
Summary of OsREG430 (All List)

OrganismOryza sativa  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3824  

Entry Sequences (3824 entries)

LocusGene modelSequenceDescription
Os01g0132700J065063N10TCATGGGCCTTSurfeit locus 5 family protein. 
AK071635TAATGGGCCTTSimilar to Splicing factor RSZ33. 
Os01g0157900AK072658CTTGGGCTGGGCCGGCTGGGCCTTProtein of unknown function Cys-rich family protein. 
AK109475ACGTGGGCCTTGConserved hypothetical protein. 
AK068405GGATGGGCCTTALG3 family protein. 
AK058815CCACCTGTGGGCCTTCTGGGCTTTTSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
AK073330AAGGCCCAATTConserved hypothetical protein. 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC (HDH). Splice isoform 2. 
AK069972CAAGGCCCAACASimilar to Histidinol dehydrogenase, chloroplast precursor (EC (HDH). Splice isoform 2. 
AK067610AAGGCCCAAACSimilar to Rab proteins geranylgeranyltransferase component A 2 (Rab escort protein 2) (REP-2) (Choroideraemia-like protein). 
Os01g0277500AK066984AAGGCCCATASimilar to Dof3 gene (Fragment). 
AK120842CAAGGCCCAATCGGCCCACAASimilar to 60S ribosomal protein L23a (L25). 
Os01g0514300AK121086TGATGGGCCTTLissencephaly type-1-like homology motif domain containing protein. 
Os01g0530300AK111105AAGGCCCAATTGGGCCGAHypothetical protein. 
AK111105AAGGCCCAGCCCATACHypothetical protein. 
AK106476AAGGCCCAACGlutaredoxin-related protein family protein. 
Os01g0560200AK102003AAATGGGCAAGGCCCAATTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
AK069151TCATGGGCCTTCyclin-like F-box domain containing protein. 
AK067476TGATGGGCCTTSimilar to RNA helicase (Fragment). 
Os01g0621700AK108938AAGGCCCAAAMyosin tail 2 domain containing protein. 
Os01g0660100AK108487AACTGGGCCTTConserved hypothetical protein. 
AK119723AAGGCCCAGTSimilar to NifU-like protein. 
Os01g0680400AK067914AAGGCCCACGCGTAFII28-like protein family protein. 
AK072230TTTTGGGCCTTGSimilar to Dynamin-related protein 1B (Dynamin-like protein B). 
AK104463TGTTGGGCCTTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0708600AK111377AAGGCCCATGGTransport protein particle (TRAPP) component, Bet3 family protein. 
AK121129AAGGCCCATGGSimilar to Serine/threonine-protein kinase PBS1 (EC (AvrPphB susceptible protein 1). 
AK071099TTTTGGGCCTTAGGCCCATATConserved hypothetical protein. 
AK063369TGTTGGGCCTTConserved hypothetical protein. 
Os01g0727900AK102017AAGGCCCATGAConserved hypothetical protein. 
AK072600AAGGCCCATTGGGCCTTProtein prenyltransferase domain containing protein. 
AK120741AGTTGGGCCTTProtein kinase-like domain containing protein. 
Os01g0743400AK059177TCGTGGGCCTTSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK104146AAGGCCCATCTSimilar to 50S ribosomal protein L13. 
Os01g0801700AK073813AAATGGGCCTTConserved hypothetical protein. 
J013094D22AAGGCCCATGARibosomal protein L34 family protein. 
AK103408CAAGGCCCAATRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0853700AK111988CAAGGCCCAATSimilar to MCB1 protein. 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
AK071139TCTGGGCCTTGGGCCTTZinc finger, FYVE/PHD-type domain containing protein. 
AK070087CAAGGCCCATATRhodanese-like domain containing protein. 
AK067623AAGGCCCAGCCConserved hypothetical protein. 
AK067623AAGGCCCATTTConserved hypothetical protein. 
AK067623AGCCCAAAGGCCCATTTConserved hypothetical protein. 
AK063922TACTGGGCCTTSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
Os01g0929500AK111399AGTTGGGCCTTACTGGGCCGGTSimilar to Carbonyl reductase-like protein. 
