAGCCCATCAGGCCCACCAACNONE 
J075056H24CCAAGCCCATCAGGCCCACCAACNONE 
J075070D02CCAAGCCCATCAGGCCCACCAACNONE 
J075084O15CCAAGCCCATCAGGCCCACCAACNONE 
J075090F24CCAAGCCCATCAGGCCCACCAACNONE 
J075135E03CCAAGCCCATCAGGCCCACCAACNONE 
J075174A01CCAAGCCCATCAGGCCCACCAACNONE 
J075188F05CCAAGCCCATCAGGCCCACCAACNONE 
J075192C17CCAAGCCCATCAGGCCCACCAACNONE 
J080001B02CCAAGCCCATCAGGCCCACCAACNONE 
J080001C08CCAAGCCCATCAGGCCCACCAACNONE 
J080002D15CCAAGCCCATCAGGCCCACCAACNONE 
J080002I03CCAAGCCCATCAGGCCCACCAACNONE 
J080003E24CCAAGCCCATCAGGCCCACCAACNONE 
J080004M10CCAAGCCCATCAGGCCCACCAACNONE 
J080005C18CCAAGCCCATCAGGCCCACCAACNONE 
J080006A12CCAAGCCCATCAGGCCCACCAACNONE 
J080006F04CCAAGCCCATCAGGCCCACCAACNONE 
J080006M11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J22CCAAGCCCATCAGGCCCACCAACNONE 
J080009F14CCAAGCCCATCAGGCCCACCAACNONE 
J080010B12CCAAGCCCATCAGGCCCACCAACNONE 
J080010G14CCAAGCCCATCAGGCCCACCAACNONE 
J080010N07CCAAGCCCATCAGGCCCACCAACNONE 
J080011D04CCAAGCCCATCAGGCCCACCAACNONE 
J080011G10CCAAGCCCATCAGGCCCACCAACNONE 
J080011O19CCAAGCCCATCAGGCCCACCAACNONE 
J080013K23CCAAGCCCATCAGGCCCACCAACNONE 
J080013M09CCAAGCCCATCAGGCCCACCAACNONE 
J080013N12CCAAGCCCATCAGGCCCACCAACNONE 
J080013O15CCAAGCCCATCAGGCCCACCAACNONE 
J080014C13CCAAGCCCATCAGGCCCACCAACNONE 
J080014D21CCAAGCCCATCAGGCCCACCAACNONE 
J080014F08CCAAGCCCATCAGGCCCACCAACNONE 
J080014N08CCAAGCCCATCAGGCCCACCAACNONE 
J080014P19CCAAGCCCATCAGGCCCACCAACNONE 
J080015L09CCAAGCCCATCAGGCCCACCAACNONE 
J080015P15CCAAGCCCATCAGGCCCACCAACNONE 
J080018P10CCAAGCCCATCAGGCCCACCAACNONE 
J080020C06CCAAGCCCATCAGGCCCACCAACNONE 
J080022C14CCAAGCCCATCAGGCCCACCAACNONE 
J080022E01CCAAGCCCATCAGGCCCACCAACNONE 
J080022P04CCAAGCCCATCAGGCCCACCAACNONE 
J080022P10CCAAGCCCATCAGGCCCACCAACNONE 
J080023B20CCAAGCCCATCAGGCCCACCAACNONE 
J080023G19CCAAGCCCATCAGGCCCACCAACNONE 
J080024N15CCAAGCCCATCAGGCCCACCAACNONE 
J080025E11CCAAGCCCATCAGGCCCACCAACNONE 
J080025G24CCAAGCCCATCAGGCCCACCAACNONE 
J080026B01CCAAGCCCATCAGGCCCACCAACNONE 
J080026B05CCAAGCCCATCAGGCCCACCAACNONE 
J080027L17CCAAGCCCATCAGGCCCACCAACNONE 
J080028K02CCAAGCCCATCAGGCCCACCAACNONE 
J080029L23CCAAGCCCATCAGGCCCACCAACNONE 
J080030D08CCAAGCCCATCAGGCCCACCAACNONE 
J080031C03CCAAGCCCATCAGGCCCACCAACNONE 
J080031K02CCAAGCCCATCAGGCCCACCAACNONE 
J080032C16CCAAGCCCATCAGGCCCACCAACNONE 
J080033F10CCAAGCCCATCAGGCCCACCAACNONE 
J080033G12CCAAGCCCATCAGGCCCACCAACNONE 
J080033K03CCAAGCCCATCAGGCCCACCAACNONE 
J080034B03CCAAGCCCATCAGGCCCACCAACNONE 
J080034N21CCAAGCCCATCAGGCCCACCAACNONE 
J080034O03CCAAGCCCATCAGGCCCACCAACNONE 
J080035G10CCAAGCCCATCAGGCCCACCAACNONE 
J080038E14CCAAGCCCATCAGGCCCACCAACNONE 
J080039A19CCAAGCCCATCAGGCCCACCAACNONE 
J080039G10CCAAGCCCATCAGGCCCACCAACNONE 
J080039J01CCAAGCCCATCAGGCCCACCAACNONE 
J080039J09CCAAGCCCATCAGGCCCACCAACNONE 
J080040F07CCAAGCCCATCAGGCCCACCAACNONE 
J080040H18CCAAGCCCATCAGGCCCACCAACNONE 
J080041E08CCAAGCCCATCAGGCCCACCAACNONE 
J080041E16CCAAGCCCATCAGGCCCACCAACNONE 
J080041L08CCAAGCCCATCAGGCCCACCAACNONE 
J080042A07CCAAGCCCATCAGGCCCACCAACNONE 
J080044E02CCAAGCCCATCAGGCCCACCAACNONE 
J080045K03CCAAGCCCATCAGGCCCACCAACNONE 
J080046O03CCAAGCCCATCAGGCCCACCAACNONE 
