version

Summary of OsREG430 (All List)

OrganismOryza sativa  
IDOsREG430  
SequenceAAGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3824  

Entry Sequences (3824 entries)

LocusGene modelSequenceDescription
Os01g0132700J065063N10TCATGGGCCTTSurfeit locus 5 family protein. 
J065164N24TCATGGGCCTTNONE 
J065167H04TCATGGGCCTTNONE 
J065187N12TCATGGGCCTTNONE 
Os01g0155600006-048-F03TAATGGGCCTTNONE 
AK060171TAATGGGCCTTNONE 
AK071635TAATGGGCCTTSimilar to Splicing factor RSZ33. 
J023080A03TAATGGGCCTTNONE 
J023100L15TAATGGGCCTTNONE 
J033075I17TAATGGGCCTTNONE 
J033085O09TAATGGGCCTTNONE 
J033105E15TAATGGGCCTTNONE 
J033132N10TAATGGGCCTTNONE 
J033132P12TAATGGGCCTTNONE 
J033149H12TAATGGGCCTTNONE 
J043026M03TAATGGGCCTTNONE 
J080305J10TAATGGGCCTTNONE 
J080308K03TAATGGGCCTTNONE 
J090023M04TAATGGGCCTTNONE 
J090078F24TAATGGGCCTTNONE 
J100066P05TAATGGGCCTTNONE 
Os01g0157900AK072658CTTGGGCTGGGCCGGCTGGGCCTTProtein of unknown function Cys-rich family protein. 
Os01g0171200AK107515ACGTGGGCCTTGNONE 
AK109475ACGTGGGCCTTGConserved hypothetical protein. 
Os01g0172000012-070-G06GGATGGGCCTTNONE 
AK068405GGATGGGCCTTALG3 family protein. 
J013149A07GGATGGGCCTTNONE 
J053047H05GGATGGGCCTTNONE 
J065075N03GGATGGGCCTTNONE 
J065093G22GGATGGGCCTTNONE 
J065130N21GGATGGGCCTTNONE 
J065143P05GGATGGGCCTTNONE 
J065216H07GGATGGGCCTTNONE 
J075013B06GGATGGGCCTTNONE 
J075196M05GGATGGGCCTTNONE 
J100039G24GGATGGGCCTTNONE 
J100041B11GGATGGGCCTTNONE 
J100069A16GGATGGGCCTTNONE 
J100069L12GGATGGGCCTTNONE 
J100074P16GGATGGGCCTTNONE 
Os01g0191100009-011-A02CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-028-D05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-058-B11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-151-D09CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-026-G03CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-063-F04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-069-B05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-029-E04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-072-H04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-089-E09CCACCTGTGGGCCTTCTGGGCTTTTNONE 
015-047-G05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
016-033-G06CCACCTGTGGGCCTTCTGGGCTTTTNONE 
AK058815CCACCTGTGGGCCTTCTGGGCTTTTSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023077K21CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023081F19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033052N11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033058N11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033114G05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033114O17CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033129L14CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J053029I12CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065067N19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065084I19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065099O03CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065201I08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075035B08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075037B22CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075054L16CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075059D15CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075164I08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075185J01CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090042O06CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090044F12CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090063L02CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090073I10CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090078E18CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J100072K16CCACCTGTGGGCCTTCTGGGCTTTTNONE 
Os01g0191800AK061360AGCCCATAAAGGCCCACCTNONE 
Os01g0221300011-021-E12AAGGCCCAATTNONE 
AK073330AAGGCCCAATTConserved hypothetical protein. 
J013130J18AAGGCCCAATTNONE 
J033024A12AAGGCCCAATTNONE 
J065063H09AAGGCCCAATTNONE 
J065093G05AAGGCCCAATTNONE 
J090007K12AAGGCCCAATTNONE 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
AK069972CAAGGCCCAACASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075090M12CAAGGCCCAACANONE 
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075146A12CAAGGCCCAACANONE 
Os01g0250600J075046P13AAGGCCCAAAANONE 
Os01g0269100011-080-F08AAGGCCCAAACNONE 
AK067610AAGGCCCAAACSimilar to Rab proteins geranylgeranyltransferase component A 2 (Rab escort protein 2) (REP-2) (Choroideraemia-like protein). 
J013059P18AAGGCCCAAACNONE 
J013112F12AAGGCCCAAACNONE 
J023002M17AAGGCCCAAACNONE 
J023022J24AAGGCCCAAACNONE 
J033050A10AAGGCCCAAACNONE 
J033091A17AAGGCCCAAACNONE 
J033123E17AAGGCCCAAACNONE 
J033143H04AAGGCCCAAACNONE 
J043005H18AAGGCCCAAACNONE 
J075038A05AAGGCCCAAACNONE 
J075091K23AAGGCCCAAACNONE 
J075118O05AAGGCCCAAACNONE 
J075195P17AAGGCCCAAACNONE 
J090027J21AAGGCCCAAACNONE 
J100024I09AAGGCCCAAACNONE 
J100032D15AAGGCCCAAACNONE 
J100071I02AAGGCCCAAACNONE 
J100080E01AAGGCCCAAACNONE 
J100086A08AAGGCCCAAACNONE 
Os01g0277500AK066984AAGGCCCATASimilar to Dof3 gene (Fragment). 
J013074F19AAGGCCCATANONE 
J013091E10AAGGCCCATANONE 
J023077C19AAGGCCCATANONE 
J033068A02AAGGCCCATANONE 
J065137O05AAGGCCCATANONE 
Os01g0295900J065076G19AAGGCCCAATNONE 
Os01g0348700009-125-H02CAAGGCCCAATCGGCCCACAANONE 
009-156-F08CAAGGCCCAATCGGCCCACAANONE 
009-177-A11CAAGGCCCAATCGGCCCACAANONE 
009-195-D02CAAGGCCCAATCGGCCCACAANONE 
013-040-B06CAAGGCCCAATCGGCCCACAANONE 
013-051-B09CAAGGCCCAATCGGCCCACAANONE 
AK120842CAAGGCCCAATCGGCCCACAASimilar to 60S ribosomal protein L23a (L25). 
J013071O22CAAGGCCCAATCGGCCCACAANONE 
J023022J07CAAGGCCCAATCGGCCCACAANONE 
J033028J08CAAGGCCCAATCGGCCCACAANONE 
J033109M11CAAGGCCCAATCGGCCCACAANONE 
J043022K15CAAGGCCCAATCGGCCCACAANONE 
J043031N11CAAGGCCCAATCGGCCCACAANONE 
J053023I10CAAGGCCCAATCGGCCCACAANONE 
J053045F16CAAGGCCCAATCGGCCCACAANONE 
J053054F22CAAGGCCCAATCGGCCCACAANONE 
J053094P15CAAGGCCCAATCGGCCCACAANONE 
J065048F01CAAGGCCCAATCGGCCCACAANONE 
J075012F16CAAGGCCCAATCGGCCCACAANONE 
J075089C09CAAGGCCCAATCGGCCCACAANONE 
J075179J20CAAGGCCCAATCGGCCCACAANONE 
J080305E19CAAGGCCCAATCGGCCCACAANONE 
J080309B21CAAGGCCCAATCGGCCCACAANONE 
J090017L05CAAGGCCCAATCGGCCCACAANONE 
J090058B11CAAGGCCCAATCGGCCCACAANONE 
Os01g0514300AK121086TGATGGGCCTTLissencephaly type-1-like homology motif domain containing protein. 
Os01g0530300AK111105AAGGCCCAATTGGGCCGAHypothetical protein. 
AK111105AAGGCCCAGCCCATACHypothetical protein. 
J090023M11AAGGCCCAATTGGGCCGANONE 
J090023M11AAGGCCCAGCCCATACNONE 
J090053G13AAGGCCCAATTGGGCCGANONE 
J090053G13AAGGCCCAGCCCATACNONE 
Os01g0530400016-019-E07AAGGCCCAACNONE 
AK103724AAGGCCCAACNONE 
AK106476AAGGCCCAACGlutaredoxin-related protein family protein. 
J023108F14AAGGCCCAACNONE 
J033138C10AAGGCCCAACNONE 
Os01g0560200AK102003AAATGGGCAAGGCCCAATTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
J033079N06AAATGGGCAAGGCCCAATTNONE 
J065092F14AAATGGGCAAGGCCCAATTNONE 
J065106D04AAATGGGCAAGGCCCAATTNONE 
J065194K23AAATGGGCAAGGCCCAATTNONE 
Os01g0596300016-083-D09TCATGGGCCTTNONE 
AK069151TCATGGGCCTTCyclin-like F-box domain containing protein. 
J023007D17TCATGGGCCTTNONE 
J065141M02TCATGGGCCTTNONE 
Os01g0618500011-019-D03TGATGGGCCTTNONE 
AK067476TGATGGGCCTTSimilar to RNA helicase (Fragment). 
J013020E19TGATGGGCCTTNONE 
J033046J12TGATGGGCCTTNONE 
J033055D06TGATGGGCCTTNONE 
Os01g0621700AK108938AAGGCCCAAAMyosin tail 2 domain containing protein. 
J100033P13AAGGCCCAAANONE 
Os01g0660100AK108487AACTGGGCCTTConserved hypothetical protein. 
Os01g0662600009-056-E10AAGGCCCAGTNONE 
AK062234AAGGCCCAGTNONE 
AK098887AAGGCCCAGTNONE 
AK099656AAGGCCCAGTNONE 
AK119723AAGGCCCAGTSimilar to NifU-like protein. 
J013001K01AAGGCCCAGTNONE 
J013090F20AAGGCCCAGTNONE 
J013119A14AAGGCCCAGTNONE 
J013121P12AAGGCCCAGTNONE 
J033132I15AAGGCCCAGTNONE 
J075023F22AAGGCCCAGTNONE 
J075023M13AAGGCCCAGTNONE 
J100024D10AAGGCCCAGTNONE 
J100024N01AAGGCCCAGTNONE 
J100026H09AAGGCCCAGTNONE 
J100027H07AAGGCCCAGTNONE 
J100045K07AAGGCCCAGTNONE 
J100057K18AAGGCCCAGTNONE 
J100085C22AAGGCCCAGTNONE 
Os01g0680400AK067914AAGGCCCACGCGTAFII28-like protein family protein. 
J065039K13AAGGCCCACGCGNONE 
J065042K22AAGGCCCACGCGNONE 
J080016E23AAGGCCCACGCGNONE 
J080064E22AAGGCCCACGCGNONE 
Os01g0681100016-048-E04TTTTGGGCCTTGNONE 
AK072230TTTTGGGCCTTGSimilar to Dynamin-related protein 1B (Dynamin-like protein B). 
J023002D21TTTTGGGCCTTGNONE 
J033136O22TTTTGGGCCTTGNONE 
Os01g0707300AK059962TGTTGGGCCTTNONE 
AK104463TGTTGGGCCTTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0708600AK111377AAGGCCCATGGTransport protein particle (TRAPP) component, Bet3 family protein. 
J065006D07AAGGCCCATGGNONE 
J065007E03AAGGCCCATGGNONE 
J065015A13AAGGCCCATGGNONE 
J065093J17AAGGCCCATGGNONE 
J065116C09AAGGCCCATGGNONE 
J065120E04AAGGCCCATGGNONE 
J065197I17AAGGCCCATGGNONE 
J065208L13AAGGCCCATGGNONE 
J065213P07AAGGCCCATGGNONE 
J075056K07AAGGCCCATGGNONE 
J090036L08AAGGCCCATGGNONE 
Os01g0709500AK065353AAGGCCCATGGNONE 
AK121129AAGGCCCATGGSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1). 
Os01g0710800013-097-E05TTTTGGGCCTTAGGCCCATATNONE 
AK069973TTTTGGGCCTTAGGCCCATATNONE 
AK071099TTTTGGGCCTTAGGCCCATATConserved hypothetical protein. 
J023081K01TTTTGGGCCTTAGGCCCATATNONE 
J023123E16TTTTGGGCCTTAGGCCCATATNONE 
J033066B11TTTTGGGCCTTAGGCCCATATNONE 
J065144G11TTTTGGGCCTTAGGCCCATATNONE 
Os01g0715800011-061-G06TGTTGGGCCTTNONE 
AK063369TGTTGGGCCTTConserved hypothetical protein. 
J065194O22TGTTGGGCCTTNONE 
Os01g0727900AK102017AAGGCCCATGAConserved hypothetical protein. 
J033080F19AAGGCCCATGANONE 
Os01g0737900012-087-D12AAGGCCCATTGGGCCTTNONE 
AK072600AAGGCCCATTGGGCCTTProtein prenyltransferase domain containing protein. 
J023006E12AAGGCCCATTGGGCCTTNONE 
J023130A18AAGGCCCATTGGGCCTTNONE 
J023134O05AAGGCCCATTGGGCCTTNONE 
Os01g0742400AK109885AGTTGGGCCTTNONE 
AK119360AGTTGGGCCTTNONE 
AK120741AGTTGGGCCTTProtein kinase-like domain containing protein. 
J023003P18AGTTGGGCCTTNONE 
Os01g0743400AK059177TCGTGGGCCTTSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114TCGTGGGCCTTNONE 
J065070E07TCGTGGGCCTTNONE 
J065152G11TCGTGGGCCTTNONE 
Os01g0749200006-074-H04AAGGCCCATCTNONE 
AK072760AAGGCCCATCTNONE 
AK099041AAGGCCCATCTNONE 
AK104146AAGGCCCATCTSimilar to 50S ribosomal protein L13. 
AK119189AAGGCCCATCTNONE 
Os01g0801700AK073813AAATGGGCCTTConserved hypothetical protein. 
J033067K14AAATGGGCCTTNONE 
Os01g0805000009-045-H11AAGGCCCATGANONE 
009-196-H08AAGGCCCATGANONE 
J013094D22AAGGCCCATGARibosomal protein L34 family protein. 
J013119F23AAGGCCCATGANONE 
J065128B11AAGGCCCATGANONE 
Os01g0805800006-057-H04CAAGGCCCAATNONE 
006-106-H01CAAGGCCCAATNONE 
AK059963CAAGGCCCAATNONE 
AK103408CAAGGCCCAATRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0853700AK111988CAAGGCCCAATSimilar to MCB1 protein. 
J075050N16CAAGGCCCAATNONE 
J075117H23CAAGGCCCAATNONE 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
J065013G01CAGCCCAGCCCAAGGCCCACCANONE 
J065063D03CAGCCCAGCCCAAGGCCCACCANONE 
J065143H01CAGCCCAGCCCAAGGCCCACCANONE 
J065146F08CAGCCCAGCCCAAGGCCCACCANONE 
J065153D14CAGCCCAGCCCAAGGCCCACCANONE 
J065170E02CAGCCCAGCCCAAGGCCCACCANONE 
J065175M22CAGCCCAGCCCAAGGCCCACCANONE 
J065186E13CAGCCCAGCCCAAGGCCCACCANONE 
J075023J16CAGCCCAGCCCAAGGCCCACCANONE 
J075176J06CAGCCCAGCCCAAGGCCCACCANONE 
Os01g0887700AF045571TCTGGGCCTTGGGCCTTNONE 
AF047428TCTGGGCCTTGGGCCTTNONE 
AK071139TCTGGGCCTTGGGCCTTZinc finger, FYVE/PHD-type domain containing protein. 
J023082D05TCTGGGCCTTGGGCCTTNONE 
J065062L19TCTGGGCCTTGGGCCTTNONE 
J065116H15TCTGGGCCTTGGGCCTTNONE 
J065194N09TCTGGGCCTTGGGCCTTNONE 
J100074C19TCTGGGCCTTGGGCCTTNONE 
Os01g0889800003-107-A06CAAGGCCCATATNONE 
005-016-H12CAAGGCCCATATNONE 
AK070087CAAGGCCCATATRhodanese-like domain containing protein. 
AK104708CAAGGCCCATATNONE 
J013035D13CAAGGCCCATATNONE 
J013068K01CAAGGCCCATATNONE 
J023042J18CAAGGCCCATATNONE 
J053023F13CAAGGCCCATATNONE 
J053026M13CAAGGCCCATATNONE 
J053033N15CAAGGCCCATATNONE 
J053035I16CAAGGCCCATATNONE 
J053039A11CAAGGCCCATATNONE 
J053039K22CAAGGCCCATATNONE 
J053043B08CAAGGCCCATATNONE 
J053068K09CAAGGCCCATATNONE 
J053082D11CAAGGCCCATATNONE 
J053092N12CAAGGCCCATATNONE 
J053099A19CAAGGCCCATATNONE 
J065027F17CAAGGCCCATATNONE 
J065039B13CAAGGCCCATATNONE 
J065139N16CAAGGCCCATATNONE 
J065205B22CAAGGCCCATATNONE 
Os01g0894700009-177-F04AAGGCCCAGCCNONE 
009-177-F04AAGGCCCATTTNONE 
009-177-F04AGCCCAAAGGCCCATTTNONE 
AK067623AAGGCCCAGCCConserved hypothetical protein. 
AK067623AAGGCCCATTTConserved hypothetical protein. 
AK067623AGCCCAAAGGCCCATTTConserved hypothetical protein. 
AK104876AAGGCCCAGCCNONE 
AK104876AAGGCCCATTTNONE 
AK104876AGCCCAAAGGCCCATTTNONE 
J013095G01AAGGCCCAGCCNONE 
J013095G01AAGGCCCATTTNONE 
J013095G01AGCCCAAAGGCCCATTTNONE 
J013108L20AAGGCCCAGCCNONE 
J013108L20AAGGCCCATTTNONE 
J013108L20AGCCCAAAGGCCCATTTNONE 
J013120P13AAGGCCCAGCCNONE 
J013120P13AAGGCCCATTTNONE 
J013120P13AGCCCAAAGGCCCATTTNONE 
Os01g0916300011-018-B12TACTGGGCCTTNONE 
AK063922TACTGGGCCTTSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
AK103107TACTGGGCCTTNONE 
AK121061TACTGGGCCTTNONE 
AK121997TACTGGGCCTTNONE 
J033118P14TACTGGGCCTTNONE 
J065002N16TACTGGGCCTTNONE 
J065079B04TACTGGGCCTTNONE 
J065102J07TACTGGGCCTTNONE 
J065128F16TACTGGGCCTTNONE 
J065184D11TACTGGGCCTTNONE 
J065186A07TACTGGGCCTTNONE 
J075115C07TACTGGGCCTTNONE 
J075147C04TACTGGGCCTTNONE 
Os01g0929500AK111399AGTTGGGCCTTACTGGGCCGGTSimilar to Carbonyl reductase-like protein. 
AK120263AGTTGGGCCTTACTGGGCCGGTNONE 
Os01g0938900006-059-H02AAATGGGCCTTNONE 
009-074-D12AAATGGGCCTTNONE 
AK059437AAATGGGCCTTNONE 
AK101971AAATGGGCCTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK109341AAATGGGCCTTNONE 
J023121P08AAATGGGCCTTNONE 
J033046G24AAATGGGCCTTNONE 
J033048E04AAATGGGCCTTNONE 
J033048F04AAATGGGCCTTNONE 
J033076L24AAATGGGCCTTNONE 
J065173H07AAATGGGCCTTNONE 
J065184H09AAATGGGCCTTNONE 
Os01g0939700AK059803CAAGGCCCAGGNONE 
AK070588CAAGGCCCAGGSimilar to Esterase D (EC 3.1.1.1). 
AK111469CAAGGCCCAGGNONE 
J090021L11CAAGGCCCAGGNONE 
Os01g0948100AK111411CAAGGCCCAGATERCC4 domain containing protein. 
J090089O16CAAGGCCCAGATNONE 
Os01g0948300009-023-A03AGATGGGCCTTGNONE 
AK102153AGATGGGCCTTGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J013090K24AGATGGGCCTTGNONE 
J023019C13AGATGGGCCTTGNONE 
J023049L21AGATGGGCCTTGNONE 
J023066H02AGATGGGCCTTGNONE 
J033050A07AGATGGGCCTTGNONE 
J033086E01AGATGGGCCTTGNONE 
J033086F11AGATGGGCCTTGNONE 
J090047I04AGATGGGCCTTGNONE 
J100035E10AGATGGGCCTTGNONE 
J100040L06AGATGGGCCTTGNONE 
J100044G21AGATGGGCCTTGNONE 
J100045F13AGATGGGCCTTGNONE 
J100046G12AGATGGGCCTTGNONE 
J100075N10AGATGGGCCTTGNONE 
J100077I01AGATGGGCCTTGNONE 
Os01g0950900AK101121AGATGGGCCTTGGCCCATGAProtein of unknown function DUF221 domain containing protein. 
J023036H24AGATGGGCCTTGGCCCATGANONE 
J023084G23AGATGGGCCTTGGCCCATGANONE 
J033025J04AGATGGGCCTTGGCCCATGANONE 
J033139J18AGATGGGCCTTGGCCCATGANONE 
J090006A09AGATGGGCCTTGGCCCATGANONE 
J090036D02AGATGGGCCTTGGCCCATGANONE 
Os01g0952600AK067525AAGGCCCAGANONE 
AK070047AAGGCCCAGASimilar to LacZ (Fragment). 
Os01g0958100AK058574CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
Os01g0959900AK058375ATATGGGCCTTConserved hypothetical protein. 
AK066497ATATGGGCCTTNONE 
Os01g0960300AK100099TTATGGGCCTTSimilar to Glucose inhibited division protein A. 
Os01g0970900011-018-A07AAGGCCCAAGNONE 
011-022-E12AAGGCCCAAGNONE 
AK063285AAGGCCCAAGNONE 
AK101688AAGGCCCAAGProtein prenyltransferase domain containing protein. 
J100042L01AAGGCCCAAGNONE 
J100053B11AAGGCCCAAGNONE 
Os01g0971600AK070366GTTTGGGCCTTGSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
Os02g0102700006-096-A07GTTTGGGCCTTNONE 
AK061193GTTTGGGCCTTSimilar to AGL157Cp. 
AK061558GTTTGGGCCTTNONE 
AK103689GTTTGGGCCTTNONE 
J023128B06GTTTGGGCCTTNONE 
J033136G21GTTTGGGCCTTNONE 
J053084F10GTTTGGGCCTTNONE 
J053089D12GTTTGGGCCTTNONE 
J075149B12GTTTGGGCCTTNONE 
J075165L17GTTTGGGCCTTNONE 
Os02g0121100012-035-F06CAAGGCCCACTCCCCCACGNONE 
013-031-H05CAAGGCCCACTCCCCCACGNONE 
013-058-E11CAAGGCCCACTCCCCCACGNONE 
014-010-D01CAAGGCCCACTCCCCCACGNONE 
AK070711CAAGGCCCACTCCCCCACGConserved hypothetical protein. 
AK119758CAAGGCCCACTCCCCCACGNONE 
J013033G12CAAGGCCCACTCCCCCACGNONE 
J023007M16CAAGGCCCACTCCCCCACGNONE 
J023020K20CAAGGCCCACTCCCCCACGNONE 
J023061H10CAAGGCCCACTCCCCCACGNONE 
J033027H20CAAGGCCCACTCCCCCACGNONE 
J033051E18CAAGGCCCACTCCCCCACGNONE 
J090005F12CAAGGCCCACTCCCCCACGNONE 
J090017A20CAAGGCCCACTCCCCCACGNONE 
J090018G11CAAGGCCCACTCCCCCACGNONE 
J090062C18CAAGGCCCACTCCCCCACGNONE 
J100027N10CAAGGCCCACTCCCCCACGNONE 
J100032L14CAAGGCCCACTCCCCCACGNONE 
J100045C14CAAGGCCCACTCCCCCACGNONE 
J100061M09CAAGGCCCACTCCCCCACGNONE 
J100062K11CAAGGCCCACTCCCCCACGNONE 
J100064H11CAAGGCCCACTCCCCCACGNONE 
J100074H16CAAGGCCCACTCCCCCACGNONE 
J100082N01CAAGGCCCACTCCCCCACGNONE 
Os02g0146700AK105609CAAGGCCCACASimilar to PSMD2 subunit (Fragment). 