AK101971AAATGGGCCTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK070588CAAGGCCCAGGSimilar to Esterase D (EC 
Os01g0948100AK111411CAAGGCCCAGATERCC4 domain containing protein. 
AK102153AGATGGGCCTTGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
Os01g0950900AK101121AGATGGGCCTTGGCCCATGAProtein of unknown function DUF221 domain containing protein. 
AK070047AAGGCCCAGASimilar to LacZ (Fragment). 
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
Os01g0959900AK058375ATATGGGCCTTConserved hypothetical protein. 
Os01g0960300AK100099TTATGGGCCTTSimilar to Glucose inhibited division protein A. 
AK101688AAGGCCCAAGProtein prenyltransferase domain containing protein. 
Os01g0971600AK070366GTTTGGGCCTTGSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
AK061193GTTTGGGCCTTSimilar to AGL157Cp. 
AK070711CAAGGCCCACTCCCCCACGConserved hypothetical protein. 
Os02g0146700AK105609CAAGGCCCACASimilar to PSMD2 subunit (Fragment). 
Os02g0169000AK101628CAAGGCCCAAGConserved hypothetical protein. 
Os02g0236100AK120541AAGGCCCAATTSimilar to SERK1 (Fragment). 
Os02g0255200AK121591AAGGCCCAAGGCCCATTASimilar to Ribosomal protein S15a homolog. 
Os02g0478700AK099723AAGGCCCAGATRibosomal protein S27. 
AK099723AAGGCCCAGCCCACGGGRibosomal protein S27. 
Os02g0496900AK059542AAGGCCCACACGGCCCACCTConserved hypothetical protein. 
J090083F07CCAGCCCAAGGCCCAGCConserved hypothetical protein. 
Os02g0520800AK102815AGCCCAAGGCCCAGCSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC (Rieske iron-sulfur protein) (RISP). 
Os02g0522000AK101294ATTTGGGCCTTGGGCTGTRetrotransposon gag protein family protein. 
AK065368CAAGGCCCAAGSimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
Os02g0542500AK109859AAGGCCCAGGConserved hypothetical protein. 
AK102380TGGATGGGCCTTHeavy metal transport/detoxification protein domain containing protein. 
AK066104AAGGCCCACGALUC7 related family protein. 
AK108575AAGGCCCAAATConserved hypothetical protein. 
Os02g0643500AK068423AAGGCCCATAAPentapeptide repeat containing protein. 
J033067E03CAAGTGGGCCTTSimilar to GTP-binding protein. 
Os02g0655700AK101068AAATGGGCCTTAmino acid/polyamine transporter I family protein. 
Os02g0658300AK073923AAGGCCCATTAConserved hypothetical protein. 
Os02g0666800AK101444CAAGGCCCATTTProtein of unknown function DUF788 family protein. 
AB079636AAGGCCCAATASimilar to HMGc1 protein. 
Os02g0672700AK059611AAGGCCCAACAAGCCCAACTDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
J023038E07AAGGCCCAGTAORMDL family protein. 
Os02g0688900AK066093AAGGCCCAATGPI transamidase subunit PIG-U family protein. 
AK102993TGATGGGCCTGATGGGCCTTConserved hypothetical protein. 
AK103602AAGGCCCAATARubisco methyltransferase family protein. 
Os02g0727400AK068514TATTGGGCCTTConserved hypothetical protein. 
Os02g0736500AK065166AAGGCCCATAAAAGCCCAACNicastrin family protein. 
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein. 
Os02g0743800AK064134GGATGGGCCTTGCS domain containing protein. 
AK069984AAGGCCCAGTTSimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
AK101869AAGGCCCATGANOT2/NOT3/NOT5 domain containing protein. 
AK120371AAGGCCCAGASimilar to Lysine-ketoglutarate reductase/saccharopine dehydrogenase bifunctional enzyme. 
Os02g0787100Os02g0787100TGATGGGCCTTProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0794400AK065845ATTGGGCCTTInitiation factor 3 family protein. 
AK067584TTTTGGGCCTTSAM (and some other nucleotide) binding motif domain containing protein. 