J080047F08CCAAGCCCATCAGGCCCACCAACNONE 
J080048H01CCAAGCCCATCAGGCCCACCAACNONE 
J080048I05CCAAGCCCATCAGGCCCACCAACNONE 
J080048N06CCAAGCCCATCAGGCCCACCAACNONE 
J080050A07CCAAGCCCATCAGGCCCACCAACNONE 
J080050B04CCAAGCCCATCAGGCCCACCAACNONE 
J080050E21CCAAGCCCATCAGGCCCACCAACNONE 
J080051J01CCAAGCCCATCAGGCCCACCAACNONE 
J080051K02CCAAGCCCATCAGGCCCACCAACNONE 
J080051L02CCAAGCCCATCAGGCCCACCAACNONE 
J080052C20CCAAGCCCATCAGGCCCACCAACNONE 
J080052I22CCAAGCCCATCAGGCCCACCAACNONE 
J080052J21CCAAGCCCATCAGGCCCACCAACNONE 
J080052K22CCAAGCCCATCAGGCCCACCAACNONE 
J080055A05CCAAGCCCATCAGGCCCACCAACNONE 
J080055I12CCAAGCCCATCAGGCCCACCAACNONE 
J080056A21CCAAGCCCATCAGGCCCACCAACNONE 
J080056N11CCAAGCCCATCAGGCCCACCAACNONE 
J080057D02CCAAGCCCATCAGGCCCACCAACNONE 
J080058H21CCAAGCCCATCAGGCCCACCAACNONE 
J080058P16CCAAGCCCATCAGGCCCACCAACNONE 
J080059M03CCAAGCCCATCAGGCCCACCAACNONE 
J080059N17CCAAGCCCATCAGGCCCACCAACNONE 
J080060F13CCAAGCCCATCAGGCCCACCAACNONE 
J080060H06CCAAGCCCATCAGGCCCACCAACNONE 
J080060J03CCAAGCCCATCAGGCCCACCAACNONE 
J080060O09CCAAGCCCATCAGGCCCACCAACNONE 
J080060P22CCAAGCCCATCAGGCCCACCAACNONE 
J080061F06CCAAGCCCATCAGGCCCACCAACNONE 
J080061H21CCAAGCCCATCAGGCCCACCAACNONE 
J080061O13CCAAGCCCATCAGGCCCACCAACNONE 
J080062J07CCAAGCCCATCAGGCCCACCAACNONE 
J080063A08CCAAGCCCATCAGGCCCACCAACNONE 
J080063F19CCAAGCCCATCAGGCCCACCAACNONE 
J080063O18CCAAGCCCATCAGGCCCACCAACNONE 
J080065D15CCAAGCCCATCAGGCCCACCAACNONE 
J080066E13CCAAGCCCATCAGGCCCACCAACNONE 
J080068L01CCAAGCCCATCAGGCCCACCAACNONE 
J080068P07CCAAGCCCATCAGGCCCACCAACNONE 
J080069I21CCAAGCCCATCAGGCCCACCAACNONE 
J080070M04CCAAGCCCATCAGGCCCACCAACNONE 
J080071E01CCAAGCCCATCAGGCCCACCAACNONE 
J080071J08CCAAGCCCATCAGGCCCACCAACNONE 
J080071M23CCAAGCCCATCAGGCCCACCAACNONE 
J080072A03CCAAGCCCATCAGGCCCACCAACNONE 
J080072G18CCAAGCCCATCAGGCCCACCAACNONE 
J080075A04CCAAGCCCATCAGGCCCACCAACNONE 
J080075E19CCAAGCCCATCAGGCCCACCAACNONE 
J080075P18CCAAGCCCATCAGGCCCACCAACNONE 
J080076N11CCAAGCCCATCAGGCCCACCAACNONE 
J080077A11CCAAGCCCATCAGGCCCACCAACNONE 
J080077D22CCAAGCCCATCAGGCCCACCAACNONE 
J080077H18CCAAGCCCATCAGGCCCACCAACNONE 
J080077L03CCAAGCCCATCAGGCCCACCAACNONE 
J080078D02CCAAGCCCATCAGGCCCACCAACNONE 
J080078L05CCAAGCCCATCAGGCCCACCAACNONE 
J080078N20CCAAGCCCATCAGGCCCACCAACNONE 
J080079I20CCAAGCCCATCAGGCCCACCAACNONE 
J080081D04CCAAGCCCATCAGGCCCACCAACNONE 
J080082A07CCAAGCCCATCAGGCCCACCAACNONE 
J080082E24CCAAGCCCATCAGGCCCACCAACNONE 
J080084A22CCAAGCCCATCAGGCCCACCAACNONE 
J080084E15CCAAGCCCATCAGGCCCACCAACNONE 
J080084G06CCAAGCCCATCAGGCCCACCAACNONE 
J080086A05CCAAGCCCATCAGGCCCACCAACNONE 
J080086F09CCAAGCCCATCAGGCCCACCAACNONE 
J080087B11CCAAGCCCATCAGGCCCACCAACNONE 
J080087H12CCAAGCCCATCAGGCCCACCAACNONE 
J080088I05CCAAGCCCATCAGGCCCACCAACNONE 
J080088N08CCAAGCCCATCAGGCCCACCAACNONE 
J080088P07CCAAGCCCATCAGGCCCACCAACNONE 
J080089A09CCAAGCCCATCAGGCCCACCAACNONE 
J080089D21CCAAGCCCATCAGGCCCACCAACNONE 
J080089F24CCAAGCCCATCAGGCCCACCAACNONE 
J080089H22CCAAGCCCATCAGGCCCACCAACNONE 
J080089I04CCAAGCCCATCAGGCCCACCAACNONE 
J080090D01CCAAGCCCATCAGGCCCACCAACNONE 
J080091F09CCAAGCCCATCAGGCCCACCAACNONE 