AK119490CAAGGCCCACANONE 
AK121963CAAGGCCCACANONE 
Os02g0169000AK101628CAAGGCCCAAGConserved hypothetical protein. 
Os02g0220600AK103901AAGGCCCAACANONE 
AK103901AAGGCCCATTTCAGCCCAACANONE 
J013058O03AAGGCCCAACANONE 
J013058O03AAGGCCCATTTCAGCCCAACANONE 
J013124E21AAGGCCCAACANONE 
J013124E21AAGGCCCATTTCAGCCCAACANONE 
J023023L03AAGGCCCAACANONE 
J023023L03AAGGCCCATTTCAGCCCAACANONE 
J023023L21AAGGCCCAACANONE 
J023023L21AAGGCCCATTTCAGCCCAACANONE 
J023061N01AAGGCCCAACANONE 
J023061N01AAGGCCCATTTCAGCCCAACANONE 
J023065O09AAGGCCCAACANONE 
J023065O09AAGGCCCATTTCAGCCCAACANONE 
J023106J17AAGGCCCAACANONE 
J023106J17AAGGCCCATTTCAGCCCAACANONE 
J023119N08AAGGCCCAACANONE 
J023119N08AAGGCCCATTTCAGCCCAACANONE 
J033058A19AAGGCCCAACANONE 
J033058A19AAGGCCCATTTCAGCCCAACANONE 
J033098O13AAGGCCCAACANONE 
J033098O13AAGGCCCATTTCAGCCCAACANONE 
J033100M18AAGGCCCAACANONE 
J033100M18AAGGCCCATTTCAGCCCAACANONE 
J033125A21AAGGCCCAACANONE 
J033125A21AAGGCCCATTTCAGCCCAACANONE 
J033148C12AAGGCCCAACANONE 
J033148C12AAGGCCCATTTCAGCCCAACANONE 
J043017F03AAGGCCCAACANONE 
J043017F03AAGGCCCATTTCAGCCCAACANONE 
J043032J02AAGGCCCAACANONE 
J043032J02AAGGCCCATTTCAGCCCAACANONE 
J053047N10AAGGCCCAACANONE 
J053047N10AAGGCCCATTTCAGCCCAACANONE 
J053089P04AAGGCCCAACANONE 
J053089P04AAGGCCCATTTCAGCCCAACANONE 
J065051K09AAGGCCCAACANONE 
J065051K09AAGGCCCATTTCAGCCCAACANONE 
J065064H24AAGGCCCAACANONE 
J065064H24AAGGCCCATTTCAGCCCAACANONE 
J090001L06AAGGCCCAACANONE 
J090001L06AAGGCCCATTTCAGCCCAACANONE 
J090017C24AAGGCCCAACANONE 
J090017C24AAGGCCCATTTCAGCCCAACANONE 
J090058G15AAGGCCCAACANONE 
J090058G15AAGGCCCATTTCAGCCCAACANONE 
J090058H23AAGGCCCAACANONE 
J090058H23AAGGCCCATTTCAGCCCAACANONE 
J090061G20AAGGCCCAACANONE 
J090061G20AAGGCCCATTTCAGCCCAACANONE 
J090069N23AAGGCCCAACANONE 
J090069N23AAGGCCCATTTCAGCCCAACANONE 
J090071A08AAGGCCCAACANONE 
J090071A08AAGGCCCATTTCAGCCCAACANONE 
J090074A08AAGGCCCAACANONE 
J090074A08AAGGCCCATTTCAGCCCAACANONE 
J090077B15AAGGCCCAACANONE 
J090077B15AAGGCCCATTTCAGCCCAACANONE 
J090081K06AAGGCCCAACANONE 
J090081K06AAGGCCCATTTCAGCCCAACANONE 
J090083I05AAGGCCCAACANONE 
J090083I05AAGGCCCATTTCAGCCCAACANONE 
J090091O22AAGGCCCAACANONE 
J090091O22AAGGCCCATTTCAGCCCAACANONE 
J090097L10AAGGCCCAACANONE 
J090097L10AAGGCCCATTTCAGCCCAACANONE 
J100026B11AAGGCCCAACANONE 
J100026B11AAGGCCCATTTCAGCCCAACANONE 
J100044M01AAGGCCCAACANONE 
J100044M01AAGGCCCATTTCAGCCCAACANONE 
J100046F10AAGGCCCAACANONE 
J100046F10AAGGCCCATTTCAGCCCAACANONE 
J100051K14AAGGCCCAACANONE 
J100051K14AAGGCCCATTTCAGCCCAACANONE 
J100060D22AAGGCCCAACANONE 
J100060D22AAGGCCCATTTCAGCCCAACANONE 
J100060H18AAGGCCCAACANONE 
J100060H18AAGGCCCATTTCAGCCCAACANONE 
J100070I06AAGGCCCAACANONE 
J100070I06AAGGCCCATTTCAGCCCAACANONE 
J100071C04AAGGCCCAACANONE 
J100071C04AAGGCCCATTTCAGCCCAACANONE 
J100078M13AAGGCCCAACANONE 
J100078M13AAGGCCCATTTCAGCCCAACANONE 
J100080E17AAGGCCCAACANONE 
J100080E17AAGGCCCATTTCAGCCCAACANONE 
J100083I09AAGGCCCAACANONE 
J100083I09AAGGCCCATTTCAGCCCAACANONE 
Os02g0236100AK120541AAGGCCCAATTSimilar to SERK1 (Fragment). 
Os02g0255200AK121591AAGGCCCAAGGCCCATTASimilar to Ribosomal protein S15a homolog. 
J033023N03AAGGCCCAAGGCCCATTANONE 
J033031C22AAGGCCCAAGGCCCATTANONE 
J033037P22AAGGCCCAAGGCCCATTANONE 
J090013J10AAGGCCCAAGGCCCATTANONE 
J090030I04AAGGCCCAAGGCCCATTANONE 
Os02g0478700AK099723AAGGCCCAGATRibosomal protein S27. 
AK099723AAGGCCCAGCCCACGGGRibosomal protein S27. 
J013089A06AAGGCCCAGATNONE 
J013089A06AAGGCCCAGCCCACGGGNONE 
J065068E01AAGGCCCAGATNONE 
J065068E01AAGGCCCAGCCCACGGGNONE 
J065217F15AAGGCCCAGATNONE 
J065217F15AAGGCCCAGCCCACGGGNONE 
Os02g0496900AK059542AAGGCCCACACGGCCCACCTConserved hypothetical protein. 
J053031E06AAGGCCCACACGGCCCACCTNONE 
J065195E11AAGGCCCACACGGCCCACCTNONE 
J090008P16AAGGCCCACACGGCCCACCTNONE 
Os02g0497700011-094-A10AAGGCCCAAAANONE 
012-073-H02AAGGCCCAAAANONE 
016-056-G05AAGGCCCAAAANONE 
AK070143AAGGCCCAAAANONE 
J023041O14AAGGCCCAAAANONE 
J023092H01AAGGCCCAAAANONE 
J033048A17AAGGCCCAAAANONE 
J033051K21AAGGCCCAAAANONE 
J033122D01AAGGCCCAAAANONE 
J090032E23AAGGCCCAAAANONE 
J090055K13AAGGCCCAAAANONE 
Os02g0501350J090074D10CCAGCCCAAGGCCCAGCNONE 
J090080M08CCAGCCCAAGGCCCAGCNONE 
J090083F07CCAGCCCAAGGCCCAGCConserved hypothetical protein. 
Os02g0520800AK102815AGCCCAAGGCCCAGCSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09AGCCCAAGGCCCAGCNONE 
J100038E09AGCCCAAGGCCCAGCNONE 
J100076G11AGCCCAAGGCCCAGCNONE 
Os02g0522000AK101294ATTTGGGCCTTGGGCTGTRetrotransposon gag protein family protein. 
Os02g0525400011-008-B01CAAGGCCCAAGNONE 
AK065368CAAGGCCCAAGSimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
J013021B13CAAGGCCCAAGNONE 
J033046H10CAAGGCCCAAGNONE 
Os02g0542500AK109859AAGGCCCAGGConserved hypothetical protein. 
Os02g0582600006-041-F11TGGATGGGCCTTNONE 
AK059791TGGATGGGCCTTNONE 
AK102380TGGATGGGCCTTHeavy metal transport/detoxification protein domain containing protein. 
J033092A09TGGATGGGCCTTNONE 
Os02g0605600016-017-B02AAGGCCCACGANONE 
AK066104AAGGCCCACGALUC7 related family protein. 
J013052G16AAGGCCCACGANONE 
J043022E03AAGGCCCACGANONE 
J065105P10AAGGCCCACGANONE 
Os02g0621600AK071074AAGGCCCAAATNONE 
AK108575AAGGCCCAAATConserved hypothetical protein. 
J023078O20AAGGCCCAAATNONE 
J075025M01AAGGCCCAAATNONE 
J090047L11AAGGCCCAAATNONE 
Os02g0643500AK068423AAGGCCCATAAPentapeptide repeat containing protein. 
Os02g0653800J023002B17CAAGTGGGCCTTNONE 
J033067E03CAAGTGGGCCTTSimilar to GTP-binding protein. 
J033105M04CAAGTGGGCCTTNONE 
J053039E15CAAGTGGGCCTTNONE 
J065026L07CAAGTGGGCCTTNONE 
J065038B03CAAGTGGGCCTTNONE 
J065087J15CAAGTGGGCCTTNONE 
J065121B22CAAGTGGGCCTTNONE 
J065128N12CAAGTGGGCCTTNONE 
J065189E19CAAGTGGGCCTTNONE 
J100058B03CAAGTGGGCCTTNONE 
Os02g0655700AK101068AAATGGGCCTTAmino acid/polyamine transporter I family protein. 
J013026C06AAATGGGCCTTNONE 
J033023I17AAATGGGCCTTNONE 
Os02g0658300AK073923AAGGCCCATTAConserved hypothetical protein. 
J065152M15AAGGCCCATTANONE 
Os02g0666800AK101444CAAGGCCCATTTProtein of unknown function DUF788 family protein. 
J033039F09CAAGGCCCATTTNONE 
J065041E15CAAGGCCCATTTNONE 
J075087I24CAAGGCCCATTTNONE 
J100079A10CAAGGCCCATTTNONE 
Os02g0670400009-189-H11AAGGCCCAATANONE 
AB079636AAGGCCCAATASimilar to HMGc1 protein. 
J090001B08AAGGCCCAATANONE 
Os02g0672700AK059611AAGGCCCAACAAGCCCAACTDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179AAGGCCCAACAAGCCCAACTNONE 
J023098L23AAGGCCCAACAAGCCCAACTNONE 
J065042J21AAGGCCCAACAAGCCCAACTNONE 
J065187L09AAGGCCCAACAAGCCCAACTNONE 
J065190O10AAGGCCCAACAAGCCCAACTNONE 
J080041G14AAGGCCCAACAAGCCCAACTNONE 
J080078K08AAGGCCCAACAAGCCCAACTNONE 
J080089D20AAGGCCCAACAAGCCCAACTNONE 
J080094D04AAGGCCCAACAAGCCCAACTNONE 
Os02g0673600009-071-C12AAGGCCCAGTANONE 
J023037G24AAGGCCCAGTANONE 
J023038E07AAGGCCCAGTAORMDL family protein. 
J023142L24AAGGCCCAGTANONE 
J033115B14AAGGCCCAGTANONE 
J075004B15AAGGCCCAGTANONE 
J075067J21AAGGCCCAGTANONE 
J075072K07AAGGCCCAGTANONE 
J075147H21AAGGCCCAGTANONE 
J075154F03AAGGCCCAGTANONE 
Os02g0688900AK066093AAGGCCCAATGPI transamidase subunit PIG-U family protein. 
J065007D18AAGGCCCAATNONE 
J065040G21AAGGCCCAATNONE 
J065103G03AAGGCCCAATNONE 
J065175F18AAGGCCCAATNONE 
J065202A07AAGGCCCAATNONE 
J075006C01AAGGCCCAATNONE 
J075178F24AAGGCCCAATNONE 
Os02g0697200015-013-B10TGATGGGCCTGATGGGCCTTNONE 
AK059475TGATGGGCCTGATGGGCCTTNONE 
AK102993TGATGGGCCTGATGGGCCTTConserved hypothetical protein. 
J033079I18TGATGGGCCTGATGGGCCTTNONE 
J033082A14TGATGGGCCTGATGGGCCTTNONE 
J065047H08TGATGGGCCTGATGGGCCTTNONE 
J065131M14TGATGGGCCTGATGGGCCTTNONE 
Os02g0725200005-020-F05AAGGCCCAATANONE 
AK058309AAGGCCCAATANONE 
AK103602AAGGCCCAATARubisco methyltransferase family protein. 
J013109C13AAGGCCCAATANONE 
J033133G01AAGGCCCAATANONE 
J075087L23AAGGCCCAATANONE 
J090073J10AAGGCCCAATANONE 
Os02g0727400AK068514TATTGGGCCTTConserved hypothetical protein. 
Os02g0736500AK065166AAGGCCCATAAAAGCCCAACNicastrin family protein. 
J013099D16AAGGCCCATAAAAGCCCAACNONE 
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein. 
Os02g0743800AK064134GGATGGGCCTTGCS domain containing protein. 
AK111254GGATGGGCCTTGNONE 
Os02g0775200AB038319AAGGCCCAGTTNONE 
AK069984AAGGCCCAGTTSimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAGGCCCAGTTNONE 
Os02g0782200AK070439AAGGCCCATGANONE 
AK101869AAGGCCCATGANOT2/NOT3/NOT5 domain containing protein. 
Os02g0783700AK064521AAGGCCCAGANONE 
AK120371AAGGCCCAGASimilar to Lysine-ketoglutarate reductase/saccharopine dehydrogenase bifunctional enzyme. 
J013070J19AAGGCCCAGANONE 
J033095H21AAGGCCCAGANONE 
J065038I07AAGGCCCAGANONE 
J065044C13AAGGCCCAGANONE 
J065060L11AAGGCCCAGANONE 
J065082G20AAGGCCCAGANONE 
J065146N24AAGGCCCAGANONE 
J065147B10AAGGCCCAGANONE 
J065181L07AAGGCCCAGANONE 
J065202K06AAGGCCCAGANONE 
J065219J12AAGGCCCAGANONE 
J075107D03AAGGCCCAGANONE 
J090020F02AAGGCCCAGANONE 
Os02g0787100Os02g0787100TGATGGGCCTTProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0794400AK065845ATTGGGCCTTInitiation factor 3 family protein. 
J013042M03ATTGGGCCTTNONE 
Os02g0800000J100043O08GCTGGGCCTTGGGCCTTGGGCTNONE 
J100064O18GCTGGGCCTTGGGCCTTGGGCTNONE 
Os02g0804300006-046-D12TTTTGGGCCTTNONE 
AK060165TTTTGGGCCTTNONE 
AK067584TTTTGGGCCTTSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12TTTTGGGCCTTNONE 
J023098C22TTTTGGGCCTTNONE 
J033123P06TTTTGGGCCTTNONE 
J065060N24TTTTGGGCCTTNONE 
J065069H22TTTTGGGCCTTNONE 
J065155N20TTTTGGGCCTTNONE 
J065170K07TTTTGGGCCTTNONE 
J090033D12TTTTGGGCCTTNONE 
Os02g0805600006-054-D07CCAGGCCCAAGGCCCATCTNONE 
AK059822CCAGGCCCAAGGCCCATCTNONE 
AK099516CCAGGCCCAAGGCCCATCTSimilar to Alcohol dehydrogenase, zinc-containing. 
AK104587CCAGGCCCAAGGCCCATCTNONE 
J065037H22CCAGGCCCAAGGCCCATCTNONE 
J090015P17CCAGGCCCAAGGCCCATCTNONE 
Os02g0810300AK059363TCGGCCCAAGGCCCAGTASimilar to NBD-like protein. 
AK099203TCGGCCCAAGGCCCAGTANONE 
Os02g0819700AK067374CAAGGCCCACACGZinc finger, Zim17-type family protein. 
AK099160CAAGGCCCACACGNONE 
J100086K17CAAGGCCCACACGNONE 
Os02g0824400AK121390AACTGGGCCTTTGATGGGCTTTConserved hypothetical protein. 
AK121390GTTTGGGCCTTGConserved hypothetical protein. 
J023128P21AACTGGGCCTTTGATGGGCTTTNONE 
J023128P21GTTTGGGCCTTGNONE 
J053097O16AACTGGGCCTTTGATGGGCTTTNONE 
J053097O16GTTTGGGCCTTGNONE 
J065012I02AACTGGGCCTTTGATGGGCTTTNONE 
J065012I02GTTTGGGCCTTGNONE 
J065049C06AACTGGGCCTTTGATGGGCTTTNONE 
J065049C06GTTTGGGCCTTGNONE 
J065051H02AACTGGGCCTTTGATGGGCTTTNONE 
J065051H02GTTTGGGCCTTGNONE 
J065069A13AACTGGGCCTTTGATGGGCTTTNONE 
J065069A13GTTTGGGCCTTGNONE 
J065082E04AACTGGGCCTTTGATGGGCTTTNONE 
J065082E04GTTTGGGCCTTGNONE 
J065102N09AACTGGGCCTTTGATGGGCTTTNONE 
J065102N09GTTTGGGCCTTGNONE 
J065157O10AACTGGGCCTTTGATGGGCTTTNONE 
J065157O10GTTTGGGCCTTGNONE 
J065188N23AACTGGGCCTTTGATGGGCTTTNONE 
J065188N23GTTTGGGCCTTGNONE 
J065190J11AACTGGGCCTTTGATGGGCTTTNONE 
J065190J11GTTTGGGCCTTGNONE 
J065202M09AACTGGGCCTTTGATGGGCTTTNONE 
J065202M09GTTTGGGCCTTGNONE 
Os02g0827600AK068455TATTGGGCCTTGConserved hypothetical protein. 
Os02g0830700AK101172AAGGCCCAGTTLeucine rich repeat, N-terminal domain containing protein. 
Os02g0832700AK099439TGTTGGGCCTTTGGGCTTCSimilar to Metal tolerance protein C2 (AtMTPc2). 
Os03g0100400AK068556AAGGCCCANONE 
AK121880AAGGCCCASimilar to DNA repair endonuclease UVH1 (EC 3.1.-.-) (Ultraviolet hypersensitive 1) (AtRAD1) (DNA excision repair protein XP-F homolog). 
Os03g0121300AK120047AAGGCCCAGGNONE 
Os03g0125000006-032-D09TGATGGGCCTAAGGCCCAAATNONE 
006-033-B05TGATGGGCCTAAGGCCCAAATNONE 
006-048-G06TGATGGGCCTAAGGCCCAAATNONE 
006-048-G09TGATGGGCCTAAGGCCCAAATNONE 
006-052-D09TGATGGGCCTAAGGCCCAAATNONE 
006-072-A04TGATGGGCCTAAGGCCCAAATNONE 
006-076-F12TGATGGGCCTAAGGCCCAAATNONE 
006-080-B03TGATGGGCCTAAGGCCCAAATNONE 
006-092-H03TGATGGGCCTAAGGCCCAAATNONE 
006-103-G04TGATGGGCCTAAGGCCCAAATNONE 
009-079-E01TGATGGGCCTAAGGCCCAAATNONE 
009-150-F03TGATGGGCCTAAGGCCCAAATNONE 
AF095708TGATGGGCCTAAGGCCCAAATNONE 
AK059557TGATGGGCCTAAGGCCCAAATNONE 
AK070779TGATGGGCCTAAGGCCCAAATSimilar to 50S ribosomal protein L5, chloroplast. 
AK098999TGATGGGCCTAAGGCCCAAATNONE 
AK104137TGATGGGCCTAAGGCCCAAATNONE 
J065002D07TGATGGGCCTAAGGCCCAAATNONE 
J065167E24TGATGGGCCTAAGGCCCAAATNONE 
J075199O14TGATGGGCCTAAGGCCCAAATNONE 
J100083L01TGATGGGCCTAAGGCCCAAATNONE 
Os03g0125700009-132-G03AAATGGGCCTTAAAGCCCATTTNONE 
009-132-G03AAGGCCCAAAANONE 
AK062913AAATGGGCCTTAAAGCCCATTTConserved hypothetical protein. 
AK062913AAGGCCCAAAAConserved hypothetical protein. 
J075046C16AAATGGGCCTTAAAGCCCATTTNONE 
J075046C16AAGGCCCAAAANONE 
J075115L05AAATGGGCCTTAAAGCCCATTTNONE 
J075115L05AAGGCCCAAAANONE 
J075143I05AAATGGGCCTTAAAGCCCATTTNONE 
J075143I05AAGGCCCAAAANONE 
J075197O07AAATGGGCCTTAAAGCCCATTTNONE 
J075197O07AAGGCCCAAAANONE 
Os03g0127000AK068479AAGGCCCATTTConserved hypothetical protein. 
J013152D10AAGGCCCATTTNONE 
J075167I20AAGGCCCATTTNONE 
J090067O04AAGGCCCATTTNONE 
Os03g0133400AK073032AAGGCCCACGPeptidoglycan-binding LysM domain containing protein. 
J013127B06AAGGCCCACGNONE 
J013151F14AAGGCCCACGNONE 
J023008L05AAGGCCCACGNONE 
J023009I03AAGGCCCACGNONE 
J023041F03AAGGCCCACGNONE 
J023146H06AAGGCCCACGNONE 
J033067A22AAGGCCCACGNONE 
J033109M12AAGGCCCACGNONE 
J065141H14AAGGCCCACGNONE 
J075003N15AAGGCCCACGNONE 
J075072J19AAGGCCCACGNONE 
J075114G10AAGGCCCACGNONE 
J075145H07AAGGCCCACGNONE 
J075160G14AAGGCCCACGNONE 
J075180J01AAGGCCCACGNONE 
J100075D05AAGGCCCACGNONE 
Os03g0143600AB110188CAAGGCCCACANONE 
AK068424CAAGGCCCACASimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464CAAGGCCCACANONE 
AY224545CAAGGCCCACANONE 
J013154F02CAAGGCCCACANONE 
Os03g0146500006-036-F10AAGGCCCACCTNONE 
006-082-C03AAGGCCCACCTNONE 
006-098-E04AAGGCCCACCTNONE 
006-110-C03AAGGCCCACCTNONE 
009-057-C11AAGGCCCACCTNONE 
009-182-D02AAGGCCCACCTNONE 
AK059776AAGGCCCACCTGalactose-binding like domain containing protein. 
AK071628AAGGCCCACCTNONE 
AK104105AAGGCCCACCTNONE 
AK104220AAGGCCCACCTNONE 
J065168B02AAGGCCCACCTNONE 
Os03g0149400AK111396AAGGCCCAACCAGCCCAAGProtein prenyltransferase domain containing protein. 
AK111396CTTGGGCTTTCAAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os03g0152800AK066205GCTGGGCCTTGProtein kinase-like domain containing protein. 
AK100518GCTGGGCCTTGNONE 
Os03g0192100AK064747TATGGGCCTTNONE 
AK105523TATGGGCCTTPeptidase S10, serine carboxypeptidase family protein. 
Os03g0197400AK071413AAGGCCCAACCSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905AAGGCCCAACCNONE 
J053023D18AAGGCCCAACCNONE 
Os03g0200500005-016-A06AATGGGCCTTNONE 
AK069251AATGGGCCTT40S ribosomal protein S3a (CYC07 protein). 
