version

Summary of OsREG431 (All List)

OrganismOryza sativa  
IDOsREG431  
SequenceAATGGGCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3301  

Entry Sequences (3301 entries)

LocusGene modelSequenceDescription
Os01g0103600006-072-A01GCCACGTCGGCCCATTNONE 
009-148-C12GCCACGTCGGCCCATTNONE 
AK059848GCCACGTCGGCCCATTEmopamil-binding family protein. 
AK102848GCCACGTCGGCCCATTNONE 
J033036P20GCCACGTCGGCCCATTNONE 
J065171N21GCCACGTCGGCCCATTNONE 
J065209M02GCCACGTCGGCCCATTNONE 
J075067A03GCCACGTCGGCCCATTNONE 
J075110C09GCCACGTCGGCCCATTNONE 
Os01g0132800AK068422TAATGGGCCGAAAPeptidyl-tRNA hydrolase family protein. 
Os01g0155600006-048-F03TAATGGGCCTTNONE 
AK060171TAATGGGCCTTNONE 
AK071635TAATGGGCCTTSimilar to Splicing factor RSZ33. 
J023080A03TAATGGGCCTTNONE 
J023100L15TAATGGGCCTTNONE 
J033075I17TAATGGGCCTTNONE 
J033085O09TAATGGGCCTTNONE 
J033105E15TAATGGGCCTTNONE 
J033132N10TAATGGGCCTTNONE 
J033132P12TAATGGGCCTTNONE 
J033149H12TAATGGGCCTTNONE 
J043026M03TAATGGGCCTTNONE 
J080305J10TAATGGGCCTTNONE 
J080308K03TAATGGGCCTTNONE 
J090023M04TAATGGGCCTTNONE 
J090078F24TAATGGGCCTTNONE 
J100066P05TAATGGGCCTTNONE 
Os01g0166800AK073783GGACGGCCCATTAGGCCCAATAConserved hypothetical protein. 
AK099378GGACGGCCCATTAGGCCCAATANONE 
J033026H10GGACGGCCCATTAGGCCCAATANONE 
J033067O18GGACGGCCCATTAGGCCCAATANONE 
J033108A17GGACGGCCCATTAGGCCCAATANONE 
J065015J11GGACGGCCCATTAGGCCCAATANONE 
J065204P09GGACGGCCCATTAGGCCCAATANONE 
Os01g0175400AK102191AATGGGCCACAnkyrin repeat containing protein. 
Os01g0179901J075009I05GAGGCCCATTGGGCCGAAANONE 
J075058D09GAGGCCCATTGGGCCGAAANONE 
J075153K16GAGGCCCATTGGGCCGAAAConserved hypothetical protein. 
Os01g0184000015-008-B06GAGGCCCATTNONE 
AK071130GAGGCCCATTNUC156 family protein. 
AK100604GAGGCCCATTNONE 
J075155H07GAGGCCCATTNONE 
J100047O19GAGGCCCATTNONE 
J100074A09GAGGCCCATTNONE 
Os01g0203300015-045-F03AATGGGCCCTNONE 
015-045-F03ACCGGCCCATTNONE 
AK106329AATGGGCCCTConserved hypothetical protein. 
AK106329ACCGGCCCATTConserved hypothetical protein. 
Os01g0206600J065041P19TAATGGGCCTGAAGCCCACATGGCCCATAConserved hypothetical protein. 
Os01g0219100J065130F20TAATGGGCCGAANONE 
J065208O10TAATGGGCCGAASFT2-like family protein. 
Os01g0222700012-011-E01ATGGCCCATTTNONE 
AK068883ATGGCCCATTTNONE 
AK101946ATGGCCCATTTZinc finger, BED-type predicted domain containing protein. 
J033075C16ATGGCCCATTTNONE 
J043013D08ATGGCCCATTTNONE 
J065089G19ATGGCCCATTTNONE 
J065197K19ATGGCCCATTTNONE 
J075161L21ATGGCCCATTTNONE 
Os01g0229100006-113-G08CCAGGCCCATTTTGGCCCATACNONE 
006-113-G08GAGGCCCATTANONE 
011-075-E08CCAGGCCCATTTTGGCCCATACNONE 
011-075-E08GAGGCCCATTANONE 
AK061285CCAGGCCCATTTTGGCCCATACNONE 
AK061285GAGGCCCATTANONE 
AK070838CCAGGCCCATTTTGGCCCATACTetratricopeptide-like helical domain containing protein. 
AK070838GAGGCCCATTATetratricopeptide-like helical domain containing protein. 
J013059F08CCAGGCCCATTTTGGCCCATACNONE 
J013059F08GAGGCCCATTANONE 
J013059G08CCAGGCCCATTTTGGCCCATACNONE 
J013059G08GAGGCCCATTANONE 
J013059G09CCAGGCCCATTTTGGCCCATACNONE 
J013059G09GAGGCCCATTANONE 
J013069M12CCAGGCCCATTTTGGCCCATACNONE 
J013069M12GAGGCCCATTANONE 
J013105A19CCAGGCCCATTTTGGCCCATACNONE 
J013105A19GAGGCCCATTANONE 
J013149F07CCAGGCCCATTTTGGCCCATACNONE 
J013149F07GAGGCCCATTANONE 
J023073J07CCAGGCCCATTTTGGCCCATACNONE 
J023073J07GAGGCCCATTANONE 
J023130F24CCAGGCCCATTTTGGCCCATACNONE 
J023130F24GAGGCCCATTANONE 
J023147J08CCAGGCCCATTTTGGCCCATACNONE 
J023147J08GAGGCCCATTANONE 
J033028F13CCAGGCCCATTTTGGCCCATACNONE 
J033028F13GAGGCCCATTANONE 
J033115A16CCAGGCCCATTTTGGCCCATACNONE 
J033115A16GAGGCCCATTANONE 
J033135F02CCAGGCCCATTTTGGCCCATACNONE 
J033135F02GAGGCCCATTANONE 
J065031G16CCAGGCCCATTTTGGCCCATACNONE 
J065031G16GAGGCCCATTANONE 
J065058A09CCAGGCCCATTTTGGCCCATACNONE 
J065058A09GAGGCCCATTANONE 
J065089N15CCAGGCCCATTTTGGCCCATACNONE 
J065089N15GAGGCCCATTANONE 
J065130I09CCAGGCCCATTTTGGCCCATACNONE 
J065130I09GAGGCCCATTANONE 
J065191P09CCAGGCCCATTTTGGCCCATACNONE 
J065191P09GAGGCCCATTANONE 
J065197P14CCAGGCCCATTTTGGCCCATACNONE 
J065197P14GAGGCCCATTANONE 
J080306D15CCAGGCCCATTTTGGCCCATACNONE 
J080306D15GAGGCCCATTANONE 
J080308M06CCAGGCCCATTTTGGCCCATACNONE 
J080308M06GAGGCCCATTANONE 
J080315A03CCAGGCCCATTTTGGCCCATACNONE 
J080315A03GAGGCCCATTANONE 
J080315N11CCAGGCCCATTTTGGCCCATACNONE 
J080315N11GAGGCCCATTANONE 
J090046E14CCAGGCCCATTTTGGCCCATACNONE 
J090046E14GAGGCCCATTANONE 
J090058G09CCAGGCCCATTTTGGCCCATACNONE 
J090058G09GAGGCCCATTANONE 
J090077H05CCAGGCCCATTTTGGCCCATACNONE 
J090077H05GAGGCCCATTANONE 
J090087O20CCAGGCCCATTTTGGCCCATACNONE 
J090087O20GAGGCCCATTANONE 
Os01g0229200AK066024GTATGGGCCAAAATGGGCCTGGVHS domain containing protein. 
AK066024TAATGGGCCTCVHS domain containing protein. 
Os01g0283000AK073165CTGGCCCATTTGCGGCCCAGTConserved hypothetical protein. 
J033023G08CTGGCCCATTTGCGGCCCAGTNONE 
Os01g0283100004-018-B01ACTGGGCCGCAAATGGGCCAGNONE 
AK060908ACTGGGCCGCAAATGGGCCAGNONE 
AK071713ACTGGGCCGCAAATGGGCCAGSimilar to Ferripyochelin-binding protein-like. 
AK104205ACTGGGCCGCAAATGGGCCAGNONE 
AK122051ACTGGGCCGCAAATGGGCCAGNONE 
J023109L19ACTGGGCCGCAAATGGGCCAGNONE 
Os01g0316800009-188-E08GACGGCCCATTTNONE 
AK058821GACGGCCCATTTNONE 
AK119788GACGGCCCATTTSimilar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1). 
J065098A09GACGGCCCATTTNONE 
J065102J21GACGGCCCATTTNONE 
J065173M10GACGGCCCATTTNONE 
J075066K08GACGGCCCATTTNONE 
J080302B04GACGGCCCATTTNONE 
J080310P14GACGGCCCATTTNONE 
J080311I23GACGGCCCATTTNONE 
J080319N12GACGGCCCATTTNONE 
J100024D14GACGGCCCATTTNONE 
J100055N12GACGGCCCATTTNONE 
Os01g0346400J100032G11ACCGGCCCATTConserved hypothetical protein. 
Os01g0369000AK064940AAATGGGCCAGSimilar to Cullin-1. 
AK104340AAATGGGCCAGNONE 
AY336990AAATGGGCCAGNONE 
J013000P07AAATGGGCCAGNONE 
J013056B18AAATGGGCCAGNONE 
J013056B20AAATGGGCCAGNONE 
J013098C09AAATGGGCCAGNONE 
J013099E23AAATGGGCCAGNONE 
J023007E10AAATGGGCCAGNONE 
J023064L04AAATGGGCCAGNONE 
J023119B15AAATGGGCCAGNONE 
J023126O19AAATGGGCCAGNONE 
J033120G16AAATGGGCCAGNONE 
J043007K19AAATGGGCCAGNONE 
J065037I22AAATGGGCCAGNONE 
J065051D18AAATGGGCCAGNONE 
J065073N09AAATGGGCCAGNONE 
J065084K20AAATGGGCCAGNONE 
J065115C15AAATGGGCCAGNONE 
J065115M01AAATGGGCCAGNONE 
J065121O10AAATGGGCCAGNONE 
J065197H21AAATGGGCCAGNONE 
J065211L23AAATGGGCCAGNONE 
J065214M19AAATGGGCCAGNONE 
J090006F13AAATGGGCCAGNONE 
J090012M21AAATGGGCCAGNONE 
J090029M05AAATGGGCCAGNONE 
J090048P16AAATGGGCCAGNONE 
J090051H13AAATGGGCCAGNONE 
J090062C14AAATGGGCCAGNONE 
J090072F21AAATGGGCCAGNONE 
J090085D11AAATGGGCCAGNONE 
J090090N24AAATGGGCCAGNONE 
J090095K17AAATGGGCCAGNONE 
J090099H12AAATGGGCCAGNONE 
J100031B11AAATGGGCCAGNONE 
J100053C15AAATGGGCCAGNONE 
J100075F19AAATGGGCCAGNONE 
J100087L22AAATGGGCCAGNONE 
Os01g0514300AK121086TTTCGGCCCATTTLissencephaly type-1-like homology motif domain containing protein. 
Os01g0530400016-019-E07AAATGGGCCCCAGNONE 
AK103724AAATGGGCCCCAGNONE 
AK106476AAATGGGCCCCAGGlutaredoxin-related protein family protein. 
J023108F14AAATGGGCCCCAGNONE 
J033138C10AAATGGGCCCCAGNONE 
Os01g0571200014-074-A10TAGGCCCATTTNONE 
AK121299TAGGCCCATTTSimilar to Ribosomal protein L34. 
J023110L12TAGGCCCATTTNONE 
Os01g0582400AK069484AATGGGCCGTAATCTCGGCCCGTTSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12AATGGGCCGTAATCTCGGCCCGTTNONE 
J023036F15AATGGGCCGTAATCTCGGCCCGTTNONE 
J023095O16AATGGGCCGTAATCTCGGCCCGTTNONE 
J033102M15AATGGGCCGTAATCTCGGCCCGTTNONE 
J043013I06AATGGGCCGTAATCTCGGCCCGTTNONE 
J065083M21AATGGGCCGTAATCTCGGCCCGTTNONE 
J065176A17AATGGGCCGTAATCTCGGCCCGTTNONE 
Os01g0590200011-100-E06GTTGGGCCGGGGCCCATTANONE 
012-005-A05GTTGGGCCGGGGCCCATTANONE 
AK063416GTTGGGCCGGGGCCCATTAConserved hypothetical protein. 
AK099235GTTGGGCCGGGGCCCATTANONE 
AK105022GTTGGGCCGGGGCCCATTANONE 
J065030D21GTTGGGCCGGGGCCCATTANONE 
J065031C10GTTGGGCCGGGGCCCATTANONE 
J065105A22GTTGGGCCGGGGCCCATTANONE 
J065173M19GTTGGGCCGGGGCCCATTANONE 
J075188F15GTTGGGCCGGGGCCCATTANONE 
J090050C15GTTGGGCCGGGGCCCATTANONE 
J100058K07GTTGGGCCGGGGCCCATTANONE 
Os01g0596700AK107371AAATGGGCCCCAFBD domain containing protein. 
Os01g0604100AK099765AAATGGGCCGAGCCCAACTUspA domain containing protein. 
J013094O21AAATGGGCCGAGCCCAACTNONE 
Os01g0612800AK071035AAATGGGCCGAConserved hypothetical protein. 
J090075K01AAATGGGCCGANONE 
Os01g0618200AK102319CACTGACAAATGGGCCCACAProtein phosphatase 2C family protein. 
Os01g0618500011-019-D03TAATGGGCCGANONE 
AK067476TAATGGGCCGASimilar to RNA helicase (Fragment). 
J013020E19TAATGGGCCGANONE 
J033046J12TAATGGGCCGANONE 
J033055D06TAATGGGCCGANONE 
Os01g0626100AK066892TAATGGGCCCACTTGAdaptin, N-terminal domain containing protein. 
J013050G23TAATGGGCCCACTTGNONE 
J013060F03TAATGGGCCCACTTGNONE 
J013088A19TAATGGGCCCACTTGNONE 
J013105M18TAATGGGCCCACTTGNONE 
J013108D15TAATGGGCCCACTTGNONE 
J013118M09TAATGGGCCCACTTGNONE 
J023009J17TAATGGGCCCACTTGNONE 
J023078I22TAATGGGCCCACTTGNONE 
J023103F15TAATGGGCCCACTTGNONE 
J023105B22TAATGGGCCCACTTGNONE 
J033024C18TAATGGGCCCACTTGNONE 
J033032N02TAATGGGCCCACTTGNONE 
J033041E20TAATGGGCCCACTTGNONE 
J033068L19TAATGGGCCCACTTGNONE 
J033076E16TAATGGGCCCACTTGNONE 
J033084J03TAATGGGCCCACTTGNONE 
J033090A13TAATGGGCCCACTTGNONE 
J033106C19TAATGGGCCCACTTGNONE 
J033116N13TAATGGGCCCACTTGNONE 
J033127C24TAATGGGCCCACTTGNONE 
J033129M02TAATGGGCCCACTTGNONE 
J033145J02TAATGGGCCCACTTGNONE 
J043005F08TAATGGGCCCACTTGNONE 
J043007L22TAATGGGCCCACTTGNONE 
J043031E03TAATGGGCCCACTTGNONE 
J043035J19TAATGGGCCCACTTGNONE 
J053027K20TAATGGGCCCACTTGNONE 
J065058I24TAATGGGCCCACTTGNONE 
J065078A06TAATGGGCCCACTTGNONE 
J065085E09TAATGGGCCCACTTGNONE 
J065093L04TAATGGGCCCACTTGNONE 
J065099H07TAATGGGCCCACTTGNONE 
J065102D09TAATGGGCCCACTTGNONE 
J065136J19TAATGGGCCCACTTGNONE 
J065182P21TAATGGGCCCACTTGNONE 
J065200F03TAATGGGCCCACTTGNONE 
J090004E22TAATGGGCCCACTTGNONE 
J090013K22TAATGGGCCCACTTGNONE 
J090019A03TAATGGGCCCACTTGNONE 
J090057B09TAATGGGCCCACTTGNONE 
J090066F19TAATGGGCCCACTTGNONE 
J090071M22TAATGGGCCCACTTGNONE 
J090075E16TAATGGGCCCACTTGNONE 
J090086D23TAATGGGCCCACTTGNONE 
Os01g0672700AK121375AAATGGGCCAGDNA polymerase, beta-like region domain containing protein. 
J023127C22AAATGGGCCAGNONE 
J033092B05AAATGGGCCAGNONE 
J033129P21AAATGGGCCAGNONE 
J065079H18AAATGGGCCAGNONE 
Os01g0685900AK064024AATGGGCCCCACCTGTCAGTNONE 
AK102005AATGGGCCCCACCTGTCAGTSimilar to 65kD microtubule associated protein. 
Os01g0705300AK102719AAATGGGCCGTGConserved hypothetical protein. 
AK103903AAATGGGCCGTGNONE 
J013146O16AAATGGGCCGTGNONE 
J023024O09AAATGGGCCGTGNONE 
J033105F22AAATGGGCCGTGNONE 
J033150L19AAATGGGCCGTGNONE 
J075008G14AAATGGGCCGTGNONE 
J090089L03AAATGGGCCGTGNONE 
J100040H18AAATGGGCCGTGNONE 
Os01g0705500AK063120CACGGCCCATTTConserved hypothetical protein. 
J065063M12CACGGCCCATTTNONE 
J065165C11CACGGCCCATTTNONE 
Os01g0710000AK111794AAATGGGCCCAGCCCACASimilar to WD-repeat protein RBAP1. 
AK111794AAATGGGCCTASimilar to WD-repeat protein RBAP1. 
J023006D22AAATGGGCCCAGCCCACANONE 
J023006D22AAATGGGCCTANONE 
J065106P04AAATGGGCCCAGCCCACANONE 
J065106P04AAATGGGCCTANONE 
J100036G13AAATGGGCCCAGCCCACANONE 
J100036G13AAATGGGCCTANONE 
Os01g0719250AK105184TAGGCCCATTGGGCTConserved hypothetical protein. 
Os01g0737900012-087-D12AAGGCCCATTGGGCCTTNONE 
AK072600AAGGCCCATTGGGCCTTProtein prenyltransferase domain containing protein. 
J023006E12AAGGCCCATTGGGCCTTNONE 
J023130A18AAGGCCCATTGGGCCTTNONE 
J023134O05AAGGCCCATTGGGCCTTNONE 
Os01g0754000014-081-F07AAATGGGCCGCNONE 
AK063730AAATGGGCCGCConserved hypothetical protein. 
J065219A11AAATGGGCCGCNONE 
J075136N13AAATGGGCCGCNONE 
J100051G01AAATGGGCCGCNONE 
J100053M22AAATGGGCCGCNONE 
Os01g0756400J065065A17ATGGCCCATTTNONE 
J075076N03ATGGCCCATTTNONE 
J075120O13ATGGCCCATTTNONE 
J075177C24ATGGCCCATTTNONE 
J080010J02ATGGCCCATTTNONE 
J080018F20ATGGCCCATTTNONE 
J080034I03ATGGCCCATTTNONE 
J080043P21ATGGCCCATTTNONE 
J080068B17ATGGCCCATTTNONE 
J080070F19ATGGCCCATTTNONE 
J080076D05ATGGCCCATTTNONE 
J080077E01ATGGCCCATTTNONE 
J080096C10ATGGCCCATTTNONE 
J080301B21ATGGCCCATTTNONE 
J080304K22ATGGCCCATTTNONE 
Os01g0764300J090053G03AGCCCAATGGGCCATProtein of unknown function DUF155 family protein. 
J090053G03CTGGCCCATTTProtein of unknown function DUF155 family protein. 
Os01g0773600AK067004TCGGCCCATTGlycoside hydrolase, family 47 protein. 
J013091F09TCGGCCCATTNONE 
J013134K14TCGGCCCATTNONE 
J013158J15TCGGCCCATTNONE 
J033060O20TCGGCCCATTNONE 
J033074C16TCGGCCCATTNONE 
J075086F05TCGGCCCATTNONE 
J075150H08TCGGCCCATTNONE 
J090006E02TCGGCCCATTNONE 
J090074E02TCGGCCCATTNONE 
J100030M05TCGGCCCATTNONE 
J100036M16TCGGCCCATTNONE 
J100063H18TCGGCCCATTNONE 
Os01g0784600AK067527ACATGGGCTAATGGGCCTAConserved hypothetical protein. 
Os01g0794900AK106644CTGGCCCATTTConserved hypothetical protein. 
Os01g0801700AK073813AAATGGGCCTTConserved hypothetical protein. 
J033067K14AAATGGGCCTTNONE 
Os01g0805000009-045-H11TAATGGGCCTANONE 
009-196-H08TAATGGGCCTANONE 
J013094D22TAATGGGCCTARibosomal protein L34 family protein. 
J013119F23TAATGGGCCTANONE 
J065128B11TAATGGGCCTANONE 
Os01g0821800015-005-A04ATTGGGCCATTGGCCCATTNONE 
AK073951ATTGGGCCATTGGCCCATTNONE 
AK103171ATTGGGCCATTGGCCCATTNONE 
AK119168ATTGGGCCATTGGCCCATTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J023031A22ATTGGGCCATTGGCCCATTNONE 
J033098N09ATTGGGCCATTGGCCCATTNONE 
J033121G11ATTGGGCCATTGGCCCATTNONE 
J090030L03ATTGGGCCATTGGCCCATTNONE 
Os01g0829266J065010C18AATGGGCCTANONE 
J065010C18TGTTGGGCCCATTANONE 
J065037A22AATGGGCCTANONE 
J065037A22TGTTGGGCCCATTANONE 
J065044B02AATGGGCCTAConserved hypothetical protein. 
J065044B02TGTTGGGCCCATTAConserved hypothetical protein. 
J065044B10AATGGGCCTANONE 
J065044B10TGTTGGGCCCATTANONE 
J065051A06AATGGGCCTANONE 
J065051A06TGTTGGGCCCATTANONE 
J065073E06AATGGGCCTANONE 
J065073E06TGTTGGGCCCATTANONE 
J065074I11AATGGGCCTANONE 
J065074I11TGTTGGGCCCATTANONE 
J065086D22AATGGGCCTANONE 
J065086D22TGTTGGGCCCATTANONE 
J065104H10AATGGGCCTANONE 
J065104H10TGTTGGGCCCATTANONE 
J065107C05AATGGGCCTANONE 
J065107C05TGTTGGGCCCATTANONE 
J065124H16AATGGGCCTANONE 
J065124H16TGTTGGGCCCATTANONE 
J065165F22AATGGGCCTANONE 
J065165F22TGTTGGGCCCATTANONE 
J065169B11AATGGGCCTANONE 
J065169B11TGTTGGGCCCATTANONE 
J065172G21AATGGGCCTANONE 
J065172G21TGTTGGGCCCATTANONE 
J065191E05AATGGGCCTANONE 
J065191E05TGTTGGGCCCATTANONE 
J065191F18AATGGGCCTANONE 
J065191F18TGTTGGGCCCATTANONE 
Os01g0838300J090017B22AATGGGCCGTANONE 
J090061B04AATGGGCCGTANONE 
Os01g0863166J065007F23CCACGGCCCATTTNONE 
J065124H21CCACGGCCCATTTConserved hypothetical protein. 