J080091G18CCAAGCCCATCAGGCCCACCAACNONE 
J080091L24CCAAGCCCATCAGGCCCACCAACNONE 
J080091M12CCAAGCCCATCAGGCCCACCAACNONE 
J080091N12CCAAGCCCATCAGGCCCACCAACNONE 
J080093A15CCAAGCCCATCAGGCCCACCAACNONE 
J080093C08CCAAGCCCATCAGGCCCACCAACNONE 
J080093I08CCAAGCCCATCAGGCCCACCAACNONE 
J080093P21CCAAGCCCATCAGGCCCACCAACNONE 
J080094E18CCAAGCCCATCAGGCCCACCAACNONE 
J080094F15CCAAGCCCATCAGGCCCACCAACNONE 
J080094J21CCAAGCCCATCAGGCCCACCAACNONE 
J080095A09CCAAGCCCATCAGGCCCACCAACNONE 
J080096G05CCAAGCCCATCAGGCCCACCAACNONE 
J080096K07CCAAGCCCATCAGGCCCACCAACNONE 
J080097M17CCAAGCCCATCAGGCCCACCAACNONE 
J080097P21CCAAGCCCATCAGGCCCACCAACNONE 
J080302B15CCAAGCCCATCAGGCCCACCAACNONE 
J080306J15CCAAGCCCATCAGGCCCACCAACNONE 
J080306O13CCAAGCCCATCAGGCCCACCAACNONE 
J080307C15CCAAGCCCATCAGGCCCACCAACNONE 
J080307I04CCAAGCCCATCAGGCCCACCAACNONE 
J080307L05CCAAGCCCATCAGGCCCACCAACNONE 
J080308F11CCAAGCCCATCAGGCCCACCAACNONE 
J080311C04CCAAGCCCATCAGGCCCACCAACNONE 
J080311I07CCAAGCCCATCAGGCCCACCAACNONE 
J080312C01CCAAGCCCATCAGGCCCACCAACNONE 
J080312O08CCAAGCCCATCAGGCCCACCAACNONE 
J080315F14CCAAGCCCATCAGGCCCACCAACNONE 
J080318K13CCAAGCCCATCAGGCCCACCAACNONE 
J080319A17CCAAGCCCATCAGGCCCACCAACNONE 
J090001I01CCAAGCCCATCAGGCCCACCAACNONE 
J090002O18CCAAGCCCATCAGGCCCACCAACNONE 
J090007A08CCAAGCCCATCAGGCCCACCAACNONE 
J090007F22CCAAGCCCATCAGGCCCACCAACNONE 
J090008D09CCAAGCCCATCAGGCCCACCAACNONE 
J090008L07CCAAGCCCATCAGGCCCACCAACNONE 
J090008O08CCAAGCCCATCAGGCCCACCAACNONE 
J090012N11CCAAGCCCATCAGGCCCACCAACNONE 
J090013M05CCAAGCCCATCAGGCCCACCAACNONE 
J090020E08CCAAGCCCATCAGGCCCACCAACNONE 
J090020O20CCAAGCCCATCAGGCCCACCAACNONE 
J090021I10CCAAGCCCATCAGGCCCACCAACNONE 
J090023D07CCAAGCCCATCAGGCCCACCAACNONE 
J090023K22CCAAGCCCATCAGGCCCACCAACNONE 
J090023O08CCAAGCCCATCAGGCCCACCAACNONE 
J090028D21CCAAGCCCATCAGGCCCACCAACNONE 
J090029H14CCAAGCCCATCAGGCCCACCAACNONE 
J090029L12CCAAGCCCATCAGGCCCACCAACNONE 
J090030C05CCAAGCCCATCAGGCCCACCAACNONE 
J090031D18CCAAGCCCATCAGGCCCACCAACNONE 
J090032G10CCAAGCCCATCAGGCCCACCAACNONE 
J090034J22CCAAGCCCATCAGGCCCACCAACNONE 
J090034K16CCAAGCCCATCAGGCCCACCAACNONE 
J090036D10CCAAGCCCATCAGGCCCACCAACNONE 
J090037N17CCAAGCCCATCAGGCCCACCAACNONE 
J090043P17CCAAGCCCATCAGGCCCACCAACNONE 
J090044L20CCAAGCCCATCAGGCCCACCAACNONE 
J090045N16CCAAGCCCATCAGGCCCACCAACNONE 
J090048K03CCAAGCCCATCAGGCCCACCAACNONE 
J090048K10CCAAGCCCATCAGGCCCACCAACNONE 
J090049O07CCAAGCCCATCAGGCCCACCAACNONE 
J090055H23CCAAGCCCATCAGGCCCACCAACNONE 
J090056G12CCAAGCCCATCAGGCCCACCAACNONE 
J090056G16CCAAGCCCATCAGGCCCACCAACNONE 
J090059B16CCAAGCCCATCAGGCCCACCAACNONE 
J090066H21CCAAGCCCATCAGGCCCACCAACNONE 
J090067D22CCAAGCCCATCAGGCCCACCAACNONE 
J090072M07CCAAGCCCATCAGGCCCACCAACNONE 
J090073J21CCAAGCCCATCAGGCCCACCAACNONE 
J090075A15CCAAGCCCATCAGGCCCACCAACNONE 
J090079J09CCAAGCCCATCAGGCCCACCAACNONE 
J090080L07CCAAGCCCATCAGGCCCACCAACNONE 
J090084A03CCAAGCCCATCAGGCCCACCAACNONE 
J090085B07CCAAGCCCATCAGGCCCACCAACNONE 
J090088H11CCAAGCCCATCAGGCCCACCAACNONE 
J090090J12CCAAGCCCATCAGGCCCACCAACNONE 
J090091I21CCAAGCCCATCAGGCCCACCAACNONE 
J090091L02CCAAGCCCATCAGGCCCACCAACNONE 
J090093G18CCAAGCCCATCAGGCCCACCAACNONE 