AK104243AATGGGCCTTNONE 
AK104699AATGGGCCTTNONE 
D26060AATGGGCCTTNONE 
J013024H20AATGGGCCTTNONE 
J013029C14AATGGGCCTTNONE 
J013035O17AATGGGCCTTNONE 
J013066B11AATGGGCCTTNONE 
J013066B12AATGGGCCTTNONE 
J013066B13AATGGGCCTTNONE 
J013152M04AATGGGCCTTNONE 
J023001A03AATGGGCCTTNONE 
J023013H23AATGGGCCTTNONE 
J023042L07AATGGGCCTTNONE 
J023081L11AATGGGCCTTNONE 
J023088I23AATGGGCCTTNONE 
J023092N22AATGGGCCTTNONE 
J023126A20AATGGGCCTTNONE 
J023139A17AATGGGCCTTNONE 
J023150G12AATGGGCCTTNONE 
J033026M10AATGGGCCTTNONE 
J033031H24AATGGGCCTTNONE 
J033036C22AATGGGCCTTNONE 
J033037P08AATGGGCCTTNONE 
J033045G14AATGGGCCTTNONE 
J033048A13AATGGGCCTTNONE 
J033048B13AATGGGCCTTNONE 
J033048K11AATGGGCCTTNONE 
J033066A06AATGGGCCTTNONE 
J033072H01AATGGGCCTTNONE 
J033082K07AATGGGCCTTNONE 
J033091G20AATGGGCCTTNONE 
J033095C14AATGGGCCTTNONE 
J033101N24AATGGGCCTTNONE 
J033105L15AATGGGCCTTNONE 
J033107J18AATGGGCCTTNONE 
J033112L02AATGGGCCTTNONE 
J033117I17AATGGGCCTTNONE 
J043003K06AATGGGCCTTNONE 
J043016I20AATGGGCCTTNONE 
J043021A10AATGGGCCTTNONE 
J043034F14AATGGGCCTTNONE 
J065002O17AATGGGCCTTNONE 
J065014B14AATGGGCCTTNONE 
J065054N19AATGGGCCTTNONE 
J065112P18AATGGGCCTTNONE 
J065121B20AATGGGCCTTNONE 
J065170M08AATGGGCCTTNONE 
J065194B05AATGGGCCTTNONE 
J090040F01AATGGGCCTTNONE 
J090078O20AATGGGCCTTNONE 
J090078P21AATGGGCCTTNONE 
J090084E11AATGGGCCTTNONE 
J100080B11AATGGGCCTTNONE 
Os03g0238700AK073387ATATGGGCCGGATGGGCCTTGSimilar to Acid phosphatase type 5. 
J033043K11ATATGGGCCGGATGGGCCTTGNONE 
Os03g0243700011-089-H03GCTGGGCCTTNONE 
AK059149GCTGGGCCTTGlycoside hydrolase, family 10 protein. 
J065048D08GCTGGGCCTTNONE 
J065075F03GCTGGGCCTTNONE 
J065093L06GCTGGGCCTTNONE 
J065120A17GCTGGGCCTTNONE 
J065131J21GCTGGGCCTTNONE 
J065140D06GCTGGGCCTTNONE 
J065155F01GCTGGGCCTTNONE 
J065157G07GCTGGGCCTTNONE 
J065157G24GCTGGGCCTTNONE 
J065165D02GCTGGGCCTTNONE 
J065179P03GCTGGGCCTTNONE 
J065179P04GCTGGGCCTTNONE 
J065183F18GCTGGGCCTTNONE 
J065185A02GCTGGGCCTTNONE 
J100018L10GCTGGGCCTTNONE 
Os03g0253100AK119618AAGGCCCAATAPhosphomevalonate kinase Erg8 family protein. 
J033052A14AAGGCCCAATANONE 
Os03g0256400AK073854TGTGGGCTGAATTGGGCCTTSimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0257900009-150-G06AATTGGGCCTTTTTGGGCCGANONE 
009-181-H05AATTGGGCCTTTTTGGGCCGANONE 
AK063892AATTGGGCCTTTTTGGGCCGANONE 
AK100114AATTGGGCCTTTTTGGGCCGASimilar to Lectin-like receptor kinase 7;2. 
AK103486AATTGGGCCTTTTTGGGCCGANONE 
J023006K11AATTGGGCCTTTTTGGGCCGANONE 
J075005E15AATTGGGCCTTTTTGGGCCGANONE 
J075007K24AATTGGGCCTTTTTGGGCCGANONE 
J075034G06AATTGGGCCTTTTTGGGCCGANONE 
J075051I19AATTGGGCCTTTTTGGGCCGANONE 
J075076A08AATTGGGCCTTTTTGGGCCGANONE 
J075096H04AATTGGGCCTTTTTGGGCCGANONE 
J075115I09AATTGGGCCTTTTTGGGCCGANONE 
J075132K23AATTGGGCCTTTTTGGGCCGANONE 
J075147C17AATTGGGCCTTTTTGGGCCGANONE 
J090059O20AATTGGGCCTTTTTGGGCCGANONE 
Os03g0265900009-004-C01TGTTGGGCCTTNONE 
009-045-B03TGTTGGGCCTTNONE 
AK099963TGTTGGGCCTTNONE 
AK120374TGTTGGGCCTTConserved hypothetical protein. 
J013036A19TGTTGGGCCTTNONE 
J013070J20TGTTGGGCCTTNONE 
J013071C06TGTTGGGCCTTNONE 
J013088C01TGTTGGGCCTTNONE 
J013112H21TGTTGGGCCTTNONE 
J065114K10TGTTGGGCCTTNONE 
J100028M20TGTTGGGCCTTNONE 
Os03g0266000AK068775AAGGCCCAACAOvarian tumour, otubain domain containing protein. 
AK104949AAGGCCCAACANONE 
J075149K24AAGGCCCAACANONE 
J075184C19AAGGCCCAACANONE 
Os03g0282900006-088-H05ACAGCCCAAGAAGGCCCATGTNONE 
AK061166ACAGCCCAAGAAGGCCCATGTNONE 
AK102161ACAGCCCAAGAAGGCCCATGTConserved hypothetical protein. 
AK104514ACAGCCCAAGAAGGCCCATGTNONE 
Os03g0292800012-077-B05CAAGGCCCATCCNONE 
AK069970CAAGGCCCATCCSimilar to Ran binding protein 1 homolog. 
J065138F22CAAGGCCCATCCNONE 
Os03g0295500009-083-F02TTGGCCCATATAAGGCCCAACTNONE 
J053029J05TTGGCCCATATAAGGCCCAACTNONE 
J053054B07TTGGCCCATATAAGGCCCAACTCHCH domain containing protein. 
J065024G23TTGGCCCATATAAGGCCCAACTNONE 
J065036F08TTGGCCCATATAAGGCCCAACTNONE 
J065066M11TTGGCCCATATAAGGCCCAACTNONE 
J065143G19TTGGCCCATATAAGGCCCAACTNONE 
Os03g0297100AK059192AAGGCCCATTTNONE 
AK122143AAGGCCCATTTNONE 
J023012D24AAGGCCCATTTNONE 
J023041A08AAGGCCCATTTNONE 
J033067H08AAGGCCCATTTNONE 
J033131K19AAGGCCCATTTNONE 
J033136J20AAGGCCCATTTNONE 
J053027D07AAGGCCCATTTNONE 
J065191B01AAGGCCCATTTNONE 
J075112A12AAGGCCCATTTNONE 
J075136D05AAGGCCCATTTNONE 
J090073P06AAGGCCCATTTNONE 
J100026B16AAGGCCCATTTNONE 
J100068P21AAGGCCCATTTNONE 
J100088C15AAGGCCCATTTNONE 
Os03g0300600003-125-G06AAGGCCCACAANONE 
006-048-C04AAGGCCCACAANONE 
009-044-A09AAGGCCCACAANONE 
AK059801AAGGCCCACAANONE 
AK066250AAGGCCCACAASimilar to Chaperone protein dnaJ. 
AK069897AAGGCCCACAANONE 
AK104186AAGGCCCACAANONE 
J065197D15AAGGCCCACAANONE 
J090031C11AAGGCCCACAANONE 
J100024C23AAGGCCCACAANONE 
J100030B16AAGGCCCACAANONE 
J100033K12AAGGCCCACAANONE 
J100043M19AAGGCCCACAANONE 
J100056N09AAGGCCCACAANONE 
J100058E12AAGGCCCACAANONE 
J100084J08AAGGCCCACAANONE 
Os03g0305500AK070638GGTTGGGCCTTArgininosuccinate lyase domain containing protein. 
Os03g0308000016-023-H09AAGGCCCAGCCNONE 
AK100355AAGGCCCAGCCUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05AAGGCCCAGCCNONE 
J023043K04AAGGCCCAGCCNONE 
J023083I20AAGGCCCAGCCNONE 
J033068F22AAGGCCCAGCCNONE 
J033125P21AAGGCCCAGCCNONE 
J065207A22AAGGCCCAGCCNONE 
J100018D20AAGGCCCAGCCNONE 
J100026L17AAGGCCCAGCCNONE 
J100055D14AAGGCCCAGCCNONE 
J100060P03AAGGCCCAGCCNONE 
J100078A20AAGGCCCAGCCNONE 
Os03g0333000AK109811AAGGCCCAGGCCCATTTConserved hypothetical protein. 
J065152D04AAGGCCCAGGCCCATTTNONE 
J090011B05AAGGCCCAGGCCCATTTNONE 
Os03g0333100AK101050AAATGGGCCTGGGCCTTProtein of unknown function DUF663 domain containing protein. 
Os03g0339100AK111641AAGGCCCAACTSimilar to PRL1 protein. 
Os03g0343900009-077-C03ACAGCCCAAGGCCCAAGNONE 
AK105813ACAGCCCAAGGCCCAAGPhotosystem II protein PsbX family protein. 
J100059N03ACAGCCCAAGGCCCAAGNONE 
J100079C20ACAGCCCAAGGCCCAAGNONE 
Os03g0344100009-166-F10ACGTGGGCCTTNONE 
AK061903ACGTGGGCCTTNONE 
AK065547ACGTGGGCCTTSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24ACGTGGGCCTTNONE 
J033087C06ACGTGGGCCTTNONE 
J053073I09ACGTGGGCCTTNONE 
J065189D11ACGTGGGCCTTNONE 
J090032B15ACGTGGGCCTTNONE 
Os03g0352800009-030-G08AAGGCCCACAAGGCCCNONE 
AK059673AAGGCCCACAAGGCCCSimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17AAGGCCCACAAGGCCCNONE 
J075050N19AAGGCCCACAAGGCCCNONE 
J075104J18AAGGCCCACAAGGCCCNONE 
J075142K05AAGGCCCACAAGGCCCNONE 
J100050I19AAGGCCCACAAGGCCCNONE 
J100057N04AAGGCCCACAAGGCCCNONE 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0395900AK120654AAGGCCCACANONE 
J075050E23AAGGCCCACANONE 
Os03g0438400AK070383AAGGCCCAAGCCCAATAConserved hypothetical protein. 
AK070383AAGGCCCAGCCConserved hypothetical protein. 
J023054E02AAGGCCCAAGCCCAATANONE 
J023054E02AAGGCCCAGCCNONE 
Os03g0566800AK103270CAAGGCCCAGTSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18CAAGGCCCAGTNONE 
J023136P06CAAGGCCCAGTNONE 
J033081A22CAAGGCCCAGTNONE 
J033109N12CAAGGCCCAGTNONE 
J033124H10CAAGGCCCAGTNONE 
J033141B09CAAGGCCCAGTNONE 
J090026G23CAAGGCCCAGTNONE 
J090077J20CAAGGCCCAGTNONE 
Os03g0569900009-027-A11CAAGGCCCATTANONE 
AK063783CAAGGCCCATTANONE 
Os03g0574600009-151-F06AAGGCCCATTTNONE 
AK063006AAGGCCCATTTConserved hypothetical protein. 
AK104941AAGGCCCATTTNONE 
J065063L24AAGGCCCATTTNONE 
Os03g0576900AK071314AAGGCCCAACCAmino acid/polyamine transporter I family protein. 
J023074L08AAGGCCCAACCNONE 
J023084D13AAGGCCCAACCNONE 
J080011C14AAGGCCCAACCNONE 
J080012F24AAGGCCCAACCNONE 
J080018M05AAGGCCCAACCNONE 
J080021G05AAGGCCCAACCNONE 
J080021N18AAGGCCCAACCNONE 
J080023E19AAGGCCCAACCNONE 
J080024H14AAGGCCCAACCNONE 
J080025E15AAGGCCCAACCNONE 
J080038F19AAGGCCCAACCNONE 
J080044N09AAGGCCCAACCNONE 
J080054D05AAGGCCCAACCNONE 
J080057J16AAGGCCCAACCNONE 
J080060A05AAGGCCCAACCNONE 
J080061M12AAGGCCCAACCNONE 
J080063H13AAGGCCCAACCNONE 
J080065O04AAGGCCCAACCNONE 
J080066I17AAGGCCCAACCNONE 
J080066J06AAGGCCCAACCNONE 
J080089J22AAGGCCCAACCNONE 
J080090I03AAGGCCCAACCNONE 
J080091J23AAGGCCCAACCNONE 
J080091K20AAGGCCCAACCNONE 
J080093G24AAGGCCCAACCNONE 
J080094I08AAGGCCCAACCNONE 
J080096A17AAGGCCCAACCNONE 
J090051G12AAGGCCCAACCNONE 
Os03g0655400009-090-G04CGATGGGCCTTNONE 
009-133-B12CGATGGGCCTTNONE 
009-136-A10CGATGGGCCTTNONE 
009-156-C02CGATGGGCCTTNONE 
009-157-C04CGATGGGCCTTNONE 
009-159-F06CGATGGGCCTTNONE 
009-192-A07CGATGGGCCTTNONE 
009-192-B05CGATGGGCCTTNONE 
011-082-F01CGATGGGCCTTNONE 
013-041-G11CGATGGGCCTTNONE 
013-077-E04CGATGGGCCTTNONE 
014-001-A12CGATGGGCCTTNONE 
015-039-A12CGATGGGCCTTNONE 
016-094-G11CGATGGGCCTTNONE 
AB011368CGATGGGCCTTNONE 
AF010584CGATGGGCCTTSimilar to Water stress induced protein. 
AK059150CGATGGGCCTTNONE 
D26538CGATGGGCCTTNONE 
J065013M08CGATGGGCCTTNONE 
J065021G11CGATGGGCCTTNONE 
J065027K20CGATGGGCCTTNONE 
J065034A02CGATGGGCCTTNONE 
J065040F23CGATGGGCCTTNONE 
J065098G21CGATGGGCCTTNONE 
J065153J21CGATGGGCCTTNONE 
J065163C13CGATGGGCCTTNONE 
J065173C23CGATGGGCCTTNONE 
J065178I22CGATGGGCCTTNONE 
J065198K21CGATGGGCCTTNONE 
J065201H19CGATGGGCCTTNONE 
J065205F11CGATGGGCCTTNONE 
J100080E05CGATGGGCCTTNONE 
Os03g0681900006-042-F08ATCTGGGCCTTGNONE 
009-043-F12ATCTGGGCCTTGNONE 
AK061750ATCTGGGCCTTGNONE 
AK062094ATCTGGGCCTTGSimilar to RGP-3 (Fragment). 
J033034F01ATCTGGGCCTTGNONE 
J033131F11ATCTGGGCCTTGNONE 
J033143N03ATCTGGGCCTTGNONE 
Os03g0683700AK065067TAGGCCCAAAGGCCCAGGProtein of unknown function DUF810 family protein. 
Os03g0685700AK066043CGATGGGCCTTGGGCTTTProtein prenyltransferase domain containing protein. 
J013048F08CGATGGGCCTTGGGCTTTNONE 
Os03g0688200015-014-E12AAGGCCCAGGGTGGGTCCNONE 
AK103539AAGGCCCAGGGTGGGTCCConserved hypothetical protein. 
Os03g0704400AK101297AAGGCCCAAGProtein kinase domain containing protein. 
AK101297AAGGCCCAGCProtein kinase domain containing protein. 
J033033I19AAGGCCCAAGNONE 
J033033I19AAGGCCCAGCNONE 
J090009M06AAGGCCCAAGNONE 
J090009M06AAGGCCCAGCNONE 
Os03g0727100AK068587GTTTGGGCCGTAAGGCCCAACAConserved hypothetical protein. 
J013153F04GTTTGGGCCGTAAGGCCCAACANONE 
J065165J09GTTTGGGCCGTAAGGCCCAACANONE 
Os03g0746800AK101718AAGGCCCAAGWD-40 repeat containing protein. 
Os03g0787100006-022-G04CAAGGCCCATGANONE 
AK110858CAAGGCCCATGAConserved hypothetical protein. 
J065197C24CAAGGCCCATGANONE 
J075147E03CAAGGCCCATGANONE 
J100065K06CAAGGCCCATGANONE 
Os03g0788200AK106623AAGGCCCATAE1 protein and Def2/Der2 allergen family protein. 
J065112K18AAGGCCCATANONE 
J065123A19AAGGCCCATANONE 
J065131C15AAGGCCCATANONE 
J065174D05AAGGCCCATANONE 
J075011P16AAGGCCCATANONE 
J075017N24AAGGCCCATANONE 
J075028P19AAGGCCCATANONE 
J075052I01AAGGCCCATANONE 
J075057H20AAGGCCCATANONE 
J075080F06AAGGCCCATANONE 
J075091A10AAGGCCCATANONE 
J075140L23AAGGCCCATANONE 
J075156J08AAGGCCCATANONE 
J075182D16AAGGCCCATANONE 
J075191O21AAGGCCCATANONE 
J090079E21AAGGCCCATANONE 
Os03g0797600006-034-B06ATATGGGCCTTNONE 
006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01ATATGGGCCTTNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08ATATGGGCCTTNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK067446ATATGGGCCTTSimilar to Helix-loop-helix protein homolog. 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK068388ATATGGGCCTTNONE 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412ATATGGGCCTTNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
Os03g0802300AK120564AGTGGGCCTTGGGCCGAGAConserved hypothetical protein. 
AK120687AGTGGGCCTTGGGCCGAGANONE 
Os03g0826000AK072695AAGGCCCATCTConserved hypothetical protein. 
Os03g0834000AB080084AAGGCCCAFlap endonuclease-1b (EC 3.-.-.-) (OsFEN-1b). 
AB088391AAGGCCCANONE 
AK062149AAGGCCCANONE 
AK069540AAGGCCCANONE 
J013047J01AAGGCCCANONE 
J023019F12AAGGCCCANONE 
J043004H21AAGGCCCANONE 
Os03g0845700009-075-D05AATTGGGCCTTGNONE 
AK062622AATTGGGCCTTGSimilar to RPB17 (Fragment). 
J065068H03AATTGGGCCTTGNONE 
J065075A18AATTGGGCCTTGNONE 
J065118C19AATTGGGCCTTGNONE 
J075001B15AATTGGGCCTTGNONE 
J075048D11AATTGGGCCTTGNONE 
J075056D01AATTGGGCCTTGNONE 
J075092P03AATTGGGCCTTGNONE 
J075111I04AATTGGGCCTTGNONE 
Os03g0847500AK073859TGATGGGCCTTSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0850100AK101126ATTGGGCCTTAATGGGCCAANLI interacting factor domain containing protein. 
Os03g0851900AK102145AAGGCCCAGGCCCATCTAFG1-like ATPase family protein. 
J033086B08AAGGCCCAGGCCCATCTNONE 
Os03g0852600009-174-G04AAGGCCCACGANONE 
AK063101AAGGCCCACGAProtein of unknown function DUF565 family protein. 
J065131H12AAGGCCCACGANONE 
J090046K24AAGGCCCACGANONE 
Os03g0854500012-067-H08AAGGCCCATCCNONE 
AK100430AAGGCCCATCCSimilar to Heat shock transcription factor 31 (Fragment). 
AK106118AAGGCCCATCCNONE 
AY344485AAGGCCCATCCNONE 
J023088F14AAGGCCCATCCNONE 
J100041G01AAGGCCCATCCNONE 
J100046N19AAGGCCCATCCNONE 
J100052O08AAGGCCCATCCNONE 
Os03g0858700006-024-D11TTTTGGGCCTTGNONE 
AK061723TTTTGGGCCTTGProtein of unknown function DUF1499 family protein. 
AK064976TTTTGGGCCTTGNONE 
J013001B23TTTTGGGCCTTGNONE 
Os04g0103200003-106-F06CAAGGCCCACANONE 
015-058-G03CAAGGCCCACANONE 
AK060850CAAGGCCCACANONE 
AK066032CAAGGCCCACAProteasome component region PCI domain containing protein. 
J013046D12CAAGGCCCACANONE 
J013088L18CAAGGCCCACANONE 
J013093J06CAAGGCCCACANONE 
J013111I01CAAGGCCCACANONE 
J013120B15CAAGGCCCACANONE 
J013149K17CAAGGCCCACANONE 
J023010J08CAAGGCCCACANONE 
J023034J10CAAGGCCCACANONE 
J023055D05CAAGGCCCACANONE 
J033023L03CAAGGCCCACANONE 
J033025N21CAAGGCCCACANONE 
J033026A19CAAGGCCCACANONE 
J033026M14CAAGGCCCACANONE 
J033046J22CAAGGCCCACANONE 
J033052H11CAAGGCCCACANONE 
J033058P05CAAGGCCCACANONE 
J033064A11CAAGGCCCACANONE 
J033067K11CAAGGCCCACANONE 
J033076H02CAAGGCCCACANONE 
J033094E04CAAGGCCCACANONE 
J033106A02CAAGGCCCACANONE 
J033108N14CAAGGCCCACANONE 
J033114I06CAAGGCCCACANONE 
J033118H18CAAGGCCCACANONE 
J033148C05CAAGGCCCACANONE 
J043010I24CAAGGCCCACANONE 
J043037C07CAAGGCCCACANONE 
J053025M02CAAGGCCCACANONE 
J053026N08CAAGGCCCACANONE 
J053027O14CAAGGCCCACANONE 
J065038N11CAAGGCCCACANONE 
J065219C03CAAGGCCCACANONE 
J090011F14CAAGGCCCACANONE 
J090027C03CAAGGCCCACANONE 
J090067M19CAAGGCCCACANONE 
J090069C17CAAGGCCCACANONE 
J090070P21CAAGGCCCACANONE 
J090075N11CAAGGCCCACANONE 
J090095C22CAAGGCCCACANONE 
J100027O14CAAGGCCCACANONE 
J100055E01CAAGGCCCACANONE 
Os04g0107900013-017-E10CAAGGCCCAGCCCAAGNONE 
014-025-A02CAAGGCCCAGCCCAAGNONE 
014-100-C01CAAGGCCCAGCCCAAGNONE 
AK063568CAAGGCCCAGCCCAAGNONE 
AK063698CAAGGCCCAGCCCAAGNONE 
AK063751CAAGGCCCAGCCCAAGSimilar to Heat shock protein 80. 
J013118G22CAAGGCCCAGCCCAAGNONE 
J033131C17CAAGGCCCAGCCCAAGNONE 
J065036G05CAAGGCCCAGCCCAAGNONE 
J065106E24CAAGGCCCAGCCCAAGNONE 
J065171K16CAAGGCCCAGCCCAAGNONE 
J065213C11CAAGGCCCAGCCCAAGNONE 
J065218L17CAAGGCCCAGCCCAAGNONE 
Os04g0194000AK102654AATTGGGCCTTGCyclin-like F-box domain containing protein. 
J033101G08AATTGGGCCTTGNONE 
J090084B18AATTGGGCCTTGNONE 
Os04g0218600009-123-A05AAGGCCCAAGGCCCATCCNONE 
AK062873AAGGCCCAAGGCCCATCCNONE 
AK103472AAGGCCCAAGGCCCATCCConserved hypothetical protein. 
J090077A20AAGGCCCAAGGCCCATCCNONE 
Os04g0430100009-125-A01AAGGCCCATTANONE 
AK102190AAGGCCCATTASimilar to 40S ribosomal protein S10-1. 
J033087A06AAGGCCCATTANONE 
J053032M06AAGGCCCATTANONE 
J065033D05AAGGCCCATTANONE 
J065045D15AAGGCCCATTANONE 
J065045K10AAGGCCCATTANONE 
J065049N05AAGGCCCATTANONE 
J065064N09AAGGCCCATTANONE 
J065068F17AAGGCCCATTANONE 
J065088F17AAGGCCCATTANONE 
J065104N22AAGGCCCATTANONE 
J065117B19AAGGCCCATTANONE 
J065119O12AAGGCCCATTANONE 
J065134G24AAGGCCCATTANONE 
J065150G16AAGGCCCATTANONE 
J065176C03AAGGCCCATTANONE 
J065212M23AAGGCCCATTANONE 
J075009P18AAGGCCCATTANONE 
J075019G06AAGGCCCATTANONE 
J075037H14AAGGCCCATTANONE 
J075057C13AAGGCCCATTANONE 
J075100E14AAGGCCCATTANONE 
J075120I16AAGGCCCATTANONE 
J075130F07AAGGCCCATTANONE 
J075156M16AAGGCCCATTANONE 
J100043J03AAGGCCCATTANONE 
Os04g0436800015-053-A06CAAGGCCCAAAANONE 
AK101115CAAGGCCCAAAAProtein prenyltransferase domain containing protein. 