AK099516CCAGGCCCAAGGCCCATCTSimilar to Alcohol dehydrogenase, zinc-containing. 
Os02g0810300AK059363TCGGCCCAAGGCCCAGTASimilar to NBD-like protein. 
Os02g0819700AK067374CAAGGCCCACACGZinc finger, Zim17-type family protein. 
Os02g0824400AK121390AACTGGGCCTTTGATGGGCTTTConserved hypothetical protein. 
AK121390GTTTGGGCCTTGConserved hypothetical protein. 
Os02g0827600AK068455TATTGGGCCTTGConserved hypothetical protein. 
Os02g0830700AK101172AAGGCCCAGTTLeucine rich repeat, N-terminal domain containing protein. 
Os02g0832700AK099439TGTTGGGCCTTTGGGCTTCSimilar to Metal tolerance protein C2 (AtMTPc2). 
AK121880AAGGCCCASimilar to DNA repair endonuclease UVH1 (EC 3.1.-.-) (Ultraviolet hypersensitive 1) (AtRAD1) (DNA excision repair protein XP-F homolog). 
AK070779TGATGGGCCTAAGGCCCAAATSimilar to 50S ribosomal protein L5, chloroplast. 
AK062913AAATGGGCCTTAAAGCCCATTTConserved hypothetical protein. 
AK062913AAGGCCCAAAAConserved hypothetical protein. 
Os03g0127000AK068479AAGGCCCATTTConserved hypothetical protein. 
Os03g0133400AK073032AAGGCCCACGPeptidoglycan-binding LysM domain containing protein. 
AK068424CAAGGCCCACASimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AK059776AAGGCCCACCTGalactose-binding like domain containing protein. 
Os03g0149400AK111396AAGGCCCAACCAGCCCAAGProtein prenyltransferase domain containing protein. 
AK111396CTTGGGCTTTCAAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os03g0152800AK066205GCTGGGCCTTGProtein kinase-like domain containing protein. 
AK105523TATGGGCCTTPeptidase S10, serine carboxypeptidase family protein. 
Os03g0197400AK071413AAGGCCCAACCSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK069251AATGGGCCTT40S ribosomal protein S3a (CYC07 protein). 
Os03g0238700AK073387ATATGGGCCGGATGGGCCTTGSimilar to Acid phosphatase type 5. 
AK059149GCTGGGCCTTGlycoside hydrolase, family 10 protein. 
Os03g0253100AK119618AAGGCCCAATAPhosphomevalonate kinase Erg8 family protein. 
Os03g0256400AK073854TGTGGGCTGAATTGGGCCTTSimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
AK100114AATTGGGCCTTTTTGGGCCGASimilar to Lectin-like receptor kinase 7;2. 
AK120374TGTTGGGCCTTConserved hypothetical protein. 
Os03g0266000AK068775AAGGCCCAACAOvarian tumour, otubain domain containing protein. 
AK102161ACAGCCCAAGAAGGCCCATGTConserved hypothetical protein. 
AK069970CAAGGCCCATCCSimilar to Ran binding protein 1 homolog. 
J053054B07TTGGCCCATATAAGGCCCAACTCHCH domain containing protein. 
AK066250AAGGCCCACAASimilar to Chaperone protein dnaJ. 
Os03g0305500AK070638GGTTGGGCCTTArgininosuccinate lyase domain containing protein. 
AK100355AAGGCCCAGCCUbiquitin-conjugating enzyme, E2 domain containing protein. 
Os03g0333000AK109811AAGGCCCAGGCCCATTTConserved hypothetical protein. 
Os03g0333100AK101050AAATGGGCCTGGGCCTTProtein of unknown function DUF663 domain containing protein. 
Os03g0339100AK111641AAGGCCCAACTSimilar to PRL1 protein. 
AK105813ACAGCCCAAGGCCCAAGPhotosystem II protein PsbX family protein. 
AK065547ACGTGGGCCTTSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
AK059673AAGGCCCACAAGGCCCSimilar to Acyl carrier protein 1 (EC (EC 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0438400AK070383AAGGCCCAAGCCCAATAConserved hypothetical protein. 