Os01g0867300AK067919AATGGGCCGTCCGTCCGTCCSimilar to OSE2-like protein (Fragment). 
J013123H12AATGGGCCGTCCGTCCGTCCNONE 
J033046C11AATGGGCCGTCCGTCCGTCCNONE 
J033051I17AATGGGCCGTCCGTCCGTCCNONE 
U25283AATGGGCCGTCCGTCCGTCCNONE 
Os01g0876500J053026A07GAGGCCCATTTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17GAGGCCCATTTNONE 
Os01g0894700009-177-F04AAGGCCCATTTNONE 
009-177-F04AGCCCAAAGGCCCATTTNONE 
AK067623AAGGCCCATTTConserved hypothetical protein. 
AK067623AGCCCAAAGGCCCATTTConserved hypothetical protein. 
AK104876AAGGCCCATTTNONE 
AK104876AGCCCAAAGGCCCATTTNONE 
J013095G01AAGGCCCATTTNONE 
J013095G01AGCCCAAAGGCCCATTTNONE 
J013108L20AAGGCCCATTTNONE 
J013108L20AGCCCAAAGGCCCATTTNONE 
J013120P13AAGGCCCATTTNONE 
J013120P13AGCCCAAAGGCCCATTTNONE 
Os01g0895100AK058611TAATGGGCCCATTTSimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK058611TTGGCCCATTSimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK067698TAATGGGCCCATTTNONE 
AK067698TTGGCCCATTNONE 
AK099166TAATGGGCCCATTTNONE 
AK099166TTGGCCCATTNONE 
J023065I03TAATGGGCCCATTTNONE 
J023065I03TTGGCCCATTNONE 
J023081J06TAATGGGCCCATTTNONE 
J023081J06TTGGCCCATTNONE 
J023126H17TAATGGGCCCATTTNONE 
J023126H17TTGGCCCATTNONE 
J023126O09TAATGGGCCCATTTNONE 
J023126O09TTGGCCCATTNONE 
J033035I06TAATGGGCCCATTTNONE 
J033035I06TTGGCCCATTNONE 
J090065C10TAATGGGCCCATTTNONE 
J090065C10TTGGCCCATTNONE 
J090095O16TAATGGGCCCATTTNONE 
J090095O16TTGGCCCATTNONE 
Os01g0908400009-140-E01GAGGCCCATTTNONE 
AK062957GAGGCCCATTTConserved hypothetical protein. 
AK099301GAGGCCCATTTNONE 
J065123M13GAGGCCCATTTNONE 
J075020O14GAGGCCCATTTNONE 
J075136L21GAGGCCCATTTNONE 
Os01g0915800AK103859AAATGGGCCTCSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20AAATGGGCCTCNONE 
J090056H03AAATGGGCCTCNONE 
J090058L14AAATGGGCCTCNONE 
J090058P16AAATGGGCCTCNONE 
J090076C19AAATGGGCCTCNONE 
J100086P14AAATGGGCCTCNONE 
Os01g0916700Os01g0916700AATGGGCCCTConserved hypothetical protein. 
Os01g0929500AK111399AATGGGCCCTSimilar to Carbonyl reductase-like protein. 
AK120263AATGGGCCCTNONE 
Os01g0938900006-059-H02AAATGGGCCTTNONE 
009-074-D12AAATGGGCCTTNONE 
AK059437AAATGGGCCTTNONE 
AK101971AAATGGGCCTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK109341AAATGGGCCTTNONE 
J023121P08AAATGGGCCTTNONE 
J033046G24AAATGGGCCTTNONE 
J033048E04AAATGGGCCTTNONE 
J033048F04AAATGGGCCTTNONE 
J033076L24AAATGGGCCTTNONE 
J065173H07AAATGGGCCTTNONE 
J065184H09AAATGGGCCTTNONE 
Os01g0946200AK071060AAATGGGCCGCNo apical meristem (NAM) protein domain containing protein. 
J023080K20AAATGGGCCGCNONE 
Os01g0953100AK064981TTGGCCCATTTNONE 
AK068882TTGGCCCATTTProtein of unknown function DUF594 family protein. 
J013001C07TTGGCCCATTTNONE 
J013169K14TTGGCCCATTTNONE 
J033114G07TTGGCCCATTTNONE 
J065035K15TTGGCCCATTTNONE 
J065082E12TTGGCCCATTTNONE 
Os01g0954400003-009-F12TAATGGGCCGANONE 
012-080-B09TAATGGGCCGANONE 
AK065709TAATGGGCCGASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335TAATGGGCCGANONE 
J013039J02TAATGGGCCGANONE 
J033081E17TAATGGGCCGANONE 
J075058B02TAATGGGCCGANONE 
J075067K19TAATGGGCCGANONE 
J075120E23TAATGGGCCGANONE 
J075147I16TAATGGGCCGANONE 
Os01g0960800AK073977TAATGGGCCTAProtein Transporter, Pam16 family protein. 
AK073977TAATGGGCCTGAProtein Transporter, Pam16 family protein. 
AK073977TAATGGGCCTGGProtein Transporter, Pam16 family protein. 
AY313247TAATGGGCCTANONE 
AY313247TAATGGGCCTGANONE 
AY313247TAATGGGCCTGGNONE 
J033075P16TAATGGGCCTANONE 
J033075P16TAATGGGCCTGANONE 
J033075P16TAATGGGCCTGGNONE 
J065051H06TAATGGGCCTANONE 
J065051H06TAATGGGCCTGANONE 
J065051H06TAATGGGCCTGGNONE 
J065167L02TAATGGGCCTANONE 
J065167L02TAATGGGCCTGANONE 
J065167L02TAATGGGCCTGGNONE 
J090083C22TAATGGGCCTANONE 
J090083C22TAATGGGCCTGANONE 
J090083C22TAATGGGCCTGGNONE 
Os01g0970900011-018-A07TGATGGGCCCATTNONE 
011-022-E12TGATGGGCCCATTNONE 
AK063285TGATGGGCCCATTNONE 
AK101688TGATGGGCCCATTProtein prenyltransferase domain containing protein. 
J100042L01TGATGGGCCCATTNONE 
J100053B11TGATGGGCCCATTNONE 
Os02g0106100AK072245AATGGGCCCGCGCCACGTGSimilar to Fructosyltransferase. 
Os02g0116900009-017-C02TAATGGGCCTANONE 
AK121401TAATGGGCCTASimilar to 15.9 kDa subunit of RNA polymerase II. 
J013105H09TAATGGGCCTANONE 
J023131N03TAATGGGCCTANONE 
J033145N08TAATGGGCCTANONE 
J065105G09TAATGGGCCTANONE 
J075086L06TAATGGGCCTANONE 
Os02g0130300011-005-D07AAATGGGCCGAGNONE 
011-041-B06AAATGGGCCGAGNONE 
015-099-D11AAATGGGCCGAGNONE 
016-049-D06AAATGGGCCGAGNONE 
AK102708AAATGGGCCGAGZinc finger, RING-type domain containing protein. 
Os02g0136800011-089-E11CTCGGCCCATTNONE 
AK070727CTCGGCCCATTNONE 
AK103485CTCGGCCCATTProtein of unknown function DUF1677, Oryza sativa family protein. 
J023058D10CTCGGCCCATTNONE 
J033140H14CTCGGCCCATTNONE 
J033142H14CTCGGCCCATTNONE 
J065151O09CTCGGCCCATTNONE 
J090076K09CTCGGCCCATTNONE 
J090085K04CTCGGCCCATTNONE 
Os02g0190900AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein. 
Os02g0220600AK103901AAGGCCCATTTCAGCCCAACANONE 
J013058O03AAGGCCCATTTCAGCCCAACANONE 
J013124E21AAGGCCCATTTCAGCCCAACANONE 
J023023L03AAGGCCCATTTCAGCCCAACANONE 
J023023L21AAGGCCCATTTCAGCCCAACANONE 
J023061N01AAGGCCCATTTCAGCCCAACANONE 
J023065O09AAGGCCCATTTCAGCCCAACANONE 
J023106J17AAGGCCCATTTCAGCCCAACANONE 
J023119N08AAGGCCCATTTCAGCCCAACANONE 
J033058A19AAGGCCCATTTCAGCCCAACANONE 
J033098O13AAGGCCCATTTCAGCCCAACANONE 
J033100M18AAGGCCCATTTCAGCCCAACANONE 
J033125A21AAGGCCCATTTCAGCCCAACANONE 
J033148C12AAGGCCCATTTCAGCCCAACANONE 
J043017F03AAGGCCCATTTCAGCCCAACANONE 
J043032J02AAGGCCCATTTCAGCCCAACANONE 
J053047N10AAGGCCCATTTCAGCCCAACANONE 
J053089P04AAGGCCCATTTCAGCCCAACANONE 
J065051K09AAGGCCCATTTCAGCCCAACANONE 
J065064H24AAGGCCCATTTCAGCCCAACANONE 
J090001L06AAGGCCCATTTCAGCCCAACANONE 
J090017C24AAGGCCCATTTCAGCCCAACANONE 
J090058G15AAGGCCCATTTCAGCCCAACANONE 
J090058H23AAGGCCCATTTCAGCCCAACANONE 
J090061G20AAGGCCCATTTCAGCCCAACANONE 
J090069N23AAGGCCCATTTCAGCCCAACANONE 
J090071A08AAGGCCCATTTCAGCCCAACANONE 
J090074A08AAGGCCCATTTCAGCCCAACANONE 
J090077B15AAGGCCCATTTCAGCCCAACANONE 
J090081K06AAGGCCCATTTCAGCCCAACANONE 
J090083I05AAGGCCCATTTCAGCCCAACANONE 
J090091O22AAGGCCCATTTCAGCCCAACANONE 
J090097L10AAGGCCCATTTCAGCCCAACANONE 
J100026B11AAGGCCCATTTCAGCCCAACANONE 
J100044M01AAGGCCCATTTCAGCCCAACANONE 
J100046F10AAGGCCCATTTCAGCCCAACANONE 
J100051K14AAGGCCCATTTCAGCCCAACANONE 
J100060D22AAGGCCCATTTCAGCCCAACANONE 
J100060H18AAGGCCCATTTCAGCCCAACANONE 
J100070I06AAGGCCCATTTCAGCCCAACANONE 
J100071C04AAGGCCCATTTCAGCCCAACANONE 
J100078M13AAGGCCCATTTCAGCCCAACANONE 
J100080E17AAGGCCCATTTCAGCCCAACANONE 
J100083I09AAGGCCCATTTCAGCCCAACANONE 
Os02g0226600AK109849AGGGCCCATTPOX domain containing protein. 
Os02g0227000J023084F07ACCGGCCCATTTNONE 
J033051H22ACCGGCCCATTTProtein of unknown function UPF0054 family protein. 
Os02g0230200AK105482GACGGCCCATTTConserved hypothetical protein. 
Os02g0235600009-009-H04ATTTGGGCTTTTGGCCCATTTNONE 
009-165-G06ATTTGGGCTTTTGGCCCATTTNONE 
AK120417ATTTGGGCTTTTGGCCCATTTSimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14ATTTGGGCTTTTGGCCCATTTNONE 
J023106P11ATTTGGGCTTTTGGCCCATTTNONE 
J033080L09ATTTGGGCTTTTGGCCCATTTNONE 
J033123O05ATTTGGGCTTTTGGCCCATTTNONE 
J065197A18ATTTGGGCTTTTGGCCCATTTNONE 
J065216P16ATTTGGGCTTTTGGCCCATTTNONE 
J075017F02ATTTGGGCTTTTGGCCCATTTNONE 
J075025L16ATTTGGGCTTTTGGCCCATTTNONE 
J075027P04ATTTGGGCTTTTGGCCCATTTNONE 
J075039N01ATTTGGGCTTTTGGCCCATTTNONE 
J075101F24ATTTGGGCTTTTGGCCCATTTNONE 
J075132J15ATTTGGGCTTTTGGCCCATTTNONE 
J075164K16ATTTGGGCTTTTGGCCCATTTNONE 
J075174E19ATTTGGGCTTTTGGCCCATTTNONE 
J100043C23ATTTGGGCTTTTGGCCCATTTNONE 
J100067B11ATTTGGGCTTTTGGCCCATTTNONE 
Os02g0252100AF139211TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AK062577TACGGCCCATTAAAGCCCAGGCCCAAAASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J013156E01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065001D02TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065042A05TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065116H01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065167P13TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065168N07TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075093G21TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075109H15TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075194P17TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
Os02g0255200AK121591AAGGCCCAAGGCCCATTASimilar to Ribosomal protein S15a homolog. 
J033023N03AAGGCCCAAGGCCCATTANONE 
J033031C22AAGGCCCAAGGCCCATTANONE 
J033037P22AAGGCCCAAGGCCCATTANONE 
J090013J10AAGGCCCAAGGCCCATTANONE 
J090030I04AAGGCCCAAGGCCCATTANONE 
Os02g0266500AK100307TAATGGGCCTASimilar to RASPBERRY3. 
AK100307TCAGGCCCATTSimilar to RASPBERRY3. 
AK100307TCGGCCCATTTSimilar to RASPBERRY3. 
Os02g0287000006-107-B10AAATGGGCCTCNONE 
006-120-E07AAATGGGCCTCNONE 
AF052503AAATGGGCCTCNONE 
AK059647AAATGGGCCTCSimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK099131AAATGGGCCTCNONE 
J023048M05AAATGGGCCTCNONE 
J033107L10AAATGGGCCTCNONE 
J065019A12AAATGGGCCTCNONE 
J065064J21AAATGGGCCTCNONE 
J065071D15AAATGGGCCTCNONE 
J065094L12AAATGGGCCTCNONE 
J065095L06AAATGGGCCTCNONE 
J065097J11AAATGGGCCTCNONE 
J065099M08AAATGGGCCTCNONE 
J065104D01AAATGGGCCTCNONE 
J065107L02AAATGGGCCTCNONE 
J065110D14AAATGGGCCTCNONE 
J065135J07AAATGGGCCTCNONE 
J065137C16AAATGGGCCTCNONE 
J065150C07AAATGGGCCTCNONE 
J065165I10AAATGGGCCTCNONE 
J065189F07AAATGGGCCTCNONE 
J065205L22AAATGGGCCTCNONE 
J065214C09AAATGGGCCTCNONE 
J065217G17AAATGGGCCTCNONE 
J075029E17AAATGGGCCTCNONE 
J075054O16AAATGGGCCTCNONE 
J075068N23AAATGGGCCTCNONE 
J075135N18AAATGGGCCTCNONE 
J075152G09AAATGGGCCTCNONE 
J075162D10AAATGGGCCTCNONE 
J075164F11AAATGGGCCTCNONE 
J080036L12AAATGGGCCTCNONE 
J080049K18AAATGGGCCTCNONE 
J080060P03AAATGGGCCTCNONE 
J080062G16AAATGGGCCTCNONE 
J080062G21AAATGGGCCTCNONE 
J080064N07AAATGGGCCTCNONE 
J080075I22AAATGGGCCTCNONE 
J080086F20AAATGGGCCTCNONE 
J080087G07AAATGGGCCTCNONE 
J080088I06AAATGGGCCTCNONE 
J080302B20AAATGGGCCTCNONE 
J080303L14AAATGGGCCTCNONE 
J080309O12AAATGGGCCTCNONE 
J080317F12AAATGGGCCTCNONE 
J080317P18AAATGGGCCTCNONE 
J090013L15AAATGGGCCTCNONE 
J090043N04AAATGGGCCTCNONE 
J090085G01AAATGGGCCTCNONE 
J090085G19AAATGGGCCTCNONE 
Os02g0288200AK073147GTGGCCCATTTNONE 
Os02g0304800Os02g0304800TCCGGCCCATTAProtein prenyltransferase domain containing protein. 
Os02g0321000AK121840TAATGGGCCGTTTTetratricopeptide-like helical domain containing protein. 
Os02g0467200014-053-H06GTGGCCCATTNONE 
AK063704GTGGCCCATTConserved hypothetical protein. 
J065197J05GTGGCCCATTNONE 
Os02g0526500006-107-D09AAATGGGCCTCNONE 
006-107-D09AATGGGCCTANONE 
Os02g0537500AK068689TCCGGCCCATTGGGCCGCSimilar to E2F homolog. 
Os02g0575900AK102188CGGGCCCATTExo70 exocyst complex subunit family protein. 
J033032M01CGGGCCCATTNONE 
J033086P19CGGGCCCATTNONE 
J033148L20CGGGCCCATTNONE 
J100040L08CGGGCCCATTNONE 
Os02g0591800AK060611ATATGGGCCGTGGTGGCCCATTBrix domain containing protein. 
AK102534ATATGGGCCGTGGTGGCCCATTNONE 
J075057H08ATATGGGCCGTGGTGGCCCATTNONE 
J075179P18ATATGGGCCGTGGTGGCCCATTNONE 
J080011H01ATATGGGCCGTGGTGGCCCATTNONE 
J080018E14ATATGGGCCGTGGTGGCCCATTNONE 
J080026N17ATATGGGCCGTGGTGGCCCATTNONE 
J080047A13ATATGGGCCGTGGTGGCCCATTNONE 
J080049C17ATATGGGCCGTGGTGGCCCATTNONE 
J080050G07ATATGGGCCGTGGTGGCCCATTNONE 
J080064D10ATATGGGCCGTGGTGGCCCATTNONE 
J080080A03ATATGGGCCGTGGTGGCCCATTNONE 
J080080G20ATATGGGCCGTGGTGGCCCATTNONE 
J080080I03ATATGGGCCGTGGTGGCCCATTNONE 
J080081H12ATATGGGCCGTGGTGGCCCATTNONE 
J080090K07ATATGGGCCGTGGTGGCCCATTNONE 
J080092O06ATATGGGCCGTGGTGGCCCATTNONE 
J080096B07ATATGGGCCGTGGTGGCCCATTNONE 
J080097M08ATATGGGCCGTGGTGGCCCATTNONE 
Os02g0601500016-057-F12GTGGCCCATTANONE 
J075091F02GTGGCCCATTACytochrome P450 family protein. 
Os02g0618700AK070657GAGGCCCATTTLung seven transmembrane receptor family protein. 
J023056H15GAGGCCCATTTNONE 
Os02g0622400005-010-C04TAATGGGCCGGCCCATTTNONE 
AK061679TAATGGGCCGGCCCATTTConserved hypothetical protein. 
J013058H01TAATGGGCCGGCCCATTTNONE 
J013095D07TAATGGGCCGGCCCATTTNONE 
J023054G05TAATGGGCCGGCCCATTTNONE 
J023093A17TAATGGGCCGGCCCATTTNONE 
J023146P16TAATGGGCCGGCCCATTTNONE 
J033089D16TAATGGGCCGGCCCATTTNONE 
J033099G12TAATGGGCCGGCCCATTTNONE 
J033131N10TAATGGGCCGGCCCATTTNONE 
J053073J04TAATGGGCCGGCCCATTTNONE 
J053074P03TAATGGGCCGGCCCATTTNONE 
J053075M06TAATGGGCCGGCCCATTTNONE 
J053088K13TAATGGGCCGGCCCATTTNONE 
J090039F18TAATGGGCCGGCCCATTTNONE 
J090045M03TAATGGGCCGGCCCATTTNONE 
Os02g0633200012-053-F09CACGGCCCAATAGGCCCATTANONE 
015-051-C09CACGGCCCAATAGGCCCATTANONE 
AK063500CACGGCCCAATAGGCCCATTAProtein prenyltransferase domain containing protein. 
J065019K23CACGGCCCAATAGGCCCATTANONE 
J065205C16CACGGCCCAATAGGCCCATTANONE 
Os02g0646400AK067828AATGGGCCCAAGSimilar to Glutaredoxin. 
J013120N01AATGGGCCCAAGNONE 
J065021N01AATGGGCCCAAGNONE 
J065021N02AATGGGCCCAAGNONE 
J065053O18AATGGGCCCAAGNONE 
J090067J17AATGGGCCCAAGNONE 
Os02g0651900AK101633AATGGGCCGGTNONE 
AK102949AATGGGCCGGTConserved hypothetical protein. 
J080018N20AATGGGCCGGTNONE 
J080062I19AATGGGCCGGTNONE 
J100064N12AATGGGCCGGTNONE 
J100083B11AATGGGCCGGTNONE 
J100089D08AATGGGCCGGTNONE 
Os02g0655700AK101068AAATGGGCCTCAmino acid/polyamine transporter I family protein. 
AK101068AAATGGGCCTTAmino acid/polyamine transporter I family protein. 
J013026C06AAATGGGCCTCNONE 
J013026C06AAATGGGCCTTNONE 
J033023I17AAATGGGCCTCNONE 
J033023I17AAATGGGCCTTNONE 
Os02g0656500011-045-C08AAATGGGCCGAANONE 
011-045-E06AAATGGGCCGAANONE 
016-046-A01AAATGGGCCGAANONE 
016-046-B01AAATGGGCCGAANONE 
AK062239AAATGGGCCGAANONE 
AK066420AAATGGGCCGAADnaJ-like protein. 
J013067J21AAATGGGCCGAANONE 
J065047L09AAATGGGCCGAANONE 
J065104M20AAATGGGCCGAANONE 
J065134B04AAATGGGCCGAANONE 
J065152C10AAATGGGCCGAANONE 
J065161O03AAATGGGCCGAANONE 
J065169F18AAATGGGCCGAANONE 
J065210M21AAATGGGCCGAANONE 
J065217B03AAATGGGCCGAANONE 
J065218C10AAATGGGCCGAANONE 
J075041F09AAATGGGCCGAANONE 
J075048A02AAATGGGCCGAANONE 
J075083F21AAATGGGCCGAANONE 
J080005F10AAATGGGCCGAANONE 
J080013P21AAATGGGCCGAANONE 
J080027J09AAATGGGCCGAANONE 
J080037O17AAATGGGCCGAANONE 
J080039F02AAATGGGCCGAANONE 
J080039G01AAATGGGCCGAANONE 
J080041I09AAATGGGCCGAANONE 
J080043M01AAATGGGCCGAANONE 
J080060H17AAATGGGCCGAANONE 
J080062O07AAATGGGCCGAANONE 
J080079F05AAATGGGCCGAANONE 
J080093H04AAATGGGCCGAANONE 
J080096B15AAATGGGCCGAANONE 
J080097H24AAATGGGCCGAANONE 
J090032O11AAATGGGCCGAANONE 
J090044F01AAATGGGCCGAANONE 
J090045E04AAATGGGCCGAANONE 
J090048O03AAATGGGCCGAANONE 
J090049E04AAATGGGCCGAANONE 
J090070E19AAATGGGCCGAANONE 
J090079E13AAATGGGCCGAANONE 
J090089L14AAATGGGCCGAANONE 
J090095K13AAATGGGCCGAANONE 
J090096I19AAATGGGCCGAANONE 
J090098B04AAATGGGCCGAANONE 
J100027P13AAATGGGCCGAANONE 
J100048H06AAATGGGCCGAANONE 
J100060J15AAATGGGCCGAANONE 
J100070K16AAATGGGCCGAANONE 
J100074O22AAATGGGCCGAANONE 
Os02g0658300AK073923AAGGCCCATTAConserved hypothetical protein. 