J033025G14CAAGGCCCAAAANONE 
J033073N23CAAGGCCCAAAANONE 
J033097L19CAAGGCCCAAAANONE 
Os04g0440100AK101324AAGGCCCAATTNONE 
AK105415AAGGCCCAATTNonsense-mediated decay UPF3 domain containing protein. 
Os04g0446500015-073-B06AAGGCCCAGANONE 
AB118009AAGGCCCAGANONE 
AK073743AAGGCCCAGANONE 
AK103814AAGGCCCAGASimilar to FK506-binding protein 2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (FKBP-13) (FKBP-15). 
J033055H15AAGGCCCAGANONE 
J033067L09AAGGCCCAGANONE 
J033147C19AAGGCCCAGANONE 
J033147C20AAGGCCCAGANONE 
Os04g0462900006-094-A02CTTGGGCCTTNONE 
006-097-F05CTTGGGCCTTNONE 
009-129-A10CTTGGGCCTTNONE 
015-042-F07CTTGGGCCTTNONE 
AK058481CTTGGGCCTTNONE 
AK059483CTTGGGCCTTNONE 
AK061324CTTGGGCCTTNONE 
AK099100CTTGGGCCTTNONE 
AK102579CTTGGGCCTTNONE 
AK106322CTTGGGCCTTSimilar to Prohibitin. 
J065059J20CTTGGGCCTTNONE 
J065085I02CTTGGGCCTTNONE 
J065118N23CTTGGGCCTTNONE 
J065208K24CTTGGGCCTTNONE 
J075053B14CTTGGGCCTTNONE 
J075097M22CTTGGGCCTTNONE 
J075184B07CTTGGGCCTTNONE 
J075194A15CTTGGGCCTTNONE 
J080315G03CTTGGGCCTTNONE 
J090088H19CTTGGGCCTTNONE 
Os04g0465700016-043-B01AAGGCCCATCANONE 
AK064379AAGGCCCATCARNA dependent RNA polymerase family protein. 
Os04g0479000AK106344CAAGGCCCAGGSimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0490000AK108365AGTTGGGCCTTGSimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0504600J065162K24CCGTGGGCCTTNONE 
Os04g0542900AK068610AAGGCCCAAACConserved hypothetical protein. 
Os04g0547600AK109141TTTGGGCCTTPathogenesis-related transcriptional factor and ERF domain containing protein. 
AY339379TTTGGGCCTTNONE 
J065112J12TTTGGGCCTTNONE 
Os04g0551800016-049-G12CAAGGCCCATCANONE 
AK121568CAAGGCCCATCASimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06CAAGGCCCATCANONE 
J013111B11CAAGGCCCATCANONE 
J013121H23CAAGGCCCATCANONE 
J023012A17CAAGGCCCATCANONE 
J023092M05CAAGGCCCATCANONE 
J033026P14CAAGGCCCATCANONE 
J033033C10CAAGGCCCATCANONE 
J033033M10CAAGGCCCATCANONE 
J033035C24CAAGGCCCATCANONE 
J033052E19CAAGGCCCATCANONE 
J033140K19CAAGGCCCATCANONE 
J065036F18CAAGGCCCATCANONE 
J065067L12CAAGGCCCATCANONE 
J065095G09CAAGGCCCATCANONE 
J065115B08CAAGGCCCATCANONE 
J065218E24CAAGGCCCATCANONE 
J090002N13CAAGGCCCATCANONE 
J090008B12CAAGGCCCATCANONE 
J090016F24CAAGGCCCATCANONE 
J090019H14CAAGGCCCATCANONE 
J090020G20CAAGGCCCATCANONE 
J090029L18CAAGGCCCATCANONE 
J090057C23CAAGGCCCATCANONE 
J090073H23CAAGGCCCATCANONE 
J090081C16CAAGGCCCATCANONE 
J090081E21CAAGGCCCATCANONE 
J090084L14CAAGGCCCATCANONE 
J090086M01CAAGGCCCATCANONE 
J090089E16CAAGGCCCATCANONE 
J100031P12CAAGGCCCATCANONE 
J100090N23CAAGGCCCATCANONE 
Os04g0564600009-038-A02CCCGGCCCATAAGGCCCACGTNONE 
AK105145CCCGGCCCATAAGGCCCACGTNONE 
AK120614CCCGGCCCATAAGGCCCACGTSimilar to HMG1 protein. 
J013102D16CCCGGCCCATAAGGCCCACGTNONE 
J013151P06CCCGGCCCATAAGGCCCACGTNONE 
J033082C11CCCGGCCCATAAGGCCCACGTNONE 
J065073N13CCCGGCCCATAAGGCCCACGTNONE 
J065142E11CCCGGCCCATAAGGCCCACGTNONE 
J065187I19CCCGGCCCATAAGGCCCACGTNONE 
J065204K02CCCGGCCCATAAGGCCCACGTNONE 
J090089P22CCCGGCCCATAAGGCCCACGTNONE 
J100060B16CCCGGCCCATAAGGCCCACGTNONE 
Os04g0573200AK065277AAGGCCCAAACNONE 
AK065277CAAGGCCCATCTNONE 
AK120348AAGGCCCAAACHeavy metal transport/detoxification protein domain containing protein. 
AK120348CAAGGCCCATCTHeavy metal transport/detoxification protein domain containing protein. 
Os04g0581300009-171-H01ATGGCCCATAAGGCCCAACANONE 
009-171-H01ATTTGGGCCTTTTTGGGCCTANONE 
AK063093ATGGCCCATAAGGCCCAACASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
AK063093ATTTGGGCCTTTTTGGGCCTASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0584900AK058633AAGGCCCACTNONE 
Os04g0607200J065082C16TTATGGGCCTTNONE 
J065167I02TTATGGGCCTTNONE 
Os04g0612600AB042115AAGGCCCAAACAATGGGCCCACCTNONE 
AK060707AAGGCCCAAACAATGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK099008AAGGCCCAAACAATGGGCCCACCTNONE 
AK104427AAGGCCCAAACAATGGGCCCACCTNONE 
J023043H02AAGGCCCAAACAATGGGCCCACCTNONE 
J033033I23AAGGCCCAAACAATGGGCCCACCTNONE 
J033067P21AAGGCCCAAACAATGGGCCCACCTNONE 
J033088M21AAGGCCCAAACAATGGGCCCACCTNONE 
J033133M08AAGGCCCAAACAATGGGCCCACCTNONE 
J043030I16AAGGCCCAAACAATGGGCCCACCTNONE 
J075049H08AAGGCCCAAACAATGGGCCCACCTNONE 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
Os04g0635700009-079-G03AAGGCCCATGTNONE 
AK062025AAGGCCCATGTRibbon-helix-helix domain containing protein. 
AK098916AAGGCCCATGTNONE 
J013002J07AAGGCCCATGTNONE 
J013109L20AAGGCCCATGTNONE 
J023055C07AAGGCCCATGTNONE 
J065036K04AAGGCCCATGTNONE 
J065164G12AAGGCCCATGTNONE 
Os04g0635800006-033-E07AATGGGCCGGCCCATCAAGGCCCATTANONE 
011-067-A08AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK060110AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK099507AATGGGCCGGCCCATCAAGGCCCATTAGCN5-related N-acetyltransferase domain containing protein. 
AK104741AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK120021AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013029B17AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013134M07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013149N18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013153L10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J033131F08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J043010E02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075030K04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075178K05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080001B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080003N19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005F20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005G16AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080007N02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080009J04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080017D04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080020M22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021A15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021F21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080023P05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080024P22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080027C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080029K03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080035M18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039F22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039J03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039L03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039P14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080042E12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047D19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047M21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080049N03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080056J12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080060B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080062K08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080064L07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080069C15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080074H06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080086O14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090L14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080095G08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080097C07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090011F03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090082O17AATGGGCCGGCCCATCAAGGCCCATTANONE 
Os04g0636900011-028-G03CCATGGGCCTTNONE 
012-040-G03CCATGGGCCTTNONE 
AK058405CCATGGGCCTTNONE 
AK065789CCATGGGCCTTNONE 
AK101408CCATGGGCCTTNONE 
AK119286CCATGGGCCTTNONE 
J013042J24CCATGGGCCTTNONE 
J033037I12CCATGGGCCTTNONE 
J043031B12CCATGGGCCTTNONE 
J065152N10CCATGGGCCTTNONE 
J090060K17CCATGGGCCTTNONE 
J090083K14CCATGGGCCTTNONE 
J100046O13CCATGGGCCTTNONE 
J100066G22CCATGGGCCTTNONE 
Os04g0637500AK108202AAGGCCCACTMitochodrial transcription termination factor-related family protein. 
J065163A11AAGGCCCACTNONE 
Os04g0660600009-113-A11CAAGGCCCAGATNONE 
AK120899CAAGGCCCAGATATPase, V0 complex, subunit H family protein. 
J023030J05CAAGGCCCAGATNONE 
J065068M07CAAGGCCCAGATNONE 
J065120G22CAAGGCCCAGATNONE 
J065168J18CAAGGCCCAGATNONE 
J065211M10CAAGGCCCAGATNONE 
J075175E21CAAGGCCCAGATNONE 
J090021C06CAAGGCCCAGATNONE 
J090032P15CAAGGCCCAGATNONE 
J090082E05CAAGGCCCAGATNONE 
J100090O11CAAGGCCCAGATNONE 
Os04g0661700AK066532CTTGGGCCTTConserved hypothetical protein. 
J065083O18CTTGGGCCTTNONE 
Os04g0674100J080097J12AAGGCCCACCAThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965TGGTGGGCCTTNONE 
AK103795TGGTGGGCCTTCoenzyme Q biosynthesis Coq4 family protein. 
J033076F14TGGTGGGCCTTNONE 
J065020P20TGGTGGGCCTTNONE 
J065057I21TGGTGGGCCTTNONE 
J065059P11TGGTGGGCCTTNONE 
J065083A22TGGTGGGCCTTNONE 
J065093K10TGGTGGGCCTTNONE 
J065097D03TGGTGGGCCTTNONE 
J065103P05TGGTGGGCCTTNONE 
J065113K09TGGTGGGCCTTNONE 
J065118F23TGGTGGGCCTTNONE 
J065119M06TGGTGGGCCTTNONE 
J065146K17TGGTGGGCCTTNONE 
J065161N12TGGTGGGCCTTNONE 
J065169L02TGGTGGGCCTTNONE 
J065189H12TGGTGGGCCTTNONE 
J065192E24TGGTGGGCCTTNONE 
J065193K17TGGTGGGCCTTNONE 
J065197O21TGGTGGGCCTTNONE 
J065214D09TGGTGGGCCTTNONE 
J065217B11TGGTGGGCCTTNONE 
J075132K07TGGTGGGCCTTNONE 
J100059D14TGGTGGGCCTTNONE 
Os04g0678800AK072212CAAGGCCCAGTAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065CAAGGCCCAGTANONE 
Os05g0102900006-056-A01AGATGGGCCTTNONE 
AK061764AGATGGGCCTTNONE 
AK065749AGATGGGCCTTSnf7 family protein. 
AK104101AGATGGGCCTTNONE 
J013042C01AGATGGGCCTTNONE 
J033038P15AGATGGGCCTTNONE 
J065032F16AGATGGGCCTTNONE 
J065039I22AGATGGGCCTTNONE 
J065150F19AGATGGGCCTTNONE 
J075079I21AGATGGGCCTTNONE 
J075082F14AGATGGGCCTTNONE 
J075098G16AGATGGGCCTTNONE 
J075167I08AGATGGGCCTTNONE 
Os05g0110700AK102486AAGGCCCACACKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12AAGGCCCACACNONE 
Os05g0121000009-181-E02TTGTGGGCCTTNONE 
AK058867TTGTGGGCCTTNONE 
AK071341TTGTGGGCCTTProtein of unknown function DUF1218 family protein. 
J023024H24TTGTGGGCCTTNONE 
J023090B22TTGTGGGCCTTNONE 
J023111G15TTGTGGGCCTTNONE 
J023134K14TTGTGGGCCTTNONE 
J033057C05TTGTGGGCCTTNONE 
J033067J15TTGTGGGCCTTNONE 
J033084L15TTGTGGGCCTTNONE 
J033088B04TTGTGGGCCTTNONE 
J043027A08TTGTGGGCCTTNONE 
J043029L03TTGTGGGCCTTNONE 
J053031K22TTGTGGGCCTTNONE 
J053046I01TTGTGGGCCTTNONE 
J053070B05TTGTGGGCCTTNONE 
J053072C10TTGTGGGCCTTNONE 
J065097M22TTGTGGGCCTTNONE 
J065164I17TTGTGGGCCTTNONE 
J075058I08TTGTGGGCCTTNONE 
J075064C09TTGTGGGCCTTNONE 
J080304C16TTGTGGGCCTTNONE 
J080304H16TTGTGGGCCTTNONE 
J080306E17TTGTGGGCCTTNONE 
J080310L03TTGTGGGCCTTNONE 
J080316J07TTGTGGGCCTTNONE 
J080317L23TTGTGGGCCTTNONE 
J080319A10TTGTGGGCCTTNONE 
J090060F01TTGTGGGCCTTNONE 
J100042N16TTGTGGGCCTTNONE 
J100047F05TTGTGGGCCTTNONE 
J100075J19TTGTGGGCCTTNONE 
Os05g0121800AK101222AAGGCCCAACAConserved hypothetical protein. 
J033031D02AAGGCCCAACANONE 
J065078F10AAGGCCCAACANONE 
J065151J16AAGGCCCAACANONE 
J065151K04AAGGCCCAACANONE 
J090057E18AAGGCCCAACANONE 
Os05g0125600AK102952AAGGCCCAAAProtein of unknown function DUF1677, Oryza sativa family protein. 
J033115D18AAGGCCCAAANONE 
Os05g0140800AK110652TGCGGCCCATAAAGGCCCAGATSimilar to Dormancy related protein (Fragment). 
J075019K14TGCGGCCCATAAAGGCCCAGATNONE 
J075020O11TGCGGCCCATAAAGGCCCAGATNONE 
J075028P06TGCGGCCCATAAAGGCCCAGATNONE 
J075050A16TGCGGCCCATAAAGGCCCAGATNONE 
J075051F18TGCGGCCCATAAAGGCCCAGATNONE 
J075085K03TGCGGCCCATAAAGGCCCAGATNONE 
J075112P22TGCGGCCCATAAAGGCCCAGATNONE 
J075118I09TGCGGCCCATAAAGGCCCAGATNONE 
J075144H09TGCGGCCCATAAAGGCCCAGATNONE 
J075166I07TGCGGCCCATAAAGGCCCAGATNONE 
J075191J02TGCGGCCCATAAAGGCCCAGATNONE 
J075195I23TGCGGCCCATAAAGGCCCAGATNONE 
Os05g0150300AK100732AAGGCCCACTSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
Os05g0155100006-075-B02AAGGCCCAAACCAGCCCACAANONE 
AK061929AAGGCCCAAACCAGCCCACAANONE 
AK102810AAGGCCCAAACCAGCCCACAANONE 
AK120877AAGGCCCAAACCAGCCCACAASimilar to 60S ribosomal protein L18. 
J013023E03AAGGCCCAAACCAGCCCACAANONE 
J013038C16AAGGCCCAAACCAGCCCACAANONE 
J013120M14AAGGCCCAAACCAGCCCACAANONE 
J013153B04AAGGCCCAAACCAGCCCACAANONE 
J013159B07AAGGCCCAAACCAGCCCACAANONE 
J023012A02AAGGCCCAAACCAGCCCACAANONE 
J023027F08AAGGCCCAAACCAGCCCACAANONE 
J023027I12AAGGCCCAAACCAGCCCACAANONE 
J023120F05AAGGCCCAAACCAGCCCACAANONE 
J023138O03AAGGCCCAAACCAGCCCACAANONE 
J023142H13AAGGCCCAAACCAGCCCACAANONE 
J023143P06AAGGCCCAAACCAGCCCACAANONE 
J033023P09AAGGCCCAAACCAGCCCACAANONE 
J033035O14AAGGCCCAAACCAGCCCACAANONE 
J033042N19AAGGCCCAAACCAGCCCACAANONE 
J033043B12AAGGCCCAAACCAGCCCACAANONE 
J033065D10AAGGCCCAAACCAGCCCACAANONE 
J033081A12AAGGCCCAAACCAGCCCACAANONE 
J033084N05AAGGCCCAAACCAGCCCACAANONE 
J033085M03AAGGCCCAAACCAGCCCACAANONE 
J033112D15AAGGCCCAAACCAGCCCACAANONE 
J033114O07AAGGCCCAAACCAGCCCACAANONE 
J033119D15AAGGCCCAAACCAGCCCACAANONE 
J033140E06AAGGCCCAAACCAGCCCACAANONE 
J033141K23AAGGCCCAAACCAGCCCACAANONE 
J043040I22AAGGCCCAAACCAGCCCACAANONE 
J053050B21AAGGCCCAAACCAGCCCACAANONE 
J053065I18AAGGCCCAAACCAGCCCACAANONE 
J053074O16AAGGCCCAAACCAGCCCACAANONE 
J065072K13AAGGCCCAAACCAGCCCACAANONE 
J065211I09AAGGCCCAAACCAGCCCACAANONE 
J090004K04AAGGCCCAAACCAGCCCACAANONE 
J090016L06AAGGCCCAAACCAGCCCACAANONE 
J090040F22AAGGCCCAAACCAGCCCACAANONE 
J090063F22AAGGCCCAAACCAGCCCACAANONE 
J090081J09AAGGCCCAAACCAGCCCACAANONE 
J100032A10AAGGCCCAAACCAGCCCACAANONE 
J100037G20AAGGCCCAAACCAGCCCACAANONE 
J100056O10AAGGCCCAAACCAGCCCACAANONE 
J100071D10AAGGCCCAAACCAGCCCACAANONE 
J100075K13AAGGCCCAAACCAGCCCACAANONE 
J100079F16AAGGCCCAAACCAGCCCACAANONE 
J100080O16AAGGCCCAAACCAGCCCACAANONE 
J100086N05AAGGCCCAAACCAGCCCACAANONE 
Os05g0177100AK064652CAAGGCCCAAATConserved hypothetical protein. 
Os05g0226300AK067770ATTTGGGCCTTConserved hypothetical protein. 
J013120H22ATTTGGGCCTTNONE 
J013146E15ATTTGGGCCTTNONE 
Os05g0295800AK070232AAGGCCCATCASimilar to Glyoxalase I (EC 4.4.1.5). 
J023043J03AAGGCCCATCANONE 
Os05g0346300009-033-C06GCGGCCCAGCAAGGCCCATCGNONE 
AF529175GCGGCCCAGCAAGGCCCATCGNONE 
AK061627GCGGCCCAGCAAGGCCCATCGSimilar to 40S ribosomal protein S7. 
AK103081GCGGCCCAGCAAGGCCCATCGNONE 
AK104191GCGGCCCAGCAAGGCCCATCGNONE 
J013049B09GCGGCCCAGCAAGGCCCATCGNONE 
J023142E24GCGGCCCAGCAAGGCCCATCGNONE 
J033052M14GCGGCCCAGCAAGGCCCATCGNONE 
J033089N04GCGGCCCAGCAAGGCCCATCGNONE 
J033118F01GCGGCCCAGCAAGGCCCATCGNONE 
J065054E07GCGGCCCAGCAAGGCCCATCGNONE 
J065066L18GCGGCCCAGCAAGGCCCATCGNONE 
J065078C21GCGGCCCAGCAAGGCCCATCGNONE 
J065127G23GCGGCCCAGCAAGGCCCATCGNONE 
J065128N24GCGGCCCAGCAAGGCCCATCGNONE 
J065144P17GCGGCCCAGCAAGGCCCATCGNONE 
J065147P14GCGGCCCAGCAAGGCCCATCGNONE 
J065170E16GCGGCCCAGCAAGGCCCATCGNONE 
J065175D17GCGGCCCAGCAAGGCCCATCGNONE 
J065176M05GCGGCCCAGCAAGGCCCATCGNONE 
J065218G20GCGGCCCAGCAAGGCCCATCGNONE 
J090074J12GCGGCCCAGCAAGGCCCATCGNONE 
J100019H16GCGGCCCAGCAAGGCCCATCGNONE 
J100031N24GCGGCCCAGCAAGGCCCATCGNONE 
J100072G08GCGGCCCAGCAAGGCCCATCGNONE 
J100086I23GCGGCCCAGCAAGGCCCATCGNONE 
Os05g0357100AK102042AAGGCCCAAAA3'-5' exonuclease domain containing protein. 
J033081J05AAGGCCCAAAANONE 
J100022A18AAGGCCCAAAANONE 
Os05g0386900009-015-C03TTTGGGCCTTGNONE 
AK059319TTTGGGCCTTGNONE 
Os05g0417200AK071955ATTTGGGCCACAATGGGCCTTGCGGGCCThioredoxin-like fold domain containing protein. 
AK071955TAATGGGCCACGATGGGCCTTThioredoxin-like fold domain containing protein. 
Os05g0452600009-022-A05AAGGCCCATTANONE 
009-166-F05AAGGCCCATTANONE 
AK121541AAGGCCCATTASimilar to Ribosomal protein L33. 
J033031N19AAGGCCCATTANONE 
Os05g0459900AK058918AAGGCCCATTTAGCCCAGCCCSimilar to 60S ribosomal protein L36-1. 
AK111268AAGGCCCATTTAGCCCAGCCCNONE 
J013129N08AAGGCCCATTTAGCCCAGCCCNONE 
J065191E01AAGGCCCATTTAGCCCAGCCCNONE 
J065216P03AAGGCCCATTTAGCCCAGCCCNONE 
J075089K21AAGGCCCATTTAGCCCAGCCCNONE 
Os05g0481600009-067-H08CACGGCCCATCCAAGGCCCAGANONE 
009-085-H10CACGGCCCATCCAAGGCCCAGANONE 
009-147-F04CACGGCCCATCCAAGGCCCAGANONE 
AK063820CACGGCCCATCCAAGGCCCAGAConserved hypothetical protein. 
AK121540CACGGCCCATCCAAGGCCCAGANONE 
J023027H12CACGGCCCATCCAAGGCCCAGANONE 
J033031M01CACGGCCCATCCAAGGCCCAGANONE 
J053031M02CACGGCCCATCCAAGGCCCAGANONE 
Os05g0487600AK100817CAAGGCCCAAACNONE 
AK103104CAAGGCCCAAACNONE 
J043027P10CAAGGCCCAAACNONE 
J065183N17CAAGGCCCAAACNONE 
Os05g0490000011-076-C07AGATGGGCCTTNONE 
015-026-D07AGATGGGCCTTNONE 
015-074-A08AGATGGGCCTTNONE 
AK064335AGATGGGCCTTNONE 
AK101340AGATGGGCCTTKrr1 family protein. 
J033034J18AGATGGGCCTTNONE 
Os05g0501300006-075-B11CTTGGGCCTTGNONE 
006-083-H08CTTGGGCCTTGNONE 
AK059889CTTGGGCCTTGSimilar to Flavoprotein wrbA (Trp repressor binding protein). 
J043030K02CTTGGGCCTTGNONE 
Os05g0502800016-060-H05CAAGGCCCATAANONE 
AK064242CAAGGCCCATAANONE 
AK065486CAAGGCCCATAANAF1 domain containing protein. 
Os05g0520200006-031-F07AAGGCCCAAACNONE 
AK061451AAGGCCCAAACThioredoxin-related domain containing protein. 