J090094D23CCAAGCCCATCAGGCCCACCAACNONE 
J090098L19CCAAGCCCATCAGGCCCACCAACNONE 
J100017I22CCAAGCCCATCAGGCCCACCAACNONE 
J100018F08CCAAGCCCATCAGGCCCACCAACNONE 
J100018G19CCAAGCCCATCAGGCCCACCAACNONE 
J100019B05CCAAGCCCATCAGGCCCACCAACNONE 
J100019J18CCAAGCCCATCAGGCCCACCAACNONE 
J100019L04CCAAGCCCATCAGGCCCACCAACNONE 
J100023M06CCAAGCCCATCAGGCCCACCAACNONE 
J100024J23CCAAGCCCATCAGGCCCACCAACNONE 
J100024P09CCAAGCCCATCAGGCCCACCAACNONE 
J100027I05CCAAGCCCATCAGGCCCACCAACNONE 
J100029G03CCAAGCCCATCAGGCCCACCAACNONE 
J100029K08CCAAGCCCATCAGGCCCACCAACNONE 
J100031J17CCAAGCCCATCAGGCCCACCAACNONE 
J100037L16CCAAGCCCATCAGGCCCACCAACNONE 
J100038C05CCAAGCCCATCAGGCCCACCAACNONE 
J100039D19CCAAGCCCATCAGGCCCACCAACNONE 
J100041L02CCAAGCCCATCAGGCCCACCAACNONE 
J100045B08CCAAGCCCATCAGGCCCACCAACNONE 
J100045B15CCAAGCCCATCAGGCCCACCAACNONE 
J100047G07CCAAGCCCATCAGGCCCACCAACNONE 
J100047P19CCAAGCCCATCAGGCCCACCAACNONE 
J100048I15CCAAGCCCATCAGGCCCACCAACNONE 
J100049M16CCAAGCCCATCAGGCCCACCAACNONE 
J100049P18CCAAGCCCATCAGGCCCACCAACNONE 
J100050E21CCAAGCCCATCAGGCCCACCAACNONE 
J100051N02CCAAGCCCATCAGGCCCACCAACNONE 
J100052M02CCAAGCCCATCAGGCCCACCAACNONE 
J100055M24CCAAGCCCATCAGGCCCACCAACNONE 
J100056K11CCAAGCCCATCAGGCCCACCAACNONE 
J100059F20CCAAGCCCATCAGGCCCACCAACNONE 
J100059J15CCAAGCCCATCAGGCCCACCAACNONE 
J100068C19CCAAGCCCATCAGGCCCACCAACNONE 
J100068G06CCAAGCCCATCAGGCCCACCAACNONE 
J100069N02CCAAGCCCATCAGGCCCACCAACNONE 
J100073N04CCAAGCCCATCAGGCCCACCAACNONE 
J100074B05CCAAGCCCATCAGGCCCACCAACNONE 
J100080P13CCAAGCCCATCAGGCCCACCAACNONE 
J100083P09CCAAGCCCATCAGGCCCACCAACNONE 
J100084B11CCAAGCCCATCAGGCCCACCAACNONE 
J100085B07CCAAGCCCATCAGGCCCACCAACNONE 
J100086O20CCAAGCCCATCAGGCCCACCAACNONE 
J100087B02CCAAGCCCATCAGGCCCACCAACNONE 
J100089B14CCAAGCCCATCAGGCCCACCAACNONE 
Os08g0137250J075030L12AAAAGCCCATTTAGCCCATCCANONE 
J075037O21AAAAGCCCATTTAGCCCATCCANONE 
J075078E23AAAAGCCCATTTAGCCCATCCANONE 
J075079C23AAAAGCCCATTTAGCCCATCCANONE 
J075092K02AAAAGCCCATTTAGCCCATCCANONE 
J075108M04AAAAGCCCATTTAGCCCATCCANONE 
J075112N13AAAAGCCCATTTAGCCCATCCANONE 
J075132M13AAAAGCCCATTTAGCCCATCCANONE 
J075146E07AAAAGCCCATTTAGCCCATCCANONE 
J075159F16AAAAGCCCATTTAGCCCATCCANONE 
J075166M12AAAAGCCCATTTAGCCCATCCANONE 
J075185B10AAAAGCCCATTTAGCCCATCCANONE 
J075193J10AAAAGCCCATTTAGCCCATCCANONE 
Os08g0139100006-027-E12TAAGCCCATCTNONE 
006-089-E06TAAGCCCATCTNONE 
006-113-G02TAAGCCCATCTNONE 
AK061429TAAGCCCATCTNONE 
AK099590TAAGCCCATCTSimilar to DAG protein, chloroplast precursor. 
AK104727TAAGCCCATCTNONE 
J013043H11TAAGCCCATCTNONE 
J013049N13TAAGCCCATCTNONE 
J065079F01TAAGCCCATCTNONE 
J065122N24TAAGCCCATCTNONE 
J065142J24TAAGCCCATCTNONE 
J065193N03TAAGCCCATCTNONE 
J075041I21TAAGCCCATCTNONE 
J075145E04TAAGCCCATCTNONE 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0156900AJ605583AAAGCCCATGTNONE 
AK073344AAAGCCCATGTSpo11/DNA topoisomerase VI, subunit A family protein. 
AK106397AAAGCCCATGTNONE 
Os08g0206600AK064336AAAGCCCATCAAICARFT/IMPCHase bienzyme family protein. 
AK102764AAAGCCCATCANONE 
Os08g0278100014-004-D02TAAGCCCATCANONE 
AK063626TAAGCCCATCAConserved hypothetical protein. 