J065152M15AAGGCCCATTANONE 
Os02g0661300016-077-C09AAATGGGCCAGCCCATAANONE 
AK106503AAATGGGCCAGCCCATAAConserved hypothetical protein. 
Os02g0666800AK101444CAAGGCCCATTTProtein of unknown function DUF788 family protein. 
AK101444TAATGGGCCTCProtein of unknown function DUF788 family protein. 
J033039F09CAAGGCCCATTTNONE 
J033039F09TAATGGGCCTCNONE 
J065041E15CAAGGCCCATTTNONE 
J065041E15TAATGGGCCTCNONE 
J075087I24CAAGGCCCATTTNONE 
J075087I24TAATGGGCCTCNONE 
J100079A10CAAGGCCCATTTNONE 
J100079A10TAATGGGCCTCNONE 
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE 
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein. 
J090039P20CAACGGCCCGGCCCATTTNONE 
Os02g0705100012-046-E01GAGGCCCATTNONE 
AK063491GAGGCCCATTEpoxide hydrolase family protein. 
J065184H07GAGGCCCATTNONE 
Os02g0717100014-089-G06CACGGCCCATTANONE 
AK063741CACGGCCCATTAEsterase/lipase/thioesterase domain containing protein. 
J065052A22CACGGCCCATTANONE 
Os02g0717800009-009-B02AAATGGGCCGTTTNONE 
J065185P06AAATGGGCCGTTTNONE 
J100061J04AAATGGGCCGTTTNONE 
J100064M21AAATGGGCCGTTTNONE 
Os02g0736500AK065166TAATGGGCCGAANicastrin family protein. 
J013099D16TAATGGGCCGAANONE 
Os02g0750500AK101960GCGGCCCATTTSAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05GCGGCCCATTTNONE 
J065054F02GCGGCCCATTTNONE 
J065124N03GCGGCCCATTTNONE 
J090001H12GCGGCCCATTTNONE 
J100057J01GCGGCCCATTTNONE 
J100062F12GCGGCCCATTTNONE 
Os02g0769700AK111328AAATGGGCCTGGProtein kinase-like domain containing protein. 
Os02g0775600003-118-H07AAATGGGCCGGGNONE 
009-075-H07AAATGGGCCGGGNONE 
AK058592AAATGGGCCGGGNONE 
AK068762AAATGGGCCGGGZinc finger, C2H2-type domain containing protein. 
Os02g0780800J090080O19TTTCGGCCCATTTNONE 
J090091I06TTTCGGCCCATTTNONE 
Os02g0795900012-075-B04AATGGGCCACCGCACNONE 
AK105305AATGGGCCACCGCACSimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21AATGGGCCACCGCACNONE 
Os02g0796500AK065276AAATGGGCCCCASimilar to Two-component response regulator ARR11 (Receiver-like protein 3). 
AK099581AAATGGGCCCCANONE 
AK120648AAATGGGCCCCANONE 
Os02g0796900009-121-E06AAATGGGCCACNONE 
D29725AAATGGGCCACSimilar to 60S ribosomal protein L39. 
J075016N24AAATGGGCCACNONE 
J075085F03AAATGGGCCACNONE 
J075147P11AAATGGGCCACNONE 
J075180E16AAATGGGCCACNONE 
J075182A19AAATGGGCCACNONE 
Os02g0798700AK101070GAGGCCCATTTNeurochondrin family protein. 
AK103079GAGGCCCATTTNONE 
J090045L09GAGGCCCATTTNONE 
Os02g0804300006-046-D12TCTCGGCCCATTTCACGTGTCNONE 
AK060165TCTCGGCCCATTTCACGTGTCNONE 
AK067584TCTCGGCCCATTTCACGTGTCSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12TCTCGGCCCATTTCACGTGTCNONE 
J023098C22TCTCGGCCCATTTCACGTGTCNONE 
J033123P06TCTCGGCCCATTTCACGTGTCNONE 
J065060N24TCTCGGCCCATTTCACGTGTCNONE 
J065069H22TCTCGGCCCATTTCACGTGTCNONE 
J065155N20TCTCGGCCCATTTCACGTGTCNONE 
J065170K07TCTCGGCCCATTTCACGTGTCNONE 
J090033D12TCTCGGCCCATTTCACGTGTCNONE 
Os02g0810300AK059363AAATGGGCCAGGGCCCAGGSimilar to NBD-like protein. 
AK099203AAATGGGCCAGGGCCCAGGNONE 
Os02g0816700009-132-E07TAATGGGCCGTAGGCCCATTTNONE 
009-132-E07TAATGGGCCTANONE 
AK059572TAATGGGCCGTAGGCCCATTTConserved hypothetical protein. 
AK059572TAATGGGCCTAConserved hypothetical protein. 
Os02g0816800013-089-A09AAATGGGCCTACGGCCCATTANONE 
013-089-A09TAGGCCCATTANONE 
AK102271AAATGGGCCTACGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
AK102271TAGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
J013105O04AAATGGGCCTACGGCCCATTANONE 
J013105O04TAGGCCCATTANONE 
J013124I08AAATGGGCCTACGGCCCATTANONE 
J013124I08TAGGCCCATTANONE 
J023002E08AAATGGGCCTACGGCCCATTANONE 
J023002E08TAGGCCCATTANONE 
J023025C01AAATGGGCCTACGGCCCATTANONE 
J023025C01TAGGCCCATTANONE 
J023037O12AAATGGGCCTACGGCCCATTANONE 
J023037O12TAGGCCCATTANONE 
J023049N06AAATGGGCCTACGGCCCATTANONE 
J023049N06TAGGCCCATTANONE 
J023069G18AAATGGGCCTACGGCCCATTANONE 
J023069G18TAGGCCCATTANONE 
J033029M02AAATGGGCCTACGGCCCATTANONE 
J033029M02TAGGCCCATTANONE 
J033037L22AAATGGGCCTACGGCCCATTANONE 
J033037L22TAGGCCCATTANONE 
J033089A08AAATGGGCCTACGGCCCATTANONE 
J033089A08TAGGCCCATTANONE 
J033103L07AAATGGGCCTACGGCCCATTANONE 
J033103L07TAGGCCCATTANONE 
J033125L19AAATGGGCCTACGGCCCATTANONE 
J033125L19TAGGCCCATTANONE 
J090008N20AAATGGGCCTACGGCCCATTANONE 
J090008N20TAGGCCCATTANONE 
J090041F23AAATGGGCCTACGGCCCATTANONE 
J090041F23TAGGCCCATTANONE 
J090092H16AAATGGGCCTACGGCCCATTANONE 
J090092H16TAGGCCCATTANONE 
Os02g0819100AK100156TTCGGCCCATTAZinc finger, DHHC-type domain containing protein. 
J013088C21TTCGGCCCATTANONE 
Os02g0820600AK066549TAGGCCCATTAConserved hypothetical protein. 
J013070F02TAGGCCCATTANONE 
Os02g0820700006-025-E04TAATGGGCCTANONE 
006-025-E04TAATGGGCCTCNONE 
006-052-F06TAATGGGCCTANONE 
006-052-F06TAATGGGCCTCNONE 
006-082-A05TAATGGGCCTANONE 
006-082-A05TAATGGGCCTCNONE 
006-089-B06TAATGGGCCTANONE 
006-089-B06TAATGGGCCTCNONE 
AK060869TAATGGGCCTASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK060869TAATGGGCCTCSimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK061365TAATGGGCCTANONE 
AK061365TAATGGGCCTCNONE 
AK103008TAATGGGCCTANONE 
AK103008TAATGGGCCTCNONE 
AK104724TAATGGGCCTANONE 
AK104724TAATGGGCCTCNONE 
J013049H21TAATGGGCCTANONE 
J013049H21TAATGGGCCTCNONE 
J043027N22TAATGGGCCTANONE 
J043027N22TAATGGGCCTCNONE 
J075031I15TAATGGGCCTANONE 
J075031I15TAATGGGCCTCNONE 
J075132D23TAATGGGCCTANONE 
J075132D23TAATGGGCCTCNONE 
Os02g0823600AK070498TAATGGGCCGCConserved hypothetical protein. 
AK070498TCCGGCCCATTTConserved hypothetical protein. 
J065055C02TAATGGGCCGCNONE 
J065055C02TCCGGCCCATTTNONE 
J065098A17TAATGGGCCGCNONE 
J065098A17TCCGGCCCATTTNONE 
J065119B13TAATGGGCCGCNONE 
J065119B13TCCGGCCCATTTNONE 
J065146F10TAATGGGCCGCNONE 
J065146F10TCCGGCCCATTTNONE 
J065209G06TAATGGGCCGCNONE 
J065209G06TCCGGCCCATTTNONE 
J080001K12TAATGGGCCGCNONE 
J080001K12TCCGGCCCATTTNONE 
J080004O17TAATGGGCCGCNONE 
J080004O17TCCGGCCCATTTNONE 
J080005P21TAATGGGCCGCNONE 
J080005P21TCCGGCCCATTTNONE 
J080009M18TAATGGGCCGCNONE 
J080009M18TCCGGCCCATTTNONE 
J080013O18TAATGGGCCGCNONE 
J080013O18TCCGGCCCATTTNONE 
J080014B04TAATGGGCCGCNONE 
J080014B04TCCGGCCCATTTNONE 
J080014O21TAATGGGCCGCNONE 
J080014O21TCCGGCCCATTTNONE 
J080015B04TAATGGGCCGCNONE 
J080015B04TCCGGCCCATTTNONE 
J080016B17TAATGGGCCGCNONE 
J080016B17TCCGGCCCATTTNONE 
J080017G09TAATGGGCCGCNONE 
J080017G09TCCGGCCCATTTNONE 
J080022A17TAATGGGCCGCNONE 
J080022A17TCCGGCCCATTTNONE 
J080024M10TAATGGGCCGCNONE 
J080024M10TCCGGCCCATTTNONE 
J080025F17TAATGGGCCGCNONE 
J080025F17TCCGGCCCATTTNONE 
J080025O16TAATGGGCCGCNONE 
J080025O16TCCGGCCCATTTNONE 
J080029H09TAATGGGCCGCNONE 
J080029H09TCCGGCCCATTTNONE 
J080030G24TAATGGGCCGCNONE 
J080030G24TCCGGCCCATTTNONE 
J080031E02TAATGGGCCGCNONE 
J080031E02TCCGGCCCATTTNONE 
J080032A18TAATGGGCCGCNONE 
J080032A18TCCGGCCCATTTNONE 
J080032G24TAATGGGCCGCNONE 
J080032G24TCCGGCCCATTTNONE 
J080033C05TAATGGGCCGCNONE 
J080033C05TCCGGCCCATTTNONE 
J080033N19TAATGGGCCGCNONE 
J080033N19TCCGGCCCATTTNONE 
J080035H10TAATGGGCCGCNONE 
J080035H10TCCGGCCCATTTNONE 
J080035L05TAATGGGCCGCNONE 
J080035L05TCCGGCCCATTTNONE 
J080042N09TAATGGGCCGCNONE 
J080042N09TCCGGCCCATTTNONE 
J080044C14TAATGGGCCGCNONE 
J080044C14TCCGGCCCATTTNONE 
J080048K16TAATGGGCCGCNONE 
J080048K16TCCGGCCCATTTNONE 
J080050L07TAATGGGCCGCNONE 
J080050L07TCCGGCCCATTTNONE 
J080051L06TAATGGGCCGCNONE 
J080051L06TCCGGCCCATTTNONE 
J080051P22TAATGGGCCGCNONE 
J080051P22TCCGGCCCATTTNONE 
J080053D09TAATGGGCCGCNONE 
J080053D09TCCGGCCCATTTNONE 
J080053J15TAATGGGCCGCNONE 
J080053J15TCCGGCCCATTTNONE 
J080053O12TAATGGGCCGCNONE 
J080053O12TCCGGCCCATTTNONE 
J080057L01TAATGGGCCGCNONE 
J080057L01TCCGGCCCATTTNONE 
J080062E08TAATGGGCCGCNONE 
J080062E08TCCGGCCCATTTNONE 
J080062I09TAATGGGCCGCNONE 
J080062I09TCCGGCCCATTTNONE 
J080063A21TAATGGGCCGCNONE 
J080063A21TCCGGCCCATTTNONE 
J080063E04TAATGGGCCGCNONE 
J080063E04TCCGGCCCATTTNONE 
J080063E08TAATGGGCCGCNONE 
J080063E08TCCGGCCCATTTNONE 
J080064D15TAATGGGCCGCNONE 
J080064D15TCCGGCCCATTTNONE 
J080064N15TAATGGGCCGCNONE 
J080064N15TCCGGCCCATTTNONE 
J080068F13TAATGGGCCGCNONE 
J080068F13TCCGGCCCATTTNONE 
J080070L16TAATGGGCCGCNONE 
J080070L16TCCGGCCCATTTNONE 
J080072O17TAATGGGCCGCNONE 
J080072O17TCCGGCCCATTTNONE 
J080075A07TAATGGGCCGCNONE 
J080075A07TCCGGCCCATTTNONE 
J080076H10TAATGGGCCGCNONE 
J080076H10TCCGGCCCATTTNONE 
J080077K19TAATGGGCCGCNONE 
J080077K19TCCGGCCCATTTNONE 
J080078E19TAATGGGCCGCNONE 
J080078E19TCCGGCCCATTTNONE 
J080082A02TAATGGGCCGCNONE 
J080082A02TCCGGCCCATTTNONE 
J080083O05TAATGGGCCGCNONE 
J080083O05TCCGGCCCATTTNONE 
J080091I07TAATGGGCCGCNONE 
J080091I07TCCGGCCCATTTNONE 
J080094K10TAATGGGCCGCNONE 
J080094K10TCCGGCCCATTTNONE 
J080094N03TAATGGGCCGCNONE 
J080094N03TCCGGCCCATTTNONE 
J080096F09TAATGGGCCGCNONE 
J080096F09TCCGGCCCATTTNONE 
J080097O04TAATGGGCCGCNONE 
J080097O04TCCGGCCCATTTNONE 
J090037B19TAATGGGCCGCNONE 
J090037B19TCCGGCCCATTTNONE 
J100017A13TAATGGGCCGCNONE 
J100017A13TCCGGCCCATTTNONE 
J100068N22TAATGGGCCGCNONE 
J100068N22TCCGGCCCATTTNONE 
J100072C06TAATGGGCCGCNONE 
J100072C06TCCGGCCCATTTNONE 
Os02g0824900AK073217AGTGGGCCCATTTNONE 
AK103528AGTGGGCCCATTTConserved hypothetical protein. 
J090069J01AGTGGGCCCATTTNONE 
J090081B04AGTGGGCCCATTTNONE 
Os02g0832700AK099439CAGGCCCATTASimilar to Metal tolerance protein C2 (AtMTPc2). 
Os03g0115200009-112-E09GCGGCCCATTANONE 
AK071287GCGGCCCATTASimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06GCGGCCCATTANONE 
J065075D17GCGGCCCATTANONE 
J065108G15GCGGCCCATTANONE 
J065165A16GCGGCCCATTANONE 
J075015O12GCGGCCCATTANONE 
J075022O06GCGGCCCATTANONE 
J075031H14GCGGCCCATTANONE 
J075033D10GCGGCCCATTANONE 
J075070A04GCGGCCCATTANONE 
J075127A05GCGGCCCATTANONE 
J100070B16GCGGCCCATTANONE 
Os03g0116500AF106844TAATGGGCCGANONE 
AK101870TAATGGGCCGAConstitutive photomorphogenic 11. 
J023055L16TAATGGGCCGANONE 
J023088I16TAATGGGCCGANONE 
J033070E21TAATGGGCCGANONE 
J065124N22TAATGGGCCGANONE 
J075152A19TAATGGGCCGANONE 
J075181J21TAATGGGCCGANONE 
J090011F23TAATGGGCCGANONE 
Os03g0119100AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
J023024E17CCATGGGCCCACGGCCCATTNONE 
J023122B02CCATGGGCCCACGGCCCATTNONE 
J090094E15CCATGGGCCCACGGCCCATTNONE 
Os03g0125700009-132-G03AAATGGGCCTTAAAGCCCATTTNONE 
009-132-G03TAATGGGCCGAAANONE 
AK062913AAATGGGCCTTAAAGCCCATTTConserved hypothetical protein. 
AK062913TAATGGGCCGAAAConserved hypothetical protein. 
J075046C16AAATGGGCCTTAAAGCCCATTTNONE 
J075046C16TAATGGGCCGAAANONE 
J075115L05AAATGGGCCTTAAAGCCCATTTNONE 
J075115L05TAATGGGCCGAAANONE 
J075143I05AAATGGGCCTTAAAGCCCATTTNONE 
J075143I05TAATGGGCCGAAANONE 
J075197O07AAATGGGCCTTAAAGCCCATTTNONE 
J075197O07TAATGGGCCGAAANONE 
Os03g0127000AK068479AAGGCCCATTTConserved hypothetical protein. 
J013152D10AAGGCCCATTTNONE 
J075167I20AAGGCCCATTTNONE 
J090067O04AAGGCCCATTTNONE 
Os03g0128500AB037900AATGGGCCGGANONE 
AB037900TCCGGCCCATTNONE 
AK067991AATGGGCCGGASimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
AK067991TCCGGCCCATTSimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
J013124O04AATGGGCCGGANONE 
J013124O04TCCGGCCCATTNONE 
J090032P09AATGGGCCGGANONE 
J090032P09TCCGGCCCATTNONE 
Os03g0130700AK110670TCCGGCCCATTTNONE 
Os03g0142900011-054-A05CAACGGCCCATTNONE 
AK067103CAACGGCCCATTNONE 
AK120438CAACGGCCCATTProtein of unknown function DUF946, plant family protein. 
J013097D18CAACGGCCCATTNONE 
J013098E18CAACGGCCCATTNONE 
J013099I17CAACGGCCCATTNONE 
J013108C09CAACGGCCCATTNONE 
J023045J15CAACGGCCCATTNONE 
J033034E13CAACGGCCCATTNONE 
J033095F07CAACGGCCCATTNONE 
J033102N22CAACGGCCCATTNONE 
J065016C14CAACGGCCCATTNONE 
J065034E13CAACGGCCCATTNONE 
J065065F21CAACGGCCCATTNONE 
J065159M09CAACGGCCCATTNONE 
J075012C13CAACGGCCCATTNONE 
J075017P18CAACGGCCCATTNONE 
J075018M03CAACGGCCCATTNONE 
J075021H19CAACGGCCCATTNONE 
J075070K23CAACGGCCCATTNONE 
J075077B18CAACGGCCCATTNONE 
J075085E20CAACGGCCCATTNONE 
J075090N23CAACGGCCCATTNONE 
J075137M16CAACGGCCCATTNONE 
J075151E03CAACGGCCCATTNONE 
J090042L02CAACGGCCCATTNONE 
J090060C21CAACGGCCCATTNONE 
J090089I17CAACGGCCCATTNONE 
J100024L19CAACGGCCCATTNONE 
J100025A06CAACGGCCCATTNONE 
J100033C24CAACGGCCCATTNONE 
J100052J17CAACGGCCCATTNONE 
J100063H10CAACGGCCCATTNONE 
J100073P04CAACGGCCCATTNONE 
J100075D01CAACGGCCCATTNONE 
J100077J17CAACGGCCCATTNONE 
J100087F03CAACGGCCCATTNONE 
J100087F09CAACGGCCCATTNONE 
Os03g0143400AK073999TAGGCCCACAACCCGGCCCATTSimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21TAGGCCCACAACCCGGCCCATTNONE 
J033073C08TAGGCCCACAACCCGGCCCATTNONE 
J033094C19TAGGCCCACAACCCGGCCCATTNONE 
J065017L10TAGGCCCACAACCCGGCCCATTNONE 
J065070H22TAGGCCCACAACCCGGCCCATTNONE 
J065079M09TAGGCCCACAACCCGGCCCATTNONE 
J065091N18TAGGCCCACAACCCGGCCCATTNONE 
J065109N03TAGGCCCACAACCCGGCCCATTNONE 
J065113F05TAGGCCCACAACCCGGCCCATTNONE 
J065135D23TAGGCCCACAACCCGGCCCATTNONE 
J065156L16TAGGCCCACAACCCGGCCCATTNONE 
J065207O04TAGGCCCACAACCCGGCCCATTNONE 
J065208F03TAGGCCCACAACCCGGCCCATTNONE 
J090010M15TAGGCCCACAACCCGGCCCATTNONE 
J090056J18TAGGCCCACAACCCGGCCCATTNONE 
Os03g0143600AB110188AAATGGGCCGCNONE 
AK068424AAATGGGCCGCSimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464AAATGGGCCGCNONE 
AY224545AAATGGGCCGCNONE 
J013154F02AAATGGGCCGCNONE 
Os03g0145700AK065716AAATGGGCCGGTNONE 
J013039F14AAATGGGCCGGTNONE 
J013091M20AAATGGGCCGGTNONE 
J065059P20AAATGGGCCGGTNONE 
J065128M07AAATGGGCCGGTNONE 
J065136N23AAATGGGCCGGTNONE 
J065163H21AAATGGGCCGGTNONE 
J065176B18AAATGGGCCGGTNONE 
J065177A17AAATGGGCCGGTNONE 
J065201F24AAATGGGCCGGTNONE 
Os03g0197000AK071163TAGGCCCATTConserved hypothetical protein. 
J023079A07TAGGCCCATTNONE 
Os03g0200500005-016-A06AATGGGCCTTNONE 
AK069251AATGGGCCTT40S ribosomal protein S3a (CYC07 protein). 