AK070383AAGGCCCAGCCConserved hypothetical protein. 
Os03g0566800AK103270CAAGGCCCAGTSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
AK063006AAGGCCCATTTConserved hypothetical protein. 
Os03g0576900AK071314AAGGCCCAACCAmino acid/polyamine transporter I family protein. 
AF010584CGATGGGCCTTSimilar to Water stress induced protein. 
AK062094ATCTGGGCCTTGSimilar to RGP-3 (Fragment). 
Os03g0683700AK065067TAGGCCCAAAGGCCCAGGProtein of unknown function DUF810 family protein. 
Os03g0685700AK066043CGATGGGCCTTGGGCTTTProtein prenyltransferase domain containing protein. 
AK103539AAGGCCCAGGGTGGGTCCConserved hypothetical protein. 
Os03g0704400AK101297AAGGCCCAAGProtein kinase domain containing protein. 
AK101297AAGGCCCAGCProtein kinase domain containing protein. 
Os03g0727100AK068587GTTTGGGCCGTAAGGCCCAACAConserved hypothetical protein. 
Os03g0746800AK101718AAGGCCCAAGWD-40 repeat containing protein. 
AK110858CAAGGCCCATGAConserved hypothetical protein. 
Os03g0788200AK106623AAGGCCCATAE1 protein and Def2/Der2 allergen family protein. 
AK067446ATATGGGCCTTSimilar to Helix-loop-helix protein homolog. 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
Os03g0802300AK120564AGTGGGCCTTGGGCCGAGAConserved hypothetical protein. 
Os03g0826000AK072695AAGGCCCATCTConserved hypothetical protein. 
Os03g0834000AB080084AAGGCCCAFlap endonuclease-1b (EC 3.-.-.-) (OsFEN-1b). 
AK062622AATTGGGCCTTGSimilar to RPB17 (Fragment). 
Os03g0847500AK073859TGATGGGCCTTSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0850100AK101126ATTGGGCCTTAATGGGCCAANLI interacting factor domain containing protein. 
Os03g0851900AK102145AAGGCCCAGGCCCATCTAFG1-like ATPase family protein. 
AK063101AAGGCCCACGAProtein of unknown function DUF565 family protein. 
AK100430AAGGCCCATCCSimilar to Heat shock transcription factor 31 (Fragment). 
AK061723TTTTGGGCCTTGProtein of unknown function DUF1499 family protein. 
AK066032CAAGGCCCACAProteasome component region PCI domain containing protein. 
AK063751CAAGGCCCAGCCCAAGSimilar to Heat shock protein 80. 
Os04g0194000AK102654AATTGGGCCTTGCyclin-like F-box domain containing protein. 
AK103472AAGGCCCAAGGCCCATCCConserved hypothetical protein. 
AK102190AAGGCCCATTASimilar to 40S ribosomal protein S10-1. 
AK101115CAAGGCCCAAAAProtein prenyltransferase domain containing protein. 
AK105415AAGGCCCAATTNonsense-mediated decay UPF3 domain containing protein. 
AK103814AAGGCCCAGASimilar to FK506-binding protein 2 precursor (EC (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (FKBP-13) (FKBP-15). 
AK106322CTTGGGCCTTSimilar to Prohibitin. 
AK064379AAGGCCCATCARNA dependent RNA polymerase family protein. 
Os04g0479000AK106344CAAGGCCCAGGSimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0490000AK108365AGTTGGGCCTTGSimilar to Glutamate synthase [NADH], chloroplast precursor (EC (NADH- GOGAT). 
Os04g0542900AK068610AAGGCCCAAACConserved hypothetical protein. 
Os04g0547600AK109141TTTGGGCCTTPathogenesis-related transcriptional factor and ERF domain containing protein. 
AK121568CAAGGCCCATCASimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
AK120614CCCGGCCCATAAGGCCCACGTSimilar to HMG1 protein. 
AK120348AAGGCCCAAACHeavy metal transport/detoxification protein domain containing protein. 
AK120348CAAGGCCCATCTHeavy metal transport/detoxification protein domain containing protein. 