Os08g0322400AK120116AAATGGGCTTGGNucleotide-binding, alpha-beta plait domain containing protein. 
J013025M20AAATGGGCTTGGNONE 
J013096J15AAATGGGCTTGGNONE 
Os08g0327400AK070992CGATGGGCTTCSimilar to Enoyl-ACP reductase (Fragment). 
J023077K10CGATGGGCTTCNONE 
J065075F06CGATGGGCTTCNONE 
J065112N14CGATGGGCTTCNONE 
J090028K07CGATGGGCTTCNONE 
J090039C15CGATGGGCTTCNONE 
J090048I11CGATGGGCTTCNONE 
J090083M10CGATGGGCTTCNONE 
Os08g0346400003-103-D08ACATGGGCTTTTNONE 
009-135-G12ACATGGGCTTTTNONE 
AK059644ACATGGGCTTTTNONE 
AK062928ACATGGGCTTTTNONE 
AK103873ACATGGGCTTTTSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
J033149L11ACATGGGCTTTTNONE 
J065137E08ACATGGGCTTTTNONE 
J065194M22ACATGGGCTTTTNONE 
J075083O16ACATGGGCTTTTNONE 
Os08g0386300AK059323TAAGCCCATTGGGCTGANONE 
AK070379TAAGCCCATTGGGCTGACytochrome b5 domain containing protein. 
J023054P20TAAGCCCATTGGGCTGANONE 
J033089H01TAAGCCCATTGGGCTGANONE 
J065013I01TAAGCCCATTGGGCTGANONE 
J065212E17TAAGCCCATTGGGCTGANONE 
J080317O15TAAGCCCATTGGGCTGANONE 
J090018O07TAAGCCCATTGGGCTGANONE 
Os08g0489300AK059000GAAGCCCATATNONE 
AK104597GAAGCCCATATDNA glycosylase family protein. 
J013160G13GAAGCCCATATNONE 
J100078P21GAAGCCCATATNONE 
Os08g0504400014-015-C10CCAAGCCCATGGGCCCTNONE 
AK069190CCAAGCCCATGGGCCCTSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089CCAAGCCCATGGGCCCTNONE 
J023006O19CCAAGCCCATGGGCCCTNONE 
J033041C11CCAAGCCCATGGGCCCTNONE 
Os08g0517900015-019-D06AAAAGCCCATTACGGCCCACACNONE 
015-019-D06CAAGCCCATTANONE 
AK064304AAAAGCCCATTACGGCCCACACSimilar to 30S ribosomal protein S16. 
AK064304CAAGCCCATTASimilar to 30S ribosomal protein S16. 
Os08g0521400006-047-C11TAAGCCCATGGNONE 
016-014-E07TAAGCCCATGGNONE 
AK070148TAAGCCCATGGNONE 
AK101704TAAGCCCATGGZinc finger, RanBP2-type domain containing protein. 
AK105045TAAGCCCATGGNONE 
J013108K14TAAGCCCATGGNONE 
J013129E16TAAGCCCATGGNONE 
J013159M23TAAGCCCATGGNONE 
J023041G22TAAGCCCATGGNONE 
J033060G13TAAGCCCATGGNONE 
J033060J15TAAGCCCATGGNONE 
J065120J24TAAGCCCATGGNONE 
J065160I01TAAGCCCATGGNONE 
J065179A16TAAGCCCATGGNONE 
J065189K04TAAGCCCATGGNONE 
J090032O15TAAGCCCATGGNONE 
J090045A18TAAGCCCATGGNONE 
J090060B21TAAGCCCATGGNONE 
J090086F23TAAGCCCATGGNONE 
J090098O22TAAGCCCATGGNONE 
J100018K20TAAGCCCATGGNONE 
J100048P22TAAGCCCATGGNONE 
J100052I06TAAGCCCATGGNONE 
Os08g0526500016-063-D04CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
016-063-D04TGATGGGCTTTNONE 
AK073431CCAGCCCAGTTAGGCCCAAGCCCATTASimilar to SOX-1 protein. 
AK073431TGATGGGCTTTSimilar to SOX-1 protein. 
J033042D10CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
J033042D10TGATGGGCTTTNONE 
J065019E02CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
J065019E02TGATGGGCTTTNONE 
Os08g0548900006-043-D07CCATGGGCTTTNONE 
006-043-H11CCATGGGCTTTNONE 
006-081-G06CCATGGGCTTTNONE 
006-109-E04CCATGGGCTTTNONE 
011-033-E04CCATGGGCTTTNONE 
AK061808CCATGGGCTTTSimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK098875CCATGGGCTTTNONE 
J013001D12CCATGGGCTTTNONE 
J033126N14CCATGGGCTTTNONE 
J053069M09CCATGGGCTTTNONE 
J053098E10CCATGGGCTTTNONE 
J053101C24CCATGGGCTTTNONE 
J065002F21CCATGGGCTTTNONE 
J065006C22CCATGGGCTTTNONE 
J065076J02CCATGGGCTTTNONE 
J065134M22CCATGGGCTTTNONE 
J075007M19CCATGGGCTTTNONE 
J075040I11CCATGGGCTTTNONE 
J075047E20CCATGGGCTTTNONE 
J075052D22CCATGGGCTTTNONE 
J075076L13CCATGGGCTTTNONE 
J075157P22CCATGGGCTTTNONE 
J075161M18CCATGGGCTTTNONE 
J075168P22CCATGGGCTTTNONE 
J075181E04CCATGGGCTTTNONE 
U92540CCATGGGCTTTNONE 
Os08g0553450Os08g0553450GAAGCCCATGAHypothetical protein. 