AK104243AATGGGCCTTNONE 
AK104699AATGGGCCTTNONE 
D26060AATGGGCCTTNONE 
J013024H20AATGGGCCTTNONE 
J013029C14AATGGGCCTTNONE 
J013035O17AATGGGCCTTNONE 
J013066B11AATGGGCCTTNONE 
J013066B12AATGGGCCTTNONE 
J013066B13AATGGGCCTTNONE 
J013152M04AATGGGCCTTNONE 
J023001A03AATGGGCCTTNONE 
J023013H23AATGGGCCTTNONE 
J023042L07AATGGGCCTTNONE 
J023081L11AATGGGCCTTNONE 
J023088I23AATGGGCCTTNONE 
J023092N22AATGGGCCTTNONE 
J023126A20AATGGGCCTTNONE 
J023139A17AATGGGCCTTNONE 
J023150G12AATGGGCCTTNONE 
J033026M10AATGGGCCTTNONE 
J033031H24AATGGGCCTTNONE 
J033036C22AATGGGCCTTNONE 
J033037P08AATGGGCCTTNONE 
J033045G14AATGGGCCTTNONE 
J033048A13AATGGGCCTTNONE 
J033048B13AATGGGCCTTNONE 
J033048K11AATGGGCCTTNONE 
J033066A06AATGGGCCTTNONE 
J033072H01AATGGGCCTTNONE 
J033082K07AATGGGCCTTNONE 
J033091G20AATGGGCCTTNONE 
J033095C14AATGGGCCTTNONE 
J033101N24AATGGGCCTTNONE 
J033105L15AATGGGCCTTNONE 
J033107J18AATGGGCCTTNONE 
J033112L02AATGGGCCTTNONE 
J033117I17AATGGGCCTTNONE 
J043003K06AATGGGCCTTNONE 
J043016I20AATGGGCCTTNONE 
J043021A10AATGGGCCTTNONE 
J043034F14AATGGGCCTTNONE 
J065002O17AATGGGCCTTNONE 
J065014B14AATGGGCCTTNONE 
J065054N19AATGGGCCTTNONE 
J065112P18AATGGGCCTTNONE 
J065121B20AATGGGCCTTNONE 
J065170M08AATGGGCCTTNONE 
J065194B05AATGGGCCTTNONE 
J090040F01AATGGGCCTTNONE 
J090078O20AATGGGCCTTNONE 
J090078P21AATGGGCCTTNONE 
J090084E11AATGGGCCTTNONE 
J100080B11AATGGGCCTTNONE 
Os03g0204900009-041-G04TAATGGGCCGGGNONE 
AK062601TAATGGGCCGGGSimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os03g0240700009-086-G10AATGGGCCTAGCCCAACANONE 
009-086-G10TAATGGGCCCGGCCCAAACNONE 
AK071799AATGGGCCTAGCCCAACAConserved hypothetical protein. 
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein. 
J023112A13AATGGGCCTAGCCCAACANONE 
J023112A13TAATGGGCCCGGCCCAAACNONE 
J043022A01AATGGGCCTAGCCCAACANONE 
J043022A01TAATGGGCCCGGCCCAAACNONE 
J065106A01AATGGGCCTAGCCCAACANONE 
J065106A01TAATGGGCCCGGCCCAAACNONE 
J075023P22AATGGGCCTAGCCCAACANONE 
J075023P22TAATGGGCCCGGCCCAAACNONE 
J075138I21AATGGGCCTAGCCCAACANONE 
J075138I21TAATGGGCCCGGCCCAAACNONE 
J075173L02AATGGGCCTAGCCCAACANONE 
J075173L02TAATGGGCCCGGCCCAAACNONE 
Os03g0240800006-092-D05GTTTGGGCCGGGCCCATTANONE 
006-092-D05TGTTGGGCTAGGCCCATTNONE 
AK059292GTTTGGGCCGGGCCCATTANONE 
AK059292TGTTGGGCTAGGCCCATTNONE 
AK061178GTTTGGGCCGGGCCCATTASimilar to AGL157Cp. 
AK061178TGTTGGGCTAGGCCCATTSimilar to AGL157Cp. 
AK121552GTTTGGGCCGGGCCCATTANONE 
AK121552TGTTGGGCTAGGCCCATTNONE 
J023131D06GTTTGGGCCGGGCCCATTANONE 
J023131D06TGTTGGGCTAGGCCCATTNONE 
J033033E14GTTTGGGCCGGGCCCATTANONE 
J033033E14TGTTGGGCTAGGCCCATTNONE 
J033105B01GTTTGGGCCGGGCCCATTANONE 
J033105B01TGTTGGGCTAGGCCCATTNONE 
J033114L18GTTTGGGCCGGGCCCATTANONE 
J033114L18TGTTGGGCTAGGCCCATTNONE 
J033132N24GTTTGGGCCGGGCCCATTANONE 
J033132N24TGTTGGGCTAGGCCCATTNONE 
J065032H03GTTTGGGCCGGGCCCATTANONE 
J065032H03TGTTGGGCTAGGCCCATTNONE 
J065115J20GTTTGGGCCGGGCCCATTANONE 
J065115J20TGTTGGGCTAGGCCCATTNONE 
J065150C05GTTTGGGCCGGGCCCATTANONE 
J065150C05TGTTGGGCTAGGCCCATTNONE 
J080302A11GTTTGGGCCGGGCCCATTANONE 
J080302A11TGTTGGGCTAGGCCCATTNONE 
J080302H16GTTTGGGCCGGGCCCATTANONE 
J080302H16TGTTGGGCTAGGCCCATTNONE 
J080305M12GTTTGGGCCGGGCCCATTANONE 
J080305M12TGTTGGGCTAGGCCCATTNONE 
J080306F13GTTTGGGCCGGGCCCATTANONE 
J080306F13TGTTGGGCTAGGCCCATTNONE 
J080312A06GTTTGGGCCGGGCCCATTANONE 
J080312A06TGTTGGGCTAGGCCCATTNONE 
J090088P09GTTTGGGCCGGGCCCATTANONE 
J090088P09TGTTGGGCTAGGCCCATTNONE 
Os03g0249200009-103-B08TAGGCCCATTANONE 
AK069944TAGGCCCATTAClass I peptide chain release factor domain containing protein. 
J065166E13TAGGCCCATTANONE 
Os03g0253100AK119618TTCGGCCCATTTPhosphomevalonate kinase Erg8 family protein. 
J033052A14TTCGGCCCATTTNONE 
Os03g0265400006-022-A01TAATGGGCCGTTTNONE 
006-033-E05TAATGGGCCGTTTNONE 
006-035-A03TAATGGGCCGTTTNONE 
006-057-D09TAATGGGCCGTTTNONE 
006-058-D03TAATGGGCCGTTTNONE 
006-061-B04TAATGGGCCGTTTNONE 
006-076-C01TAATGGGCCGTTTNONE 
006-089-C09TAATGGGCCGTTTNONE 
006-092-D01TAATGGGCCGTTTNONE 
006-100-D06TAATGGGCCGTTTNONE 
009-014-G04TAATGGGCCGTTTNONE 
009-060-C06TAATGGGCCGTTTNONE 
009-098-A06TAATGGGCCGTTTNONE 
AK061468TAATGGGCCGTTTNONE 
AK104116TAATGGGCCGTTTNONE 
AK104424TAATGGGCCGTTTNONE 
AK120527TAATGGGCCGTTTSimilar to 50S ribosomal protein L4, chloroplast precursor (R-protein L4). 
J013127C20TAATGGGCCGTTTNONE 
J023031E11TAATGGGCCGTTTNONE 
J023150F18TAATGGGCCGTTTNONE 
J033037G14TAATGGGCCGTTTNONE 
J065073K02TAATGGGCCGTTTNONE 
J065085P13TAATGGGCCGTTTNONE 
J065161B21TAATGGGCCGTTTNONE 
J065197G23TAATGGGCCGTTTNONE 
Os03g0278900006-049-H12TGGATGGGCTAATGGGCCCAACTNONE 
006-082-A07TGGATGGGCTAATGGGCCCAACTNONE 
009-169-C04TGGATGGGCTAATGGGCCCAACTNONE 
AK066019TGGATGGGCTAATGGGCCCAACTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TGGATGGGCTAATGGGCCCAACTNONE 
AY224460TGGATGGGCTAATGGGCCCAACTNONE 
J065021K17TGGATGGGCTAATGGGCCCAACTNONE 
J065141H24TGGATGGGCTAATGGGCCCAACTNONE 
J065142J20TGGATGGGCTAATGGGCCCAACTNONE 
J065152J03TGGATGGGCTAATGGGCCCAACTNONE 
J065163A13TGGATGGGCTAATGGGCCCAACTNONE 
J065191I21TGGATGGGCTAATGGGCCCAACTNONE 
J065193K12TGGATGGGCTAATGGGCCCAACTNONE 
J075003D01TGGATGGGCTAATGGGCCCAACTNONE 
J075017D24TGGATGGGCTAATGGGCCCAACTNONE 
J075060F20TGGATGGGCTAATGGGCCCAACTNONE 
J075154C11TGGATGGGCTAATGGGCCCAACTNONE 
J075173F04TGGATGGGCTAATGGGCCCAACTNONE 
Os03g0282900006-088-H05TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
AK061166TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
AK102161TAATGGGCCTAGCCCATTTAGGCCCATTTConserved hypothetical protein. 
AK104514TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
Os03g0283300AK070169ATGGCCCAAGGGCCCATTTConserved hypothetical protein. 
Os03g0288400Os03g0288400GAGGCCCATTGGCCCAATAConserved hypothetical protein. 
Os03g0294200AK069285TTGGCCCATTSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0297100AK059192AAGGCCCATTTNONE 
AK122143AAGGCCCATTTNONE 
J023012D24AAGGCCCATTTNONE 
J023041A08AAGGCCCATTTNONE 
J033067H08AAGGCCCATTTNONE 
J033131K19AAGGCCCATTTNONE 
J033136J20AAGGCCCATTTNONE 
J053027D07AAGGCCCATTTNONE 
J065191B01AAGGCCCATTTNONE 
J075112A12AAGGCCCATTTNONE 
J075136D05AAGGCCCATTTNONE 
J090073P06AAGGCCCATTTNONE 
J100026B16AAGGCCCATTTNONE 
J100068P21AAGGCCCATTTNONE 
J100088C15AAGGCCCATTTNONE 
Os03g0300600003-125-G06AAATGGGCCTANONE 
006-048-C04AAATGGGCCTANONE 
009-044-A09AAATGGGCCTANONE 
AK059801AAATGGGCCTANONE 
AK066250AAATGGGCCTASimilar to Chaperone protein dnaJ. 
AK069897AAATGGGCCTANONE 
AK104186AAATGGGCCTANONE 
J065197D15AAATGGGCCTANONE 
J090031C11AAATGGGCCTANONE 
J100024C23AAATGGGCCTANONE 
J100030B16AAATGGGCCTANONE 
J100033K12AAATGGGCCTANONE 
J100043M19AAATGGGCCTANONE 
J100056N09AAATGGGCCTANONE 
J100058E12AAATGGGCCTANONE 
J100084J08AAATGGGCCTANONE 
Os03g0321800006-065-G02GTGGCCCATTTNONE 
AK061075GTGGCCCATTTNONE 
AK111447GTGGCCCATTTSimilar to WRKY transcription factor 55. 
J065122E07GTGGCCCATTTNONE 
J065187N05GTGGCCCATTTNONE 
J065214K09GTGGCCCATTTNONE 
J090050M01GTGGCCCATTTNONE 
Os03g0324800AK059868AATGGGCCCAAACNONE 
AK071431AATGGGCCCAAACHypothetical protein. 
Os03g0333000AK109811AAGGCCCAGGCCCATTTConserved hypothetical protein. 
J065152D04AAGGCCCAGGCCCATTTNONE 
J090011B05AAGGCCCAGGCCCATTTNONE 
Os03g0333100AK101050AAATGGGCCTGGGCCTTProtein of unknown function DUF663 domain containing protein. 
Os03g0343500009-042-G06CTCGGCCCATTANONE 
009-063-D01CTCGGCCCATTANONE 
009-156-H09CTCGGCCCATTANONE 
AB117995CTCGGCCCATTANONE 
AK058737CTCGGCCCATTANONE 
AK059599CTCGGCCCATTASimilar to 60S ribosomal protein L22-2. 
AK121502CTCGGCCCATTANONE 
J023082D10CTCGGCCCATTANONE 
J033022G11CTCGGCCCATTANONE 
J075048M16CTCGGCCCATTANONE 
J075049O20CTCGGCCCATTANONE 
J075082I02CTCGGCCCATTANONE 
J075105G01CTCGGCCCATTANONE 
J075131K05CTCGGCCCATTANONE 
J080002H01CTCGGCCCATTANONE 
J080003H01CTCGGCCCATTANONE 
J080005G08CTCGGCCCATTANONE 
J080011M13CTCGGCCCATTANONE 
J080020M02CTCGGCCCATTANONE 
J080026N24CTCGGCCCATTANONE 
J080028L09CTCGGCCCATTANONE 
J080032O14CTCGGCCCATTANONE 
J080033J12CTCGGCCCATTANONE 
J080035D05CTCGGCCCATTANONE 
J080039H01CTCGGCCCATTANONE 
J080044B07CTCGGCCCATTANONE 
J080044E23CTCGGCCCATTANONE 
J080049N11CTCGGCCCATTANONE 
J080050A21CTCGGCCCATTANONE 
J080055L24CTCGGCCCATTANONE 
J080059N20CTCGGCCCATTANONE 
J080061F04CTCGGCCCATTANONE 
J080078I16CTCGGCCCATTANONE 
J080079G24CTCGGCCCATTANONE 
J080080K13CTCGGCCCATTANONE 
J080083G20CTCGGCCCATTANONE 
J080087B08CTCGGCCCATTANONE 
J080091L19CTCGGCCCATTANONE 
J080094D06CTCGGCCCATTANONE 
J090038L06CTCGGCCCATTANONE 
J090075H06CTCGGCCCATTANONE 
J090081D12CTCGGCCCATTANONE 
Os03g0381000AK069332AATGGGCCAASimilar to Aldose 1-epimerase-like protein. 
J023010L17AATGGGCCAANONE 
Os03g0383100AK107106AGCCCAATGGGCCAGAConserved hypothetical protein. 
Os03g0390400009-175-E06TCCGGGCCCATTTNONE 
013-040-G01TCCGGGCCCATTTNONE 
014-050-G05TCCGGGCCCATTTNONE 
AB025187TCCGGGCCCATTTSimilar to Cytochrome c oxidase subunit 6b. 
AK120174TCCGGGCCCATTTNONE 
J013033A17TCCGGGCCCATTTNONE 
J023028J08TCCGGGCCCATTTNONE 
J023061N05TCCGGGCCCATTTNONE 
J023077A03TCCGGGCCCATTTNONE 
J023086E01TCCGGGCCCATTTNONE 
J033022A08TCCGGGCCCATTTNONE 
J033040F24TCCGGGCCCATTTNONE 
J075073I24TCCGGGCCCATTTNONE 
J075081H01TCCGGGCCCATTTNONE 
J075175N19TCCGGGCCCATTTNONE 
J100025M03TCCGGGCCCATTTNONE 
J100036J06TCCGGGCCCATTTNONE 
J100045O18TCCGGGCCCATTTNONE 
J100062G15TCCGGGCCCATTTNONE 
J100090N19TCCGGGCCCATTTNONE 
Os03g0569900009-027-A11CAAGGCCCATTANONE 
AK063783CAAGGCCCATTANONE 
Os03g0574600009-151-F06AAGGCCCATTTNONE 
AK063006AAGGCCCATTTConserved hypothetical protein. 
AK104941AAGGCCCATTTNONE 
J065063L24AAGGCCCATTTNONE 
Os03g0578200003-117-B07ACATGGGCCCAATGGGCCCATGANONE 
009-175-C06ACATGGGCCCAATGGGCCCATGANONE 
009-179-H05ACATGGGCCCAATGGGCCCATGANONE 
013-078-G11ACATGGGCCCAATGGGCCCATGANONE 
AK062224ACATGGGCCCAATGGGCCCATGANONE 
AK120432ACATGGGCCCAATGGGCCCATGAConserved hypothetical protein. 
J013096L16ACATGGGCCCAATGGGCCCATGANONE 
J100042G12ACATGGGCCCAATGGGCCCATGANONE 
J100069F04ACATGGGCCCAATGGGCCCATGANONE 
J100073H14ACATGGGCCCAATGGGCCCATGANONE 
Os03g0586800003-114-H11CCAGGCCCATTTNONE 
AK063765CCAGGCCCATTTSimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302CCAGGCCCATTTNONE 
J090004H06CCAGGCCCATTTNONE 
J090022N15CCAGGCCCATTTNONE 
J100035E05CCAGGCCCATTTNONE 
J100041L05CCAGGCCCATTTNONE 
J100041M18CCAGGCCCATTTNONE 
J100057P04CCAGGCCCATTTNONE 
J100089H06CCAGGCCCATTTNONE 
J100090C23CCAGGCCCATTTNONE 
Os03g0598200AK068322TAGGCCCATTANop14-like protein family protein. 
Os03g0604600J090093K23AGGGCCCATTTConserved hypothetical protein. 
Os03g0639700AK099587GAGGCCCATTTSimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
Os03g0656900AK066416TACGGCCCATTTNusB/RsmB/TIM44 domain containing protein. 
J065157L23TACGGCCCATTTNONE 
J065166P22TACGGCCCATTTNONE 
Os03g0668900AK108369AATGGGCCGAAConserved hypothetical protein. 
Os03g0669000AK067769GCTGGGCCCATTTSimilar to RNA helicase (Fragment). 
AK099820GCTGGGCCCATTTNONE 
Os03g0681900006-042-F08ATGGCCCATTANONE 
009-043-F12ATGGCCCATTANONE 
AK061750ATGGCCCATTANONE 
AK062094ATGGCCCATTASimilar to RGP-3 (Fragment). 
J033034F01ATGGCCCATTANONE 
J033131F11ATGGCCCATTANONE 
J033143N03ATGGCCCATTANONE 
Os03g0701900AK068404CCCGGCCCATTConserved hypothetical protein. 
Os03g0726900AK072553GACGGCCCATTConserved hypothetical protein. 
AK100280GACGGCCCATTNONE 
Os03g0735300AK071715CAGGCCCATTAlba, DNA/RNA-binding protein family protein. 
J065100I07CAGGCCCATTNONE 
Os03g0744700AK071178TCCGGCCCATTTConserved hypothetical protein. 
J075006D24TCCGGCCCATTTNONE 
J075165F21TCCGGCCCATTTNONE 
Os03g0746000AK073682GTGGCCCATTGGGCTGAConserved hypothetical protein. 
AK111472GTGGCCCATTGGGCTGANONE 
J090083F05GTGGCCCATTGGGCTGANONE 
Os03g0746600AK069559TAATGGGCCACWD40-like domain containing protein. 
J023141K22TAATGGGCCACNONE 
Os03g0749900006-112-A05CTCGGCCCACCTAGGCCCATTTNONE 
AK061252CTCGGCCCACCTAGGCCCATTTConserved hypothetical protein. 
J023020I01CTCGGCCCACCTAGGCCCATTTNONE 
J033060N21CTCGGCCCACCTAGGCCCATTTNONE 
Os03g0754800AK101584TAATGGGCCTAMitochondrial substrate carrier family protein. 
J080305A09TAATGGGCCTANONE 
J080310E24TAATGGGCCTANONE 
J080310O12TAATGGGCCTANONE 
J080311N04TAATGGGCCTANONE 
J080313N20TAATGGGCCTANONE 
J080317H24TAATGGGCCTANONE 
Os03g0755000AK068540GAGGCCCATTTGGGCCCAACCSimilar to Serine/threonine kinase (Fragment). 
Os03g0758800AJ252135CGGGCCGAGCCGAATGGGCCGGCNONE 
AJ312906CGGGCCGAGCCGAATGGGCCGGCNONE 
AK060387CGGGCCGAGCCGAATGGGCCGGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592CGGGCCGAGCCGAATGGGCCGGCNONE 
J023109G09CGGGCCGAGCCGAATGGGCCGGCNONE 
J033038B14CGGGCCGAGCCGAATGGGCCGGCNONE 
J043013C09CGGGCCGAGCCGAATGGGCCGGCNONE 
J053096E21CGGGCCGAGCCGAATGGGCCGGCNONE 
J065026B08CGGGCCGAGCCGAATGGGCCGGCNONE 
J065062B16CGGGCCGAGCCGAATGGGCCGGCNONE 
J065066E03CGGGCCGAGCCGAATGGGCCGGCNONE 
J065091J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J065164A06CGGGCCGAGCCGAATGGGCCGGCNONE 
J075014I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J075117N07CGGGCCGAGCCGAATGGGCCGGCNONE 
J075142M03CGGGCCGAGCCGAATGGGCCGGCNONE 
J075175D04CGGGCCGAGCCGAATGGGCCGGCNONE 
J075188M01CGGGCCGAGCCGAATGGGCCGGCNONE 
J075199I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J090010J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J090025O16CGGGCCGAGCCGAATGGGCCGGCNONE 
J090041H05CGGGCCGAGCCGAATGGGCCGGCNONE 
J090078P07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100031K10CGGGCCGAGCCGAATGGGCCGGCNONE 
J100055F23CGGGCCGAGCCGAATGGGCCGGCNONE 
J100064G05CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080C24CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080O07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100090F01CGGGCCGAGCCGAATGGGCCGGCNONE 
Os03g0761200011-038-H02AAATGGGCCGGAAAATGGGCCNONE 
015-055-D12AAATGGGCCGGAAAATGGGCCNONE 
016-032-B01AAATGGGCCGGAAAATGGGCCNONE 
AK064205AAATGGGCCGGAAAATGGGCCNONE 
AK101534AAATGGGCCGGAAAATGGGCCAnkyrin repeat containing protein. 
J075033L23AAATGGGCCGGAAAATGGGCCNONE 
J075046K09AAATGGGCCGGAAAATGGGCCNONE 
J075134K18AAATGGGCCGGAAAATGGGCCNONE 
J075157I10AAATGGGCCGGAAAATGGGCCNONE 
Os03g0766900AK066137TAATGGGCCAGAllene oxide synthase. 
AK066137TCCGGCCCATTTAllene oxide synthase. 
AK071361TAATGGGCCAGNONE 
AK071361TCCGGCCCATTTNONE 
AK103989TAATGGGCCAGNONE 
AK103989TCCGGCCCATTTNONE 
J023090K09TAATGGGCCAGNONE 
J023090K09TCCGGCCCATTTNONE 
J043022H11TAATGGGCCAGNONE 
J043022H11TCCGGCCCATTTNONE 
J053078F12TAATGGGCCAGNONE 
J053078F12TCCGGCCCATTTNONE 
Os03g0784400AK103474AAATGGGCCCAATTProtein of unknown function DUF1692 domain containing protein. 
AK103474CAAGCCCAATGGGCCGAGAProtein of unknown function DUF1692 domain containing protein. 
J023135I15AAATGGGCCCAATTNONE 
J023135I15CAAGCCCAATGGGCCGAGANONE 
J033130D12AAATGGGCCCAATTNONE 
J033130D12CAAGCCCAATGGGCCGAGANONE 
J043035E20AAATGGGCCCAATTNONE 
J043035E20CAAGCCCAATGGGCCGAGANONE 
J065206K15AAATGGGCCCAATTNONE 
J065206K15CAAGCCCAATGGGCCGAGANONE 
J075053J20AAATGGGCCCAATTNONE 
J075053J20CAAGCCCAATGGGCCGAGANONE 
J075129B11AAATGGGCCCAATTNONE 
J075129B11CAAGCCCAATGGGCCGAGANONE 
J090003E22AAATGGGCCCAATTNONE 
J090003E22CAAGCCCAATGGGCCGAGANONE 
J100023E23AAATGGGCCCAATTNONE 
J100023E23CAAGCCCAATGGGCCGAGANONE 
Os03g0788200AK106623TAGGCCCATTAE1 protein and Def2/Der2 allergen family protein. 