AK099433AAGGCCCAAACNONE 
Os05g0528200009-146-C01AAGGCCCACTNONE 
AK062985AAGGCCCACTSimilar to 50S ribosomal protein L20. 
Os05g0541500AK101190CCATGGGCCTTCyclin-like F-box domain containing protein. 
AK101531CCATGGGCCTTNONE 
J033030F10CCATGGGCCTTNONE 
Os05g0547850009-102-F03AGATGGGCCTTGGGCCGAAANONE 
013-076-H08AGATGGGCCTTGGGCCGAAANONE 
AK058330AGATGGGCCTTGGGCCGAAANONE 
AK122158AGATGGGCCTTGGGCCGAAADNA-binding TFAR19-related protein family protein. 
AY626826AGATGGGCCTTGGGCCGAAANONE 
J043012O19AGATGGGCCTTGGGCCGAAANONE 
J043038O15AGATGGGCCTTGGGCCGAAANONE 
J053094L06AGATGGGCCTTGGGCCGAAANONE 
Os05g0548100AK060333TACTGGGCCTTConserved hypothetical protein. 
AK060333TTTCGGCCCAAGGCCCATATConserved hypothetical protein. 
AK100682TACTGGGCCTTNONE 
AK100682TTTCGGCCCAAGGCCCATATNONE 
J013151E01TACTGGGCCTTNONE 
J013151E01TTTCGGCCCAAGGCCCATATNONE 
J023113L22TACTGGGCCTTNONE 
J023113L22TTTCGGCCCAAGGCCCATATNONE 
J043027A19TACTGGGCCTTNONE 
J043027A19TTTCGGCCCAAGGCCCATATNONE 
J075093E06TACTGGGCCTTNONE 
J075093E06TTTCGGCCCAAGGCCCATATNONE 
J090060D15TACTGGGCCTTNONE 
J090060D15TTTCGGCCCAAGGCCCATATNONE 
J090082J03TACTGGGCCTTNONE 
J090082J03TTTCGGCCCAAGGCCCATATNONE 
J100050E01TACTGGGCCTTNONE 
J100050E01TTTCGGCCCAAGGCCCATATNONE 
Os05g0552900AK102095AAGGCCCAAGMAP65/ASE1 family protein. 
Os05g0559900AK067197GAAGCCCAAGGCCCAAACtRNA-binding arm domain containing protein. 
J013074C15GAAGCCCAAGGCCCAAACNONE 
J013098O16GAAGCCCAAGGCCCAAACNONE 
J033030M01GAAGCCCAAGGCCCAAACNONE 
J090058H12GAAGCCCAAGGCCCAAACNONE 
J090075M06GAAGCCCAAGGCCCAAACNONE 
Os05g0565200004-015-E06AAGGCCCAACCNONE 
004-015-E06AAGGCCCAACCNONE 
AK067090AAGGCCCAACCSimilar to Urease accessory protein G. 
AK067090AAGGCCCAACCSimilar to Urease accessory protein G. 
AK104200AAGGCCCAACCNONE 
AK104200AAGGCCCAACCNONE 
AK104368AAGGCCCAACCNONE 
AK104368AAGGCCCAACCNONE 
Os05g0584600AK072537CCATGGGCCTTAAA ATPase domain containing protein. 
AK107350CCATGGGCCTTNONE 
Os05g0592400AB037144CAAGGCCCACACNONE 
AK065508CAAGGCCCACACUV-damaged DNA binding protein. 
J013069J24CAAGGCCCACACNONE 
J013075H15CAAGGCCCACACNONE 
J013095H04CAAGGCCCACACNONE 
J013105L19CAAGGCCCACACNONE 
J013152P13CAAGGCCCACACNONE 
J023072O05CAAGGCCCACACNONE 
J033024J22CAAGGCCCACACNONE 
J033030D07CAAGGCCCACACNONE 
J033041D09CAAGGCCCACACNONE 
J033051M16CAAGGCCCACACNONE 
J033126M01CAAGGCCCACACNONE 
J033145H24CAAGGCCCACACNONE 
Os05g0595400006-103-B08AAGGCCCAAGNONE 
009-117-H06AAGGCCCAAGNONE 
AK061858AAGGCCCAAGNONE 
AK066391AAGGCCCAAGSimilar to Nucleoside diphosphate kinase III (EC 2.7.4.6) (NDK III) (NDP kinase III) (NDPK III). 
J013109B15AAGGCCCAAGNONE 
J023003J16AAGGCCCAAGNONE 
J023027P15AAGGCCCAAGNONE 
J023106M08AAGGCCCAAGNONE 
J023122O03AAGGCCCAAGNONE 
J033081D04AAGGCCCAAGNONE 
J033086G23AAGGCCCAAGNONE 
J033115F13AAGGCCCAAGNONE 
Os06g0101600AF093636AAGGCCCACGTNONE 
AK070447AAGGCCCACGTPlastocyanin, chloroplast precursor. 
J065001A20AAGGCCCACGTNONE 
J065019M17AAGGCCCACGTNONE 
J065021H18AAGGCCCACGTNONE 
J065061A17AAGGCCCACGTNONE 
J065073L02AAGGCCCACGTNONE 
J065099F17AAGGCCCACGTNONE 
J065101C23AAGGCCCACGTNONE 
J065121E23AAGGCCCACGTNONE 
J065122N04AAGGCCCACGTNONE 
J065141N05AAGGCCCACGTNONE 
J065143N21AAGGCCCACGTNONE 
J065161H09AAGGCCCACGTNONE 
J065161J04AAGGCCCACGTNONE 
J065162P20AAGGCCCACGTNONE 
J065182K10AAGGCCCACGTNONE 
J065184M05AAGGCCCACGTNONE 
J065186H24AAGGCCCACGTNONE 
J065189G21AAGGCCCACGTNONE 
J065190N14AAGGCCCACGTNONE 
J065191H08AAGGCCCACGTNONE 
J065205H17AAGGCCCACGTNONE 
J075001E03AAGGCCCACGTNONE 
J075001H21AAGGCCCACGTNONE 
J075003J23AAGGCCCACGTNONE 
J075003K01AAGGCCCACGTNONE 
J075005I11AAGGCCCACGTNONE 
J075007F16AAGGCCCACGTNONE 
J075017I11AAGGCCCACGTNONE 
J075018O05AAGGCCCACGTNONE 
J075019G24AAGGCCCACGTNONE 
J075032D04AAGGCCCACGTNONE 
J075032N13AAGGCCCACGTNONE 
J075033C09AAGGCCCACGTNONE 
J075033D11AAGGCCCACGTNONE 
J075039A20AAGGCCCACGTNONE 
J075058P12AAGGCCCACGTNONE 
J075062E10AAGGCCCACGTNONE 
J075062P16AAGGCCCACGTNONE 
J075063C17AAGGCCCACGTNONE 
J075066E07AAGGCCCACGTNONE 
J075066I20AAGGCCCACGTNONE 
J075075K21AAGGCCCACGTNONE 
J075078F03AAGGCCCACGTNONE 
J075082F10AAGGCCCACGTNONE 
J075086G16AAGGCCCACGTNONE 
J075087E07AAGGCCCACGTNONE 
J075087K06AAGGCCCACGTNONE 
J075087L04AAGGCCCACGTNONE 
J075088B16AAGGCCCACGTNONE 
J075088D02AAGGCCCACGTNONE 
J075094H21AAGGCCCACGTNONE 
J075094I24AAGGCCCACGTNONE 
J075094K10AAGGCCCACGTNONE 
J075095C18AAGGCCCACGTNONE 
J075097B05AAGGCCCACGTNONE 
J075099C13AAGGCCCACGTNONE 
J075099H22AAGGCCCACGTNONE 
J075099L16AAGGCCCACGTNONE 
J075104K08AAGGCCCACGTNONE 
J075118O06AAGGCCCACGTNONE 
J075119E15AAGGCCCACGTNONE 
J075124N06AAGGCCCACGTNONE 
J075126G02AAGGCCCACGTNONE 
J075127L24AAGGCCCACGTNONE 
J075131E23AAGGCCCACGTNONE 
J075140H06AAGGCCCACGTNONE 
J075146I20AAGGCCCACGTNONE 
J075146N24AAGGCCCACGTNONE 
J075147I19AAGGCCCACGTNONE 
J075155K07AAGGCCCACGTNONE 
J075156C05AAGGCCCACGTNONE 
J075161G07AAGGCCCACGTNONE 
J075164G01AAGGCCCACGTNONE 
J075170J18AAGGCCCACGTNONE 
J075172G17AAGGCCCACGTNONE 
J075176G10AAGGCCCACGTNONE 
J075178C05AAGGCCCACGTNONE 
J075179G01AAGGCCCACGTNONE 
J075181E24AAGGCCCACGTNONE 
J080029D19AAGGCCCACGTNONE 
J080034L11AAGGCCCACGTNONE 
J080039G07AAGGCCCACGTNONE 
J080062M23AAGGCCCACGTNONE 
J080302A01AAGGCCCACGTNONE 
J100042I15AAGGCCCACGTNONE 
J100043G22AAGGCCCACGTNONE 
J100056L12AAGGCCCACGTNONE 
J100061A12AAGGCCCACGTNONE 
J100073O20AAGGCCCACGTNONE 
J100082I08AAGGCCCACGTNONE 
Os06g0103400009-138-H04AAGGCCCAGGCCCACCANONE 
009-138-H04AAGGCCCATCCNONE 
AK067021AAGGCCCAGGCCCACCANucleic acid-binding, OB-fold domain containing protein. 
AK067021AAGGCCCATCCNucleic acid-binding, OB-fold domain containing protein. 
AK071627AAGGCCCAGGCCCACCANONE 
AK071627AAGGCCCATCCNONE 
J080307A01AAGGCCCAGGCCCACCANONE 
J080307A01AAGGCCCATCCNONE 
Os06g0111700011-090-A02CAAGGCCCACCAAAGCCCACACNONE 
AK063401CAAGGCCCACCAAAGCCCACACTetratricopeptide-like helical domain containing protein. 
Os06g0116800AK058985AATGGGCCTTGSimilar to GFA2. 
AK120746AATGGGCCTTGNONE 
Os06g0119300AK067271CAAGGCCCAGTProtein of unknown function DUF594 family protein. 
Os06g0128400AK064390AAGGCCCAGCNONE 
AK121983AAGGCCCAGCWD40-like domain containing protein. 
Os06g0134900AK103205TCGTGGGCCTTConserved hypothetical protein. 
J033122E01TCGTGGGCCTTNONE 
Os06g0135000J075008J15AAGGCCCACGANONE 
J075166F23AAGGCCCACGANONE 
J075185F03AAGGCCCACGANONE 
Os06g0139700006-052-C07CCATGGGCCAAGGCCCATTNONE 
009-009-A08CCATGGGCCAAGGCCCATTNONE 
015-020-D09CCATGGGCCAAGGCCCATTNONE 
015-087-H06CCATGGGCCAAGGCCCATTNONE 
016-078-A03CCATGGGCCAAGGCCCATTNONE 
AK067884CCATGGGCCAAGGCCCATTNONE 
AK103245CCATGGGCCAAGGCCCATTConserved hypothetical protein. 
AK106116CCATGGGCCAAGGCCCATTNONE 
AK106220CCATGGGCCAAGGCCCATTNONE 
Os06g0140100011-063-A02AAGGCCCAACANONE 
AK063371AAGGCCCAACALeucine carboxyl methyltransferase family protein. 
Os06g0156700AK107226GCCCAGTAAGGCCCATGGGCCTTGLipolytic enzyme, G-D-S-L family protein. 
J075021O05GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075023M12GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075041C14GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075041C19GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075064F08GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075116I03GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075123I02GCCCAGTAAGGCCCATGGGCCTTGNONE 
Os06g0199500AK060939TACTGGGCCCAAGGCCCAAATNONE 
AK064613TACTGGGCCCAAGGCCCAAATSimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138TACTGGGCCCAAGGCCCAAATNONE 
Os06g0210200012-084-E04TTTGGGCCTTNONE 
AK060502TTTGGGCCTTNONE 
AK069709TTTGGGCCTTN-acyl-L-amino-acid amidohydrolase family protein. 
J023028L23TTTGGGCCTTNONE 
J023056O05TTTGGGCCTTNONE 
J033075N06TTTGGGCCTTNONE 
J065099C14TTTGGGCCTTNONE 
J065158C17TTTGGGCCTTNONE 
J065214B02TTTGGGCCTTNONE 
J075026E10TTTGGGCCTTNONE 
J075066J06TTTGGGCCTTNONE 
J075121I06TTTGGGCCTTNONE 
J075124L08TTTGGGCCTTNONE 
J100055D09TTTGGGCCTTNONE 
J100055E04TTTGGGCCTTNONE 
J100077L12TTTGGGCCTTNONE 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0225300AK065224AAGGCCCAAATAGGCCCACTNONE 
AK100258AAGGCCCAAATAGGCCCACTSimilar to SERK1 (Fragment). 
J013002G23AAGGCCCAAATAGGCCCACTNONE 
Os06g0226600006-083-D04AAGGCCCAACTNONE 
006-083-D04GTTGGGCCTTNONE 
AK061806AAGGCCCAACTNONE 
AK061806GTTGGGCCTTNONE 
AK102752AAGGCCCAACTTB2/DP1 and HVA22 related protein family protein. 
AK102752GTTGGGCCTTTB2/DP1 and HVA22 related protein family protein. 
J013089J11AAGGCCCAACTNONE 
J013089J11GTTGGGCCTTNONE 
J033106M05AAGGCCCAACTNONE 
J033106M05GTTGGGCCTTNONE 
J100044M21AAGGCCCAACTNONE 
J100044M21GTTGGGCCTTNONE 
J100056E06AAGGCCCAACTNONE 
J100056E06GTTGGGCCTTNONE 
J100059F06AAGGCCCAACTNONE 
J100059F06GTTGGGCCTTNONE 
Os06g0227200AK066970AAGGCCCATAAConserved hypothetical protein. 
AK073517AAGGCCCATAANONE 
J013088F13AAGGCCCATAANONE 
J013089B21AAGGCCCATAANONE 
J013109D18AAGGCCCATAANONE 
J023138G01AAGGCCCATAANONE 
J033040I03AAGGCCCATAANONE 
J033042L14AAGGCCCATAANONE 
J065207L20AAGGCCCATAANONE 
J090019A12AAGGCCCATAANONE 
J090053M23AAGGCCCATAANONE 
Os06g0304500AK119441GAAGCCCATTAAGGCCCACTCRS1/YhbY domain containing protein. 
J075143M24GAAGCCCATTAAGGCCCACTNONE 
J075194D03GAAGCCCATTAAGGCCCACTNONE 
Os06g0309000AK121021AAGGCCCAGACAGCCCAACZinc finger, FYVE/PHD-type domain containing protein. 
Os06g0320000009-030-C04CAAGGCCCAATTNONE 
009-135-F08CAAGGCCCAATTNONE 
J075103B05CAAGGCCCAATTProtein of unknown function DUF953, thioredoxin-like family protein. 
J075187J24CAAGGCCCAATTNONE 
Os06g0539066J065210J16CCTGGGCCTTConserved hypothetical protein. 
Os06g0547900AK100950CGATGGGCCTTSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665CGATGGGCCTTNONE 
J023139I22CGATGGGCCTTNONE 
J090066J10CGATGGGCCTTNONE 
Y13437CGATGGGCCTTNONE 
Os06g0567000009-166-G12CAAGGCCCAACANONE 
AK121337CAAGGCCCAACAProtein of unknown function UPF0197 family protein. 
J013122F01CAAGGCCCAACANONE 
J023080N12CAAGGCCCAACANONE 
J023120F03CAAGGCCCAACANONE 
J065013B18CAAGGCCCAACANONE 
J065039P21CAAGGCCCAACANONE 
J065089E06CAAGGCCCAACANONE 
J065095N19CAAGGCCCAACANONE 
J065119H03CAAGGCCCAACANONE 
J065121D18CAAGGCCCAACANONE 
J065149G04CAAGGCCCAACANONE 
J075012J04CAAGGCCCAACANONE 
J075021G13CAAGGCCCAACANONE 
J075106I23CAAGGCCCAACANONE 
J075107F19CAAGGCCCAACANONE 
J075152J22CAAGGCCCAACANONE 
J075186J20CAAGGCCCAACANONE 
J075188F16CAAGGCCCAACANONE 
J080001G06CAAGGCCCAACANONE 
J080002O09CAAGGCCCAACANONE 
J080006E10CAAGGCCCAACANONE 
J080006F24CAAGGCCCAACANONE 
J080012L07CAAGGCCCAACANONE 
J080016A10CAAGGCCCAACANONE 
J080017D11CAAGGCCCAACANONE 
J080017I04CAAGGCCCAACANONE 
J080017I10CAAGGCCCAACANONE 
J080020P06CAAGGCCCAACANONE 
J080024A20CAAGGCCCAACANONE 
J080027B10CAAGGCCCAACANONE 
J080027E03CAAGGCCCAACANONE 
J080027I01CAAGGCCCAACANONE 
J080027K20CAAGGCCCAACANONE 
J080041L12CAAGGCCCAACANONE 
J080043D21CAAGGCCCAACANONE 
J080044K11CAAGGCCCAACANONE 
J080048I08CAAGGCCCAACANONE 
J080049M12CAAGGCCCAACANONE 
J080050C14CAAGGCCCAACANONE 
J080050N21CAAGGCCCAACANONE 
J080053F04CAAGGCCCAACANONE 
J080054O16CAAGGCCCAACANONE 
J080058O21CAAGGCCCAACANONE 
J080059M11CAAGGCCCAACANONE 
J080061A11CAAGGCCCAACANONE 
J080063B15CAAGGCCCAACANONE 
J080063F22CAAGGCCCAACANONE 
J080066M18CAAGGCCCAACANONE 
J080068D12CAAGGCCCAACANONE 
J080070D22CAAGGCCCAACANONE 
J080071B06CAAGGCCCAACANONE 
J080072B17CAAGGCCCAACANONE 
J080081O04CAAGGCCCAACANONE 
J080089H05CAAGGCCCAACANONE 
J080093K13CAAGGCCCAACANONE 
J080095I05CAAGGCCCAACANONE 
J080097F19CAAGGCCCAACANONE 
J080304C03CAAGGCCCAACANONE 
J080304H11CAAGGCCCAACANONE 
J080308M21CAAGGCCCAACANONE 
J080313O15CAAGGCCCAACANONE 
J090020N23CAAGGCCCAACANONE 
J100023C12CAAGGCCCAACANONE 
Os06g0581300AK070987TTTGGGCCTTProtein of unknown function DUF1475 family protein. 
AK073185TTTGGGCCTTNONE 
J065209C10TTTGGGCCTTNONE 
J075060B03TTTGGGCCTTNONE 
J075117M08TTTGGGCCTTNONE 
J075126E04TTTGGGCCTTNONE 
J075189G04TTTGGGCCTTNONE 
J075189L16TTTGGGCCTTNONE 
J100061E16TTTGGGCCTTNONE 
Os06g0607800012-010-G03CAAGGCCCAAATNONE 
AB070254CAAGGCCCAAATNONE 
AK063158CAAGGCCCAAATSimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695CAAGGCCCAAATNONE 
J013074G13CAAGGCCCAAATNONE 
J090015C16CAAGGCCCAAATNONE 
J090069H10CAAGGCCCAAATNONE 
Os06g0622700AK107021TCTGGCCCAAAAGGCCCACAEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTGGCCCAAAAGGCCCACANONE 
J065100L18TCTGGCCCAAAAGGCCCACANONE 
J065129N15TCTGGCCCAAAAGGCCCACANONE 
J065152M08TCTGGCCCAAAAGGCCCACANONE 
J065198M12TCTGGCCCAAAAGGCCCACANONE 
J090077J22TCTGGCCCAAAAGGCCCACANONE 
J100024G23TCTGGCCCAAAAGGCCCACANONE 
J100027L01TCTGGCCCAAAAGGCCCACANONE 
J100047C06TCTGGCCCAAAAGGCCCACANONE 
J100055D01TCTGGCCCAAAAGGCCCACANONE 
J100067M05TCTGGCCCAAAAGGCCCACANONE 
J100077M16TCTGGCCCAAAAGGCCCACANONE 
J100078M22TCTGGCCCAAAAGGCCCACANONE 
Os06g0663600AK100787AAGGCCCATTEndonuclease V family protein. 
Os06g0670500AK059079AAGGCCCAAGNONE 
Os06g0673500J100018J12CCATGGGCCTTNONE 
J100072F13CCATGGGCCTTSimilar to Ubiquitin. 
Os06g0674800J065007E09AAGGCCCAAGNONE 
J065037D21AAGGCCCAAGHypothetical protein. 
J065063P14AAGGCCCAAGNONE 
J065128K24AAGGCCCAAGNONE 
J065188F06AAGGCCCAAGNONE 
J065199I24AAGGCCCAAGNONE 
J065214N19AAGGCCCAAGNONE 
Os06g0693000AK064280CAAGGCCCATATProtein kinase-like domain containing protein. 
Os06g0696600006-060-B12AAGGCCCAAAANONE 
AK105934AAGGCCCAAAASimilar to Xyloglucan endo-transglycosylase homolog. 
Os06g0702800009-039-E05ATGGCCCAGAAGGCCCACCANONE 
AK073948ATGGCCCAGAAGGCCCACCAHypothetical protein. 
J023108K23ATGGCCCAGAAGGCCCACCANONE 
J033072H04ATGGCCCAGAAGGCCCACCANONE 
J065008G05ATGGCCCAGAAGGCCCACCANONE 
J065128J12ATGGCCCAGAAGGCCCACCANONE 
J065131A01ATGGCCCAGAAGGCCCACCANONE 
J065173B12ATGGCCCAGAAGGCCCACCANONE 
Os06g0710300AK121344AAGGCCCACCTUncharacterized protein UPF0114 family protein. 
J043016B12AAGGCCCACCTNONE 
J065104H21AAGGCCCACCTNONE 
Os06g0711600016-047-G09CATGGGCCTTGNONE 
AK064384CATGGGCCTTGmRNA splicing factor SYF2 family protein. 
AK102831CATGGGCCTTGNONE 
J013072P18CATGGGCCTTGNONE 
J023049G01CATGGGCCTTGNONE 
J023088I01CATGGGCCTTGNONE 
J033023I22CATGGGCCTTGNONE 
J033106I12CATGGGCCTTGNONE 
J033109G07CATGGGCCTTGNONE 
J065030F22CATGGGCCTTGNONE 
J065132H19CATGGGCCTTGNONE 
J080301D07CATGGGCCTTGNONE 
J080305C09CATGGGCCTTGNONE 
J080312C03CATGGGCCTTGNONE 
J080313I15CATGGGCCTTGNONE 
J080315B09CATGGGCCTTGNONE 
J090056N21CATGGGCCTTGNONE 
J100027B07CATGGGCCTTGNONE 
Os06g0712900AK106648TCATGGGCCGAAAAGGCCCATATDihydrouridine synthase, DuS family protein. 
J075055M19TCATGGGCCGAAAAGGCCCATATNONE 
J075122I03TCATGGGCCGAAAAGGCCCATATNONE 
Os06g0715400012-007-C01GAGGCCCAAGGCCCATACNONE 
012-038-G03GAGGCCCAAGGCCCATACNONE 
AK071262GAGGCCCAAGGCCCATACt-snare domain containing protein. 
AK073963GAGGCCCAAGGCCCATACNONE 
J023085J06GAGGCCCAAGGCCCATACNONE 
J033073I09GAGGCCCAAGGCCCATACNONE 
J080316N15GAGGCCCAAGGCCCATACNONE 
J090062N15GAGGCCCAAGGCCCATACNONE 
Os06g0725400J065086O07AGTGGGCCTTGSimilar to BLE1 protein. 
