version

Summary of OsREG432 (All List)

OrganismOryza sativa  
IDOsREG432  
SequenceAATGGGCT  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1559  

Entry Sequences (1559 entries)

LocusGene modelSequenceDescription
Os01g0104000AK072087AGCCCATTTNONE 
AK103808AGCCCATTTC-type lectin domain containing protein. 
Os01g0104100AK072797AAATGGGCTZinc finger, RING-type domain containing protein. 
AK104280AAATGGGCTNONE 
Os01g0104600AK058683AAAAGCCCATTAGTGGCCCAATANONE 
AK100613AAAAGCCCATTAGTGGCCCAATASimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
Os01g0212100AK065467AAAAGCCCATTTNONE 
AK101456AAAAGCCCATTTATP-dependent helicase, DEAH-box family protein. 
Os01g0248800009-103-G11CCAGCCCATTTNONE 
AK062766CCAGCCCATTTConserved hypothetical protein. 
Os01g0286600AB057749CCCAGCCCATTSimilar to Plastidal protoporphyrinogen oxidase. 
Os01g0327600AK120216AAATGGGCTTGGNONE 
AK121799AAATGGGCTTGGConserved hypothetical protein. 
J065081I07AAATGGGCTTGGNONE 
J065082D04AAATGGGCTTGGNONE 
J065082G10AAATGGGCTTGGNONE 
J065085G24AAATGGGCTTGGNONE 
J065105J24AAATGGGCTTGGNONE 
J065128D18AAATGGGCTTGGNONE 
J065155D13AAATGGGCTTGGNONE 
J065200C11AAATGGGCTTGGNONE 
Os01g0348600AK062168TCAGCCCATTTNONE 
AK099063TCAGCCCATTTNONE 
J013157A11TCAGCCCATTTNONE 
Os01g0358300AK060388AAATGGGCTGGGNONE 
AK072081AAATGGGCTGGGTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11CCCAGCCCATTTNONE 
006-083-B11CCCAGCCCATTTNONE 
006-083-C09CCCAGCCCATTTNONE 
006-088-H03CCCAGCCCATTTNONE 
006-102-H05CCCAGCCCATTTNONE 
AK061826CCCAGCCCATTTSimilar to 40S ribosomal protein S4. 
J013105M07CCCAGCCCATTTNONE 
J013155A16CCCAGCCCATTTNONE 
J033025C03CCCAGCCCATTTNONE 
J033072L20CCCAGCCCATTTNONE 
J033095I15CCCAGCCCATTTNONE 
J033105E03CCCAGCCCATTTNONE 
J033112G18CCCAGCCCATTTNONE 
J033125D09CCCAGCCCATTTNONE 
J065100L16CCCAGCCCATTTNONE 
J065176I05CCCAGCCCATTTNONE 
J090001C14CCCAGCCCATTTNONE 
J090058E15CCCAGCCCATTTNONE 
J090068F07CCCAGCCCATTTNONE 
Os01g0495900AK065221TAATGGGCTTTTSimilar to CRS2-associated factor 1. 
Os01g0558500AK099982TAATGGGCTTTTGGGCCCAGCCPWWP domain containing protein. 
J065096J12TAATGGGCTTTTGGGCCCAGCCNONE 
Os01g0678700AK111611AAATGGGCTGTDP protein. 
AY224529AAATGGGCTGTNONE 
Os01g0681900AB008845AATGGGCTTANADH dependent Glutamate Synthase precursor (EC 1.4.1.14). 