J065112K18TAGGCCCATTANONE 
J065123A19TAGGCCCATTANONE 
J065131C15TAGGCCCATTANONE 
J065174D05TAGGCCCATTANONE 
J075011P16TAGGCCCATTANONE 
J075017N24TAGGCCCATTANONE 
J075028P19TAGGCCCATTANONE 
J075052I01TAGGCCCATTANONE 
J075057H20TAGGCCCATTANONE 
J075080F06TAGGCCCATTANONE 
J075091A10TAGGCCCATTANONE 
J075140L23TAGGCCCATTANONE 
J075156J08TAGGCCCATTANONE 
J075182D16TAGGCCCATTANONE 
J075191O21TAGGCCCATTANONE 
J090079E21TAGGCCCATTANONE 
Os03g0795900012-092-G05CCAGGCCCATTANONE 
015-043-D09CCAGGCCCATTANONE 
016-078-G11CCAGGCCCATTANONE 
AK068660CCAGGCCCATTASimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14CCAGGCCCATTANONE 
J023001L04CCAGGCCCATTANONE 
J053032K11CCAGGCCCATTANONE 
J065059E10CCAGGCCCATTANONE 
J065095H19CCAGGCCCATTANONE 
J065181M06CCAGGCCCATTANONE 
J100047D11CCAGGCCCATTANONE 
J100068G04CCAGGCCCATTANONE 
Os03g0798600AK121716AAATGGGCCAGSimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18AAATGGGCCAGNONE 
J033079G18AAATGGGCCAGNONE 
J043038B19AAATGGGCCAGNONE 
J065091E15AAATGGGCCAGNONE 
J065092P10AAATGGGCCAGNONE 
J065189F18AAATGGGCCAGNONE 
J065189L12AAATGGGCCAGNONE 
J075021B11AAATGGGCCAGNONE 
J075022L15AAATGGGCCAGNONE 
J075046G12AAATGGGCCAGNONE 
J075080H15AAATGGGCCAGNONE 
J090045H01AAATGGGCCAGNONE 
J090077H16AAATGGGCCAGNONE 
J090083D22AAATGGGCCAGNONE 
J100021D24AAATGGGCCAGNONE 
J100023G04AAATGGGCCAGNONE 
J100049J23AAATGGGCCAGNONE 
J100075K23AAATGGGCCAGNONE 
J100077G22AAATGGGCCAGNONE 
Os03g0801800AK067130ATGGCCCATTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J090079D17ATGGCCCATTNONE 
J090087F23ATGGCCCATTNONE 
Os03g0809700J023093B03AAATGGGCCAANONE 
Os03g0819900006-058-B05TAATGGGCCTGAATGGGCCGGGCCNONE 
AK111912TAATGGGCCTGAATGGGCCGGGCCNONE 
AK112029TAATGGGCCTGAATGGGCCGGGCCSimilar to RAB8C. 
AY576526TAATGGGCCTGAATGGGCCGGGCCNONE 
AY579410TAATGGGCCTGAATGGGCCGGGCCNONE 
J075041G24TAATGGGCCTGAATGGGCCGGGCCNONE 
J100070N08TAATGGGCCTGAATGGGCCGGGCCNONE 
Os03g0824500AK058990TCATGGGCCCATTTConserved hypothetical protein. 
J065057L18TCATGGGCCCATTTNONE 
J065083L02TCATGGGCCCATTTNONE 
J065086L24TCATGGGCCCATTTNONE 
J065121L10TCATGGGCCCATTTNONE 
J065168N03TCATGGGCCCATTTNONE 
J100035J22TCATGGGCCCATTTNONE 
J100050G18TCATGGGCCCATTTNONE 
J100055F15TCATGGGCCCATTTNONE 
Os03g0828100009-088-D04AAATGGGCCAANONE 
009-125-F01AAATGGGCCAANONE 
009-169-C06AAATGGGCCAANONE 
AK059132AAATGGGCCAANONE 
AK062799AAATGGGCCAANONE 
AK099043AAATGGGCCAASimilar to 50S ribosomal protein L18. 
J013146D01AAATGGGCCAANONE 
J065057J16AAATGGGCCAANONE 
Os03g0833900AK073655AAATGGGCCCTSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800AAATGGGCCCTNONE 
AK104068AAATGGGCCCTNONE 
J075031J11AAATGGGCCCTNONE 
J075051N01AAATGGGCCCTNONE 
J075166D18AAATGGGCCCTNONE 
J075171E14AAATGGGCCCTNONE 
Os03g0834000AB080084AATGGGCCAAFlap endonuclease-1b (EC 3.-.-.-) (OsFEN-1b). 
AB080084GAGGCCCATTTFlap endonuclease-1b (EC 3.-.-.-) (OsFEN-1b). 
AB088391AATGGGCCAANONE 
AB088391GAGGCCCATTTNONE 
AK062149AATGGGCCAANONE 
AK062149GAGGCCCATTTNONE 
AK069540AATGGGCCAANONE 
AK069540GAGGCCCATTTNONE 
J013047J01AATGGGCCAANONE 
J013047J01GAGGCCCATTTNONE 
J023019F12AATGGGCCAANONE 
J023019F12GAGGCCCATTTNONE 
J043004H21AATGGGCCAANONE 
J043004H21GAGGCCCATTTNONE 
Os03g0835400AK061773TCCGGCCCATTTSimilar to Uvs101. 
AK098986TCCGGCCCATTTNONE 
AK105896TCCGGCCCATTTNONE 
Os03g0837300AK111243TTCGGCCCATTTNONE 
AK121140TTCGGCCCATTTNicotinate phosphoribosyltransferase and related family protein. 
AY214337TTCGGCCCATTTNONE 
J023077G12TTCGGCCCATTTNONE 
J023078M10TTCGGCCCATTTNONE 
J033031B10TTCGGCCCATTTNONE 
J033067L18TTCGGCCCATTTNONE 
J043005P09TTCGGCCCATTTNONE 
J090013J15TTCGGCCCATTTNONE 
J090042E10TTCGGCCCATTTNONE 
J090045A20TTCGGCCCATTTNONE 
J100022H02TTCGGCCCATTTNONE 
Os03g0843400009-195-F11TAATGGGCCTCNONE 
AK061198TAATGGGCCTCSimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076TAATGGGCCTCNONE 
Os03g0844100AK067164TAATGGGCCCCACGTCTCSimilar to Pti1 kinase-like protein. 
Os03g0844600AK059168TTGGCCCATTTLipolytic enzyme, G-D-S-L family protein. 
Os03g0847500AK073859AAATGGGCCGTGGSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0850100AK101126ATTGGGCCTTAATGGGCCAANLI interacting factor domain containing protein. 
Os03g0851100AF303468GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
AK102069GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTSimilar to Translational elongation factor EF-TuM. 
J033082G06GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J043036M21GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065158H05GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065192A04GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
Os03g0851200009-035-B01AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-134-F10AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-154-H05AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
AK059425AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCSimilar to CAXIP1 protein. 
J065065D24AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046O19AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075048O04AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075181I09AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J080303G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090086F12AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090088E07AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
Os03g0851900AK102145TAGGCCCATTTAFG1-like ATPase family protein. 
J033086B08TAGGCCCATTTNONE 
Os03g0852600009-174-G04TTGGCCCATTANONE 
AK063101TTGGCCCATTAProtein of unknown function DUF565 family protein. 
J065131H12TTGGCCCATTANONE 
J090046K24TTGGCCCATTANONE 
Os03g0860600AK071828CCCGGCCCATTTSimilar to 2-oxoglutarate-dependent oxygenase. 
J023118E08CCCGGCCCATTTNONE 
J100032J11CCCGGCCCATTTNONE 
Os04g0105700004-005-E05AAATGGGCCTANONE 
004-005-E05AATGGGCCGGCNONE 
006-037-C11AAATGGGCCTANONE 
006-037-C11AATGGGCCGGCNONE 
006-039-E07AAATGGGCCTANONE 
006-039-E07AATGGGCCGGCNONE 
006-049-A02AAATGGGCCTANONE 
006-049-A02AATGGGCCGGCNONE 
006-076-D05AAATGGGCCTANONE 
006-076-D05AATGGGCCGGCNONE 
006-089-E04AAATGGGCCTANONE 
006-089-E04AATGGGCCGGCNONE 
006-097-F12AAATGGGCCTANONE 
006-097-F12AATGGGCCGGCNONE 
AK060872AAATGGGCCTANONE 
AK060872AATGGGCCGGCNONE 
AK065082AAATGGGCCTANONE 
AK065082AATGGGCCGGCNONE 
AK104254AAATGGGCCTAConserved hypothetical protein. 
AK104254AATGGGCCGGCConserved hypothetical protein. 
AK104546AAATGGGCCTANONE 
AK104546AATGGGCCGGCNONE 
AK104634AAATGGGCCTANONE 
AK104634AATGGGCCGGCNONE 
AY224557AAATGGGCCTANONE 
AY224557AATGGGCCGGCNONE 
J013001L09AAATGGGCCTANONE 
J013001L09AATGGGCCGGCNONE 
J013151B18AAATGGGCCTANONE 
J013151B18AATGGGCCGGCNONE 
J023054G18AAATGGGCCTANONE 
J023054G18AATGGGCCGGCNONE 
Os04g0128700AK107172TGCGGGCCCATTAThioredoxin-like fold domain containing protein. 
J065102M16TGCGGGCCCATTANONE 
J065124K01TGCGGGCCCATTANONE 
J065129I12TGCGGGCCCATTANONE 
J065192C08TGCGGGCCCATTANONE 
Os04g0194000AK102654TCAGGCCCATTCyclin-like F-box domain containing protein. 
J033101G08TCAGGCCCATTNONE 
J090084B18TCAGGCCCATTNONE 
Os04g0258900009-146-B02CCCGGCCCATTTNONE 
AK062983CCCGGCCCATTTCyclin-like F-box domain containing protein. 
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein. 
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
Os04g0370600AK103855AATGGGCCAGGAGGCCCAGG4Fe-4S ferredoxin, iron-sulfur binding domain containing protein. 
J023115N20AATGGGCCAGGAGGCCCAGGNONE 
J033148N10AATGGGCCAGGAGGCCCAGGNONE 
J090031L24AATGGGCCAGGAGGCCCAGGNONE 
J090089F12AATGGGCCAGGAGGCCCAGGNONE 
Os04g0418000006-025-C05AAACGGCCCATTTNONE 
006-025-D11AAACGGCCCATTTNONE 
006-045-F02AAACGGCCCATTTNONE 
006-060-B04AAACGGCCCATTTNONE 
006-063-E03AAACGGCCCATTTNONE 
006-070-G08AAACGGCCCATTTNONE 
006-072-H05AAACGGCCCATTTNONE 
AK061030AAACGGCCCATTTNONE 
AK099124AAACGGCCCATTTNONE 
AK106155AAACGGCCCATTTConserved hypothetical protein. 
AK119714AAACGGCCCATTTNONE 
J023039I07AAACGGCCCATTTNONE 
J065025N03AAACGGCCCATTTNONE 
Os04g0430100009-125-A01AAGGCCCATTANONE 
AK102190AAGGCCCATTASimilar to 40S ribosomal protein S10-1. 
J033087A06AAGGCCCATTANONE 
J053032M06AAGGCCCATTANONE 
J065033D05AAGGCCCATTANONE 
J065045D15AAGGCCCATTANONE 
J065045K10AAGGCCCATTANONE 
J065049N05AAGGCCCATTANONE 
J065064N09AAGGCCCATTANONE 
J065068F17AAGGCCCATTANONE 
J065088F17AAGGCCCATTANONE 
J065104N22AAGGCCCATTANONE 
J065117B19AAGGCCCATTANONE 
J065119O12AAGGCCCATTANONE 
J065134G24AAGGCCCATTANONE 
J065150G16AAGGCCCATTANONE 
J065176C03AAGGCCCATTANONE 
J065212M23AAGGCCCATTANONE 
J075009P18AAGGCCCATTANONE 
J075019G06AAGGCCCATTANONE 
J075037H14AAGGCCCATTANONE 
J075057C13AAGGCCCATTANONE 
J075100E14AAGGCCCATTANONE 
J075120I16AAGGCCCATTANONE 
J075130F07AAGGCCCATTANONE 
J075156M16AAGGCCCATTANONE 
J100043J03AAGGCCCATTANONE 
Os04g0462900006-094-A02AATGGGCCACCACCTGTCNONE 
006-097-F05AATGGGCCACCACCTGTCNONE 
009-129-A10AATGGGCCACCACCTGTCNONE 
015-042-F07AATGGGCCACCACCTGTCNONE 
AK058481AATGGGCCACCACCTGTCNONE 
AK059483AATGGGCCACCACCTGTCNONE 
AK061324AATGGGCCACCACCTGTCNONE 
AK099100AATGGGCCACCACCTGTCNONE 
AK102579AATGGGCCACCACCTGTCNONE 
AK106322AATGGGCCACCACCTGTCSimilar to Prohibitin. 
J065059J20AATGGGCCACCACCTGTCNONE 
J065085I02AATGGGCCACCACCTGTCNONE 
J065118N23AATGGGCCACCACCTGTCNONE 
J065208K24AATGGGCCACCACCTGTCNONE 
J075053B14AATGGGCCACCACCTGTCNONE 
J075097M22AATGGGCCACCACCTGTCNONE 
J075184B07AATGGGCCACCACCTGTCNONE 
J075194A15AATGGGCCACCACCTGTCNONE 
J080315G03AATGGGCCACCACCTGTCNONE 
J090088H19AATGGGCCACCACCTGTCNONE 
Os04g0473400AK067896AAATGGGCCAASimilar to 60S ribosomal protein L6-B (L17) (YL16) (RP18). 
J013123D20AAATGGGCCAANONE 
J033108A09AAATGGGCCAANONE 
J065196E24AAATGGGCCAANONE 
J100066B16AAATGGGCCAANONE 
Os04g0504600J065162K24TAATGGGCCGCNONE 
Os04g0530000009-106-E11TCGGCCCATTTNONE 
011-012-E12TCGGCCCATTTNONE 
AK066169TCGGCCCATTTConserved hypothetical protein. 
J013052P20TCGGCCCATTTNONE 
J090060G12TCGGCCCATTTNONE 
J100073H10TCGGCCCATTTNONE 
Os04g0542900AK068610TCGGCCCATTAConserved hypothetical protein. 
Os04g0555900009-154-G03GAGGCCCATTANONE 
AK063168GAGGCCCATTAPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
J065012D11GAGGCCCATTANONE 
Os04g0562000006-096-A05AAATGGGCCGGANONE 
006-105-B08AAATGGGCCGGANONE 
AK060894AAATGGGCCGGANONE 
AK072630AAATGGGCCGGAZinc finger, DHHC-type domain containing protein. 
AK104521AAATGGGCCGGANONE 
J023038A11AAATGGGCCGGANONE 
J023130P03AAATGGGCCGGANONE 
J090006F10AAATGGGCCGGANONE 
J090007M22AAATGGGCCGGANONE 
Os04g0585600006-117-A02GAGGCCCATTNONE 
AK106073GAGGCCCATTConserved hypothetical protein. 
J053089I23GAGGCCCATTNONE 
J065112K06GAGGCCCATTNONE 
J065128D09GAGGCCCATTNONE 
J100038D09GAGGCCCATTNONE 
Os04g0592500AK066893TAATGGGCCAAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18TAATGGGCCAANONE 
Os04g0597900J065038C09GAGGCCCATTANONE 
J065059G21GAGGCCCATTANONE 
J065079G06GAGGCCCATTAConserved hypothetical protein. 
Os04g0610500006-115-C07AATGGGCCACNONE 
AK066289AATGGGCCACPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817AATGGGCCACNONE 
J013096N09AATGGGCCACNONE 
J023054I11AATGGGCCACNONE 
J023121P20AATGGGCCACNONE 
J053039O20AATGGGCCACNONE 
J053071L20AATGGGCCACNONE 
J053088H23AATGGGCCACNONE 
J053096J03AATGGGCCACNONE 
Os04g0612600AB042115AAGGCCCAAACAATGGGCCCACCTNONE 
AK060707AAGGCCCAAACAATGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK099008AAGGCCCAAACAATGGGCCCACCTNONE 
AK104427AAGGCCCAAACAATGGGCCCACCTNONE 
J023043H02AAGGCCCAAACAATGGGCCCACCTNONE 
J033033I23AAGGCCCAAACAATGGGCCCACCTNONE 
J033067P21AAGGCCCAAACAATGGGCCCACCTNONE 
J033088M21AAGGCCCAAACAATGGGCCCACCTNONE 
J033133M08AAGGCCCAAACAATGGGCCCACCTNONE 
J043030I16AAGGCCCAAACAATGGGCCCACCTNONE 
J075049H08AAGGCCCAAACAATGGGCCCACCTNONE 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
Os04g0623600AK068129AAATGGGCCCCAGGCCCACTGTCAGTSimilar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC 1.1.3.15) (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase). 
J013126M17AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J013131A08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J023133N08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
Os04g0635800006-033-E07AATGGGCCGGCCCATCAAGGCCCATTANONE 
011-067-A08AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK060110AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK099507AATGGGCCGGCCCATCAAGGCCCATTAGCN5-related N-acetyltransferase domain containing protein. 
AK104741AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK120021AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013029B17AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013134M07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013149N18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013153L10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J033131F08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J043010E02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075030K04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075178K05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080001B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080003N19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005F20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005G16AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080007N02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080009J04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080017D04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080020M22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021A15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021F21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080023P05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080024P22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080027C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080029K03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080035M18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039F22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039J03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039L03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039P14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080042E12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047D19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047M21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080049N03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080056J12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080060B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080062K08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080064L07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080069C15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080074H06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080086O14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090L14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080095G08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080097C07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090011F03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090082O17AATGGGCCGGCCCATCAAGGCCCATTANONE 
Os04g0636400006-064-G07AAATGGGCCGTGGNONE 
006-064-G07GAGGCCCATTANONE 
006-097-D05AAATGGGCCGTGGNONE 
006-097-D05GAGGCCCATTANONE 
AK061848AAATGGGCCGTGGSimilar to Senescence-associated protein 6. 
AK061848GAGGCCCATTASimilar to Senescence-associated protein 6. 
AK099573AAATGGGCCGTGGNONE 
AK099573GAGGCCCATTANONE 
J013035J20AAATGGGCCGTGGNONE 
J013035J20GAGGCCCATTANONE 
Os04g0658300AK067399ATTTGGGCCCATTASimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
AK067399TAATGGGCCGGTSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0659000009-172-A09ATGGCCCATTTNONE 
AK063095ATGGCCCATTTConserved hypothetical protein. 
J065062J07ATGGCCCATTTNONE 
Os04g0670400012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0674100J080097J12TAATGGGCCGAGThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965CTCGGCCCATTANONE 
AK103795CTCGGCCCATTACoenzyme Q biosynthesis Coq4 family protein. 
J033076F14CTCGGCCCATTANONE 
J065020P20CTCGGCCCATTANONE 
J065057I21CTCGGCCCATTANONE 
J065059P11CTCGGCCCATTANONE 
J065083A22CTCGGCCCATTANONE 
J065093K10CTCGGCCCATTANONE 
J065097D03CTCGGCCCATTANONE 
J065103P05CTCGGCCCATTANONE 
J065113K09CTCGGCCCATTANONE 
J065118F23CTCGGCCCATTANONE 
J065119M06CTCGGCCCATTANONE 
J065146K17CTCGGCCCATTANONE 
J065161N12CTCGGCCCATTANONE 
J065169L02CTCGGCCCATTANONE 
J065189H12CTCGGCCCATTANONE 
J065192E24CTCGGCCCATTANONE 
J065193K17CTCGGCCCATTANONE 
J065197O21CTCGGCCCATTANONE 
J065214D09CTCGGCCCATTANONE 
J065217B11CTCGGCCCATTANONE 
J075132K07CTCGGCCCATTANONE 
J100059D14CTCGGCCCATTANONE 
Os04g0678800AK072212AAATGGGCCGAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK072212CTGGCCCATTAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065AAATGGGCCGANONE 
AK099065CTGGCCCATTANONE 
Os04g0681500AK105582AAATGGGCCAGGCCCAACEF-Hand type domain containing protein. 
Os04g0682800AK121846GCCGGCCCATTSodium/hydrogen exchanger family protein. 
Os04g0692500AK101528GCGGCCCATTNONE 
Os05g0122900009-052-C11TAATGGGCCGCNONE 
009-132-C12TAATGGGCCGCNONE 
014-091-G03TAATGGGCCGCNONE 
AB072977TAATGGGCCGCNONE 
AK071296TAATGGGCCGCNONE 
AK099375TAATGGGCCGCNONE 
AK104970TAATGGGCCGCBLE1 protein. 
J065007I09TAATGGGCCGCNONE 
J065081H07TAATGGGCCGCNONE 
J065122B18TAATGGGCCGCNONE 
J065181G15TAATGGGCCGCNONE 
J065182J07TAATGGGCCGCNONE 
J065197D23TAATGGGCCGCNONE 
J065197G08TAATGGGCCGCNONE 
J065201H20TAATGGGCCGCNONE 
J090034E11TAATGGGCCGCNONE 
J100077M04TAATGGGCCGCNONE 
Os05g0152400Os05g0152400AAATGGGCCACGlycosyl transferase, family 14 protein. 
Os05g0168400006-039-A06TAATGGGCCAANONE 
AK069800TAATGGGCCAANONE 
AK106195TAATGGGCCAAConserved hypothetical protein. 
J065086N09TAATGGGCCAANONE 
J065137B10TAATGGGCCAANONE 
J075062B04TAATGGGCCAANONE 
J075193I07TAATGGGCCAANONE 
J075193K24TAATGGGCCAANONE 
J075194D10TAATGGGCCAANONE 
J100037F01TAATGGGCCAANONE 
J100071E09TAATGGGCCAANONE 
Os05g0169400AK073439AAATGGGCCGAAProtein of unknown function DUF1421 family protein. 
AK073439TAATGGGCCGAAACAGGTGGGACCCACTCTProtein of unknown function DUF1421 family protein. 
J013110E15AAATGGGCCGAANONE 
J013110E15TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
J033044H02AAATGGGCCGAANONE 
J033044H02TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
Os05g0182800AK121273TAATGGGCCAAGTGGCCCAATGlutamyl-tRNA synthetase, class Ic family protein. 
AK121273TAATGGGCCTAGlutamyl-tRNA synthetase, class Ic family protein. 
Os05g0223300AK069616ACCGGCCCATTTSimilar to RNA-binding protein. 