J065114J19AGTGGGCCTTGNONE 
Os06g0726400AF136268GACACGTGAAGGCCCATGGNONE 
AK065121GACACGTGAAGGCCCATGGNONE 
AK119436GACACGTGAAGGCCCATGGBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
AK120332GACACGTGAAGGCCCATGGNONE 
AY302112GACACGTGAAGGCCCATGGNONE 
D10752GACACGTGAAGGCCCATGGNONE 
D11082GACACGTGAAGGCCCATGGNONE 
J013031L12GACACGTGAAGGCCCATGGNONE 
J013042M09GACACGTGAAGGCCCATGGNONE 
J013058E01GACACGTGAAGGCCCATGGNONE 
J013058O09GACACGTGAAGGCCCATGGNONE 
J013063J17GACACGTGAAGGCCCATGGNONE 
J013066I24GACACGTGAAGGCCCATGGNONE 
J013069F17GACACGTGAAGGCCCATGGNONE 
J013106E01GACACGTGAAGGCCCATGGNONE 
J013118D19GACACGTGAAGGCCCATGGNONE 
J013162M11GACACGTGAAGGCCCATGGNONE 
J023028B19GACACGTGAAGGCCCATGGNONE 
J023031A13GACACGTGAAGGCCCATGGNONE 
J023047H18GACACGTGAAGGCCCATGGNONE 
J023059N10GACACGTGAAGGCCCATGGNONE 
J023104N22GACACGTGAAGGCCCATGGNONE 
J033025J03GACACGTGAAGGCCCATGGNONE 
J033045B05GACACGTGAAGGCCCATGGNONE 
J033067M08GACACGTGAAGGCCCATGGNONE 
J033113D04GACACGTGAAGGCCCATGGNONE 
J043003D11GACACGTGAAGGCCCATGGNONE 
J043009O20GACACGTGAAGGCCCATGGNONE 
J043016P06GACACGTGAAGGCCCATGGNONE 
J043017C21GACACGTGAAGGCCCATGGNONE 
J043017J20GACACGTGAAGGCCCATGGNONE 
J043021P15GACACGTGAAGGCCCATGGNONE 
J043026I22GACACGTGAAGGCCCATGGNONE 
J043032L15GACACGTGAAGGCCCATGGNONE 
J043034G14GACACGTGAAGGCCCATGGNONE 
J043039L16GACACGTGAAGGCCCATGGNONE 
J075003D02GACACGTGAAGGCCCATGGNONE 
J075003O22GACACGTGAAGGCCCATGGNONE 
J075005I24GACACGTGAAGGCCCATGGNONE 
J075006N09GACACGTGAAGGCCCATGGNONE 
J075011A22GACACGTGAAGGCCCATGGNONE 
J075012K24GACACGTGAAGGCCCATGGNONE 
J075017D01GACACGTGAAGGCCCATGGNONE 
J075017I23GACACGTGAAGGCCCATGGNONE 
J075023D17GACACGTGAAGGCCCATGGNONE 
J075024B03GACACGTGAAGGCCCATGGNONE 
J075025H05GACACGTGAAGGCCCATGGNONE 
J075031D19GACACGTGAAGGCCCATGGNONE 
J075034B02GACACGTGAAGGCCCATGGNONE 
J075035C02GACACGTGAAGGCCCATGGNONE 
J075037J12GACACGTGAAGGCCCATGGNONE 
J075038M11GACACGTGAAGGCCCATGGNONE 
J075039J17GACACGTGAAGGCCCATGGNONE 
J075042P10GACACGTGAAGGCCCATGGNONE 
J075046J20GACACGTGAAGGCCCATGGNONE 
J075047F21GACACGTGAAGGCCCATGGNONE 
J075053E05GACACGTGAAGGCCCATGGNONE 
J075054D11GACACGTGAAGGCCCATGGNONE 
J075054K06GACACGTGAAGGCCCATGGNONE 
J075059E15GACACGTGAAGGCCCATGGNONE 
J075061O04GACACGTGAAGGCCCATGGNONE 
J075062I20GACACGTGAAGGCCCATGGNONE 
J075066I12GACACGTGAAGGCCCATGGNONE 
J075066L06GACACGTGAAGGCCCATGGNONE 
J075071H12GACACGTGAAGGCCCATGGNONE 
J075071N19GACACGTGAAGGCCCATGGNONE 
J075074K01GACACGTGAAGGCCCATGGNONE 
J075077H22GACACGTGAAGGCCCATGGNONE 
J075083H18GACACGTGAAGGCCCATGGNONE 
J075085F04GACACGTGAAGGCCCATGGNONE 
J075085K09GACACGTGAAGGCCCATGGNONE 
J075086C06GACACGTGAAGGCCCATGGNONE 
J075086E06GACACGTGAAGGCCCATGGNONE 
J075087A15GACACGTGAAGGCCCATGGNONE 
J075090N02GACACGTGAAGGCCCATGGNONE 
J075090N22GACACGTGAAGGCCCATGGNONE 
J075091C04GACACGTGAAGGCCCATGGNONE 
J075091G16GACACGTGAAGGCCCATGGNONE 
J075097E04GACACGTGAAGGCCCATGGNONE 
J075099E04GACACGTGAAGGCCCATGGNONE 
J075102P22GACACGTGAAGGCCCATGGNONE 
J075109B08GACACGTGAAGGCCCATGGNONE 
J075109J02GACACGTGAAGGCCCATGGNONE 
J075115I12GACACGTGAAGGCCCATGGNONE 
J075117E17GACACGTGAAGGCCCATGGNONE 
J075123C07GACACGTGAAGGCCCATGGNONE 
J075124N05GACACGTGAAGGCCCATGGNONE 
J075125E12GACACGTGAAGGCCCATGGNONE 
J075126B11GACACGTGAAGGCCCATGGNONE 
J075129E14GACACGTGAAGGCCCATGGNONE 
J075130N15GACACGTGAAGGCCCATGGNONE 
J075131I07GACACGTGAAGGCCCATGGNONE 
J075141B13GACACGTGAAGGCCCATGGNONE 
J075141B20GACACGTGAAGGCCCATGGNONE 
J075144D23GACACGTGAAGGCCCATGGNONE 
J075144N01GACACGTGAAGGCCCATGGNONE 
J075147M24GACACGTGAAGGCCCATGGNONE 
J075148L16GACACGTGAAGGCCCATGGNONE 
J075151A22GACACGTGAAGGCCCATGGNONE 
J075151D03GACACGTGAAGGCCCATGGNONE 
J075151D04GACACGTGAAGGCCCATGGNONE 
J075153E23GACACGTGAAGGCCCATGGNONE 
J075156D02GACACGTGAAGGCCCATGGNONE 
J075156P05GACACGTGAAGGCCCATGGNONE 
J075162E23GACACGTGAAGGCCCATGGNONE 
J075165J22GACACGTGAAGGCCCATGGNONE 
J075166A06GACACGTGAAGGCCCATGGNONE 
J075168H13GACACGTGAAGGCCCATGGNONE 
J075170D04GACACGTGAAGGCCCATGGNONE 
J075171C19GACACGTGAAGGCCCATGGNONE 
J075173B12GACACGTGAAGGCCCATGGNONE 
J075173M23GACACGTGAAGGCCCATGGNONE 
J075174C03GACACGTGAAGGCCCATGGNONE 
J075185O11GACACGTGAAGGCCCATGGNONE 
J075186G21GACACGTGAAGGCCCATGGNONE 
J075187D06GACACGTGAAGGCCCATGGNONE 
J075195G21GACACGTGAAGGCCCATGGNONE 
J090003D18GACACGTGAAGGCCCATGGNONE 
J090005I12GACACGTGAAGGCCCATGGNONE 
J090007D15GACACGTGAAGGCCCATGGNONE 
J090007G20GACACGTGAAGGCCCATGGNONE 
J090014G13GACACGTGAAGGCCCATGGNONE 
J090014L08GACACGTGAAGGCCCATGGNONE 
J090016J03GACACGTGAAGGCCCATGGNONE 
J090023P22GACACGTGAAGGCCCATGGNONE 
J090025C19GACACGTGAAGGCCCATGGNONE 
J090028F11GACACGTGAAGGCCCATGGNONE 
J090028G01GACACGTGAAGGCCCATGGNONE 
J090028H02GACACGTGAAGGCCCATGGNONE 
J090037I11GACACGTGAAGGCCCATGGNONE 
J090040F21GACACGTGAAGGCCCATGGNONE 
J090040N24GACACGTGAAGGCCCATGGNONE 
J090044M12GACACGTGAAGGCCCATGGNONE 
J090045B13GACACGTGAAGGCCCATGGNONE 
J090045M22GACACGTGAAGGCCCATGGNONE 
J090048C10GACACGTGAAGGCCCATGGNONE 
J090051J02GACACGTGAAGGCCCATGGNONE 
J090058O15GACACGTGAAGGCCCATGGNONE 
J090062F11GACACGTGAAGGCCCATGGNONE 
J090067D23GACACGTGAAGGCCCATGGNONE 
J090069G15GACACGTGAAGGCCCATGGNONE 
J090072I06GACACGTGAAGGCCCATGGNONE 
J090073H18GACACGTGAAGGCCCATGGNONE 
J090073L01GACACGTGAAGGCCCATGGNONE 
J090075O21GACACGTGAAGGCCCATGGNONE 
J090084K24GACACGTGAAGGCCCATGGNONE 
J090087P11GACACGTGAAGGCCCATGGNONE 
J090092B17GACACGTGAAGGCCCATGGNONE 
J100042H08GACACGTGAAGGCCCATGGNONE 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J033064G11TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065044F12TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065047I05TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065059P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065180P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J075131M22TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
Os07g0122300015-004-G08GCAGCCCATGGGCCTTNONE 
AK103212GCAGCCCATGGGCCTTNONE 
AK119295GCAGCCCATGGGCCTTProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09GCAGCCCATGGGCCTTNONE 
J090007P13GCAGCCCATGGGCCTTNONE 
Os07g0133700J065005A21AAATGGGCTAATTGGGCCTTHypothetical protein. 
J065096D02AAATGGGCTAATTGGGCCTTNONE 
J065097G13AAATGGGCTAATTGGGCCTTNONE 
Os07g0155200006-036-E03TATTGGGCCTTNONE 
006-036-E04TATTGGGCCTTNONE 
AK061006TATTGGGCCTTProtein of unknown function DUF150 family protein. 
AK104606TATTGGGCCTTNONE 
Os07g0180900006-055-B11CAAGGCCCAGCCCANONE 
006-103-F09CAAGGCCCAGCCCANONE 
011-009-E03CAAGGCCCAGCCCANONE 
011-035-H08CAAGGCCCAGCCCANONE 
014-043-F08CAAGGCCCAGCCCANONE 
AK060711CAAGGCCCAGCCCARibosomal protein L4/L1e family protein. 
AK060963CAAGGCCCAGCCCANONE 
AK104447CAAGGCCCAGCCCANONE 
AK104504CAAGGCCCAGCCCANONE 
AK104629CAAGGCCCAGCCCANONE 
J023003P15CAAGGCCCAGCCCANONE 
J023075H14CAAGGCCCAGCCCANONE 
J033101N17CAAGGCCCAGCCCANONE 
J033132M11CAAGGCCCAGCCCANONE 
J065081C24CAAGGCCCAGCCCANONE 
J080004L10CAAGGCCCAGCCCANONE 
J080009H21CAAGGCCCAGCCCANONE 
J080013F01CAAGGCCCAGCCCANONE 
J080022K24CAAGGCCCAGCCCANONE 
J080023C22CAAGGCCCAGCCCANONE 
J080024M16CAAGGCCCAGCCCANONE 
J080026K06CAAGGCCCAGCCCANONE 
J080030J23CAAGGCCCAGCCCANONE 
J080030L05CAAGGCCCAGCCCANONE 
J080031G03CAAGGCCCAGCCCANONE 
J080033C03CAAGGCCCAGCCCANONE 
J080033D02CAAGGCCCAGCCCANONE 
J080035A11CAAGGCCCAGCCCANONE 
J080035A14CAAGGCCCAGCCCANONE 
J080039E08CAAGGCCCAGCCCANONE 
J080040L15CAAGGCCCAGCCCANONE 
J080040M03CAAGGCCCAGCCCANONE 
J080041L21CAAGGCCCAGCCCANONE 
J080043E09CAAGGCCCAGCCCANONE 
J080048B14CAAGGCCCAGCCCANONE 
J080048O09CAAGGCCCAGCCCANONE 
J080051H01CAAGGCCCAGCCCANONE 
J080052H06CAAGGCCCAGCCCANONE 
J080065K05CAAGGCCCAGCCCANONE 
J080066D10CAAGGCCCAGCCCANONE 
J080066E23CAAGGCCCAGCCCANONE 
J080069F10CAAGGCCCAGCCCANONE 
J080074M06CAAGGCCCAGCCCANONE 
J080075D13CAAGGCCCAGCCCANONE 
J080076G02CAAGGCCCAGCCCANONE 
J080082G15CAAGGCCCAGCCCANONE 
J080082K06CAAGGCCCAGCCCANONE 
J080082P12CAAGGCCCAGCCCANONE 
J080085F01CAAGGCCCAGCCCANONE 
J080090H22CAAGGCCCAGCCCANONE 
J080092D07CAAGGCCCAGCCCANONE 
J080094M03CAAGGCCCAGCCCANONE 
J080094O10CAAGGCCCAGCCCANONE 
J090008I06CAAGGCCCAGCCCANONE 
J100058N20CAAGGCCCAGCCCANONE 
J100060M07CAAGGCCCAGCCCANONE 
J100062M08CAAGGCCCAGCCCANONE 
J100064L07CAAGGCCCAGCCCANONE 
J100073H16CAAGGCCCAGCCCANONE 
J100074C10CAAGGCCCAGCCCANONE 
J100075N06CAAGGCCCAGCCCANONE 
J100087P11CAAGGCCCAGCCCANONE 
J100088B13CAAGGCCCAGCCCANONE 
J100088J16CAAGGCCCAGCCCANONE 
J100088L17CAAGGCCCAGCCCANONE 
J100088O12CAAGGCCCAGCCCANONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0187300AK103069AAGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12AAGGCCCACGAANONE 
J033117P16AAGGCCCACGAANONE 
Os07g0242000AK107347CAAGGCCCACCConserved hypothetical protein. 
Os07g0245100AK059133GTTTGGGCCTTNONE 
Os07g0270900015-039-A02AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
AK068904AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J013169N21AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065039I11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065081J11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065162P04AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
Os07g0448800003-112-B05AAGGCCCATCCANONE 
003-118-A02AAGGCCCATCCANONE 
006-029-E09AAGGCCCATCCANONE 
006-056-F11AAGGCCCATCCANONE 
006-081-F01AAGGCCCATCCANONE 
006-084-H12AAGGCCCATCCANONE 
006-094-A12AAGGCCCATCCANONE 
006-095-C01AAGGCCCATCCANONE 
006-098-F09AAGGCCCATCCANONE 
009-151-B09AAGGCCCATCCANONE 
009-169-C08AAGGCCCATCCANONE 
009-172-F09AAGGCCCATCCANONE 
009-200-H03AAGGCCCATCCANONE 
011-008-B03AAGGCCCATCCANONE 
011-035-C10AAGGCCCATCCANONE 
011-041-G11AAGGCCCATCCANONE 
011-059-H01AAGGCCCATCCANONE 
011-071-D12AAGGCCCATCCANONE 
013-010-E11AAGGCCCATCCANONE 
013-015-B06AAGGCCCATCCANONE 
013-028-A11AAGGCCCATCCANONE 
013-037-A04AAGGCCCATCCANONE 
013-057-B07AAGGCCCATCCANONE 
014-041-D03AAGGCCCATCCANONE 
014-073-G04AAGGCCCATCCANONE 
014-093-D10AAGGCCCATCCANONE 
016-030-F03AAGGCCCATCCANONE 
016-034-B08AAGGCCCATCCANONE 
016-064-D05AAGGCCCATCCANONE 
AB029446AAGGCCCATCCANONE 
AF062393AAGGCCCATCCANONE 
AK072519AAGGCCCATCCAAquaporin. 
AK103938AAGGCCCATCCANONE 
AK103970AAGGCCCATCCANONE 
AK119656AAGGCCCATCCANONE 
J023026N01AAGGCCCATCCANONE 
J023055M16AAGGCCCATCCANONE 
J023063J21AAGGCCCATCCANONE 
J023128K12AAGGCCCATCCANONE 
J065041P10AAGGCCCATCCANONE 
J065134L07AAGGCCCATCCANONE 
J075198L17AAGGCCCATCCANONE 
J090031G17AAGGCCCATCCANONE 
J090032B21AAGGCCCATCCANONE 
J090032D13AAGGCCCATCCANONE 
J090057J22AAGGCCCATCCANONE 
J090062J02AAGGCCCATCCANONE 
J100028J09AAGGCCCATCCANONE 
J100053C06AAGGCCCATCCANONE 
J100056I11AAGGCCCATCCANONE 
J100067E10AAGGCCCATCCANONE 
Os07g0462700009-033-D05TTTTGGGCCTTGNONE 
AK073834TTTTGGGCCTTGNONE 
AK104968TTTTGGGCCTTGThioesterase superfamily domain containing protein. 
J065104G16TTTTGGGCCTTGNONE 
J065197C14TTTTGGGCCTTGNONE 
J065213E17TTTTGGGCCTTGNONE 
J065215D11TTTTGGGCCTTGNONE 
J075001J15TTTTGGGCCTTGNONE 
J075026M11TTTTGGGCCTTGNONE 
J075142G03TTTTGGGCCTTGNONE 
J075178H04TTTTGGGCCTTGNONE 
J100069P18TTTTGGGCCTTGNONE 
Os07g0480900012-002-E04GCTGGGCCTTNONE 
AK063422GCTGGGCCTTSimilar to Cysteine protease (Fragment). 
J065073E02GCTGGGCCTTNONE 
J065122P21GCTGGGCCTTNONE 
J075108D13GCTGGGCCTTNONE 
J075147K14GCTGGGCCTTNONE 
Os07g0516200AK061373CAAGGCCCAACASimilar to Endoribonuclease, L-PSP family. 
Os07g0522600AK067405AAGGCCCACTSimilar to Glutamate receptor 3.4 precursor (Ligand-gated ion channel 3.4) (AtGLR4). Splice isoform 2. 
AK103813AAGGCCCACTNONE 
J013106I10AAGGCCCACTNONE 
J023019F16AAGGCCCACTNONE 
J023111D09AAGGCCCACTNONE 
J033147C01AAGGCCCACTNONE 
J090014A07AAGGCCCACTNONE 
J090040K16AAGGCCCACTNONE 
J090087I22AAGGCCCACTNONE 
Os07g0565000AK121056GTTTGGGCCTTCTTGGGCCGASimilar to 40S ribosomal protein S11. 
J023056G18GTTTGGGCCTTCTTGGGCCGANONE 
J065131K04GTTTGGGCCTTCTTGGGCCGANONE 
J065190L19GTTTGGGCCTTCTTGGGCCGANONE 
J065209B06GTTTGGGCCTTCTTGGGCCGANONE 
J065216P11GTTTGGGCCTTCTTGGGCCGANONE 
J090088F06GTTTGGGCCTTCTTGGGCCGANONE 
Os07g0568900009-083-H02TAATGGGCCTTATTGGGCTTANONE 
AK062660TAATGGGCCTTATTGGGCTTAConserved hypothetical protein. 
Os07g0569000AK073915TAAGCCCAATAAGGCCCATTAConserved hypothetical protein. 
Os07g0573700AK070473CAAGGCCCAAGNucleotide-sugar transporter family protein. 
Os07g0578600AK067155GCTGGGCCTTSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065GCTGGGCCTTNONE 
Os07g0585800006-106-A05GTATGGGCCTTNONE 
AK066419GTATGGGCCTTNONE 
AK105064GTATGGGCCTTSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01GTATGGGCCTTNONE 
J065085B08GTATGGGCCTTNONE 
J065099I23GTATGGGCCTTNONE 
J065169A01GTATGGGCCTTNONE 
J065187N13GTATGGGCCTTNONE 
J065191L18GTATGGGCCTTNONE 
J065194D04GTATGGGCCTTNONE 
J065211M09GTATGGGCCTTNONE 
J065212I02GTATGGGCCTTNONE 
J090003C10GTATGGGCCTTNONE 
J090025O11GTATGGGCCTTNONE 
J090092F10GTATGGGCCTTNONE 
J100055A04GTATGGGCCTTNONE 
J100064A01GTATGGGCCTTNONE 
J100080L02GTATGGGCCTTNONE 
Os07g0611600AK059431TTTTGGGCCTTGNONE 
J033096O12TTTTGGGCCTTGNONE 
J075143O21TTTTGGGCCTTGNONE 
Os07g0620200AK099859TGTTGGGCCTTHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04TGTTGGGCCTTNONE 
Os07g0626600Os07g0626600GCTGGGCCTTSimilar to Embryogenic callus protein-like. 
Os07g0632600AK058943AAGGCCCAAGNONE 
J065034J15AAGGCCCAAGNONE 
Os07g0644300AK066726AAGGCCCACCASimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483AAGGCCCACCANONE 
Os07g0656400011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
Os08g0112800009-113-D03AAGGCCCATTANONE 
AK121176AAGGCCCATTARickettsia 17 kDa surface antigen family protein. 
J023083C18AAGGCCCATTANONE 
J033074M10AAGGCCCATTANONE 
J033097G10AAGGCCCATTANONE 
J065090F05AAGGCCCATTANONE 
J090001J03AAGGCCCATTANONE 
J090044F23AAGGCCCATTANONE 
J090078H09AAGGCCCATTANONE 
J100088G23AAGGCCCATTANONE 
Os08g0118900AK109749AAGGCCCACAAAdenylate kinase family protein. 
Os08g0130500006-024-B12AGCCCAATAAGGCCCATCTNONE 
006-024-B12CAAGGCCCATACNONE 
006-032-F11AGCCCAATAAGGCCCATCTNONE 
006-032-F11CAAGGCCCATACNONE 
006-047-B12AGCCCAATAAGGCCCATCTNONE 
006-047-B12CAAGGCCCATACNONE 
006-058-H06AGCCCAATAAGGCCCATCTNONE 
006-058-H06CAAGGCCCATACNONE 
006-062-D07AGCCCAATAAGGCCCATCTNONE 
006-062-D07CAAGGCCCATACNONE 
006-083-F11AGCCCAATAAGGCCCATCTNONE 
006-083-F11CAAGGCCCATACNONE 
006-084-A11AGCCCAATAAGGCCCATCTNONE 
006-084-A11CAAGGCCCATACNONE 
006-096-F12AGCCCAATAAGGCCCATCTNONE 
006-096-F12CAAGGCCCATACNONE 
006-105-A04AGCCCAATAAGGCCCATCTNONE 
006-105-A04CAAGGCCCATACNONE 
006-110-D11AGCCCAATAAGGCCCATCTNONE 
006-110-D11CAAGGCCCATACNONE 
011-022-D11AGCCCAATAAGGCCCATCTNONE 
011-022-D11CAAGGCCCATACNONE 
AK064857AGCCCAATAAGGCCCATCT60S acidic ribosomal protein P0. 
AK064857CAAGGCCCATAC60S acidic ribosomal protein P0. 