AK105755AATGGGCTTANONE 
Os01g0686800006-098-B12AATGGGCTGCNONE 
006-098-B12GCAGCCCATTTNONE 
006-113-H04AATGGGCTGCNONE 
006-113-H04GCAGCCCATTTNONE 
AK060428AATGGGCTGCNONE 
AK060428GCAGCCCATTTNONE 
AK098877AATGGGCTGCNONE 
AK098877GCAGCCCATTTNONE 
AK098893AATGGGCTGCNONE 
AK098893GCAGCCCATTTNONE 
AK121587AATGGGCTGCGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
AK121587GCAGCCCATTTGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231AATGGGCTGCNONE 
D38231GCAGCCCATTTNONE 
J013001E12AATGGGCTGCNONE 
J013001E12GCAGCCCATTTNONE 
J013001N15AATGGGCTGCNONE 
J013001N15GCAGCCCATTTNONE 
J013098G22AATGGGCTGCNONE 
J013098G22GCAGCCCATTTNONE 
J023004P15AATGGGCTGCNONE 
J023004P15GCAGCCCATTTNONE 
J023014D09AATGGGCTGCNONE 
J023014D09GCAGCCCATTTNONE 
J023020G09AATGGGCTGCNONE 
J023020G09GCAGCCCATTTNONE 
J023034A19AATGGGCTGCNONE 
J023034A19GCAGCCCATTTNONE 
J023050I11AATGGGCTGCNONE 
J023050I11GCAGCCCATTTNONE 
J023079D13AATGGGCTGCNONE 
J023079D13GCAGCCCATTTNONE 
J023091B11AATGGGCTGCNONE 
J023091B11GCAGCCCATTTNONE 
J023099M03AATGGGCTGCNONE 
J023099M03GCAGCCCATTTNONE 
J023101H20AATGGGCTGCNONE 
J023101H20GCAGCCCATTTNONE 
J023106P14AATGGGCTGCNONE 
J023106P14GCAGCCCATTTNONE 
J023111F19AATGGGCTGCNONE 
J023111F19GCAGCCCATTTNONE 
J023132C22AATGGGCTGCNONE 
J023132C22GCAGCCCATTTNONE 
J023139O03AATGGGCTGCNONE 
J023139O03GCAGCCCATTTNONE 
J023146O10AATGGGCTGCNONE 
J023146O10GCAGCCCATTTNONE 
J033022G16AATGGGCTGCNONE 
J033022G16GCAGCCCATTTNONE 
J033030C10AATGGGCTGCNONE 
J033030C10GCAGCCCATTTNONE 
J033032G18AATGGGCTGCNONE 
J033032G18GCAGCCCATTTNONE 
J033034N09AATGGGCTGCNONE 
J033034N09GCAGCCCATTTNONE 
J033037K24AATGGGCTGCNONE 
J033037K24GCAGCCCATTTNONE 
J033038B22AATGGGCTGCNONE 
J033038B22GCAGCCCATTTNONE 
J033061E06AATGGGCTGCNONE 
J033061E06GCAGCCCATTTNONE 
J033065F08AATGGGCTGCNONE 
J033065F08GCAGCCCATTTNONE 
J033065I24AATGGGCTGCNONE 
J033065I24GCAGCCCATTTNONE 
J033069L01AATGGGCTGCNONE 
J033069L01GCAGCCCATTTNONE 
J033086N21AATGGGCTGCNONE 
J033086N21GCAGCCCATTTNONE 
J033102I06AATGGGCTGCNONE 
J033102I06GCAGCCCATTTNONE 
J033111N07AATGGGCTGCNONE 
J033111N07GCAGCCCATTTNONE 
J033118K11AATGGGCTGCNONE 
J033118K11GCAGCCCATTTNONE 
J033125D08AATGGGCTGCNONE 
J033125D08GCAGCCCATTTNONE 
J033129P22AATGGGCTGCNONE 
J033129P22GCAGCCCATTTNONE 
J033131L12AATGGGCTGCNONE 
J033131L12GCAGCCCATTTNONE 
J033139D08AATGGGCTGCNONE 
J033139D08GCAGCCCATTTNONE 
J033141J08AATGGGCTGCNONE 
J033141J08GCAGCCCATTTNONE 
J043024B14AATGGGCTGCNONE 
J043024B14GCAGCCCATTTNONE 
J053048G19AATGGGCTGCNONE 
J053048G19GCAGCCCATTTNONE 
J065023B15AATGGGCTGCNONE 
J065023B15GCAGCCCATTTNONE 
J065082C15AATGGGCTGCNONE 
J065082C15GCAGCCCATTTNONE 
J065087D24AATGGGCTGCNONE 
J065087D24GCAGCCCATTTNONE 