J080093O15ACCGGCCCATTTNONE 
J090061N02ACCGGCCCATTTNONE 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0255600AK073067CACGGCCCATTThioredoxin domain 2 containing protein. 
J033022A04CACGGCCCATTNONE 
J033022B03CACGGCCCATTNONE 
J033116F22CACGGCCCATTNONE 
J065017H13CACGGCCCATTNONE 
J065038G20CACGGCCCATTNONE 
J065076J16CACGGCCCATTNONE 
J065135D06CACGGCCCATTNONE 
J065168P22CACGGCCCATTNONE 
J065188G21CACGGCCCATTNONE 
J065207C14CACGGCCCATTNONE 
J080014C23CACGGCCCATTNONE 
J080018G12CACGGCCCATTNONE 
J080021F03CACGGCCCATTNONE 
J100068C14CACGGCCCATTNONE 
Os05g0295900AK069962TAGGCCCATTAGCCCAAACConserved hypothetical protein. 
Os05g0325200J090038J19GGGCTGGGCGGCCCATTTGGGCCyclin-like domain containing protein. 
Os05g0327000014-005-A12GAGGCCCATTANONE 
AK064059GAGGCCCATTACyclin-like domain containing protein. 
AK101588GAGGCCCATTANONE 
J033051A05GAGGCCCATTANONE 
J065106E02GAGGCCCATTANONE 
J065183D01GAGGCCCATTANONE 
Os05g0363600AK108572TAATGGGCCTConserved hypothetical protein. 
Os05g0367100AK108334TAATGGGCCTCConserved hypothetical protein. 
Os05g0378900AK103841TCGGCCCATTTConserved hypothetical protein. 
AK103841TTGGCCCATTConserved hypothetical protein. 
J033148I18TCGGCCCATTTNONE 
J033148I18TTGGCCCATTNONE 
J065085F12TCGGCCCATTTNONE 
J065085F12TTGGCCCATTNONE 
J075041H24TCGGCCCATTTNONE 
J075041H24TTGGCCCATTNONE 
J075180P06TCGGCCCATTTNONE 
J075180P06TTGGCCCATTNONE 
Os05g0383100AK121835CCATGGGCCGGCCCATTClathrin adaptor complex, medium chain family protein. 
Os05g0417200AK071955ATTTGGGCCACAATGGGCCTTGCGGGCCThioredoxin-like fold domain containing protein. 
AK071955TAATGGGCCACGATGGGCCTTThioredoxin-like fold domain containing protein. 
Os05g0435400AK109595TAGGCCCATTTConserved hypothetical protein. 
Os05g0443300Os05g0443300AAATGGGCCTGASec23/Sec24 trunk region domain containing protein. 
Os05g0445500009-021-C05TCTGGCCCATTNONE 
009-129-D11TCTGGCCCATTNONE 
009-147-E04TCTGGCCCATTNONE 
009-169-C11TCTGGCCCATTNONE 
AK121459TCTGGCCCATTSimilar to 60S acidic ribosomal protein P2B. 
D21114TCTGGCCCATTNONE 
J023001K23TCTGGCCCATTNONE 
J023107J19TCTGGCCCATTNONE 
J023143J09TCTGGCCCATTNONE 
J065049D04TCTGGCCCATTNONE 
J065092I06TCTGGCCCATTNONE 
J065188H04TCTGGCCCATTNONE 
Os05g0452600009-022-A05AAGGCCCATTANONE 
009-166-F05AAGGCCCATTANONE 
AK121541AAGGCCCATTASimilar to Ribosomal protein L33. 
J033031N19AAGGCCCATTANONE 
Os05g0459900AK058918AAGGCCCATTTAGCCCAGCCCSimilar to 60S ribosomal protein L36-1. 
AK111268AAGGCCCATTTAGCCCAGCCCNONE 
J013129N08AAGGCCCATTTAGCCCAGCCCNONE 
J065191E01AAGGCCCATTTAGCCCAGCCCNONE 
J065216P03AAGGCCCATTTAGCCCAGCCCNONE 
J075089K21AAGGCCCATTTAGCCCAGCCCNONE 
Os05g0481600009-067-H08TACGGCCCATTANONE 
009-085-H10TACGGCCCATTANONE 
009-147-F04TACGGCCCATTANONE 
AK063820TACGGCCCATTAConserved hypothetical protein. 
AK121540TACGGCCCATTANONE 
J023027H12TACGGCCCATTANONE 
J033031M01TACGGCCCATTANONE 
J053031M02TACGGCCCATTANONE 
Os05g0488900AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase. 
AK073699TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
AK105459TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080009C06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080021N09TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080041K24TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080058H15TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080064P06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080077B16TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
Os05g0520200006-031-F07TACGGCCCACTGGCCCATTANONE 
AK061451TACGGCCCACTGGCCCATTAThioredoxin-related domain containing protein. 
AK099433TACGGCCCACTGGCCCATTANONE 
Os05g0536900009-033-D11AATGGGCCCGTTNONE 
AK105140AATGGGCCCGTTSimilar to RAB7A. 
Os05g0543800AK072185AATGGGCCTAConserved hypothetical protein. 
Os05g0553700006-100-D08TCGGCCCATTNONE 
AK099747TCGGCCCATTNONE 
AK101606TCGGCCCATTNONE 
AK103396TCGGCCCATTSimilar to Syntaxin 71 (AtSYP71). 
J033022M23TCGGCCCATTNONE 
J090086G01TCGGCCCATTNONE 
Os05g0554100AK073023AAATGGGCCCTRibosomal protein L7/L12 family protein. 
AK101756AAATGGGCCCTNONE 
Os05g0558000015-029-G05TAATGGGCCTGACTGGGCCTGANONE 
AK073857TAATGGGCCTGACTGGGCCTGARibosomal protein L1 family protein. 
J033074P11TAATGGGCCTGACTGGGCCTGANONE 
J090060I16TAATGGGCCTGACTGGGCCTGANONE 
Os05g0558900AK101679TTTCGGCCCATTSimilar to Frsb-prov protein. 
J013028M08TTTCGGCCCATTNONE 
J013074E16TTTCGGCCCATTNONE 
J013096L01TTTCGGCCCATTNONE 
J023085M19TTTCGGCCCATTNONE 
J033058I10TTTCGGCCCATTNONE 
J033091D18TTTCGGCCCATTNONE 
J033111H13TTTCGGCCCATTNONE 
J033114C18TTTCGGCCCATTNONE 
Os05g0559900AK067197AAATGGGCCTAtRNA-binding arm domain containing protein. 
J013074C15AAATGGGCCTANONE 
J013098O16AAATGGGCCTANONE 
J033030M01AAATGGGCCTANONE 
J090058H12AAATGGGCCTANONE 
J090075M06AAATGGGCCTANONE 
Os05g0565000AK102673GAAGCCCACGGCCCATTASimilar to 60S ribosomal protein L18a-1. 
J033102C12GAAGCCCACGGCCCATTANONE 
J033124C13GAAGCCCACGGCCCATTANONE 
J043003L04GAAGCCCACGGCCCATTANONE 
J043006N08GAAGCCCACGGCCCATTANONE 
Os05g0567500AK073046AAATGGGCCTCNONE 
AK121133AAATGGGCCTCDNA glycosylase family protein. 
J023075P20AAATGGGCCTCNONE 
Os05g0574500006-021-A08ATCTCGGCCCATTAGGCCCATATNONE 
006-049-A11ATCTCGGCCCATTAGGCCCATATNONE 
006-086-F03ATCTCGGCCCATTAGGCCCATATNONE 
009-051-F06ATCTCGGCCCATTAGGCCCATATNONE 
AB015287ATCTCGGCCCATTAGGCCCATATNONE 
AB015972ATCTCGGCCCATTAGGCCCATATNONE 
AK061714ATCTCGGCCCATTAGGCCCATATNONE 
AK098889ATCTCGGCCCATTAGGCCCATATNONE 
AK121699ATCTCGGCCCATTAGGCCCATATSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCTCGGCCCATTAGGCCCATATNONE 
J013072D17ATCTCGGCCCATTAGGCCCATATNONE 
J023028M04ATCTCGGCCCATTAGGCCCATATNONE 
J023031F01ATCTCGGCCCATTAGGCCCATATNONE 
J023114L22ATCTCGGCCCATTAGGCCCATATNONE 
J033058L12ATCTCGGCCCATTAGGCCCATATNONE 
J033073D17ATCTCGGCCCATTAGGCCCATATNONE 
J043031D08ATCTCGGCCCATTAGGCCCATATNONE 
J043036G01ATCTCGGCCCATTAGGCCCATATNONE 
J065144O04ATCTCGGCCCATTAGGCCCATATNONE 
J065181O08ATCTCGGCCCATTAGGCCCATATNONE 
J080066B20ATCTCGGCCCATTAGGCCCATATNONE 
Os05g0577900016-028-C02TGTGGGCCCATTTNONE 
AK064201TGTGGGCCCATTTConserved hypothetical protein. 
Os05g0588200AK109323TTGGCCCATTTRuvA domain 2-like containing protein. 
Os05g0593100AK061855TTCGGCCCATTANONE 
AK100119TTCGGCCCATTASimilar to Vacuolar ATP synthase subunit C (EC 3.6.3.14) (V-ATPase C subunit) (Vacuolar proton pump C subunit). 
AY224442TTCGGCCCATTANONE 
Os05g0596600AK107823TCAGGCCCATTANONE 
AK121149TCAGGCCCATTASimilar to SMC5 protein. 
Os06g0106100009-197-E09CTGGGCTGGCCCATTTNONE 
AK111784CTGGGCTGGCCCATTTCwf15/Cwc15 cell cycle control protein family protein. 
AK112060CTGGGCTGGCCCATTTNONE 
Os06g0116800AK058985AATGGGCCTASimilar to GFA2. 
AK058985AATGGGCCTTGSimilar to GFA2. 
AK120746AATGGGCCTANONE 
AK120746AATGGGCCTTGNONE 
Os06g0132600006-104-C03TAGGCCCATTTNONE 
AK061226TAGGCCCATTTConserved hypothetical protein. 
AK074010TAGGCCCATTTNONE 
J033076A22TAGGCCCATTTNONE 
Os06g0136000AK060303AATGGGCCTCSimilar to Hypersensitive-induced reaction protein 4. 
AK102678AATGGGCCTCNONE 
J075185K19AATGGGCCTCNONE 
J090028C16AATGGGCCTCNONE 
J090099N12AATGGGCCTCNONE 
J100070O10AATGGGCCTCNONE 
Os06g0139700006-052-C07CCATGGGCCAAGGCCCATTNONE 
009-009-A08CCATGGGCCAAGGCCCATTNONE 
015-020-D09CCATGGGCCAAGGCCCATTNONE 
015-087-H06CCATGGGCCAAGGCCCATTNONE 
016-078-A03CCATGGGCCAAGGCCCATTNONE 
AK067884CCATGGGCCAAGGCCCATTNONE 
AK103245CCATGGGCCAAGGCCCATTConserved hypothetical protein. 
AK106116CCATGGGCCAAGGCCCATTNONE 
AK106220CCATGGGCCAAGGCCCATTNONE 
Os06g0156900AK110688TAGGCCCATTTGlycosyl transferase, family 31 protein. 
Os06g0172000AK068738AAATGGGCCCTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os06g0225200005-009-B07AAATGGGCCGTTNONE 
AK067095AAATGGGCCGTTMitochodrial transcription termination factor-related family protein. 
AK104692AAATGGGCCGTTNONE 
J013096A05AAATGGGCCGTTNONE 
J090092C03AAATGGGCCGTTNONE 
Os06g0257200J053059P05GCGGCCCAAATAAATGGGCCCCNONE 
J075006K03GCGGCCCAAATAAATGGGCCCCNONE 
J075067F07GCGGCCCAAATAAATGGGCCCCNONE 
J075068F14GCGGCCCAAATAAATGGGCCCCNONE 
J075068H14GCGGCCCAAATAAATGGGCCCCNONE 
J075098N06GCGGCCCAAATAAATGGGCCCCNONE 
J075099F08GCGGCCCAAATAAATGGGCCCCNONE 
J075154G24GCGGCCCAAATAAATGGGCCCCNONE 
J075195H09GCGGCCCAAATAAATGGGCCCCNONE 
Os06g0268700AK120783GGGGCCCATTPeptidase A1, pepsin family protein. 
Os06g0275500AK111743AATGGGCCGGGSimilar to Polycomb protein EZ1 (Enhancer of zeste protein 1). 
Os06g0325500011-037-D06TAATGGGCCAGNONE 
011-093-G07TAATGGGCCAGNONE 
AK063974TAATGGGCCAGProtein of unknown function DUF89 family protein. 
AK099286TAATGGGCCAGNONE 
J065124G18TAATGGGCCAGNONE 
J065160K08TAATGGGCCAGNONE 
J065207O08TAATGGGCCAGNONE 
J075011D18TAATGGGCCAGNONE 
J075012D02TAATGGGCCAGNONE 
J075090F13TAATGGGCCAGNONE 
J075164A04TAATGGGCCAGNONE 
J075198I19TAATGGGCCAGNONE 
Os06g0555500016-056-B08AAATGGGCCGTANONE 
AK102375AAATGGGCCGTANONE 
AK106546AAATGGGCCGTAInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08AAATGGGCCGTANONE 
J033091P04AAATGGGCCGTANONE 
J090082P16AAATGGGCCGTANONE 
Os06g0561200AK120422AAATGGGCCCTSimilar to Potassium/proton antiporter-like protein. 
Os06g0601000AK071330AAATGGGCCCAGAHomeodomain-like containing protein. 
AY224485AAATGGGCCCAGANONE 
Os06g0602600AK121619AATGGGCCCAACAlba, DNA/RNA-binding protein family protein. 
J033044O03AATGGGCCCAACNONE 
J043036G04AATGGGCCCAACNONE 
J075107E08AATGGGCCCAACNONE 
J090060N14AATGGGCCCAACNONE 
J090094K04AATGGGCCCAACNONE 
Os06g0607800012-010-G03AAATGGGCCAANONE 
AB070254AAATGGGCCAANONE 
AK063158AAATGGGCCAASimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695AAATGGGCCAANONE 
J013074G13AAATGGGCCAANONE 
J090015C16AAATGGGCCAANONE 
J090069H10AAATGGGCCAANONE 
Os06g0607900AK070879TAATGGGCCATNONE 
Os06g0616900AK107912TGCGGCCCATTAConserved hypothetical protein. 
Os06g0646600AB061818ATATGGGCCCATTAKNOX family class 2 homeodomain protein. 
J023088C09ATATGGGCCCATTANONE 
J065162G03ATATGGGCCCATTANONE 
Os06g0656800AK109762AAAGCCCAATGGGCCAGABeta-Ig-H3/fasciclin domain containing protein. 
AK109762GCGGCCCATTTBeta-Ig-H3/fasciclin domain containing protein. 
Os06g0663600AK100787AAGGCCCATTEndonuclease V family protein. 
Os06g0682800011-092-E01GAGGCCCATTTNONE 
AK064816GAGGCCCATTTZinc finger, CCCH-type domain containing protein. 
J013000E13GAGGCCCATTTNONE 
J013035J22GAGGCCCATTTNONE 
J013045M06GAGGCCCATTTNONE 
J013120A07GAGGCCCATTTNONE 
J033144H15GAGGCCCATTTNONE 
J033145H15GAGGCCCATTTNONE 
J033145N16GAGGCCCATTTNONE 
J090019J02GAGGCCCATTTNONE 
Os06g0683200AK060024GAGGCCCATTTSimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432GAGGCCCATTTNONE 
J023002B12GAGGCCCATTTNONE 
J023054E10GAGGCCCATTTNONE 
J023123F19GAGGCCCATTTNONE 
J065035K13GAGGCCCATTTNONE 
J065129P09GAGGCCCATTTNONE 
J065184B14GAGGCCCATTTNONE 
Os06g0708900AK100402AAATGGGCCGAConserved hypothetical protein. 
Os06g0712500AK068531AAATGGGCCTASimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os06g0714800006-033-C09AGGGCCCATTTNONE 
006-042-G10AGGGCCCATTTNONE 
006-081-G10AGGGCCCATTTNONE 
006-120-F12AGGGCCCATTTNONE 
009-149-F08AGGGCCCATTTNONE 
AK059793AGGGCCCATTTProtein of unknown function DUF581 family protein. 
AK071528AGGGCCCATTTNONE 
J023102E22AGGGCCCATTTNONE 
J065099H06AGGGCCCATTTNONE 
J065127G22AGGGCCCATTTNONE 
J075089J03AGGGCCCATTTNONE 
J075109B02AGGGCCCATTTNONE 
J075179K22AGGGCCCATTTNONE 
Os06g0715000AK107114TAATGGGCCGGAConserved hypothetical protein. 
Os06g0717400AK072887GCCGGCCCGGCCCATTTPseudouridine synthase, Rlu family protein. 
Os06g0725400J065086O07AATGGGCCGGGCCGGTSimilar to BLE1 protein. 
J065086O07TCAGGCCCATTASimilar to BLE1 protein. 
J065114J19AATGGGCCGGGCCGGTNONE 
J065114J19TCAGGCCCATTANONE 
Os06g0731800012-049-D10AAATGGGCCGAANONE 
AK069288AAATGGGCCGAAClathrin light chain family protein. 
J023014P04AAATGGGCCGAANONE 
J023058N12AAATGGGCCGAANONE 
J053035L13AAATGGGCCGAANONE 
J065097L21AAATGGGCCGAANONE 
J065099F07AAATGGGCCGAANONE 
J065144L02AAATGGGCCGAANONE 
J065161J11AAATGGGCCGAANONE 
J065181N05AAATGGGCCGAANONE 
J075087D09AAATGGGCCGAANONE 
J075088H19AAATGGGCCGAANONE 
J075116E21AAATGGGCCGAANONE 
J075147K03AAATGGGCCGAANONE 
J090083H22AAATGGGCCGAANONE 
J100079M09AAATGGGCCGAANONE 
Os07g0105300AK107419CACGGCCCATTTConserved hypothetical protein. 
AK109521CACGGCCCATTTNONE 
Os07g0112800AK058206CCCGGCCCATTTSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13CCCGGCCCATTTNONE 
J033064G11CCCGGCCCATTTNONE 
J065044F12CCCGGCCCATTTNONE 
J065047I05CCCGGCCCATTTNONE 
J065059P17CCCGGCCCATTTNONE 
J065180P17CCCGGCCCATTTNONE 
J075131M22CCCGGCCCATTTNONE 
Os07g0124500012-092-F01GAGGCCCATTTNONE 
AK070529GAGGCCCATTTSimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000GAGGCCCATTTNONE 
J090007O11GAGGCCCATTTNONE 
J090010E02GAGGCCCATTTNONE 
J090078C04GAGGCCCATTTNONE 
Os07g0154300009-070-E08TAATGGGCCATNONE 
009-077-E01TAATGGGCCATNONE 
009-196-F05TAATGGGCCATNONE 
AK105386TAATGGGCCATConserved hypothetical protein. 
AK122093TAATGGGCCATNONE 
J033124K14TAATGGGCCATNONE 
J075006I22TAATGGGCCATNONE 
J075185G02TAATGGGCCATNONE 
J090039C02TAATGGGCCATNONE 
Os07g0158300006-049-G04TACGGCCCATTANONE 
AK099188TACGGCCCATTANONE 
AK104773TACGGCCCATTANONE 
J013106F16TACGGCCCATTANONE 
J013123H22TACGGCCCATTANONE 
J023029J02TACGGCCCATTANONE 
J023029J03TACGGCCCATTANONE 
J033138N08TACGGCCCATTANONE 
J075011F05TACGGCCCATTANONE 
J075022F10TACGGCCCATTANONE 
J075071L13TACGGCCCATTANONE 
J075094B08TACGGCCCATTANONE 
J075119B21TACGGCCCATTANONE 
J075140L02TACGGCCCATTANONE 
J075199O21TACGGCCCATTANONE 
J080001I17TACGGCCCATTANONE 
J080005M04TACGGCCCATTANONE 
J080011P17TACGGCCCATTANONE 
J080026B14TACGGCCCATTANONE 
J080026C12TACGGCCCATTANONE 
J080030N16TACGGCCCATTANONE 
J080035K23TACGGCCCATTANONE 
J080039J22TACGGCCCATTANONE 
J080045D04TACGGCCCATTANONE 
J080050C06TACGGCCCATTANONE 
J080050K14TACGGCCCATTANONE 
J080051I09TACGGCCCATTANONE 
J080053F18TACGGCCCATTANONE 
J080053G10TACGGCCCATTANONE 
J080055F05TACGGCCCATTANONE 
J080057E22TACGGCCCATTANONE 
J080058F17TACGGCCCATTANONE 
J080063C18TACGGCCCATTANONE 
J080065E02TACGGCCCATTANONE 
J080066E06TACGGCCCATTANONE 
J080067O05TACGGCCCATTANONE 
J080068N15TACGGCCCATTANONE 
J080071O04TACGGCCCATTANONE 
J080074A20TACGGCCCATTANONE 
J080074E14TACGGCCCATTANONE 
J080074L05TACGGCCCATTANONE 
J080075E08TACGGCCCATTANONE 
J080075H07TACGGCCCATTANONE 
J080077D04TACGGCCCATTANONE 
J080077N15TACGGCCCATTANONE 
J080078A07TACGGCCCATTANONE 
J080079H22TACGGCCCATTANONE 
J080080F20TACGGCCCATTANONE 
J080080M22TACGGCCCATTANONE 
J080081K09TACGGCCCATTANONE 
J080081L04TACGGCCCATTANONE 
J080090K09TACGGCCCATTANONE 
J080093O13TACGGCCCATTANONE 
J080094A18TACGGCCCATTANONE 
J080094E10TACGGCCCATTANONE 
J080094H06TACGGCCCATTANONE 
J080096I21TACGGCCCATTANONE 
J100081A19TACGGCCCATTANONE 
Os07g0158900AK064980GGCCCGGCCCATTTCyclin-like F-box domain containing protein. 
Os07g0164500J013094M18CCCGGGCCGGCCCATTNONE 
J013153L05CCCGGGCCGGCCCATTNONE 
J023011J18CCCGGGCCGGCCCATTNONE 
J023106H21CCCGGGCCGGCCCATTNONE 
J033105F10CCCGGGCCGGCCCATTNONE 
J065210M20CCCGGGCCGGCCCATTSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05CCCGGGCCGGCCCATTNONE 
J090061C13CCCGGGCCGGCCCATTNONE 
J090074K15CCCGGGCCGGCCCATTNONE 
Os07g0179000AK100008TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
AK119398TTCGGCCCATTAAAGCCCATATAGGCCCACGAProtein prenyltransferase domain containing protein. 
AK119505TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
Os07g0202100AK101736TAATGGGCCTCSimilar to ATP-dependent RNA helicase ded1. 