Os08g0558000J080005K14GAAGCCCATACNONE 
Os09g0103300009-007-D10AAAAGCCCATATNONE 
AK062317AAAAGCCCATATHypothetical protein. 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0392400AK106799TAAGCCCATTTNONE 
Os09g0397900AK101306ATATGGGCTTASimilar to FEG protein. 
AK101306ATATGGGCTTASimilar to FEG protein. 
Os09g0415700AK102287CAAGCCCATTProtein of unknown function DUF248, methyltransferase putative family protein. 
J013095G13CAAGCCCATTNONE 
J013128E08CAAGCCCATTNONE 
J023072N21CAAGCCCATTNONE 
J023083D13CAAGCCCATTNONE 
J023090E24CAAGCCCATTNONE 
J023097A14CAAGCCCATTNONE 
J023122E02CAAGCCCATTNONE 
J023130H06CAAGCCCATTNONE 
J033052I04CAAGCCCATTNONE 
J033071G04CAAGCCCATTNONE 
J033089J21CAAGCCCATTNONE 
J033090L16CAAGCCCATTNONE 
J033100P19CAAGCCCATTNONE 
J033102C11CAAGCCCATTNONE 
J033124H23CAAGCCCATTNONE 
J033129E23CAAGCCCATTNONE 
J043003I16CAAGCCCATTNONE 
J090029J24CAAGCCCATTNONE 
J090033P05CAAGCCCATTNONE 
J090068G20CAAGCCCATTNONE 
J090094K13CAAGCCCATTNONE 
Os09g0456900AK073236TATGGGCTTGGNucleic acid-binding, OB-fold domain containing protein. 
Os09g0509200AK069525AAAGCCCATCASimilar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1). 
Os09g0513900AK107699AAAGCCCATTTConserved hypothetical protein. 
Os09g0532600J013002F02TTTGGGCCAAGCCCATGTNONE 
Os09g0532800J065167K16CCAAGCCCATGTProtein prenyltransferase domain containing protein. 
Os09g0540600AK101798ATATGGGCTTTACGGCCCATAAAAGCCCATTANONE 
AK103397ATATGGGCTTTACGGCCCATAAAAGCCCATTASimilar to WD-40 repeat protein MSI1. 
Os09g0547200016-021-H03CAAGCCCATGNONE 
AK073078CAAGCCCATGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984CAAGCCCATGNONE 
J065005L05CAAGCCCATGNONE 
J065039C06CAAGCCCATGNONE 
J065116H17CAAGCCCATGNONE 
J100046A17CAAGCCCATGNONE 
Os09g0549700J053039F06TAATGGGCTTTCGGCCCATGTNONE 
J065089F23TAATGGGCTTTCGGCCCATGTRibosomal protein L18P/L5E family protein. 
J065090G14TAATGGGCTTTCGGCCCATGTNONE 
J065093M17TAATGGGCTTTCGGCCCATGTNONE 
J065096L23TAATGGGCTTTCGGCCCATGTNONE 
J065152A18TAATGGGCTTTCGGCCCATGTNONE 
J065155H12TAATGGGCTTTCGGCCCATGTNONE 
Os09g0554000J065123C23TTATGGGCTTATGGCCCATCASimilar to Mitochondrial phosphate transporter. 
Os09g0571400AK103109AGCCCATTAAGCCCATTCyclophilin 1. 
J023011A12AGCCCATTAAGCCCATTNONE 
J033119A20AGCCCATTAAGCCCATTNONE 
J053034N16AGCCCATTAAGCCCATTNONE 
J053045N23AGCCCATTAAGCCCATTNONE 
J053052J12AGCCCATTAAGCCCATTNONE 
J053052K04AGCCCATTAAGCCCATTNONE 
J053099M15AGCCCATTAAGCCCATTNONE 
J065071H23AGCCCATTAAGCCCATTNONE 
J065131B16AGCCCATTAAGCCCATTNONE 
J075003F19AGCCCATTAAGCCCATTNONE 
J075116F02AGCCCATTAAGCCCATTNONE 
J075126G05AGCCCATTAAGCCCATTNONE 
J075145E09AGCCCATTAAGCCCATTNONE 
J075149O22AGCCCATTAAGCCCATTNONE 
J075163A09AGCCCATTAAGCCCATTNONE 
J075194A09AGCCCATTAAGCCCATTNONE 
L29471AGCCCATTAAGCCCATTNONE 
Os09g0573200J013027J02TATGGGCTTGGNONE 
J013034M08TATGGGCTTGGNONE 
J013037L03TATGGGCTTGGNONE 
J013041D10TATGGGCTTGGNONE 
J013042D15TATGGGCTTGGNONE 
J013109H17TATGGGCTTGGNONE 
J013132A18TATGGGCTTGGNONE 
J013160N13TATGGGCTTGGNONE 
J013169I09TATGGGCTTGGNONE 
J023029F18TATGGGCTTGGNONE 
J023041A02TATGGGCTTGGNONE 
J023097B14TATGGGCTTGGNONE 
J023142I04TATGGGCTTGGNONE 
J023142N06TATGGGCTTGGNONE 
J033023I21TATGGGCTTGGNONE 
J033032G15TATGGGCTTGGNONE 
J033042M17TATGGGCTTGGNONE 
J033070F09TATGGGCTTGGNONE 
J053063L09TATGGGCTTGGNONE 
J053064A09TATGGGCTTGGNONE 
J065073M19TATGGGCTTGGNONE 
J075005H11TATGGGCTTGGNONE 
J075026D12TATGGGCTTGGNONE 
J075043G07TATGGGCTTGGNONE 
J075084N05TATGGGCTTGGNONE 
J075092D05TATGGGCTTGGNONE 
J075110E24TATGGGCTTGGNONE 
J075176I05TATGGGCTTGGNONE 
J090009H19TATGGGCTTGGNONE 
J090025K11TATGGGCTTGGNONE 
J090049E20TATGGGCTTGGNONE 
J090070G02TATGGGCTTGGNONE 
Os11g0116400AK059833GCTGGGCCGATGGGCTTCSimilar to Elongation factor P (EF-P). 