D21130AGCCCAATAAGGCCCATCTNONE 
D21130CAAGGCCCATACNONE 
J013000H12AGCCCAATAAGGCCCATCTNONE 
J013000H12CAAGGCCCATACNONE 
J013024M17AGCCCAATAAGGCCCATCTNONE 
J013024M17CAAGGCCCATACNONE 
J013028H09AGCCCAATAAGGCCCATCTNONE 
J013028H09CAAGGCCCATACNONE 
J013045N22AGCCCAATAAGGCCCATCTNONE 
J013045N22CAAGGCCCATACNONE 
J013092K19AGCCCAATAAGGCCCATCTNONE 
J013092K19CAAGGCCCATACNONE 
J013106L12AGCCCAATAAGGCCCATCTNONE 
J013106L12CAAGGCCCATACNONE 
J013107A03AGCCCAATAAGGCCCATCTNONE 
J013107A03CAAGGCCCATACNONE 
J013109E12AGCCCAATAAGGCCCATCTNONE 
J013109E12CAAGGCCCATACNONE 
J013114N08AGCCCAATAAGGCCCATCTNONE 
J013114N08CAAGGCCCATACNONE 
J013120J12AGCCCAATAAGGCCCATCTNONE 
J013120J12CAAGGCCCATACNONE 
J013121E21AGCCCAATAAGGCCCATCTNONE 
J013121E21CAAGGCCCATACNONE 
J013135P20AGCCCAATAAGGCCCATCTNONE 
J013135P20CAAGGCCCATACNONE 
J023006J08AGCCCAATAAGGCCCATCTNONE 
J023006J08CAAGGCCCATACNONE 
J023014L16AGCCCAATAAGGCCCATCTNONE 
J023014L16CAAGGCCCATACNONE 
J023020N03AGCCCAATAAGGCCCATCTNONE 
J023020N03CAAGGCCCATACNONE 
J023027M24AGCCCAATAAGGCCCATCTNONE 
J023027M24CAAGGCCCATACNONE 
J023029D18AGCCCAATAAGGCCCATCTNONE 
J023029D18CAAGGCCCATACNONE 
J023030A14AGCCCAATAAGGCCCATCTNONE 
J023030A14CAAGGCCCATACNONE 
J023041G23AGCCCAATAAGGCCCATCTNONE 
J023041G23CAAGGCCCATACNONE 
J023049H05AGCCCAATAAGGCCCATCTNONE 
J023049H05CAAGGCCCATACNONE 
J023060I23AGCCCAATAAGGCCCATCTNONE 
J023060I23CAAGGCCCATACNONE 
J023099D07AGCCCAATAAGGCCCATCTNONE 
J023099D07CAAGGCCCATACNONE 
J023104A20AGCCCAATAAGGCCCATCTNONE 
J023104A20CAAGGCCCATACNONE 
J023105F18AGCCCAATAAGGCCCATCTNONE 
J023105F18CAAGGCCCATACNONE 
J023112D21AGCCCAATAAGGCCCATCTNONE 
J023112D21CAAGGCCCATACNONE 
J023122M18AGCCCAATAAGGCCCATCTNONE 
J023122M18CAAGGCCCATACNONE 
J023139J20AGCCCAATAAGGCCCATCTNONE 
J023139J20CAAGGCCCATACNONE 
J023149L20AGCCCAATAAGGCCCATCTNONE 
J023149L20CAAGGCCCATACNONE 
J023150G04AGCCCAATAAGGCCCATCTNONE 
J023150G04CAAGGCCCATACNONE 
J033036G02AGCCCAATAAGGCCCATCTNONE 
J033036G02CAAGGCCCATACNONE 
J033045P13AGCCCAATAAGGCCCATCTNONE 
J033045P13CAAGGCCCATACNONE 
J033046A22AGCCCAATAAGGCCCATCTNONE 
J033046A22CAAGGCCCATACNONE 
J033086H16AGCCCAATAAGGCCCATCTNONE 
J033086H16CAAGGCCCATACNONE 
J033087D07AGCCCAATAAGGCCCATCTNONE 
J033087D07CAAGGCCCATACNONE 
J033089M14AGCCCAATAAGGCCCATCTNONE 
J033089M14CAAGGCCCATACNONE 
J033095F14AGCCCAATAAGGCCCATCTNONE 
J033095F14CAAGGCCCATACNONE 
J033108M01AGCCCAATAAGGCCCATCTNONE 
J033108M01CAAGGCCCATACNONE 
J033117A17AGCCCAATAAGGCCCATCTNONE 
J033117A17CAAGGCCCATACNONE 
J033122F03AGCCCAATAAGGCCCATCTNONE 
J033122F03CAAGGCCCATACNONE 
J033126A04AGCCCAATAAGGCCCATCTNONE 
J033126A04CAAGGCCCATACNONE 
J033144D13AGCCCAATAAGGCCCATCTNONE 
J033144D13CAAGGCCCATACNONE 
J033145D13AGCCCAATAAGGCCCATCTNONE 
J033145D13CAAGGCCCATACNONE 
J043022M09AGCCCAATAAGGCCCATCTNONE 
J043022M09CAAGGCCCATACNONE 
J053025I11AGCCCAATAAGGCCCATCTNONE 
J053025I11CAAGGCCCATACNONE 
J053027K06AGCCCAATAAGGCCCATCTNONE 
J053027K06CAAGGCCCATACNONE 
J053029D15AGCCCAATAAGGCCCATCTNONE 
J053029D15CAAGGCCCATACNONE 
J053048I22AGCCCAATAAGGCCCATCTNONE 
J053048I22CAAGGCCCATACNONE 
J053055I01AGCCCAATAAGGCCCATCTNONE 
J053055I01CAAGGCCCATACNONE 
J053079P07AGCCCAATAAGGCCCATCTNONE 
J053079P07CAAGGCCCATACNONE 
J053090J23AGCCCAATAAGGCCCATCTNONE 
J053090J23CAAGGCCCATACNONE 
J053094C24AGCCCAATAAGGCCCATCTNONE 
J053094C24CAAGGCCCATACNONE 
J065023F18AGCCCAATAAGGCCCATCTNONE 
J065023F18CAAGGCCCATACNONE 
J065029I12AGCCCAATAAGGCCCATCTNONE 
J065029I12CAAGGCCCATACNONE 
J065044B18AGCCCAATAAGGCCCATCTNONE 
J065044B18CAAGGCCCATACNONE 
J065045C07AGCCCAATAAGGCCCATCTNONE 
J065045C07CAAGGCCCATACNONE 
J065063K22AGCCCAATAAGGCCCATCTNONE 
J065063K22CAAGGCCCATACNONE 
J065093D11AGCCCAATAAGGCCCATCTNONE 
J065093D11CAAGGCCCATACNONE 
J065096P09AGCCCAATAAGGCCCATCTNONE 
J065096P09CAAGGCCCATACNONE 
J065099N04AGCCCAATAAGGCCCATCTNONE 
J065099N04CAAGGCCCATACNONE 
J065103K24AGCCCAATAAGGCCCATCTNONE 
J065103K24CAAGGCCCATACNONE 
J065110H12AGCCCAATAAGGCCCATCTNONE 
J065110H12CAAGGCCCATACNONE 
J065132F24AGCCCAATAAGGCCCATCTNONE 
J065132F24CAAGGCCCATACNONE 
J065157K16AGCCCAATAAGGCCCATCTNONE 
J065157K16CAAGGCCCATACNONE 
J065185D11AGCCCAATAAGGCCCATCTNONE 
J065185D11CAAGGCCCATACNONE 
J065202E16AGCCCAATAAGGCCCATCTNONE 
J065202E16CAAGGCCCATACNONE 
J065217D07AGCCCAATAAGGCCCATCTNONE 
J065217D07CAAGGCCCATACNONE 
J075053I19AGCCCAATAAGGCCCATCTNONE 
J075053I19CAAGGCCCATACNONE 
J075055L24AGCCCAATAAGGCCCATCTNONE 
J075055L24CAAGGCCCATACNONE 
J075056H24AGCCCAATAAGGCCCATCTNONE 
J075056H24CAAGGCCCATACNONE 
J075070D02AGCCCAATAAGGCCCATCTNONE 
J075070D02CAAGGCCCATACNONE 
J075084O15AGCCCAATAAGGCCCATCTNONE 
J075084O15CAAGGCCCATACNONE 
J075090F24AGCCCAATAAGGCCCATCTNONE 
J075090F24CAAGGCCCATACNONE 
J075135E03AGCCCAATAAGGCCCATCTNONE 
J075135E03CAAGGCCCATACNONE 
J075174A01AGCCCAATAAGGCCCATCTNONE 
J075174A01CAAGGCCCATACNONE 
J075188F05AGCCCAATAAGGCCCATCTNONE 
J075188F05CAAGGCCCATACNONE 
J075192C17AGCCCAATAAGGCCCATCTNONE 
J075192C17CAAGGCCCATACNONE 
J080001B02AGCCCAATAAGGCCCATCTNONE 
J080001B02CAAGGCCCATACNONE 
J080001C08AGCCCAATAAGGCCCATCTNONE 
J080001C08CAAGGCCCATACNONE 
J080002D15AGCCCAATAAGGCCCATCTNONE 
J080002D15CAAGGCCCATACNONE 
J080002I03AGCCCAATAAGGCCCATCTNONE 
J080002I03CAAGGCCCATACNONE 
J080003E24AGCCCAATAAGGCCCATCTNONE 
J080003E24CAAGGCCCATACNONE 
J080004M10AGCCCAATAAGGCCCATCTNONE 
J080004M10CAAGGCCCATACNONE 
J080005C18AGCCCAATAAGGCCCATCTNONE 
J080005C18CAAGGCCCATACNONE 
J080006A12AGCCCAATAAGGCCCATCTNONE 
J080006A12CAAGGCCCATACNONE 
J080006F04AGCCCAATAAGGCCCATCTNONE 
J080006F04CAAGGCCCATACNONE 
J080006M11AGCCCAATAAGGCCCATCTNONE 
J080006M11CAAGGCCCATACNONE 
J080008J11AGCCCAATAAGGCCCATCTNONE 
J080008J11CAAGGCCCATACNONE 
J080008J22AGCCCAATAAGGCCCATCTNONE 
J080008J22CAAGGCCCATACNONE 
J080009F14AGCCCAATAAGGCCCATCTNONE 
J080009F14CAAGGCCCATACNONE 
J080010B12AGCCCAATAAGGCCCATCTNONE 
J080010B12CAAGGCCCATACNONE 
J080010G14AGCCCAATAAGGCCCATCTNONE 
J080010G14CAAGGCCCATACNONE 
J080010N07AGCCCAATAAGGCCCATCTNONE 
J080010N07CAAGGCCCATACNONE 
J080011D04AGCCCAATAAGGCCCATCTNONE 
J080011D04CAAGGCCCATACNONE 
J080011G10AGCCCAATAAGGCCCATCTNONE 
J080011G10CAAGGCCCATACNONE 
J080011O19AGCCCAATAAGGCCCATCTNONE 
J080011O19CAAGGCCCATACNONE 
J080013K23AGCCCAATAAGGCCCATCTNONE 
J080013K23CAAGGCCCATACNONE 
J080013M09AGCCCAATAAGGCCCATCTNONE 
J080013M09CAAGGCCCATACNONE 
J080013N12AGCCCAATAAGGCCCATCTNONE 
J080013N12CAAGGCCCATACNONE 
J080013O15AGCCCAATAAGGCCCATCTNONE 
J080013O15CAAGGCCCATACNONE 
J080014C13AGCCCAATAAGGCCCATCTNONE 
J080014C13CAAGGCCCATACNONE 
J080014D21AGCCCAATAAGGCCCATCTNONE 
J080014D21CAAGGCCCATACNONE 
J080014F08AGCCCAATAAGGCCCATCTNONE 
J080014F08CAAGGCCCATACNONE 
J080014N08AGCCCAATAAGGCCCATCTNONE 
J080014N08CAAGGCCCATACNONE 
J080014P19AGCCCAATAAGGCCCATCTNONE 
J080014P19CAAGGCCCATACNONE 
J080015L09AGCCCAATAAGGCCCATCTNONE 
J080015L09CAAGGCCCATACNONE 
J080015P15AGCCCAATAAGGCCCATCTNONE 
J080015P15CAAGGCCCATACNONE 
J080018P10AGCCCAATAAGGCCCATCTNONE 
J080018P10CAAGGCCCATACNONE 
J080020C06AGCCCAATAAGGCCCATCTNONE 
J080020C06CAAGGCCCATACNONE 
J080022C14AGCCCAATAAGGCCCATCTNONE 
J080022C14CAAGGCCCATACNONE 
J080022E01AGCCCAATAAGGCCCATCTNONE 
J080022E01CAAGGCCCATACNONE 
J080022P04AGCCCAATAAGGCCCATCTNONE 
J080022P04CAAGGCCCATACNONE 
J080022P10AGCCCAATAAGGCCCATCTNONE 
J080022P10CAAGGCCCATACNONE 
J080023B20AGCCCAATAAGGCCCATCTNONE 
J080023B20CAAGGCCCATACNONE 
J080023G19AGCCCAATAAGGCCCATCTNONE 
J080023G19CAAGGCCCATACNONE 
J080024N15AGCCCAATAAGGCCCATCTNONE 
J080024N15CAAGGCCCATACNONE 
J080025E11AGCCCAATAAGGCCCATCTNONE 
J080025E11CAAGGCCCATACNONE 
J080025G24AGCCCAATAAGGCCCATCTNONE 
J080025G24CAAGGCCCATACNONE 
J080026B01AGCCCAATAAGGCCCATCTNONE 
J080026B01CAAGGCCCATACNONE 
J080026B05AGCCCAATAAGGCCCATCTNONE 
J080026B05CAAGGCCCATACNONE 
J080027L17AGCCCAATAAGGCCCATCTNONE 
J080027L17CAAGGCCCATACNONE 
J080028K02AGCCCAATAAGGCCCATCTNONE 
J080028K02CAAGGCCCATACNONE 
J080029L23AGCCCAATAAGGCCCATCTNONE 
J080029L23CAAGGCCCATACNONE 
J080030D08AGCCCAATAAGGCCCATCTNONE 
J080030D08CAAGGCCCATACNONE 
J080031C03AGCCCAATAAGGCCCATCTNONE 
J080031C03CAAGGCCCATACNONE 
J080031K02AGCCCAATAAGGCCCATCTNONE 
J080031K02CAAGGCCCATACNONE 
J080032C16AGCCCAATAAGGCCCATCTNONE 
J080032C16CAAGGCCCATACNONE 
J080033F10AGCCCAATAAGGCCCATCTNONE 
J080033F10CAAGGCCCATACNONE 
J080033G12AGCCCAATAAGGCCCATCTNONE 
J080033G12CAAGGCCCATACNONE 
J080033K03AGCCCAATAAGGCCCATCTNONE 
J080033K03CAAGGCCCATACNONE 
J080034B03AGCCCAATAAGGCCCATCTNONE 
J080034B03CAAGGCCCATACNONE 
J080034N21AGCCCAATAAGGCCCATCTNONE 
J080034N21CAAGGCCCATACNONE 
J080034O03AGCCCAATAAGGCCCATCTNONE 
J080034O03CAAGGCCCATACNONE 
J080035G10AGCCCAATAAGGCCCATCTNONE 
J080035G10CAAGGCCCATACNONE 
J080038E14AGCCCAATAAGGCCCATCTNONE 
J080038E14CAAGGCCCATACNONE 
J080039A19AGCCCAATAAGGCCCATCTNONE 
J080039A19CAAGGCCCATACNONE 
J080039G10AGCCCAATAAGGCCCATCTNONE 
J080039G10CAAGGCCCATACNONE 
J080039J01AGCCCAATAAGGCCCATCTNONE 
J080039J01CAAGGCCCATACNONE 
J080039J09AGCCCAATAAGGCCCATCTNONE 
J080039J09CAAGGCCCATACNONE 
J080040F07AGCCCAATAAGGCCCATCTNONE 
J080040F07CAAGGCCCATACNONE 
J080040H18AGCCCAATAAGGCCCATCTNONE 
J080040H18CAAGGCCCATACNONE 
J080041E08AGCCCAATAAGGCCCATCTNONE 
J080041E08CAAGGCCCATACNONE 
J080041E16AGCCCAATAAGGCCCATCTNONE 
J080041E16CAAGGCCCATACNONE 
J080041L08AGCCCAATAAGGCCCATCTNONE 
J080041L08CAAGGCCCATACNONE 
J080042A07AGCCCAATAAGGCCCATCTNONE 
J080042A07CAAGGCCCATACNONE 
J080044E02AGCCCAATAAGGCCCATCTNONE 
J080044E02CAAGGCCCATACNONE 
J080045K03AGCCCAATAAGGCCCATCTNONE 
J080045K03CAAGGCCCATACNONE 
J080046O03AGCCCAATAAGGCCCATCTNONE 
J080046O03CAAGGCCCATACNONE 
J080047F08AGCCCAATAAGGCCCATCTNONE 
J080047F08CAAGGCCCATACNONE 
J080048H01AGCCCAATAAGGCCCATCTNONE 
J080048H01CAAGGCCCATACNONE 
J080048I05AGCCCAATAAGGCCCATCTNONE 
J080048I05CAAGGCCCATACNONE 
J080048N06AGCCCAATAAGGCCCATCTNONE 
J080048N06CAAGGCCCATACNONE 
J080050A07AGCCCAATAAGGCCCATCTNONE 
J080050A07CAAGGCCCATACNONE 
J080050B04AGCCCAATAAGGCCCATCTNONE 
J080050B04CAAGGCCCATACNONE 
J080050E21AGCCCAATAAGGCCCATCTNONE 
J080050E21CAAGGCCCATACNONE 
J080051J01AGCCCAATAAGGCCCATCTNONE 
J080051J01CAAGGCCCATACNONE 
J080051K02AGCCCAATAAGGCCCATCTNONE 
J080051K02CAAGGCCCATACNONE 
J080051L02AGCCCAATAAGGCCCATCTNONE 
J080051L02CAAGGCCCATACNONE 
J080052C20AGCCCAATAAGGCCCATCTNONE 
J080052C20CAAGGCCCATACNONE 
J080052I22AGCCCAATAAGGCCCATCTNONE 
J080052I22CAAGGCCCATACNONE 
J080052J21AGCCCAATAAGGCCCATCTNONE 
J080052J21CAAGGCCCATACNONE 
J080052K22AGCCCAATAAGGCCCATCTNONE 
J080052K22CAAGGCCCATACNONE 
J080055A05AGCCCAATAAGGCCCATCTNONE 
J080055A05CAAGGCCCATACNONE 
J080055I12AGCCCAATAAGGCCCATCTNONE 
J080055I12CAAGGCCCATACNONE 
J080056A21AGCCCAATAAGGCCCATCTNONE 
J080056A21CAAGGCCCATACNONE 
J080056N11AGCCCAATAAGGCCCATCTNONE 
J080056N11CAAGGCCCATACNONE 
J080057D02AGCCCAATAAGGCCCATCTNONE 
J080057D02CAAGGCCCATACNONE 
J080058H21AGCCCAATAAGGCCCATCTNONE 
J080058H21CAAGGCCCATACNONE 
J080058P16AGCCCAATAAGGCCCATCTNONE 
J080058P16CAAGGCCCATACNONE 
J080059M03AGCCCAATAAGGCCCATCTNONE 
J080059M03CAAGGCCCATACNONE 
J080059N17AGCCCAATAAGGCCCATCTNONE 
J080059N17CAAGGCCCATACNONE 
J080060F13AGCCCAATAAGGCCCATCTNONE 
J080060F13CAAGGCCCATACNONE 
J080060H06AGCCCAATAAGGCCCATCTNONE 
J080060H06CAAGGCCCATACNONE 
J080060J03AGCCCAATAAGGCCCATCTNONE 
J080060J03CAAGGCCCATACNONE 
J080060O09AGCCCAATAAGGCCCATCTNONE 
J080060O09CAAGGCCCATACNONE 
J080060P22AGCCCAATAAGGCCCATCTNONE 
J080060P22CAAGGCCCATACNONE 
J080061F06AGCCCAATAAGGCCCATCTNONE 
J080061F06CAAGGCCCATACNONE 
J080061H21AGCCCAATAAGGCCCATCTNONE 
J080061H21CAAGGCCCATACNONE 
J080061O13AGCCCAATAAGGCCCATCTNONE 
J080061O13CAAGGCCCATACNONE 
J080062J07AGCCCAATAAGGCCCATCTNONE 
J080062J07CAAGGCCCATACNONE 
J080063A08AGCCCAATAAGGCCCATCTNONE 
J080063A08CAAGGCCCATACNONE 
J080063F19AGCCCAATAAGGCCCATCTNONE 
J080063F19CAAGGCCCATACNONE 
J080063O18AGCCCAATAAGGCCCATCTNONE 
J080063O18CAAGGCCCATACNONE 
J080065D15AGCCCAATAAGGCCCATCTNONE 
J080065D15CAAGGCCCATACNONE 
J080066E13AGCCCAATAAGGCCCATCTNONE 
J080066E13CAAGGCCCATACNONE 
J080068L01AGCCCAATAAGGCCCATCTNONE 
J080068L01CAAGGCCCATACNONE 
J080068P07AGCCCAATAAGGCCCATCTNONE 
J080068P07CAAGGCCCATACNONE 
J080069I21AGCCCAATAAGGCCCATCTNONE 
J080069I21CAAGGCCCATACNONE 
J080070M04AGCCCAATAAGGCCCATCTNONE 
J080070M04CAAGGCCCATACNONE 
J080071E01AGCCCAATAAGGCCCATCTNONE 
J080071E01CAAGGCCCATACNONE 
J080071J08AGCCCAATAAGGCCCATCTNONE 
J080071J08CAAGGCCCATACNONE 
J080071M23AGCCCAATAAGGCCCATCTNONE 
J080071M23CAAGGCCCATACNONE 
J080072A03AGCCCAATAAGGCCCATCTNONE 
J080072A03CAAGGCCCATACNONE 
J080072G18AGCCCAATAAGGCCCATCTNONE 
J080072G18CAAGGCCCATACNONE 
J080075A04AGCCCAATAAGGCCCATCTNONE 
J080075A04CAAGGCCCATACNONE 
J080075E19AGCCCAATAAGGCCCATCTNONE 
J080075E19CAAGGCCCATACNONE 
J080075P18AGCCCAATAAGGCCCATCTNONE 
J080075P18CAAGGCCCATACNONE 
J080076N11AGCCCAATAAGGCCCATCTNONE 
J080076N11CAAGGCCCATACNONE 
J080077A11AGCCCAATAAGGCCCATCTNONE 
J080077A11CAAGGCCCATACNONE 
J080077D22AGCCCAATAAGGCCCATCTNONE 
J080077D22CAAGGCCCATACNONE 
J080077H18AGCCCAATAAGGCCCATCTNONE 
J080077H18CAAGGCCCATACNONE 
J080077L03AGCCCAATAAGGCCCATCTNONE 
J080077L03CAAGGCCCATACNONE 
J080078D02AGCCCAATAAGGCCCATCTNONE 
J080078D02CAAGGCCCATACNONE 
J080078L05AGCCCAATAAGGCCCATCTNONE 
J080078L05CAAGGCCCATACNONE 
J080078N20AGCCCAATAAGGCCCATCTNONE 
J080078N20CAAGGCCCATACNONE 
J080079I20AGCCCAATAAGGCCCATCTNONE 
J080079I20CAAGGCCCATACNONE 
J080081D04AGCCCAATAAGGCCCATCTNONE 
J080081D04CAAGGCCCATACNONE 
J080082A07AGCCCAATAAGGCCCATCTNONE 
J080082A07CAAGGCCCATACNONE 
J080082E24AGCCCAATAAGGCCCATCTNONE 
J080082E24CAAGGCCCATACNONE 
J080084A22AGCCCAATAAGGCCCATCTNONE 
J080084A22CAAGGCCCATACNONE 
J080084E15AGCCCAATAAGGCCCATCTNONE 
J080084E15CAAGGCCCATACNONE 
J080084G06AGCCCAATAAGGCCCATCTNONE 
J080084G06CAAGGCCCATACNONE 
J080086A05AGCCCAATAAGGCCCATCTNONE 
J080086A05CAAGGCCCATACNONE 
J080086F09AGCCCAATAAGGCCCATCTNONE 
J080086F09CAAGGCCCATACNONE 
J080087B11AGCCCAATAAGGCCCATCTNONE 
J080087B11CAAGGCCCATACNONE 
J080087H12AGCCCAATAAGGCCCATCTNONE 
J080087H12CAAGGCCCATACNONE 
J080088I05AGCCCAATAAGGCCCATCTNONE 
J080088I05CAAGGCCCATACNONE 
J080088N08AGCCCAATAAGGCCCATCTNONE 
J080088N08CAAGGCCCATACNONE 
J080088P07AGCCCAATAAGGCCCATCTNONE 
J080088P07CAAGGCCCATACNONE 
J080089A09AGCCCAATAAGGCCCATCTNONE 
J080089A09CAAGGCCCATACNONE 
J080089D21AGCCCAATAAGGCCCATCTNONE 
J080089D21CAAGGCCCATACNONE 
J080089F24AGCCCAATAAGGCCCATCTNONE 
J080089F24CAAGGCCCATACNONE 
J080089H22AGCCCAATAAGGCCCATCTNONE 
J080089H22CAAGGCCCATACNONE 
J080089I04AGCCCAATAAGGCCCATCTNONE 
J080089I04CAAGGCCCATACNONE 
J080090D01AGCCCAATAAGGCCCATCTNONE 
J080090D01CAAGGCCCATACNONE 
J080091F09AGCCCAATAAGGCCCATCTNONE 
J080091F09CAAGGCCCATACNONE 
J080091G18AGCCCAATAAGGCCCATCTNONE 
J080091G18CAAGGCCCATACNONE 
J080091L24AGCCCAATAAGGCCCATCTNONE 
J080091L24CAAGGCCCATACNONE 
J080091M12AGCCCAATAAGGCCCATCTNONE 
J080091M12CAAGGCCCATACNONE 
J080091N12AGCCCAATAAGGCCCATCTNONE 