AK063093ATGGCCCATAAGGCCCAACASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
AK063093ATTTGGGCCTTTTTGGGCCTASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
AK060707AAGGCCCAAACAATGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
AK062025AAGGCCCATGTRibbon-helix-helix domain containing protein. 
AK099507AATGGGCCGGCCCATCAAGGCCCATTAGCN5-related N-acetyltransferase domain containing protein. 
Os04g0637500AK108202AAGGCCCACTMitochodrial transcription termination factor-related family protein. 
AK120899CAAGGCCCAGATATPase, V0 complex, subunit H family protein. 
Os04g0661700AK066532CTTGGGCCTTConserved hypothetical protein. 
Os04g0674100J080097J12AAGGCCCACCAThioredoxin-like fold domain containing protein. 
AK103795TGGTGGGCCTTCoenzyme Q biosynthesis Coq4 family protein. 
Os04g0678800AK072212CAAGGCCCAGTAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK065749AGATGGGCCTTSnf7 family protein. 
Os05g0110700AK102486AAGGCCCACACKinetochore-Ndc80 subunit Spc25 family protein. 
AK071341TTGTGGGCCTTProtein of unknown function DUF1218 family protein. 
Os05g0121800AK101222AAGGCCCAACAConserved hypothetical protein. 
Os05g0125600AK102952AAGGCCCAAAProtein of unknown function DUF1677, Oryza sativa family protein. 
Os05g0140800AK110652TGCGGCCCATAAAGGCCCAGATSimilar to Dormancy related protein (Fragment). 
Os05g0150300AK100732AAGGCCCACTSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
AK120877AAGGCCCAAACCAGCCCACAASimilar to 60S ribosomal protein L18. 
Os05g0177100AK064652CAAGGCCCAAATConserved hypothetical protein. 
Os05g0226300AK067770ATTTGGGCCTTConserved hypothetical protein. 
Os05g0295800AK070232AAGGCCCATCASimilar to Glyoxalase I (EC 
AK061627GCGGCCCAGCAAGGCCCATCGSimilar to 40S ribosomal protein S7. 
Os05g0357100AK102042AAGGCCCAAAA3'-5' exonuclease domain containing protein. 
Os05g0417200AK071955ATTTGGGCCACAATGGGCCTTGCGGGCCThioredoxin-like fold domain containing protein. 
AK071955TAATGGGCCACGATGGGCCTTThioredoxin-like fold domain containing protein. 
AK121541AAGGCCCATTASimilar to Ribosomal protein L33. 
Os05g0459900AK058918AAGGCCCATTTAGCCCAGCCCSimilar to 60S ribosomal protein L36-1. 
AK063820CACGGCCCATCCAAGGCCCAGAConserved hypothetical protein. 
AK101340AGATGGGCCTTKrr1 family protein. 
AK059889CTTGGGCCTTGSimilar to Flavoprotein wrbA (Trp repressor binding protein). 
AK065486CAAGGCCCATAANAF1 domain containing protein. 
AK061451AAGGCCCAAACThioredoxin-related domain containing protein. 
AK062985AAGGCCCACTSimilar to 50S ribosomal protein L20. 
Os05g0541500AK101190CCATGGGCCTTCyclin-like F-box domain containing protein. 
AK122158AGATGGGCCTTGGGCCGAAADNA-binding TFAR19-related protein family protein. 
Os05g0548100AK060333TACTGGGCCTTConserved hypothetical protein. 
AK060333TTTCGGCCCAAGGCCCATATConserved hypothetical protein. 
Os05g0552900AK102095AAGGCCCAAGMAP65/ASE1 family protein. 
Os05g0559900AK067197GAAGCCCAAGGCCCAAACtRNA-binding arm domain containing protein. 
AK067090AAGGCCCAACCSimilar to Urease accessory protein G. 
AK067090AAGGCCCAACCSimilar to Urease accessory protein G. 
Os05g0584600AK072537CCATGGGCCTTAAA ATPase domain containing protein. 
AK065508CAAGGCCCACACUV-damaged DNA binding protein. 