J065122D11AATGGGCTGCNONE 
J065122D11GCAGCCCATTTNONE 
J065128P13AATGGGCTGCNONE 
J065128P13GCAGCCCATTTNONE 
J065149I19AATGGGCTGCNONE 
J065149I19GCAGCCCATTTNONE 
J065154E16AATGGGCTGCNONE 
J065154E16GCAGCCCATTTNONE 
J065156K21AATGGGCTGCNONE 
J065156K21GCAGCCCATTTNONE 
J065166H09AATGGGCTGCNONE 
J065166H09GCAGCCCATTTNONE 
J065169F24AATGGGCTGCNONE 
J065169F24GCAGCCCATTTNONE 
J065194I16AATGGGCTGCNONE 
J065194I16GCAGCCCATTTNONE 
J065213M20AATGGGCTGCNONE 
J065213M20GCAGCCCATTTNONE 
J075020F19AATGGGCTGCNONE 
J075020F19GCAGCCCATTTNONE 
J075051J16AATGGGCTGCNONE 
J075051J16GCAGCCCATTTNONE 
J075093C18AATGGGCTGCNONE 
J075093C18GCAGCCCATTTNONE 
J075119H02AATGGGCTGCNONE 
J075119H02GCAGCCCATTTNONE 
J075120J11AATGGGCTGCNONE 
J075120J11GCAGCCCATTTNONE 
J075173A15AATGGGCTGCNONE 
J075173A15GCAGCCCATTTNONE 
J080302B05AATGGGCTGCNONE 
J080302B05GCAGCCCATTTNONE 
J080304G10AATGGGCTGCNONE 
J080304G10GCAGCCCATTTNONE 
J080305E13AATGGGCTGCNONE 
J080305E13GCAGCCCATTTNONE 
J080315L11AATGGGCTGCNONE 
J080315L11GCAGCCCATTTNONE 
J090005H15AATGGGCTGCNONE 
J090005H15GCAGCCCATTTNONE 
J090021C24AATGGGCTGCNONE 
J090021C24GCAGCCCATTTNONE 
J090025H24AATGGGCTGCNONE 
J090025H24GCAGCCCATTTNONE 
J090025M11AATGGGCTGCNONE 
J090025M11GCAGCCCATTTNONE 
J090026C22AATGGGCTGCNONE 
J090026C22GCAGCCCATTTNONE 
J090027H15AATGGGCTGCNONE 
J090027H15GCAGCCCATTTNONE 
J090034B17AATGGGCTGCNONE 
J090034B17GCAGCCCATTTNONE 
J090045G11AATGGGCTGCNONE 
J090045G11GCAGCCCATTTNONE 
J090048H02AATGGGCTGCNONE 
J090048H02GCAGCCCATTTNONE 
J090051N04AATGGGCTGCNONE 
J090051N04GCAGCCCATTTNONE 
J090052I06AATGGGCTGCNONE 
J090052I06GCAGCCCATTTNONE 
J090054L17AATGGGCTGCNONE 
J090054L17GCAGCCCATTTNONE 
J090060M22AATGGGCTGCNONE 
J090060M22GCAGCCCATTTNONE 
J090075N17AATGGGCTGCNONE 
J090075N17GCAGCCCATTTNONE 
J090079K13AATGGGCTGCNONE 
J090079K13GCAGCCCATTTNONE 
J090086H08AATGGGCTGCNONE 
J090086H08GCAGCCCATTTNONE 
J090094N20AATGGGCTGCNONE 
J090094N20GCAGCCCATTTNONE 
J100021F03AATGGGCTGCNONE 
J100021F03GCAGCCCATTTNONE 
J100031M01AATGGGCTGCNONE 
J100031M01GCAGCCCATTTNONE 
J100033I18AATGGGCTGCNONE 
J100033I18GCAGCCCATTTNONE 
J100034P07AATGGGCTGCNONE 
J100034P07GCAGCCCATTTNONE 
J100043M16AATGGGCTGCNONE 
J100043M16GCAGCCCATTTNONE 
J100046J12AATGGGCTGCNONE 
J100046J12GCAGCCCATTTNONE 
J100055F09AATGGGCTGCNONE 
J100055F09GCAGCCCATTTNONE 
J100057D19AATGGGCTGCNONE 
J100057D19GCAGCCCATTTNONE 
J100060O10AATGGGCTGCNONE 
J100060O10GCAGCCCATTTNONE 
J100064G09AATGGGCTGCNONE 
J100064G09GCAGCCCATTTNONE 
J100077F24AATGGGCTGCNONE 
J100077F24GCAGCCCATTTNONE 
J100080E12AATGGGCTGCNONE 
J100080E12GCAGCCCATTTNONE 
J100089J04AATGGGCTGCNONE 
J100089J04GCAGCCCATTTNONE 
Os01g0727900AK102017AATGGGCTConserved hypothetical protein. 