Os11g0126900012-037-D04CCAAGCCCATNONE 
015-046-E12CCAAGCCCATNONE 
015-069-A05CCAAGCCCATNONE 
AK069257CCAAGCCCATSimilar to NAC domain transcription factor. 
J023011O06CCAAGCCCATNONE 
J065091E09CCAAGCCCATNONE 
J075021C14CCAAGCCCATNONE 
J075035D07CCAAGCCCATNONE 
J075084B04CCAAGCCCATNONE 
J075171O09CCAAGCCCATNONE 
J075199M23CCAAGCCCATNONE 
Os11g0128400AK102291GAAGCCCATATCDC45-like protein family protein. 
J033089K18GAAGCCCATATNONE 
Os11g0131200J065024D18AAAGCCCATCAMpv17/PMP22 family protein. 
J065206C17AAAGCCCATCANONE 
Os11g0175500015-087-F02TCAGGCCCATGAAAGCCCATGTNONE 
AK064320TCAGGCCCATGAAAGCCCATGTZinc finger, RING-type domain containing protein. 
AK101592TCAGGCCCATGAAAGCCCATGTNONE 
Os11g0210500AK070886GAAGCCCATCTNONE 
J023069O03GAAGCCCATCTNONE 
J100038M22GAAGCCCATCTNONE 
J100066M06GAAGCCCATCTNONE 
Os11g0227600AK101375TAATGGGCTTAGCGTGGGCCGGAConserved hypothetical protein. 
AK102193TAATGGGCTTAGCGTGGGCCGGANONE 
J033087C03TAATGGGCTTAGCGTGGGCCGGANONE 
Os11g0231400AK108047TAATGGGCTTCProtein of unknown function DUF295 family protein. 
Os11g0531700006-023-B12GAAGCCCATCTNONE 
AK059751GAAGCCCATCTNUDIX hydrolase domain containing protein. 
AK099204GAAGCCCATCTNONE 
Os11g0543100AK108274ACATGGGCTTTTConserved hypothetical protein. 
Os11g0545800AK073687CCACGGCCCACCAAGCCCATCCARegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCACGGCCCACCAAGCCCATCCANONE 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os11g0616200AK069189ATATGGGCTTTCGGCCCAAATConserved hypothetical protein. 
J023004N19ATATGGGCTTTCGGCCCAAATNONE 
Os11g0641800AK066963ATATGGGCTTGGCupredoxin domain containing protein. 
J013023J11ATATGGGCTTGGNONE 
J013058D03ATATGGGCTTGGNONE 
J013093P21ATATGGGCTTGGNONE 
J013120G19ATATGGGCTTGGNONE 
Os11g0657200AK059959TCATGGGCTTT2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07AAAGCCCATGANONE 
AK062752AAAGCCCATGASimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os12g0120000011-024-E09AAAGCCCATATNONE 
AK105399AAAGCCCATATProtein of unknown function DUF936, plant family protein. 
Os12g0120400AK099904TGATGGGCTTGSimilar to ATPase-like protein. 
J065169A07TGATGGGCTTGNONE 
Os12g0133600AK103096AGATGGGCTTGConserved hypothetical protein. 
J033118M03AGATGGGCTTGNONE 
Os12g0146300J065162K17TAAGCCCATCAHypothetical protein. 
Os12g0167900005-004-A06AAAAGCCCATTNONE 
005-004-A06CAAGCCCATTNONE 
006-024-H01AAAAGCCCATTNONE 
006-024-H01CAAGCCCATTNONE 
006-044-H12AAAAGCCCATTNONE 
006-044-H12CAAGCCCATTNONE 
006-053-B08AAAAGCCCATTNONE 
006-053-B08CAAGCCCATTNONE 
015-080-F12AAAAGCCCATTNONE 
015-080-F12CAAGCCCATTNONE 
AK060925AAAAGCCCATT60S ribosomal protein L3. 
AK060925CAAGCCCATT60S ribosomal protein L3. 