Os07g0213600AK107696CACGGCCCATTAPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J100067F09CACGGCCCATTANONE 
J100082J05CACGGCCCATTANONE 
Os07g0224000009-060-E01GCCCGGCCCATTANONE 
J065042D20GCCCGGCCCATTANONE 
J065127D14GCCCGGCCCATTANONE 
J065176C24GCCCGGCCCATTANONE 
J065188M12GCCCGGCCCATTANONE 
J065194L14GCCCGGCCCATTANONE 
J075060P09GCCCGGCCCATTANONE 
J075134C14GCCCGGCCCATTARibosomal protein L24E family protein. 
J075192M12GCCCGGCCCATTANONE 
J100032N01GCCCGGCCCATTANONE 
Os07g0258400AK121534AACTGGGCCCATTNONE 
L41217AACTGGGCCCATTNONE 
S81897AACTGGGCCCATTOsNramp1 (Integral membrane protein). 
Os07g0270900015-039-A02AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
AK068904AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J013169N21AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065039I11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065081J11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065162P04AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
Os07g0408100AK108466TCCGGCCCATTTNONE 
AK111780TCCGGCCCATTTWD40-like domain containing protein. 
Os07g0435400AK111603AAATGGGCCAASimilar to WD40. 
AK111603TAATGGGCCTCSimilar to WD40. 
Os07g0486000AK069343AAATGGGCCCAGGCCCSimilar to MSH4. 
Os07g0515700AK103117TAATGGGCCTCAnkyrin repeat containing protein. 
Os07g0537500AK111734GAGGCCCATTProtein of unknown function DUF26 domain containing protein. 
Os07g0546700009-110-H10TAATGGGCCCGNONE 
AK058262TAATGGGCCCGNONE 
J065154I05TAATGGGCCCGNONE 
J065175P09TAATGGGCCCGNONE 
J065187F11TAATGGGCCCGNONE 
J075114K16TAATGGGCCCGNONE 
J090031L21TAATGGGCCCGNONE 
U86017TAATGGGCCCGSimilar to 60S ribosomal protein L38. 
Os07g0558200AK065243TAATGGGCCAAInositol monophosphatase family protein. 
Os07g0568900009-083-H02AACTGGGCCCATTTTGGGCTAAGCCCATCGNONE 
009-083-H02TAATGGGCCTTATTGGGCTTANONE 
AK062660AACTGGGCCCATTTTGGGCTAAGCCCATCGConserved hypothetical protein. 
AK062660TAATGGGCCTTATTGGGCTTAConserved hypothetical protein. 
Os07g0569000AK073915CGATGGGCTTAGCCCAAAATGGGCCCAGTTConserved hypothetical protein. 
AK073915TAAGCCCAATAAGGCCCATTAConserved hypothetical protein. 
Os07g0570700AK065242AAACGGCCCATTARibosome recycling factor family protein. 
J013002I12AAACGGCCCATTANONE 
Os07g0606500AK068811ATCTCGGCCCATTTNONE 
AK121873ATCTCGGCCCATTTNONE 
J013159C05ATCTCGGCCCATTTNONE 
J075158B14ATCTCGGCCCATTTNONE 
Os07g0607200AK065746ACCGGCCCATTTProtein of unknown function DUF751 family protein. 
J065037B15ACCGGCCCATTTNONE 
J065042E20ACCGGCCCATTTNONE 
J065161I08ACCGGCCCATTTNONE 
Os07g0626100009-127-G03AATGGGCCAANONE 
AK062899AATGGGCCAASimilar to 50S ribosomal protein L7/L12. 
Os07g0639800AK074012AAATGGGCCGCASimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK074012TTCGGCCCATTSimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592AAATGGGCCGCANONE 
AK104592TTCGGCCCATTNONE 
AK104739AAATGGGCCGCANONE 
AK104739TTCGGCCCATTNONE 
Os07g0641700009-030-F09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
014-030-D10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AF009413AAATGGGCCGTGGAGGTGGGCCGGTSimilar to 10 kDa chaperonin (Protein CPN10) (Protein groES). 
AK059154AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK119728AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK122129AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023057A19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023143P09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J033132M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065039D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065062M22AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065071L10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065088N13AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065115D21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065187D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011B03AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075029J17AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075038J07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075065A18AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075083P05AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075101G24AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075127E19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075161K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075175D23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090044M07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065G16AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065J11AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090097M02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090099D02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100056A20AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100063M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
Os07g0665200003-019-A05AATGGGCCTANONE 
009-087-A09AATGGGCCTANONE 
D01000AATGGGCCTANONE 
J033143H14AATGGGCCTANONE 
J043022G14AATGGGCCTANONE 
J043040G10AATGGGCCTANONE 
J065046K22AATGGGCCTANONE 
J065162K09AATGGGCCTANONE 
J065164G02AATGGGCCTANONE 
J075003D09AATGGGCCTANONE 
J075004F23AATGGGCCTANONE 
J075025F23AATGGGCCTANONE 
J075026E23AATGGGCCTANONE 
J075028N04AATGGGCCTANONE 
J075046L05AATGGGCCTANONE 
J075047G14AATGGGCCTANONE 
J075052I05AATGGGCCTANONE 
J075060K13AATGGGCCTANONE 
J075066I02AATGGGCCTANONE 
J075082L08AATGGGCCTANONE 
J075086C20AATGGGCCTANONE 
J075087E13AATGGGCCTANONE 
J075101B12AATGGGCCTASuperoxide dismutase [Cu-Zn] 2 (EC 1.15.1.1). 
J075114M12AATGGGCCTANONE 
J075120J06AATGGGCCTANONE 
J075141D13AATGGGCCTANONE 
J075155D09AATGGGCCTANONE 
J075155N05AATGGGCCTANONE 
J075163H19AATGGGCCTANONE 
J075165C16AATGGGCCTANONE 
J075172N15AATGGGCCTANONE 
J075174A22AATGGGCCTANONE 
J075175M10AATGGGCCTANONE 
J075176D14AATGGGCCTANONE 
J075180H01AATGGGCCTANONE 
J075188H09AATGGGCCTANONE 
J075192G18AATGGGCCTANONE 
J080003I11AATGGGCCTANONE 
J080013F21AATGGGCCTANONE 
J080027D23AATGGGCCTANONE 
J080033F06AATGGGCCTANONE 
J080034C04AATGGGCCTANONE 
J080044E15AATGGGCCTANONE 
J080048M04AATGGGCCTANONE 
J080049J23AATGGGCCTANONE 
J080059A17AATGGGCCTANONE 
J080063A12AATGGGCCTANONE 
J080069K04AATGGGCCTANONE 
J080070K24AATGGGCCTANONE 
J080075F04AATGGGCCTANONE 
J080076A11AATGGGCCTANONE 
J080076J10AATGGGCCTANONE 
J080082C24AATGGGCCTANONE 
J080085B06AATGGGCCTANONE 
J080089C13AATGGGCCTANONE 
J080096E20AATGGGCCTANONE 
J100021E15AATGGGCCTANONE 
J100029A07AATGGGCCTANONE 
J100053A11AATGGGCCTANONE 
J100058L04AATGGGCCTANONE 
J100061J11AATGGGCCTANONE 
J100063A11AATGGGCCTANONE 
Os07g0687300AK073043AAATGGGCTTAGGCCCATTSimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0105800AK065355AATGGGCCAGANONE 
AK067200AATGGGCCAGACytochrome P450 family protein. 
Os08g0107500013-094-H02GCGGCCCATTTNONE 
013-095-E07GCGGCCCATTTNONE 
AK064053GCGGCCCATTTShwachman-Bodian-Diamond syndrome proteins family protein. 
AK101418GCGGCCCATTTNONE 
J033037P14GCGGCCCATTTNONE 
J090025I15GCGGCCCATTTNONE 
J100022F23GCGGCCCATTTNONE 
Os08g0112800009-113-D03AAGGCCCATTANONE 
AK121176AAGGCCCATTARickettsia 17 kDa surface antigen family protein. 
J023083C18AAGGCCCATTANONE 
J033074M10AAGGCCCATTANONE 
J033097G10AAGGCCCATTANONE 
J065090F05AAGGCCCATTANONE 
J090001J03AAGGCCCATTANONE 
J090044F23AAGGCCCATTANONE 
J090078H09AAGGCCCATTANONE 
J100088G23AAGGCCCATTANONE 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J013149L10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075027H17ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075060F10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
Os08g0127700012-086-F03TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK059350TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK099242TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
J033027J18TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065012F22TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065046N17TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065197B02TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100018P04TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100052C14TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100083A12TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0158900AK067062AAATGGGCCCGCAGTP1/OBG domain containing protein. 
J013089F04AAATGGGCCCGCANONE 
J013092D16AAATGGGCCCGCANONE 
J033120K14AAATGGGCCCGCANONE 
J033133F24AAATGGGCCCGCANONE 
J033145A10AAATGGGCCCGCANONE 
J033145A11AAATGGGCCCGCANONE 
J053048H24AAATGGGCCCGCANONE 
J053075H10AAATGGGCCCGCANONE 
Os08g0161700009-088-D09AAATGGGCCTTATTGGGCCGGGCCNONE 
009-131-H02AAATGGGCCTTATTGGGCCGGGCCNONE 
009-182-D04AAATGGGCCTTATTGGGCCGGGCCNONE 
AK059272AAATGGGCCTTATTGGGCCGGGCCConserved hypothetical protein. 
J075002M21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075090H12AAATGGGCCTTATTGGGCCGGGCCNONE 
J075129C21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075146N03AAATGGGCCTTATTGGGCCGGGCCNONE 
J075178P18AAATGGGCCTTATTGGGCCGGGCCNONE 
J075190M03AAATGGGCCTTATTGGGCCGGGCCNONE 
J090030G01AAATGGGCCTTATTGGGCCGGGCCNONE 
J100088M23AAATGGGCCTTATTGGGCCGGGCCNONE 
Os08g0178100AK101717TAATGGGCCAGAPep3/Vps18/deep orange domain containing protein. 
Os08g0191900AK067587CGTGTGGGGCCCATGTGGGGCCCATTProtein prenyltransferase domain containing protein. 
AK099016CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013032I08CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013050I24CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013128E05CGTGTGGGGCCCATGTGGGGCCCATTNONE 
Os08g0224700AK121754AATGGGCCGAGSimilar to 26S proteasome subunit RPN2a. 
Os08g0328300AK102227GGCCCGGCCCATTTNONE 
AK105392GGCCCGGCCCATTTENT domain containing protein. 
Os08g0363000015-090-A07TAATGGGCCTCCGGCCCGGTNONE 
AK103677TAATGGGCCTCCGGCCCGGTNONE 
AK106532TAATGGGCCTCCGGCCCGGTProtein of unknown function DUF295 family protein. 
J033136B21TAATGGGCCTCCGGCCCGGTNONE 
J033136E01TAATGGGCCTCCGGCCCGGTNONE 
J043029N11TAATGGGCCTCCGGCCCGGTNONE 
J065071G13TAATGGGCCTCCGGCCCGGTNONE 
J065105J22TAATGGGCCTCCGGCCCGGTNONE 
J075084B18TAATGGGCCTCCGGCCCGGTNONE 
Os08g0375800AK101199TAATGGGCCACProtein prenyltransferase domain containing protein. 
J033030L22TAATGGGCCACNONE 
Os08g0387050J043038F21TTGGCCCATTConserved hypothetical protein. 
Os08g0412100AK072641AAATGGGCCGTCDisease resistance protein family protein. 
Os08g0412200006-028-H07AAATGGGCCAANONE 
AJ575234AAATGGGCCAANONE 
AK059631AAATGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099367AAATGGGCCAANONE 
AK104578AAATGGGCCAANONE 
J033071L08AAATGGGCCAANONE 
J065197K18AAATGGGCCAANONE 
Os08g0431500009-186-D05GGCCCGGCCCATTTNONE 
AK058993GGCCCGGCCCATTTNONE 
AK100797GGCCCGGCCCATTTConserved hypothetical protein. 
J023121F15GGCCCGGCCCATTTNONE 
Os08g0435800AK121712AATTGGGCCCACACGAATGGGCCACSimilar to Lipoate protein ligase-like protein. 
J065121P15AATTGGGCCCACACGAATGGGCCACNONE 
Os08g0438400Os08g0438400CAGGCCCATTAZF-HD homeobox protein Cys/His-rich dimerisation region domain containing protein. 
Os08g0439900AK110628AACTGGGCCCATTMitochondrial glycoprotein family protein. 
J065118D13AACTGGGCCCATTNONE 
Os08g0440500AK058761CCACGGCCCATTAMIR domain containing protein. 
Os08g0468400011-057-F06ACCGGCCCAATGGGCCATNONE 
AK063363ACCGGCCCAATGGGCCATHEC/Ndc80p family protein. 
J100048N11ACCGGCCCAATGGGCCATNONE 
Os08g0485700AK068131TAATGGGCCGAGNONE 
AK069097TAATGGGCCGAGMethyl-CpG binding domain containing protein. 
J013130L03TAATGGGCCGAGNONE 
Os08g0493900AK101284AAATGGGCCGGANONE 
AK111820AAATGGGCCGGAWD40-like domain containing protein. 
Os08g0522500006-026-A04AAATGGGCCTTNONE 
006-037-B02AAATGGGCCTTNONE 
006-047-E11AAATGGGCCTTNONE 
015-049-E10AAATGGGCCTTNONE 
AK060080AAATGGGCCTTNONE 
AK102814AAATGGGCCTTNONE 
AK104718AAATGGGCCTTNONE 
AK106190AAATGGGCCTTGlycoside hydrolase, family 19 protein. 
J013068H02AAATGGGCCTTNONE 
J033108M05AAATGGGCCTTNONE 
J033116M13AAATGGGCCTTNONE 
J065211H04AAATGGGCCTTNONE 
J075195H03AAATGGGCCTTNONE 
J075195I24AAATGGGCCTTNONE 
Os08g0522600014-041-A10GGGCCGGGGGCCCATTNONE 
AK105364GGGCCGGGGGCCCATTSimilar to Chaperone protein dnaJ 10 (AtJ10) (AtDjC10). 
Os08g0530200009-166-A09AAATGGGCCTANONE 
009-166-A09AGCCCACAATAATGGGCCAGNONE 
AK062052AAATGGGCCTANONE 
AK062052AGCCCACAATAATGGGCCAGNONE 
AK120448AAATGGGCCTASimilar to 60S ribosomal protein L17. 
AK120448AGCCCACAATAATGGGCCAGSimilar to 60S ribosomal protein L17. 
J013100M19AAATGGGCCTANONE 
J013100M19AGCCCACAATAATGGGCCAGNONE 
J023045K22AAATGGGCCTANONE 
J023045K22AGCCCACAATAATGGGCCAGNONE 
J033046D13AAATGGGCCTANONE 
J033046D13AGCCCACAATAATGGGCCAGNONE 
J033066N01AAATGGGCCTANONE 
J033066N01AGCCCACAATAATGGGCCAGNONE 
J033143N05AAATGGGCCTANONE 
J033143N05AGCCCACAATAATGGGCCAGNONE 
J053070P13AAATGGGCCTANONE 
J053070P13AGCCCACAATAATGGGCCAGNONE 
J065011C18AAATGGGCCTANONE 
J065011C18AGCCCACAATAATGGGCCAGNONE 
J065013C23AAATGGGCCTANONE 
J065013C23AGCCCACAATAATGGGCCAGNONE 
J065016B09AAATGGGCCTANONE 
J065016B09AGCCCACAATAATGGGCCAGNONE 
J065016C21AAATGGGCCTANONE 
J065016C21AGCCCACAATAATGGGCCAGNONE 
J065023K18AAATGGGCCTANONE 
J065023K18AGCCCACAATAATGGGCCAGNONE 
J065028F12AAATGGGCCTANONE 
J065028F12AGCCCACAATAATGGGCCAGNONE 
J065030L02AAATGGGCCTANONE 
J065030L02AGCCCACAATAATGGGCCAGNONE 
J065042H15AAATGGGCCTANONE 
J065042H15AGCCCACAATAATGGGCCAGNONE 
J065078H02AAATGGGCCTANONE 
J065078H02AGCCCACAATAATGGGCCAGNONE 
J065092D07AAATGGGCCTANONE 
J065092D07AGCCCACAATAATGGGCCAGNONE 
J065092E01AAATGGGCCTANONE 
J065092E01AGCCCACAATAATGGGCCAGNONE 
J065104M21AAATGGGCCTANONE 
J065104M21AGCCCACAATAATGGGCCAGNONE 
J065119P21AAATGGGCCTANONE 
J065119P21AGCCCACAATAATGGGCCAGNONE 
J065124B15AAATGGGCCTANONE 
J065124B15AGCCCACAATAATGGGCCAGNONE 
J065146H09AAATGGGCCTANONE 
J065146H09AGCCCACAATAATGGGCCAGNONE 
J065149L09AAATGGGCCTANONE 
J065149L09AGCCCACAATAATGGGCCAGNONE 
J065156A09AAATGGGCCTANONE 
J065156A09AGCCCACAATAATGGGCCAGNONE 
J065157H23AAATGGGCCTANONE 
J065157H23AGCCCACAATAATGGGCCAGNONE 
J065165L14AAATGGGCCTANONE 
J065165L14AGCCCACAATAATGGGCCAGNONE 
J065165M18AAATGGGCCTANONE 
J065165M18AGCCCACAATAATGGGCCAGNONE 
J065172O03AAATGGGCCTANONE 
J065172O03AGCCCACAATAATGGGCCAGNONE 
J065192M18AAATGGGCCTANONE 
J065192M18AGCCCACAATAATGGGCCAGNONE 
J065198D21AAATGGGCCTANONE 
J065198D21AGCCCACAATAATGGGCCAGNONE 
J065200D05AAATGGGCCTANONE 
J065200D05AGCCCACAATAATGGGCCAGNONE 
J065202B20AAATGGGCCTANONE 
J065202B20AGCCCACAATAATGGGCCAGNONE 
J065212P11AAATGGGCCTANONE 
J065212P11AGCCCACAATAATGGGCCAGNONE 
J065215E08AAATGGGCCTANONE 
J065215E08AGCCCACAATAATGGGCCAGNONE 
J065217P19AAATGGGCCTANONE 
J065217P19AGCCCACAATAATGGGCCAGNONE 
J075005I19AAATGGGCCTANONE 
J075005I19AGCCCACAATAATGGGCCAGNONE 
J075134J06AAATGGGCCTANONE 
J075134J06AGCCCACAATAATGGGCCAGNONE 
J075162G12AAATGGGCCTANONE 
J075162G12AGCCCACAATAATGGGCCAGNONE 
J075178H07AAATGGGCCTANONE 
J075178H07AGCCCACAATAATGGGCCAGNONE 
J075186K01AAATGGGCCTANONE 
J075186K01AGCCCACAATAATGGGCCAGNONE 
J080315I17AAATGGGCCTANONE 
J080315I17AGCCCACAATAATGGGCCAGNONE 
J080318P19AAATGGGCCTANONE 
J080318P19AGCCCACAATAATGGGCCAGNONE 
J090004H16AAATGGGCCTANONE 
J090004H16AGCCCACAATAATGGGCCAGNONE 
J090020A16AAATGGGCCTANONE 
J090020A16AGCCCACAATAATGGGCCAGNONE 
J090047J12AAATGGGCCTANONE 
J090047J12AGCCCACAATAATGGGCCAGNONE 
J090080E07AAATGGGCCTANONE 
J090080E07AGCCCACAATAATGGGCCAGNONE 
J090090H23AAATGGGCCTANONE 
J090090H23AGCCCACAATAATGGGCCAGNONE 
J100021G24AAATGGGCCTANONE 
J100021G24AGCCCACAATAATGGGCCAGNONE 
J100037L04AAATGGGCCTANONE 
J100037L04AGCCCACAATAATGGGCCAGNONE 
J100043L09AAATGGGCCTANONE 
J100043L09AGCCCACAATAATGGGCCAGNONE 
J100044A10AAATGGGCCTANONE 
J100044A10AGCCCACAATAATGGGCCAGNONE 
Os08g0542100AK058490TAATGGGCCTARibosomal protein L7, eukaryotic form family protein. 
AK101416TAATGGGCCTANONE 
J033037N08TAATGGGCCTANONE 
J033086B16TAATGGGCCTANONE 
J043036J02TAATGGGCCTANONE 
J065137E02TAATGGGCCTANONE 
J090015L07TAATGGGCCTANONE 
J100036D02TAATGGGCCTANONE 
Os08g0546300AK064717ATGGCCCATTAConserved hypothetical protein. 
AK119794ATGGCCCATTANONE 
D10982ATGGCCCATTANONE 
J080044B21ATGGCCCATTANONE 
Os08g0557100AK070743AAATGGGCCGGANONE 
AK101214AAATGGGCCGGASimilar to Nucleic acid-binding protein precursor. 
AK105901AAATGGGCCGGANONE 
J033031B04AAATGGGCCGGANONE 
J080004F08AAATGGGCCGGANONE 
J080004H12AAATGGGCCGGANONE 
J080005H08AAATGGGCCGGANONE 
J080005I02AAATGGGCCGGANONE 
J080008N16AAATGGGCCGGANONE 
J080009H23AAATGGGCCGGANONE 
J080012H17AAATGGGCCGGANONE 
J080012J21AAATGGGCCGGANONE 
J080013I20AAATGGGCCGGANONE 
J080016E07AAATGGGCCGGANONE 
J080018O04AAATGGGCCGGANONE 
J080020B18AAATGGGCCGGANONE 
J080021I16AAATGGGCCGGANONE 
J080022N01AAATGGGCCGGANONE 
J080023G08AAATGGGCCGGANONE 
J080023N09AAATGGGCCGGANONE 
J080024J24AAATGGGCCGGANONE 
J080025M12AAATGGGCCGGANONE 
J080028A22AAATGGGCCGGANONE 
J080028I01AAATGGGCCGGANONE 
J080029D22AAATGGGCCGGANONE 
J080030M02AAATGGGCCGGANONE 
J080031B06AAATGGGCCGGANONE 
J080035G08AAATGGGCCGGANONE 
J080036F19AAATGGGCCGGANONE 
J080038P14AAATGGGCCGGANONE 
J080039C17AAATGGGCCGGANONE 
J080043A10AAATGGGCCGGANONE 
J080044H02AAATGGGCCGGANONE 
J080044P12AAATGGGCCGGANONE 
J080047L06AAATGGGCCGGANONE 
J080050L06AAATGGGCCGGANONE 
J080052J11AAATGGGCCGGANONE 
J080052M10AAATGGGCCGGANONE 
J080053E20AAATGGGCCGGANONE 
J080054J01AAATGGGCCGGANONE 
J080059N09AAATGGGCCGGANONE 
J080064F19AAATGGGCCGGANONE 
J080064N22AAATGGGCCGGANONE 
J080065K14AAATGGGCCGGANONE 
J080065M12AAATGGGCCGGANONE 
J080068O07AAATGGGCCGGANONE 
J080076P20AAATGGGCCGGANONE 
J080087D08AAATGGGCCGGANONE 
J080087H16AAATGGGCCGGANONE 
J080090N23AAATGGGCCGGANONE 
J080091H04AAATGGGCCGGANONE 
J080091P13AAATGGGCCGGANONE 
J080094O15AAATGGGCCGGANONE 
J080094P14AAATGGGCCGGANONE 
J080095I07AAATGGGCCGGANONE 
J080097E22AAATGGGCCGGANONE 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os08g0567200AK067161CAAGGCCCATTTNONE 
J013094H15CAAGGCCCATTTNONE 
J065209H08CAAGGCCCATTTNONE 
Os09g0127300AK100234AAATGGGCCCTNAD-dependent epimerase/dehydratase family protein. 