J033080F19AATGGGCTNONE 
Os01g0838300J090017B22AGCCCATTNONE 
J090061B04AGCCCATTNONE 
Os01g0838800AK066366AATGGGCTNONE 
AK073775AATGGGCTClathrin adaptor complex, small chain family protein. 
J013067M01AATGGGCTNONE 
J033030I24AATGGGCTNONE 
J090089A10AATGGGCTNONE 
Os01g0847700AK103729GCCCATAATGGGCTGTSimilar to Aldose reductase. 
J033031B19GCCCATAATGGGCTGTNONE 
J065110K09GCCCATAATGGGCTGTNONE 
J065135H06GCCCATAATGGGCTGTNONE 
J075015H10GCCCATAATGGGCTGTNONE 
Os01g0850400AJ575220AAAAGCCCATTTNONE 
AK108582AAAAGCCCATTTSimilar to MYBY1 protein (Fragment). 
Os01g0872100AK099405TCAGCCCATTATGF-beta receptor, type I/II extracellular region family protein. 
J013001K17TCAGCCCATTANONE 
Os01g0874800016-042-F01AAATGGGCTTTTGGCCCATAANONE 
AK065916AAATGGGCTTTTGGCCCATAANONE 
AK065991AAATGGGCTTTTGGCCCATAANONE 
AK103577AAATGGGCTTTTGGCCCATAANONE 
AK105063AAATGGGCTTTTGGCCCATAA5'-3' exonuclease domain containing protein. 
AK119315AAATGGGCTTTTGGCCCATAANONE 
J023106C06AAATGGGCTTTTGGCCCATAANONE 
J053023A11AAATGGGCTTTTGGCCCATAANONE 
J053068H13AAATGGGCTTTTGGCCCATAANONE 
J053071O13AAATGGGCTTTTGGCCCATAANONE 
J053074M10AAATGGGCTTTTGGCCCATAANONE 
Os01g0891400J065077E24AAAGCCCATTConserved hypothetical protein. 
J065206I07AAAGCCCATTNONE 
Os01g0912600009-186-H02AGCCCATTTNONE 
AK063179AGCCCATTTConserved hypothetical protein. 
Os01g0938900006-059-H02GACGGCCCAGCCCATTTNONE 
009-074-D12GACGGCCCAGCCCATTTNONE 
AK059437GACGGCCCAGCCCATTTNONE 
AK101971GACGGCCCAGCCCATTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK109341GACGGCCCAGCCCATTTNONE 
J023121P08GACGGCCCAGCCCATTTNONE 
J033046G24GACGGCCCAGCCCATTTNONE 
J033048E04GACGGCCCAGCCCATTTNONE 
J033048F04GACGGCCCAGCCCATTTNONE 
J033076L24GACGGCCCAGCCCATTTNONE 
J065173H07GACGGCCCAGCCCATTTNONE 
J065184H09GACGGCCCAGCCCATTTNONE 
Os01g0958100AK058574AAATGGGCTNONE 
AK103090AAATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369AAATGGGCTNONE 
Os02g0119300AK065427AGCCCATTTPeptidase M14, carboxypeptidase A family protein. 