AK066391AAGGCCCAAGSimilar to Nucleoside diphosphate kinase III (EC (NDK III) (NDP kinase III) (NDPK III). 
AK070447AAGGCCCACGTPlastocyanin, chloroplast precursor. 
AK067021AAGGCCCAGGCCCACCANucleic acid-binding, OB-fold domain containing protein. 
AK067021AAGGCCCATCCNucleic acid-binding, OB-fold domain containing protein. 
AK063401CAAGGCCCACCAAAGCCCACACTetratricopeptide-like helical domain containing protein. 
Os06g0116800AK058985AATGGGCCTTGSimilar to GFA2. 
Os06g0119300AK067271CAAGGCCCAGTProtein of unknown function DUF594 family protein. 
AK121983AAGGCCCAGCWD40-like domain containing protein. 
Os06g0134900AK103205TCGTGGGCCTTConserved hypothetical protein. 
AK103245CCATGGGCCAAGGCCCATTConserved hypothetical protein. 
AK063371AAGGCCCAACALeucine carboxyl methyltransferase family protein. 
Os06g0156700AK107226GCCCAGTAAGGCCCATGGGCCTTGLipolytic enzyme, G-D-S-L family protein. 
AK064613TACTGGGCCCAAGGCCCAAATSimilar to Phosphopantothenoylcysteine decarboxylase (EC (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK069709TTTGGGCCTTN-acyl-L-amino-acid amidohydrolase family protein. 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
AK100258AAGGCCCAAATAGGCCCACTSimilar to SERK1 (Fragment). 
AK102752AAGGCCCAACTTB2/DP1 and HVA22 related protein family protein. 
AK102752GTTGGGCCTTTB2/DP1 and HVA22 related protein family protein. 
Os06g0227200AK066970AAGGCCCATAAConserved hypothetical protein. 
Os06g0304500AK119441GAAGCCCATTAAGGCCCACTCRS1/YhbY domain containing protein. 
Os06g0309000AK121021AAGGCCCAGACAGCCCAACZinc finger, FYVE/PHD-type domain containing protein. 
J075103B05CAAGGCCCAATTProtein of unknown function DUF953, thioredoxin-like family protein. 
Os06g0539066J065210J16CCTGGGCCTTConserved hypothetical protein. 
Os06g0547900AK100950CGATGGGCCTTSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK121337CAAGGCCCAACAProtein of unknown function UPF0197 family protein. 
Os06g0581300AK070987TTTGGGCCTTProtein of unknown function DUF1475 family protein. 
AK063158CAAGGCCCAAATSimilar to 26S proteasome regulatory complex subunit p42D. 
Os06g0622700AK107021TCTGGCCCAAAAGGCCCACAEukaryotic transcription factor, DNA-binding domain containing protein. 
Os06g0663600AK100787AAGGCCCATTEndonuclease V family protein. 
J100072F13CCATGGGCCTTSimilar to Ubiquitin. 
J065037D21AAGGCCCAAGHypothetical protein. 
Os06g0693000AK064280CAAGGCCCATATProtein kinase-like domain containing protein. 
AK105934AAGGCCCAAAASimilar to Xyloglucan endo-transglycosylase homolog. 
AK073948ATGGCCCAGAAGGCCCACCAHypothetical protein. 
Os06g0710300AK121344AAGGCCCACCTUncharacterized protein UPF0114 family protein. 
AK064384CATGGGCCTTGmRNA splicing factor SYF2 family protein. 
Os06g0712900AK106648TCATGGGCCGAAAAGGCCCATATDihydrouridine synthase, DuS family protein. 
AK071262GAGGCCCAAGGCCCATACt-snare domain containing protein. 
Os06g0725400J065086O07AGTGGGCCTTGSimilar to BLE1 protein. 
AK119436GACACGTGAAGGCCCATGGBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
AK119295GCAGCCCATGGGCCTTProtein of unknown function DUF1719, Oryza sativa family protein. 
Os07g0133700J065005A21AAATGGGCTAATTGGGCCTTHypothetical protein. 
AK061006TATTGGGCCTTProtein of unknown function DUF150 family protein. 