J080091N12CAAGGCCCATACNONE 
J080093A15AGCCCAATAAGGCCCATCTNONE 
J080093A15CAAGGCCCATACNONE 
J080093C08AGCCCAATAAGGCCCATCTNONE 
J080093C08CAAGGCCCATACNONE 
J080093I08AGCCCAATAAGGCCCATCTNONE 
J080093I08CAAGGCCCATACNONE 
J080093P21AGCCCAATAAGGCCCATCTNONE 
J080093P21CAAGGCCCATACNONE 
J080094E18AGCCCAATAAGGCCCATCTNONE 
J080094E18CAAGGCCCATACNONE 
J080094F15AGCCCAATAAGGCCCATCTNONE 
J080094F15CAAGGCCCATACNONE 
J080094J21AGCCCAATAAGGCCCATCTNONE 
J080094J21CAAGGCCCATACNONE 
J080095A09AGCCCAATAAGGCCCATCTNONE 
J080095A09CAAGGCCCATACNONE 
J080096G05AGCCCAATAAGGCCCATCTNONE 
J080096G05CAAGGCCCATACNONE 
J080096K07AGCCCAATAAGGCCCATCTNONE 
J080096K07CAAGGCCCATACNONE 
J080097M17AGCCCAATAAGGCCCATCTNONE 
J080097M17CAAGGCCCATACNONE 
J080097P21AGCCCAATAAGGCCCATCTNONE 
J080097P21CAAGGCCCATACNONE 
J080302B15AGCCCAATAAGGCCCATCTNONE 
J080302B15CAAGGCCCATACNONE 
J080306J15AGCCCAATAAGGCCCATCTNONE 
J080306J15CAAGGCCCATACNONE 
J080306O13AGCCCAATAAGGCCCATCTNONE 
J080306O13CAAGGCCCATACNONE 
J080307C15AGCCCAATAAGGCCCATCTNONE 
J080307C15CAAGGCCCATACNONE 
J080307I04AGCCCAATAAGGCCCATCTNONE 
J080307I04CAAGGCCCATACNONE 
J080307L05AGCCCAATAAGGCCCATCTNONE 
J080307L05CAAGGCCCATACNONE 
J080308F11AGCCCAATAAGGCCCATCTNONE 
J080308F11CAAGGCCCATACNONE 
J080311C04AGCCCAATAAGGCCCATCTNONE 
J080311C04CAAGGCCCATACNONE 
J080311I07AGCCCAATAAGGCCCATCTNONE 
J080311I07CAAGGCCCATACNONE 
J080312C01AGCCCAATAAGGCCCATCTNONE 
J080312C01CAAGGCCCATACNONE 
J080312O08AGCCCAATAAGGCCCATCTNONE 
J080312O08CAAGGCCCATACNONE 
J080315F14AGCCCAATAAGGCCCATCTNONE 
J080315F14CAAGGCCCATACNONE 
J080318K13AGCCCAATAAGGCCCATCTNONE 
J080318K13CAAGGCCCATACNONE 
J080319A17AGCCCAATAAGGCCCATCTNONE 
J080319A17CAAGGCCCATACNONE 
J090001I01AGCCCAATAAGGCCCATCTNONE 
J090001I01CAAGGCCCATACNONE 
J090002O18AGCCCAATAAGGCCCATCTNONE 
J090002O18CAAGGCCCATACNONE 
J090007A08AGCCCAATAAGGCCCATCTNONE 
J090007A08CAAGGCCCATACNONE 
J090007F22AGCCCAATAAGGCCCATCTNONE 
J090007F22CAAGGCCCATACNONE 
J090008D09AGCCCAATAAGGCCCATCTNONE 
J090008D09CAAGGCCCATACNONE 
J090008L07AGCCCAATAAGGCCCATCTNONE 
J090008L07CAAGGCCCATACNONE 
J090008O08AGCCCAATAAGGCCCATCTNONE 
J090008O08CAAGGCCCATACNONE 
J090012N11AGCCCAATAAGGCCCATCTNONE 
J090012N11CAAGGCCCATACNONE 
J090013M05AGCCCAATAAGGCCCATCTNONE 
J090013M05CAAGGCCCATACNONE 
J090020E08AGCCCAATAAGGCCCATCTNONE 
J090020E08CAAGGCCCATACNONE 
J090020O20AGCCCAATAAGGCCCATCTNONE 
J090020O20CAAGGCCCATACNONE 
J090021I10AGCCCAATAAGGCCCATCTNONE 
J090021I10CAAGGCCCATACNONE 
J090023D07AGCCCAATAAGGCCCATCTNONE 
J090023D07CAAGGCCCATACNONE 
J090023K22AGCCCAATAAGGCCCATCTNONE 
J090023K22CAAGGCCCATACNONE 
J090023O08AGCCCAATAAGGCCCATCTNONE 
J090023O08CAAGGCCCATACNONE 
J090028D21AGCCCAATAAGGCCCATCTNONE 
J090028D21CAAGGCCCATACNONE 
J090029H14AGCCCAATAAGGCCCATCTNONE 
J090029H14CAAGGCCCATACNONE 
J090029L12AGCCCAATAAGGCCCATCTNONE 
J090029L12CAAGGCCCATACNONE 
J090030C05AGCCCAATAAGGCCCATCTNONE 
J090030C05CAAGGCCCATACNONE 
J090031D18AGCCCAATAAGGCCCATCTNONE 
J090031D18CAAGGCCCATACNONE 
J090032G10AGCCCAATAAGGCCCATCTNONE 
J090032G10CAAGGCCCATACNONE 
J090034J22AGCCCAATAAGGCCCATCTNONE 
J090034J22CAAGGCCCATACNONE 
J090034K16AGCCCAATAAGGCCCATCTNONE 
J090034K16CAAGGCCCATACNONE 
J090036D10AGCCCAATAAGGCCCATCTNONE 
J090036D10CAAGGCCCATACNONE 
J090037N17AGCCCAATAAGGCCCATCTNONE 
J090037N17CAAGGCCCATACNONE 
J090043P17AGCCCAATAAGGCCCATCTNONE 
J090043P17CAAGGCCCATACNONE 
J090044L20AGCCCAATAAGGCCCATCTNONE 
J090044L20CAAGGCCCATACNONE 
J090045N16AGCCCAATAAGGCCCATCTNONE 
J090045N16CAAGGCCCATACNONE 
J090048K03AGCCCAATAAGGCCCATCTNONE 
J090048K03CAAGGCCCATACNONE 
J090048K10AGCCCAATAAGGCCCATCTNONE 
J090048K10CAAGGCCCATACNONE 
J090049O07AGCCCAATAAGGCCCATCTNONE 
J090049O07CAAGGCCCATACNONE 
J090055H23AGCCCAATAAGGCCCATCTNONE 
J090055H23CAAGGCCCATACNONE 
J090056G12AGCCCAATAAGGCCCATCTNONE 
J090056G12CAAGGCCCATACNONE 
J090056G16AGCCCAATAAGGCCCATCTNONE 
J090056G16CAAGGCCCATACNONE 
J090059B16AGCCCAATAAGGCCCATCTNONE 
J090059B16CAAGGCCCATACNONE 
J090066H21AGCCCAATAAGGCCCATCTNONE 
J090066H21CAAGGCCCATACNONE 
J090067D22AGCCCAATAAGGCCCATCTNONE 
J090067D22CAAGGCCCATACNONE 
J090072M07AGCCCAATAAGGCCCATCTNONE 
J090072M07CAAGGCCCATACNONE 
J090073J21AGCCCAATAAGGCCCATCTNONE 
J090073J21CAAGGCCCATACNONE 
J090075A15AGCCCAATAAGGCCCATCTNONE 
J090075A15CAAGGCCCATACNONE 
J090079J09AGCCCAATAAGGCCCATCTNONE 
J090079J09CAAGGCCCATACNONE 
J090080L07AGCCCAATAAGGCCCATCTNONE 
J090080L07CAAGGCCCATACNONE 
J090084A03AGCCCAATAAGGCCCATCTNONE 
J090084A03CAAGGCCCATACNONE 
J090085B07AGCCCAATAAGGCCCATCTNONE 
J090085B07CAAGGCCCATACNONE 
J090088H11AGCCCAATAAGGCCCATCTNONE 
J090088H11CAAGGCCCATACNONE 
J090090J12AGCCCAATAAGGCCCATCTNONE 
J090090J12CAAGGCCCATACNONE 
J090091I21AGCCCAATAAGGCCCATCTNONE 
J090091I21CAAGGCCCATACNONE 
J090091L02AGCCCAATAAGGCCCATCTNONE 
J090091L02CAAGGCCCATACNONE 
J090093G18AGCCCAATAAGGCCCATCTNONE 
J090093G18CAAGGCCCATACNONE 
J090094D23AGCCCAATAAGGCCCATCTNONE 
J090094D23CAAGGCCCATACNONE 
J090098L19AGCCCAATAAGGCCCATCTNONE 
J090098L19CAAGGCCCATACNONE 
J100017I22AGCCCAATAAGGCCCATCTNONE 
J100017I22CAAGGCCCATACNONE 
J100018F08AGCCCAATAAGGCCCATCTNONE 
J100018F08CAAGGCCCATACNONE 
J100018G19AGCCCAATAAGGCCCATCTNONE 
J100018G19CAAGGCCCATACNONE 
J100019B05AGCCCAATAAGGCCCATCTNONE 
J100019B05CAAGGCCCATACNONE 
J100019J18AGCCCAATAAGGCCCATCTNONE 
J100019J18CAAGGCCCATACNONE 
J100019L04AGCCCAATAAGGCCCATCTNONE 
J100019L04CAAGGCCCATACNONE 
J100023M06AGCCCAATAAGGCCCATCTNONE 
J100023M06CAAGGCCCATACNONE 
J100024J23AGCCCAATAAGGCCCATCTNONE 
J100024J23CAAGGCCCATACNONE 
J100024P09AGCCCAATAAGGCCCATCTNONE 
J100024P09CAAGGCCCATACNONE 
J100027I05AGCCCAATAAGGCCCATCTNONE 
J100027I05CAAGGCCCATACNONE 
J100029G03AGCCCAATAAGGCCCATCTNONE 
J100029G03CAAGGCCCATACNONE 
J100029K08AGCCCAATAAGGCCCATCTNONE 
J100029K08CAAGGCCCATACNONE 
J100031J17AGCCCAATAAGGCCCATCTNONE 
J100031J17CAAGGCCCATACNONE 
J100037L16AGCCCAATAAGGCCCATCTNONE 
J100037L16CAAGGCCCATACNONE 
J100038C05AGCCCAATAAGGCCCATCTNONE 
J100038C05CAAGGCCCATACNONE 
J100039D19AGCCCAATAAGGCCCATCTNONE 
J100039D19CAAGGCCCATACNONE 
J100041L02AGCCCAATAAGGCCCATCTNONE 
J100041L02CAAGGCCCATACNONE 
J100045B08AGCCCAATAAGGCCCATCTNONE 
J100045B08CAAGGCCCATACNONE 
J100045B15AGCCCAATAAGGCCCATCTNONE 
J100045B15CAAGGCCCATACNONE 
J100047G07AGCCCAATAAGGCCCATCTNONE 
J100047G07CAAGGCCCATACNONE 
J100047P19AGCCCAATAAGGCCCATCTNONE 
J100047P19CAAGGCCCATACNONE 
J100048I15AGCCCAATAAGGCCCATCTNONE 
J100048I15CAAGGCCCATACNONE 
J100049M16AGCCCAATAAGGCCCATCTNONE 
J100049M16CAAGGCCCATACNONE 
J100049P18AGCCCAATAAGGCCCATCTNONE 
J100049P18CAAGGCCCATACNONE 
J100050E21AGCCCAATAAGGCCCATCTNONE 
J100050E21CAAGGCCCATACNONE 
J100051N02AGCCCAATAAGGCCCATCTNONE 
J100051N02CAAGGCCCATACNONE 
J100052M02AGCCCAATAAGGCCCATCTNONE 
J100052M02CAAGGCCCATACNONE 
J100055M24AGCCCAATAAGGCCCATCTNONE 
J100055M24CAAGGCCCATACNONE 
J100056K11AGCCCAATAAGGCCCATCTNONE 
J100056K11CAAGGCCCATACNONE 
J100059F20AGCCCAATAAGGCCCATCTNONE 
J100059F20CAAGGCCCATACNONE 
J100059J15AGCCCAATAAGGCCCATCTNONE 
J100059J15CAAGGCCCATACNONE 
J100068C19AGCCCAATAAGGCCCATCTNONE 
J100068C19CAAGGCCCATACNONE 
J100068G06AGCCCAATAAGGCCCATCTNONE 
J100068G06CAAGGCCCATACNONE 
J100069N02AGCCCAATAAGGCCCATCTNONE 
J100069N02CAAGGCCCATACNONE 
J100073N04AGCCCAATAAGGCCCATCTNONE 
J100073N04CAAGGCCCATACNONE 
J100074B05AGCCCAATAAGGCCCATCTNONE 
J100074B05CAAGGCCCATACNONE 
J100080P13AGCCCAATAAGGCCCATCTNONE 
J100080P13CAAGGCCCATACNONE 
J100083P09AGCCCAATAAGGCCCATCTNONE 
J100083P09CAAGGCCCATACNONE 
J100084B11AGCCCAATAAGGCCCATCTNONE 
J100084B11CAAGGCCCATACNONE 
J100085B07AGCCCAATAAGGCCCATCTNONE 
J100085B07CAAGGCCCATACNONE 
J100086O20AGCCCAATAAGGCCCATCTNONE 
J100086O20CAAGGCCCATACNONE 
J100087B02AGCCCAATAAGGCCCATCTNONE 
J100087B02CAAGGCCCATACNONE 
J100089B14AGCCCAATAAGGCCCATCTNONE 
J100089B14CAAGGCCCATACNONE 
Os08g0132600AK068578AAGGCCCATCAConserved hypothetical protein. 
AK105651AAGGCCCATCANONE 
Os08g0133000006-050-B01AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
006-068-G03AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK061574AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
J065108C24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075075K24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075092A19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J100061O19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0158900AK067062AAGGCCCACGAGTP1/OBG domain containing protein. 
J013089F04AAGGCCCACGANONE 
J013092D16AAGGCCCACGANONE 
J033120K14AAGGCCCACGANONE 
J033133F24AAGGCCCACGANONE 
J033145A10AAGGCCCACGANONE 
J033145A11AAGGCCCACGANONE 
J053048H24AAGGCCCACGANONE 
J053075H10AAGGCCCACGANONE 
Os08g0159000AK073617TCGTGGGCCTTNONE 
AK103973TCGTGGGCCTTSimilar to DnaJ homolog subfamily C member 1. 
J023130H14TCGTGGGCCTTNONE 
J033051J11TCGTGGGCCTTNONE 
J065101C10TCGTGGGCCTTNONE 
J065168B04TCGTGGGCCTTNONE 
J065184E22TCGTGGGCCTTNONE 
J080021D11TCGTGGGCCTTNONE 
J080025H10TCGTGGGCCTTNONE 
J080026N19TCGTGGGCCTTNONE 
J080034A12TCGTGGGCCTTNONE 
J080040L02TCGTGGGCCTTNONE 
J080042H19TCGTGGGCCTTNONE 
J080047B05TCGTGGGCCTTNONE 
J080047E09TCGTGGGCCTTNONE 
J080047I01TCGTGGGCCTTNONE 
J080052H19TCGTGGGCCTTNONE 
J080062K13TCGTGGGCCTTNONE 
J080063A22TCGTGGGCCTTNONE 
J080068G18TCGTGGGCCTTNONE 
J080068N19TCGTGGGCCTTNONE 
J080076G08TCGTGGGCCTTNONE 
J080077H13TCGTGGGCCTTNONE 
J080077K06TCGTGGGCCTTNONE 
J080093D15TCGTGGGCCTTNONE 
J080094D21TCGTGGGCCTTNONE 
J080097A20TCGTGGGCCTTNONE 
J080097E21TCGTGGGCCTTNONE 
J080097N17TCGTGGGCCTTNONE 
J100071K18TCGTGGGCCTTNONE 
J100072F09TCGTGGGCCTTNONE 
Os08g0161700009-088-D09AAATGGGCCTTATTGGGCCGGGCCNONE 
009-131-H02AAATGGGCCTTATTGGGCCGGGCCNONE 
009-182-D04AAATGGGCCTTATTGGGCCGGGCCNONE 
AK059272AAATGGGCCTTATTGGGCCGGGCCConserved hypothetical protein. 
J075002M21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075090H12AAATGGGCCTTATTGGGCCGGGCCNONE 
J075129C21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075146N03AAATGGGCCTTATTGGGCCGGGCCNONE 
J075178P18AAATGGGCCTTATTGGGCCGGGCCNONE 
J075190M03AAATGGGCCTTATTGGGCCGGGCCNONE 
J090030G01AAATGGGCCTTATTGGGCCGGGCCNONE 
J100088M23AAATGGGCCTTATTGGGCCGGGCCNONE 
Os08g0167500006-063-D04AAGGCCCATATGGGCCCACAANONE 
006-066-G09AAGGCCCATATGGGCCCACAANONE 
AK061061AAGGCCCATATGGGCCCACAAConserved hypothetical protein. 
AK071197AAGGCCCATATGGGCCCACAANONE 
J023082N10AAGGCCCATATGGGCCCACAANONE 
Os08g0192900AK103422CAAGGCCCATATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645CAAGGCCCATATNONE 
Os08g0224700AK121754ATTGGGCCTTSimilar to 26S proteasome subunit RPN2a. 
Os08g0230000014-096-F01AAGGCCCAGANONE 
AK067127AAGGCCCAGAConserved hypothetical protein. 
J013096C05AAGGCCCAGANONE 
J100032D12AAGGCCCAGANONE 
Os08g0270800AK061845CATGGGCCTTNONE 
AK066874CATGGGCCTTConserved hypothetical protein. 
J013075I05CATGGGCCTTNONE 
J013146E07CATGGGCCTTNONE 
Os08g0327400AK070992AAGGCCCAAAASimilar to Enoyl-ACP reductase (Fragment). 
J023077K10AAGGCCCAAAANONE 
J065075F06AAGGCCCAAAANONE 
J065112N14AAGGCCCAAAANONE 
J090028K07AAGGCCCAAAANONE 
J090039C15AAGGCCCAAAANONE 
J090048I11AAGGCCCAAAANONE 
J090083M10AAGGCCCAAAANONE 
Os08g0359500003-107-F09CAAGGCCCACGANONE 
006-091-E08CAAGGCCCACGANONE 
006-096-E12CAAGGCCCACGANONE 
006-111-F11CAAGGCCCACGANONE 
009-090-H10CAAGGCCCACGANONE 
014-013-B02CAAGGCCCACGANONE 
014-083-E03CAAGGCCCACGANONE 
014-100-F05CAAGGCCCACGANONE 
AK104798CAAGGCCCACGANONE 
AK112034CAAGGCCCACGAHSP20-like chaperone domain containing protein. 
J013060J18CAAGGCCCACGANONE 
J033042C22CAAGGCCCACGANONE 
J065168I06CAAGGCCCACGANONE 
J075077E12CAAGGCCCACGANONE 
J075094M21CAAGGCCCACGANONE 
J090068D17CAAGGCCCACGANONE 
J100027E21CAAGGCCCACGANONE 
J100058D21CAAGGCCCACGANONE 
J100067B02CAAGGCCCACGANONE 
Os08g0412200006-028-H07AAGGCCCAAATNONE 
AJ575234AAGGCCCAAATNONE 
AK059631AAGGCCCAAATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099367AAGGCCCAAATNONE 
AK104578AAGGCCCAAATNONE 
J033071L08AAGGCCCAAATNONE 
J065197K18AAGGCCCAAATNONE 
Os08g0416400AK064144GCCCAGTAAGGCCCATCARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0433200013-023-E07AAGGCCCAAACNONE 
013-023-E07AAGGCCCAGCNONE 
AK099471AAGGCCCAAACConserved hypothetical protein. 
AK099471AAGGCCCAGCConserved hypothetical protein. 
J013024A05AAGGCCCAAACNONE 
J013024A05AAGGCCCAGCNONE 
J013065N03AAGGCCCAAACNONE 
J013065N03AAGGCCCAGCNONE 
J023111A21AAGGCCCAAACNONE 
J023111A21AAGGCCCAGCNONE 
J065035F10AAGGCCCAAACNONE 
J065035F10AAGGCCCAGCNONE 
J065083H01AAGGCCCAAACNONE 
J065083H01AAGGCCCAGCNONE 
J065159E03AAGGCCCAAACNONE 
J065159E03AAGGCCCAGCNONE 
J065186A03AAGGCCCAAACNONE 
J065186A03AAGGCCCAGCNONE 
J075032B02AAGGCCCAAACNONE 
J075032B02AAGGCCCAGCNONE 
J075038L14AAGGCCCAAACNONE 
J075038L14AAGGCCCAGCNONE 
J075047N21AAGGCCCAAACNONE 
J075047N21AAGGCCCAGCNONE 
J075076H05AAGGCCCAAACNONE 
J075076H05AAGGCCCAGCNONE 
J075110C08AAGGCCCAAACNONE 
J075110C08AAGGCCCAGCNONE 
J090096K17AAGGCCCAAACNONE 
J090096K17AAGGCCCAGCNONE 
Os08g0460800015-094-E01TTGGCCCAAGGCCCAGTTCyclin-like F-box domain containing protein. 
Os08g0471900015-099-E10ACAGCCCAACAAGGCCCATCGNONE 
AK069434ACAGCCCAACAAGGCCCATCGZinc finger, ZPR1-type domain containing protein. 
Os08g0500900AK102314AAGGCCCACASimilar to Phosphoribosylglycinamide formyltransferase, chloroplast precursor (EC 2.1.2.2) (GART) (GAR transformylase) (5'-phosphoribosylglycinamide transformylase). 
AK102314TATTGGGCCTTSimilar to Phosphoribosylglycinamide formyltransferase, chloroplast precursor (EC 2.1.2.2) (GART) (GAR transformylase) (5'-phosphoribosylglycinamide transformylase). 
Os08g0511800011-007-H01AAGGCCCACTGGGCTGANONE 
AK063264AAGGCCCACTGGGCTGAConserved hypothetical protein. 
Os08g0515800006-067-C11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
009-131-F05AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
016-026-E03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
AK061787AGCCCATGGGCCTTATCTCGGCCCAAGMitochodrial transcription termination factor-related family protein. 
J013032E15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J013032E16AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J033140O22AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065058M21AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065090D03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065115G12AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065124N11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100021K19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100035P15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100043J19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
Os08g0517900015-019-D06AAAAGCCCAAAAAAGGCCCATATNONE 
AK064304AAAAGCCCAAAAAAGGCCCATATSimilar to 30S ribosomal protein S16. 
Os08g0522500006-026-A04AAATGGGCCTTNONE 
006-037-B02AAATGGGCCTTNONE 
006-047-E11AAATGGGCCTTNONE