Os02g0168500011-010-B05AAATGGGCTNONE 
AJ831493AAATGGGCTNONE 
AK073338AAATGGGCTNONE 
AK073486AAATGGGCTConserved hypothetical protein. 
J100059F05AAATGGGCTNONE 
J100082K14AAATGGGCTNONE 
J100090P09AAATGGGCTNONE 
Os02g0177500009-106-B06AAATGGGCTGTGGCCCATCGNONE 
AK062715AAATGGGCTGTGGCCCATCGSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
J065049F10AAATGGGCTGTGGCCCATCGNONE 
J065063L16AAATGGGCTGTGGCCCATCGNONE 
J065102P06AAATGGGCTGTGGCCCATCGNONE 
J065137A16AAATGGGCTGTGGCCCATCGNONE 
J065212M11AAATGGGCTGTGGCCCATCGNONE 
Os02g0215200012-043-E08AGCCCATTNONE 
AF513383AGCCCATTNONE 
AK064000AGCCCATTSimilar to Histone deacetylase (Fragment). 
AK103097AGCCCATTNONE 
J033118M13AGCCCATTNONE 
J033125F03AGCCCATTNONE 
J053045B08AGCCCATTNONE 
J053048M04AGCCCATTNONE 
J065047A12AGCCCATTNONE 
Os02g0250600J075143F23AAATGGGCTTCATGGGCCGCLate embryogenesis abundant protein repeat containing protein. 
Os02g0467200014-053-H06CACGTCACAAAAGCCCATTNONE 
AK063704CACGTCACAAAAGCCCATTConserved hypothetical protein. 
J065197J05CACGTCACAAAAGCCCATTNONE 
Os02g0516600AK058519AGCCCATTNONE 
Os02g0531450J065097O14TAATGGGCTHypothetical protein. 
J075155C16TAATGGGCTNONE 
Os02g0584900AK102041AGCCCATTTConserved hypothetical protein. 
J013156E02AGCCCATTTNONE 
J033081H13AGCCCATTTNONE 
J033120M20AGCCCATTTNONE 
J080005N16AGCCCATTTNONE 
J080061N19AGCCCATTTNONE 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0658300AK073923ACAGCCCATTAConserved hypothetical protein. 
J065152M15ACAGCCCATTANONE 
Os02g0672600AK070286AAATGGGCTSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174AAATGGGCTNONE 
Os02g0732900AK065796GCAGCCCATTACGGCCCProtein of unknown function DUF794, plant family protein. 
AK104342GCAGCCCATTACGGCCCNONE 
Os02g0740300AK067833TAAGCCCATTTTGGGCCTGAAA ATPase domain containing protein. 
Os02g0755600014-024-D06AATGGGCTNONE 
015-039-F09AATGGGCTNONE 
AK064105AATGGGCTNONE 
AK106639AATGGGCTSimilar to UDP-glucuronosyltransferase. 
Os02g0775200AB038319AAATGGGCTGGGCCCATANONE 
AK069984AAATGGGCTGGGCCCATASimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAATGGGCTGGGCCCATANONE 
Os02g0787100Os02g0787100AGCCCATTAProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os03g0100400AK068556TAATGGGCTNONE 
AK121880TAATGGGCTSimilar to DNA repair endonuclease UVH1 (EC 3.1.-.-) (Ultraviolet hypersensitive 1) (AtRAD1) (DNA excision repair protein XP-F homolog). 
Os03g0115200009-112-E09AGCCCATTANONE 
AK071287AGCCCATTASimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06AGCCCATTANONE 
J065075D17AGCCCATTANONE 
J065108G15AGCCCATTANONE 
J065165A16AGCCCATTANONE 
J075015O12AGCCCATTANONE 
J075022O06AGCCCATTANONE 
J075031H14AGCCCATTANONE 
J075033D10AGCCCATTANONE 
J075070A04AGCCCATTANONE 
J075127A05AGCCCATTANONE 
J100070B16AGCCCATTANONE 
Os03g0125700009-132-G03AAATGGGCCTTAAAGCCCATTTNONE 
AK062913AAATGGGCCTTAAAGCCCATTTConserved hypothetical protein. 