D10403AAAAGCCCATTNONE 
D10403CAAGCCCATTNONE 
D12630AAAAGCCCATTNONE 
D12630CAAGCCCATTNONE 
J013046A17AAAAGCCCATTNONE 
J013046A17CAAGCCCATTNONE 
J013048A16AAAAGCCCATTNONE 
J013048A16CAAGCCCATTNONE 
J013057L14AAAAGCCCATTNONE 
J013057L14CAAGCCCATTNONE 
J023058G08AAAAGCCCATTNONE 
J023058G08CAAGCCCATTNONE 
J023058I08AAAAGCCCATTNONE 
J023058I08CAAGCCCATTNONE 
J023078E17AAAAGCCCATTNONE 
J023078E17CAAGCCCATTNONE 
J023087E03AAAAGCCCATTNONE 
J023087E03CAAGCCCATTNONE 
J023097D18AAAAGCCCATTNONE 
J023097D18CAAGCCCATTNONE 
J023141E14AAAAGCCCATTNONE 
J023141E14CAAGCCCATTNONE 
J023150P21AAAAGCCCATTNONE 
J023150P21CAAGCCCATTNONE 
J033045K05AAAAGCCCATTNONE 
J033045K05CAAGCCCATTNONE 
J033071G03AAAAGCCCATTNONE 
J033071G03CAAGCCCATTNONE 
J033071I15AAAAGCCCATTNONE 
J033071I15CAAGCCCATTNONE 
J033136D08AAAAGCCCATTNONE 
J033136D08CAAGCCCATTNONE 
J043012M21AAAAGCCCATTNONE 
J043012M21CAAGCCCATTNONE 
J043015C13AAAAGCCCATTNONE 
J043015C13CAAGCCCATTNONE 
J053031L19AAAAGCCCATTNONE 
J053031L19CAAGCCCATTNONE 
J053050C01AAAAGCCCATTNONE 
J053050C01CAAGCCCATTNONE 
J053055I20AAAAGCCCATTNONE 
J053055I20CAAGCCCATTNONE 
J053074B18AAAAGCCCATTNONE 
J053074B18CAAGCCCATTNONE 
J053091I08AAAAGCCCATTNONE 
J053091I08CAAGCCCATTNONE 
J053097N01AAAAGCCCATTNONE 
J053097N01CAAGCCCATTNONE 
J065058A02AAAAGCCCATTNONE 
J065058A02CAAGCCCATTNONE 
J065141H11AAAAGCCCATTNONE 
J065141H11CAAGCCCATTNONE 
J075019D10AAAAGCCCATTNONE 
J075019D10CAAGCCCATTNONE 
J075078G18AAAAGCCCATTNONE 
J075078G18CAAGCCCATTNONE 
J075094C12AAAAGCCCATTNONE 
J075094C12CAAGCCCATTNONE 
J075165H12AAAAGCCCATTNONE 
J075165H12CAAGCCCATTNONE 
J090011E05AAAAGCCCATTNONE 
J090011E05CAAGCCCATTNONE 
J090021H18AAAAGCCCATTNONE 
J090021H18CAAGCCCATTNONE 
J090027N07AAAAGCCCATTNONE 
J090027N07CAAGCCCATTNONE 
J090035F04AAAAGCCCATTNONE 
J090035F04CAAGCCCATTNONE 
J090050F21AAAAGCCCATTNONE 
J090050F21CAAGCCCATTNONE 
J090051M02AAAAGCCCATTNONE 
J090051M02CAAGCCCATTNONE 
J090060F21AAAAGCCCATTNONE 
J090060F21CAAGCCCATTNONE 
J090075G15AAAAGCCCATTNONE 
J090075G15CAAGCCCATTNONE 
J090092P11AAAAGCCCATTNONE 
J090092P11CAAGCCCATTNONE 
J090097B18AAAAGCCCATTNONE 
J090097B18CAAGCCCATTNONE 
J100019C17AAAAGCCCATTNONE 
J100019C17CAAGCCCATTNONE 
J100022O04AAAAGCCCATTNONE 
J100022O04CAAGCCCATTNONE 
J100034G13AAAAGCCCATTNONE 
J100034G13CAAGCCCATTNONE 
J100048A13AAAAGCCCATTNONE 
J100048A13CAAGCCCATTNONE 
J100050P18AAAAGCCCATTNONE 
J100050P18CAAGCCCATTNONE 
J100054B21AAAAGCCCATTNONE 
J100054B21CAAGCCCATTNONE 
J100062L01AAAAGCCCATTNONE 
J100062L01CAAGCCCATTNONE 
J100065E11AAAAGCCCATTNONE 
J100065E11CAAGCCCATTNONE 
J100074P09AAAAGCCCATTNONE 
J100074P09CAAGCCCATTNONE 
J100086E10AAAAGCCCATTNONE 
J100086E10CAAGCCCATTNONE 
Os12g0277500006-025-D06AGATGGGCTTCNONE 
AK061410AGATGGGCTTCNONE 
AK119217AGATGGGCTTCNONE 
AK119223AGATGGGCTTCNONE 
Os12g0481100AK073151GACGGCCCACGAAAGCCCATCASimilar to RNA helicase. 
Os12g0489400AK062351CATGGGCTTGHypothetical protein. 
Os12g0508300009-006-G07AAAAGCCCATTANONE 
009-133-E05AAAAGCCCATTANONE 
009-137-F10AAAAGCCCATTANONE 
014-024-A06AAAAGCCCATTANONE 
AK059123AAAAGCCCATTARibosomal protein S14 family protein. 
J100088E22AAAAGCCCATTANONE 
Os12g0540000AK108630TAATGGGCTTGGGCTConserved hypothetical protein. 
J065046N02TAATGGGCTTGGGCTNONE 
J065100H24TAATGGGCTTGGGCTNONE 
J065142M24TAATGGGCTTGGGCTNONE 
Os12g0564800AK103886ATATGGGCTTADisease resistance protein family protein. 
Os12g0572400016-084-F04AAAGCCCATAAGGCCCACCCNONE 
AK065531AAAGCCCATAAGGCCCACCCSimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03AAAGCCCATAAGGCCCACCCNONE 
J013034H02AAAGCCCATAAGGCCCACCCNONE 
J033117N05AAAGCCCATAAGGCCCACCCNONE 
J065027L09AAAGCCCATAAGGCCCACCCNONE 
J065037D09AAAGCCCATAAGGCCCACCCNONE 
J065197I09AAAGCCCATAAGGCCCACCCNONE 
J090045C01AAAGCCCATAAGGCCCACCCNONE 
J100031E11AAAGCCCATAAGGCCCACCCNONE 
Os12g0588900AK069966AAAGCCCATTGGGCCTGGConserved hypothetical protein. 
J023038A10AAAGCCCATTGGGCCTGGNONE 
J065061J23AAAGCCCATTGGGCCTGGNONE 
J065176O08AAAGCCCATTGGGCCTGGNONE 
J075143K13AAAGCCCATTGGGCCTGGNONE 
Os12g0592200Os12g0592200TAAGCCCATCGConserved hypothetical protein. 
Os12g0599900AK101252TAAGCCCATTTTetratricopeptide region domain containing protein. 
J033032F05TAAGCCCATTTNONE 
Os12g0634600009-019-G12TAATGGGCTTCNONE 
AK070357TAATGGGCTTCConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.