J065025J06AAATGGGCCCTNONE 
J065026I05AAATGGGCCCTNONE 
J065042L03AAATGGGCCCTNONE 
J065061B18AAATGGGCCCTNONE 
J065121H13AAATGGGCCCTNONE 
J065183N10AAATGGGCCCTNONE 
Os09g0347900AK071224TGCGGCCCATTAConserved hypothetical protein. 
J023087B12TGCGGCCCATTANONE 
Os09g0355400AK105685ATTTGGGCCCATTANONE 
Os09g0370300AK108199AAATGGGCCAGASimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
AK108199AAATGGGCCTGASimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0375700AK068295TTTGGGCTCGGCCCATTHypothetical protein. 
Os09g0401200AK063980CTGGCCCAAATAGGCCCAAGGCCCATTTSimilar to HSP associated protein like. 
Os09g0411700005-017-C05TCTGGCCCATTANONE 
009-163-B01TCTGGCCCATTANONE 
AK058290TCTGGCCCATTAPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919TCTGGCCCATTANONE 
AK121091TCTGGCCCATTANONE 
J013039D20TCTGGCCCATTANONE 
J023066F16TCTGGCCCATTANONE 
J023082H09TCTGGCCCATTANONE 
J023088H05TCTGGCCCATTANONE 
J065013G09TCTGGCCCATTANONE 
J065065C12TCTGGCCCATTANONE 
J065111I04TCTGGCCCATTANONE 
J065179H22TCTGGCCCATTANONE 
J075023N14TCTGGCCCATTANONE 
J090041J17TCTGGCCCATTANONE 
J100031J21TCTGGCCCATTANONE 
J100057A18TCTGGCCCATTANONE 
J100068P22TCTGGCCCATTANONE 
Os09g0433650J075094M19TAATGGGCCATTobacco mosaic virus coat protein family protein. 
Os09g0437900AK107833TTGGCCCATTTSimilar to Adrenodoxin. 
Os09g0464000AK060777TAATGGGCCCCAGNONE 
AK069530TAATGGGCCCCAGSimilar to Carbonate dehydratase-like protein. 
Os09g0467700AK061600TGCGGCCCATTAConserved hypothetical protein. 
Os09g0478400AK107794AAATGGGCCTAConserved hypothetical protein. 
J065082F04AAATGGGCCTANONE 
Os09g0485800AK108749TTGGCCCATTAConserved hypothetical protein. 
J065137H03TTGGCCCATTANONE 
Os09g0497400AK058354TAATGGGCCTCNONE 
AK068677TAATGGGCCTCProtein of unknown function DUF850, transmembrane eukaryotic family protein. 
J013159B19TAATGGGCCTCNONE 
J023011D22TAATGGGCCTCNONE 
J023081K05TAATGGGCCTCNONE 
J033060O14TAATGGGCCTCNONE 
J075020I08TAATGGGCCTCNONE 
J075034J03TAATGGGCCTCNONE 
J075049M15TAATGGGCCTCNONE 
J075065K02TAATGGGCCTCNONE 
J075099L06TAATGGGCCTCNONE 
Os09g0531900AK073015CCTCGCCCACAAATGGGCCGAAASimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os09g0537600006-054-B05TAATGGGCCATNONE 
AK061004TAATGGGCCATSimilar to Cyclophilin-like protein (Single domain cyclophilin type peptidyl- prolyl cis-trans isomerase). 
J065104J20TAATGGGCCATNONE 
J075029H16TAATGGGCCATNONE 
Os09g0539100AK071977ACCGGGCCCATTTSimilar to 3-dehydroquinate synthase-like protein. 
AK098959ACCGGGCCCATTTNONE 
Os09g0540600AK101798TAATGGGCTAATGGGCCTCNONE 
AK103397TAATGGGCTAATGGGCCTCSimilar to WD-40 repeat protein MSI1. 
Os09g0542200006-092-A09TAGGCCCATTNONE 
AK064887TAGGCCCATTThioredoxin fold domain containing protein. 
AK104804TAGGCCCATTNONE 
J013000K12TAGGCCCATTNONE 
J013170A19TAGGCCCATTNONE 
J033103B02TAGGCCCATTNONE 
J065196J20TAGGCCCATTNONE 
J075037H17TAGGCCCATTNONE 
J075069H14TAGGCCCATTNONE 
J075071C16TAGGCCCATTNONE 
J075095N02TAGGCCCATTNONE 
J075136N03TAGGCCCATTNONE 
J075192L16TAGGCCCATTNONE 
J100057N23TAGGCCCATTNONE 
J100060O07TAGGCCCATTNONE 
J100062F10TAGGCCCATTNONE 
J100077I08TAGGCCCATTNONE 
J100086B07TAGGCCCATTNONE 
J100088L14TAGGCCCATTNONE 
Os09g0552300AK111721GCGGCCCATTTProtein kinase-like domain containing protein. 
J043013E21GCGGCCCATTTNONE 
Os09g0559900AK111842TAATGGGCCGTGTTGGGCCGGCCCACTGACAGProtein kinase-like domain containing protein. 
Os11g0111200AK109277TAATGGGCCCTConserved hypothetical protein. 
Os11g0139500AK121845AAATGGGCCGAAANONE 
Os11g0148600AK100066AAATGGGCCGAGAConserved hypothetical protein. 
AK100066AAATGGGCCTAConserved hypothetical protein. 
AK102442AAATGGGCCGAGANONE 
AK102442AAATGGGCCTANONE 
J065167F17AAATGGGCCGAGANONE 
J065167F17AAATGGGCCTANONE 
Os11g0156200AK100124AAATGGGCCTAPeptidase S28 family protein. 
Os11g0157100012-010-F03TAATGGGCCGGGNONE 
J013028H01TAATGGGCCGGGNONE 
J013061L19TAATGGGCCGGGNONE 
J033044L03TAATGGGCCGGGNONE 
J033064P09TAATGGGCCGGGNONE 
J033076A10TAATGGGCCGGGNONE 
J033076K22TAATGGGCCGGGNONE 
J033084J05TAATGGGCCGGGNONE 
J033145A22TAATGGGCCGGGNONE 
J033148L19TAATGGGCCGGGNONE 
J065027P20TAATGGGCCGGGNONE 
J065085D16TAATGGGCCGGGNONE 
J065091L03TAATGGGCCGGGNONE 
J065195C18TAATGGGCCGGGNONE 
J090018N23TAATGGGCCGGGNONE 
J090048A10TAATGGGCCGGGNONE 
J090048M03TAATGGGCCGGGNONE 
J090066L11TAATGGGCCGGGNONE 
J090075G16TAATGGGCCGGGNONE 
J090083G23TAATGGGCCGGGNONE 
J090087E24TAATGGGCCGGGNONE 
J090096H16TAATGGGCCGGGNONE 
Os11g0167300AK071335TAATGGGCCGCProtein of unknown function DUF537 family protein. 
AK101314TAATGGGCCGCNONE 
Os11g0175500015-087-F02AAATGGGCCCACCCNONE 
AK064320AAATGGGCCCACCCZinc finger, RING-type domain containing protein. 
AK101592AAATGGGCCCACCCNONE 
Os11g0181900011-064-E11AATGGGCCTCNONE 
016-031-C07AATGGGCCTCNONE 
AK063374AATGGGCCTCPrefoldin domain containing protein. 
J065083K20AATGGGCCTCNONE 
Os11g0182400016-077-B04TGTCAGTGTAATGGGCCATTGGGCCAGANONE 
AK112089TGTCAGTGTAATGGGCCATTGGGCCAGACyclin-like F-box domain containing protein. 
Os11g0199600AK101774TCGGCCCATTAACGGCCCACGTZinc finger, CCHC-type domain containing protein. 
AK120040TCGGCCCATTAACGGCCCACGTNONE 
J023047I06TCGGCCCATTAACGGCCCACGTNONE 
J033064L23TCGGCCCATTAACGGCCCACGTNONE 
J033117I01TCGGCCCATTAACGGCCCACGTNONE 
J033123I18TCGGCCCATTAACGGCCCACGTNONE 
J053026H17TCGGCCCATTAACGGCCCACGTNONE 
J053078G05TCGGCCCATTAACGGCCCACGTNONE 
J065102A09TCGGCCCATTAACGGCCCACGTNONE 
J065113G11TCGGCCCATTAACGGCCCACGTNONE 
J065207F20TCGGCCCATTAACGGCCCACGTNONE 
J075027K21TCGGCCCATTAACGGCCCACGTNONE 
Os11g0209100016-063-F03AAATGGGCCCAGCNONE 
AK064391AAATGGGCCCAGCCyclin-like F-box domain containing protein. 
J075027K02AAATGGGCCCAGCNONE 
J075154K15AAATGGGCCCAGCNONE 
Os11g0425800AK066603TTGGCCCATTASimilar to 60S ribosomal protein L13a. 
J065063A20TTGGCCCATTANONE 
J075021H08TTGGCCCATTANONE 
J075058J10TTGGCCCATTANONE 
J075088B15TTGGCCCATTANONE 
J075099E15TTGGCCCATTANONE 
J075110F13TTGGCCCATTANONE 
J075150G18TTGGCCCATTANONE 
J080312E14TTGGCCCATTANONE 
Os11g0484300AK121422AAATGGGCCGGGCCGAGGCCCAAASimilar to Mcm2-prov protein. 
Os11g0557900009-196-H11CAAGGCCCATTTNONE 
AK063232CAAGGCCCATTTARP2/3 complex 16 kDa subunit (p16-Arc) family protein. 
Os11g0594000J033124N02ATGGCCCATTNONE 
J100054J17ATGGCCCATTGeneral substrate transporter family protein. 
Os11g0602600006-046-H02AAGGCCCATTTNONE 
006-046-H02ATCTCGGCCCATTTNONE 
006-046-H02TAATGGGCCGAGANONE 
006-056-H08AAGGCCCATTTNONE 
006-056-H08ATCTCGGCCCATTTNONE 
006-056-H08TAATGGGCCGAGANONE 
009-116-D05AAGGCCCATTTNONE 
009-116-D05ATCTCGGCCCATTTNONE 
009-116-D05TAATGGGCCGAGANONE 
AK072671AAGGCCCATTTSimilar to 40S ribosomal protein S9. 
AK072671ATCTCGGCCCATTTSimilar to 40S ribosomal protein S9. 
AK072671TAATGGGCCGAGASimilar to 40S ribosomal protein S9. 
AK104660AAGGCCCATTTNONE 
AK104660ATCTCGGCCCATTTNONE 
AK104660TAATGGGCCGAGANONE 
J023134P20AAGGCCCATTTNONE 
J023134P20ATCTCGGCCCATTTNONE 
J023134P20TAATGGGCCGAGANONE 
J023141O13AAGGCCCATTTNONE 
J023141O13ATCTCGGCCCATTTNONE 
J023141O13TAATGGGCCGAGANONE 
J033066I15AAGGCCCATTTNONE 
J033066I15ATCTCGGCCCATTTNONE 
J033066I15TAATGGGCCGAGANONE 
J033076A08AAGGCCCATTTNONE 
J033076A08ATCTCGGCCCATTTNONE 
J033076A08TAATGGGCCGAGANONE 
J033150J23AAGGCCCATTTNONE 
J033150J23ATCTCGGCCCATTTNONE 
J033150J23TAATGGGCCGAGANONE 
J065114P19AAGGCCCATTTNONE 
J065114P19ATCTCGGCCCATTTNONE 
J065114P19TAATGGGCCGAGANONE 
J065176B01AAGGCCCATTTNONE 
J065176B01ATCTCGGCCCATTTNONE 
J065176B01TAATGGGCCGAGANONE 
J065207H21AAGGCCCATTTNONE 
J065207H21ATCTCGGCCCATTTNONE 
J065207H21TAATGGGCCGAGANONE 
J080301L21AAGGCCCATTTNONE 
J080301L21ATCTCGGCCCATTTNONE 
J080301L21TAATGGGCCGAGANONE 
J080308A08AAGGCCCATTTNONE 
J080308A08ATCTCGGCCCATTTNONE 
J080308A08TAATGGGCCGAGANONE 
J080318K23AAGGCCCATTTNONE 
J080318K23ATCTCGGCCCATTTNONE 
J080318K23TAATGGGCCGAGANONE 
J080319F17AAGGCCCATTTNONE 
J080319F17ATCTCGGCCCATTTNONE 
J080319F17TAATGGGCCGAGANONE 
J080319I10AAGGCCCATTTNONE 
J080319I10ATCTCGGCCCATTTNONE 
J080319I10TAATGGGCCGAGANONE 
J090028C08AAGGCCCATTTNONE 
J090028C08ATCTCGGCCCATTTNONE 
J090028C08TAATGGGCCGAGANONE 
J090051I24AAGGCCCATTTNONE 
J090051I24ATCTCGGCCCATTTNONE 
J090051I24TAATGGGCCGAGANONE 
J090053L21AAGGCCCATTTNONE 
J090053L21ATCTCGGCCCATTTNONE 
J090053L21TAATGGGCCGAGANONE 
J090069C20AAGGCCCATTTNONE 
J090069C20ATCTCGGCCCATTTNONE 
J090069C20TAATGGGCCGAGANONE 
J100017G08AAGGCCCATTTNONE 
J100017G08ATCTCGGCCCATTTNONE 
J100017G08TAATGGGCCGAGANONE 
J100042B06AAGGCCCATTTNONE 
J100042B06ATCTCGGCCCATTTNONE 
J100042B06TAATGGGCCGAGANONE 
J100045G24AAGGCCCATTTNONE 
J100045G24ATCTCGGCCCATTTNONE 
J100045G24TAATGGGCCGAGANONE 
J100050J19AAGGCCCATTTNONE 
J100050J19ATCTCGGCCCATTTNONE 
J100050J19TAATGGGCCGAGANONE 
J100052D23AAGGCCCATTTNONE 
J100052D23ATCTCGGCCCATTTNONE 
J100052D23TAATGGGCCGAGANONE 
J100053M03AAGGCCCATTTNONE 
J100053M03ATCTCGGCCCATTTNONE 
J100053M03TAATGGGCCGAGANONE 
J100056D08AAGGCCCATTTNONE 
J100056D08ATCTCGGCCCATTTNONE 
J100056D08TAATGGGCCGAGANONE 
J100066B19AAGGCCCATTTNONE 
J100066B19ATCTCGGCCCATTTNONE 
J100066B19TAATGGGCCGAGANONE 
J100071N23AAGGCCCATTTNONE 
J100071N23ATCTCGGCCCATTTNONE 
J100071N23TAATGGGCCGAGANONE 
J100074H01AAGGCCCATTTNONE 
J100074H01ATCTCGGCCCATTTNONE 
J100074H01TAATGGGCCGAGANONE 
J100074H19AAGGCCCATTTNONE 
J100074H19ATCTCGGCCCATTTNONE 
J100074H19TAATGGGCCGAGANONE 
J100077C06AAGGCCCATTTNONE 
J100077C06ATCTCGGCCCATTTNONE 
J100077C06TAATGGGCCGAGANONE 
Os11g0617800009-105-D10CACGGCCCATTCTGGCCCAACANONE 
AK062778CACGGCCCATTCTGGCCCAACAConserved hypothetical protein. 
Os11g0642100AK107010TAATGGGCCCAGCCCCyclin-like F-box domain containing protein. 
Os11g0657200AK059959TCTCGGCCCATT2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07AATGGGCCGAGANONE 
AK062752AATGGGCCGAGASimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os12g0112250J013069O10AATGGGCCTTSaposin B domain containing protein. 
J065206G04AATGGGCCTTNONE 
J080302C06AATGGGCCTTNONE 
J080306K06AATGGGCCTTNONE 
J080307O09AATGGGCCTTNONE 
J080310J07AATGGGCCTTNONE 
J080311G18AATGGGCCTTNONE 
J080318C07AATGGGCCTTNONE 
Os12g0118900009-090-F10AATGGGCCTANONE 
AK062692AATGGGCCTACytochrome P450 family protein. 
Os12g0120400AK099904TAATGGGCCTGASimilar to ATPase-like protein. 
J065169A07TAATGGGCCTGANONE 
Os12g0150100009-047-B11AAATGGGCCCAATNONE 
AK105075AAATGGGCCCAATSimilar to 60S ribosomal protein L26A. 
J013067G22AAATGGGCCCAATNONE 
J033103F08AAATGGGCCCAATNONE 
J065029P11AAATGGGCCCAATNONE 
J065043B18AAATGGGCCCAATNONE 
J065123E16AAATGGGCCCAATNONE 
J065141O20AAATGGGCCCAATNONE 
J065161O04AAATGGGCCCAATNONE 
J065201M07AAATGGGCCCAATNONE 
J075058I23AAATGGGCCCAATNONE 
J075172J08AAATGGGCCCAATNONE 
J100040L13AAATGGGCCCAATNONE 
Os12g0156400012-065-D02CCAGGCCCATTTNONE 
AK072086CCAGGCCCATTTNONE 
AK099278CCAGGCCCATTTDcp1-like decapping family protein. 
J013063H09CCAGGCCCATTTNONE 
J023125D09CCAGGCCCATTTNONE 
J023149G21CCAGGCCCATTTNONE 
J033064E07CCAGGCCCATTTNONE 
J033093C07CCAGGCCCATTTNONE 
J033107E06CCAGGCCCATTTNONE 
J075172A11CCAGGCCCATTTNONE 
J090009E07CCAGGCCCATTTNONE 
J090023F13CCAGGCCCATTTNONE 
J090071N18CCAGGCCCATTTNONE 
Os12g0223300006-037-D03GGGCCCGGCCCATTNONE 
AJ429043GGGCCCGGCCCATTNONE 
AK060133GGGCCCGGCCCATTSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK073017GGGCCCGGCCCATTNONE 
J065085K05GGGCCCGGCCCATTNONE 
J075053C01GGGCCCGGCCCATTNONE 
J075055O06GGGCCCGGCCCATTNONE 
J075073B01GGGCCCGGCCCATTNONE 
J075089M07GGGCCCGGCCCATTNONE 
J075095E16GGGCCCGGCCCATTNONE 
J075112O19GGGCCCGGCCCATTNONE 
J075143A11GGGCCCGGCCCATTNONE 
J075173D24GGGCCCGGCCCATTNONE 
J075199G18GGGCCCGGCCCATTNONE 
J090030N06GGGCCCGGCCCATTNONE 
J100052H12GGGCCCGGCCCATTNONE 
J100079F09GGGCCCGGCCCATTNONE 
Os12g0242500J065129F10AATGGGCCGGCGCGGGTGCGGGCCNONE 
J090032G12AATGGGCCGGCGCGGGTGCGGGCCConserved hypothetical protein. 
Os12g0279600AK070295CTCGGCCCATTAExodeoxyribonuclease III xth family protein. 
Os12g0287200009-067-B11GCCGGCCCATTTGGGCCCAATTNONE 
009-130-F06GCCGGCCCATTTGGGCCCAATTNONE 
009-185-H10GCCGGCCCATTTGGGCCCAATTNONE 
AF338343GCCGGCCCATTTGGGCCCAATTNONE 
AK063847GCCGGCCCATTTGGGCCCAATTSimilar to Mago nashi protein. 
AK121477GCCGGCCCATTTGGGCCCAATTNONE 
J023149H05GCCGGCCCATTTGGGCCCAATTNONE 
J065019G18GCCGGCCCATTTGGGCCCAATTNONE 
J065049J18GCCGGCCCATTTGGGCCCAATTNONE 
J065143C22GCCGGCCCATTTGGGCCCAATTNONE 
J075130D23GCCGGCCCATTTGGGCCCAATTNONE 
J090014I22GCCGGCCCATTTGGGCCCAATTNONE 
J090018A06GCCGGCCCATTTGGGCCCAATTNONE 
J090053H11GCCGGCCCATTTGGGCCCAATTNONE 
J090080N13GCCGGCCCATTTGGGCCCAATTNONE 
J100019H19GCCGGCCCATTTGGGCCCAATTNONE 
Os12g0299700AK071145TTGGCCCATTConserved hypothetical protein. 
J023082N05TTGGCCCATTNONE 
Os12g0481100AK073151CCCGGCCCATTASimilar to RNA helicase. 
Os12g0517100012-071-A03AAATGGGCCAGNONE 
AK073020AAATGGGCCAGCyclin-like F-box domain containing protein. 
J023149K21AAATGGGCCAGNONE 
Os12g0556400009-129-D04AGGGCCCATTTNONE 
AK062903AGGGCCCATTTNONE 
AK108690AGGGCCCATTTConserved hypothetical protein. 
J080027A03AGGGCCCATTTNONE 
J100074F22AGGGCCCATTTNONE 
Os12g0557800AK121691AAATGGGCCGGTGGGCCGTGProtein prenyltransferase domain containing protein. 
J013095M03AAATGGGCCGGTGGGCCGTGNONE 
J033071H11AAATGGGCCGGTGGGCCGTGNONE 
J065101B02AAATGGGCCGGTGGGCCGTGNONE 
Os12g0588900AK069966AAATGGGCCTAConserved hypothetical protein. 
J023038A10AAATGGGCCTANONE 
J065061J23AAATGGGCCTANONE 
J065176O08AAATGGGCCTANONE 
J075143K13AAATGGGCCTANONE 
Os12g0592200Os12g0592200TAATGGGCCGGAConserved hypothetical protein. 
Os12g0599900AK101252AAATGGGCCCTTetratricopeptide region domain containing protein. 
J033032F05AAATGGGCCCTNONE 
Os12g0605900AK109696AGGGCCCATGGGCCCTGGCCCATTASimilar to Kinase like protein. 
Os12g0610950J075157D04AAGGCCCATTTHypothetical protein. 
Os12g0611000AK111837GCCGGCCCATTASimilar to Zinc-finger protein Lsd1. 
Os12g0612500Os12g0612500ATTGGGCCGGCCCATTTModification methylase HemK family protein. 
Os12g0612500CCCGGCCCATTTModification methylase HemK family protein. 
Os12g0615300AK119448AAATGGGCCGCAEGF-like calcium-binding domain containing protein. 
Os12g0623700009-168-F09GTGGCCCATTTNONE 
AK063876GTGGCCCATTTConserved hypothetical protein. 
Os12g0624800AK103828TAATGGGCCTGGHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.