J075046C16AAATGGGCCTTAAAGCCCATTTNONE 
J075115L05AAATGGGCCTTAAAGCCCATTTNONE 
J075143I05AAATGGGCCTTAAAGCCCATTTNONE 
J075197O07AAATGGGCCTTAAAGCCCATTTNONE 
Os03g0143400AK073999AAAGCCCATTTSimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21AAAGCCCATTTNONE 
J033073C08AAAGCCCATTTNONE 
J033094C19AAAGCCCATTTNONE 
J065017L10AAAGCCCATTTNONE 
J065070H22AAAGCCCATTTNONE 
J065079M09AAAGCCCATTTNONE 
J065091N18AAAGCCCATTTNONE 
J065109N03AAAGCCCATTTNONE 
J065113F05AAAGCCCATTTNONE 
J065135D23AAAGCCCATTTNONE 
J065156L16AAAGCCCATTTNONE 
J065207O04AAAGCCCATTTNONE 
J065208F03AAAGCCCATTTNONE 
J090010M15AAAGCCCATTTNONE 
J090056J18AAAGCCCATTTNONE 
Os03g0149400AK111396AGCCCATTProtein prenyltransferase domain containing protein. 
Os03g0151500AK109181TCAGCCCATTConserved hypothetical protein. 
Os03g0156600014-033-H04TCAGCCCATTNONE 
014-051-C04TCAGCCCATTNONE 
AK105367TCAGCCCATTSimilar to Farnesylated protein (ATFP6). 
Os03g0168200AK099530AGCCCATTTConserved hypothetical protein. 
Os03g0192400009-081-A03TAAGCCCATTANONE 
009-159-B02TAAGCCCATTANONE 
AK070573TAAGCCCATTAGRIM-19 family protein. 
J023056B01TAAGCCCATTANONE 
J023075G06TAAGCCCATTANONE 
J033048K16TAAGCCCATTANONE 
J033048L16TAAGCCCATTANONE 
J053031H23TAAGCCCATTANONE 
J065002H14TAAGCCCATTANONE 
J065006G22TAAGCCCATTANONE 
J065032G13TAAGCCCATTANONE 
J065056A09TAAGCCCATTANONE 
J065078I01TAAGCCCATTANONE 
J065095G01TAAGCCCATTANONE 
J065095I18TAAGCCCATTANONE 
J065134M18TAAGCCCATTANONE 
J065158P07TAAGCCCATTANONE 
J065165K17TAAGCCCATTANONE 
J065181J12TAAGCCCATTANONE 
J065189N09TAAGCCCATTANONE 
J065200D13TAAGCCCATTANONE 
J065202H20TAAGCCCATTANONE 
J065215K20TAAGCCCATTANONE 
J075049N19TAAGCCCATTANONE 
J075147J16TAAGCCCATTANONE 
J090081E19TAAGCCCATTANONE 
J100017C16TAAGCCCATTANONE 
J100039M16TAAGCCCATTANONE 
J100043E23TAAGCCCATTANONE 
J100063L12TAAGCCCATTANONE 
J100079F22TAAGCCCATTANONE 
Os03g0216400016-073-D08AGCCCATTNONE 
AK106498AGCCCATTTetratricopeptide-like helical domain containing protein. 
Os03g0231950J075103H14AAAGCCCATTConserved hypothetical protein. 
Os03g0257900009-150-G06AGCCCATTTNONE 
009-181-H05AGCCCATTTNONE 
AK063892AGCCCATTTNONE 
AK100114AGCCCATTTSimilar to Lectin-like receptor kinase 7;2. 