AK060711CAAGGCCCAGCCCARibosomal protein L4/L1e family protein. 
Os07g0187300AK103069AAGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os07g0242000AK107347CAAGGCCCACCConserved hypothetical protein. 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
AK104968TTTTGGGCCTTGThioesterase superfamily domain containing protein. 
AK063422GCTGGGCCTTSimilar to Cysteine protease (Fragment). 
Os07g0516200AK061373CAAGGCCCAACASimilar to Endoribonuclease, L-PSP family. 
Os07g0522600AK067405AAGGCCCACTSimilar to Glutamate receptor 3.4 precursor (Ligand-gated ion channel 3.4) (AtGLR4). Splice isoform 2. 
Os07g0565000AK121056GTTTGGGCCTTCTTGGGCCGASimilar to 40S ribosomal protein S11. 
AK062660TAATGGGCCTTATTGGGCTTAConserved hypothetical protein. 
Os07g0569000AK073915TAAGCCCAATAAGGCCCATTAConserved hypothetical protein. 
Os07g0573700AK070473CAAGGCCCAAGNucleotide-sugar transporter family protein. 
Os07g0578600AK067155GCTGGGCCTTSimilar to 5-formyltetrahydrofolate cycloligase (EC 
AK105064GTATGGGCCTTSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC (EC (Complex I-18KD) (CI-18KD) (Fragment). 
Os07g0620200AK099859TGTTGGGCCTTHeat shock protein DnaJ, N-terminal domain containing protein. 
Os07g0626600Os07g0626600GCTGGGCCTTSimilar to Embryogenic callus protein-like. 
Os07g0644300AK066726AAGGCCCACCASimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
Os07g0656400011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
AK121176AAGGCCCATTARickettsia 17 kDa surface antigen family protein. 
Os08g0118900AK109749AAGGCCCACAAAdenylate kinase family protein. 
AK064857AGCCCAATAAGGCCCATCT60S acidic ribosomal protein P0. 
AK064857CAAGGCCCATAC60S acidic ribosomal protein P0. 
Os08g0132600AK068578AAGGCCCATCAConserved hypothetical protein. 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
Os08g0158900AK067062AAGGCCCACGAGTP1/OBG domain containing protein. 
AK103973TCGTGGGCCTTSimilar to DnaJ homolog subfamily C member 1. 
AK059272AAATGGGCCTTATTGGGCCGGGCCConserved hypothetical protein. 
AK061061AAGGCCCATATGGGCCCACAAConserved hypothetical protein. 
Os08g0192900AK103422CAAGGCCCATATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0224700AK121754ATTGGGCCTTSimilar to 26S proteasome subunit RPN2a. 
AK067127AAGGCCCAGAConserved hypothetical protein. 
AK066874CATGGGCCTTConserved hypothetical protein. 
Os08g0327400AK070992AAGGCCCAAAASimilar to Enoyl-ACP reductase (Fragment). 
AK112034CAAGGCCCACGAHSP20-like chaperone domain containing protein. 
AK059631AAGGCCCAAATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0416400AK064144GCCCAGTAAGGCCCATCARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099471AAGGCCCAAACConserved hypothetical protein. 
AK099471AAGGCCCAGCConserved hypothetical protein. 
Os08g0460800015-094-E01TTGGCCCAAGGCCCAGTTCyclin-like F-box domain containing protein. 
AK069434ACAGCCCAACAAGGCCCATCGZinc finger, ZPR1-type domain containing protein. 
Os08g0500900AK102314AAGGCCCACASimilar to Phosphoribosylglycinamide formyltransferase, chloroplast precursor (EC (GART) (GAR transformylase) (5'-phosphoribosylglycinamide transformylase). 
AK102314TATTGGGCCTTSimilar to Phosphoribosylglycinamide formyltransferase, chloroplast precursor (EC (GART) (GAR transformylase) (5'-phosphoribosylglycinamide transformylase). 
AK063264AAGGCCCACTGGGCTGAConserved hypothetical protein. 
AK061787AGCCCATGGGCCTTATCTCGGCCCAAGMitochodrial transcription termination factor-related family protein.