AK103486AGCCCATTTNONE 
J023006K11AGCCCATTTNONE 
J075005E15AGCCCATTTNONE 
J075007K24AGCCCATTTNONE 
J075034G06AGCCCATTTNONE 
J075051I19AGCCCATTTNONE 
J075076A08AGCCCATTTNONE 
J075096H04AGCCCATTTNONE 
J075115I09AGCCCATTTNONE 
J075132K23AGCCCATTTNONE 
J075147C17AGCCCATTTNONE 
J090059O20AGCCCATTTNONE 
Os03g0270200012-009-A03GAAGCCCATTNONE 
AK066896GAAGCCCATTNONE 
AK102826GAAGCCCATTSplicing factor PWI domain containing protein. 
J013042L05GAAGCCCATTNONE 
J013091L22GAAGCCCATTNONE 
J013096P13GAAGCCCATTNONE 
J013118M15GAAGCCCATTNONE 
J013151N20GAAGCCCATTNONE 
J033061D07GAAGCCCATTNONE 
J033086L04GAAGCCCATTNONE 
J033099J11GAAGCCCATTNONE 
J033109C10GAAGCCCATTNONE 
J033116F13GAAGCCCATTNONE 
J065019F13GAAGCCCATTNONE 
J065089O14GAAGCCCATTNONE 
J065158D07GAAGCCCATTNONE 
J065160G19GAAGCCCATTNONE 
J065168N10GAAGCCCATTNONE 
J065208E17GAAGCCCATTNONE 
J075001A15GAAGCCCATTNONE 
J075010G15GAAGCCCATTNONE 
J075016L23GAAGCCCATTNONE 
J075019A06GAAGCCCATTNONE 
J075023B13GAAGCCCATTNONE 
J075032P15GAAGCCCATTNONE 
J075045F05GAAGCCCATTNONE 
J075053O13GAAGCCCATTNONE 
J075057P06GAAGCCCATTNONE 
J075061C19GAAGCCCATTNONE 
J075078B10GAAGCCCATTNONE 
J075086A20GAAGCCCATTNONE 
J075127A16GAAGCCCATTNONE 
J075128E07GAAGCCCATTNONE 
J075129C06GAAGCCCATTNONE 
J075130M14GAAGCCCATTNONE 
J075136H13GAAGCCCATTNONE 
J075149M17GAAGCCCATTNONE 
J075156L08GAAGCCCATTNONE 
J075160P12GAAGCCCATTNONE 
J075164J01GAAGCCCATTNONE 
J075173N05GAAGCCCATTNONE 
J075177O03GAAGCCCATTNONE 
J075188K11GAAGCCCATTNONE 
J090009A02GAAGCCCATTNONE 
J090019O12GAAGCCCATTNONE 
J090065H05GAAGCCCATTNONE 
J090067E24GAAGCCCATTNONE 
J090080C03GAAGCCCATTNONE 
J090090A04GAAGCCCATTNONE 
J090098D13GAAGCCCATTNONE 
J100060D03GAAGCCCATTNONE 
J100062D05GAAGCCCATTNONE 
J100074A08GAAGCCCATTNONE 
Os03g0282900006-088-H05TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
AK061166TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
AK102161TAATGGGCCTAGCCCATTTAGGCCCATTTConserved hypothetical protein. 
AK104514TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
Os03g0288900AK100329AGCCCATTConserved hypothetical protein. 
J023080H15AGCCCATTNONE 
J033136I21AGCCCATTNONE 
J065036A16AGCCCATTNONE 
J065186A16AGCCCATTNONE 
J065187B08AGCCCATTNONE 
J065202E24AGCCCATTNONE 
Os03g0332700AK072820TAAGCCCATTAGGCCCATAASimilar to ABC Transporter, ATP binding component. 
Os03g0338600AK066604TCAGCCCATTAtRNA pseudouridine synthase family protein. 
Os03g0569800AK070080CCCATCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK120873CCCATCCAGCCCATTANONE 
Os03g0577000012-055-F04AAAGCCCAATGGGCTTTNONE 
AK061051AAAGCCCAATGGGCTTTSimilar to Ribosomal protein S3 (Fragment). 
AK099146AAAGCCCAATGGGCTTTNONE 
J065060A01AAAGCCCAATGGGCTTTNONE 
J075079B17AAAGCCCAATGGGCTTTNONE 
J075134K12AAAGCCCAATGGGCTTTNONE 
J090048F23AAAGCCCAATGGGCTTTNONE 
J090072I19AAAGCCCAATGGGCTTTNONE 
J100087C19AAAGCCCAATGGGCTTTNONE 
J100090C21AAAGCCCAATGGGCTTTNONE 
Os03g0598200AK068322AATGGGCTNop14-like protein family protein. 
Os03g0634000014-034-A03AGCCCATTTNONE 
AK063673AGCCCATTTSimilar to THA4. 
Os03g0640800AF139210AATGGGCTGANONE 
J023022K02AATGGGCTGANONE 
J023030J24AATGGGCTGANONE 
J023062H06AATGGGCTGANONE 
J033023I12AATGGGCTGANONE 
J033023O07AATGGGCTGANONE 
J033040B18AATGGGCTGANONE 
J033041D08AATGGGCTGANONE 
J033046C22AATGGGCTGANONE 
J033052G04AATGGGCTGANONE 
J033055N17AATGGGCTGANONE 
J033068L18AATGGGCTGANONE 
J033070G21AATGGGCTGANONE 
J033071E05AATGGGCTGANONE 
J033071P14AATGGGCTGANONE 
J033072G03AATGGGCTGANONE 
J033073P10AATGGGCTGANONE 
J033076F02AATGGGCTGANONE 
J033080E23AATGGGCTGANONE 
J033089G17AATGGGCTGANONE 
J033095O20AATGGGCTGANONE 
J033103M02AATGGGCTGANONE 
J033108C06AATGGGCTGANONE 
J033109O14AATGGGCTGANONE 
J033114C01AATGGGCTGANONE 
J033121K12AATGGGCTGANONE 
J033123G23AATGGGCTGANONE 
J033124M18AATGGGCTGANONE 
J033132J15AATGGGCTGANONE 
J033140L20AATGGGCTGANONE 
J065165E15AATGGGCTGANONE 
J065217L02AATGGGCTGANONE 
J090040H05AATGGGCTGANONE 
J090073L17AATGGGCTGANONE 
J090091D11AATGGGCTGANONE 
Os03g0699700AB099850AATGGGCT9-lipoxigenase. 
AK103565AATGGGCTNONE 
J033041M05AATGGGCTNONE 
J033074I05AATGGGCTNONE 
J033105I23AATGGGCTNONE 
J033126I24AATGGGCTNONE 
J033132L12AATGGGCTNONE 
Os03g0701900AK068404AAATGGGCTTTTConserved hypothetical protein. 
Os03g0725300011-085-E09TAATGGGCTTCNONE 
AK063969TAATGGGCTTCSimilar to Dbr1-prov protein. 
AK073636TAATGGGCTTCNONE 
J033050L15TAATGGGCTTCNONE 
J053082G03TAATGGGCTTCNONE 
Os03g0746400AK063445CCCAGCCCATACCAGCCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK070923CCCAGCCCATACCAGCCCAGCCCATTANONE 
J065008K24CCCAGCCCATACCAGCCCAGCCCATTANONE 
Os03g0749900006-112-A05CCAGCCCATTGAGGCCCATGGGCTNONE 
AK061252CCAGCCCATTGAGGCCCATGGGCTConserved hypothetical protein. 
J023020I01CCAGCCCATTGAGGCCCATGGGCTNONE 
J033060N21CCAGCCCATTGAGGCCCATGGGCTNONE 
Os03g0766000AK070596GAAGCCCATTANONE 
AK104743GAAGCCCATTANONE 
AK106079GAAGCCCATTANONE 
J013063M09GAAGCCCATTANONE 
J023056A03GAAGCCCATTANONE 
J043038L07GAAGCCCATTANONE 
J053067N16GAAGCCCATTANONE 
J053073G09GAAGCCCATTANONE 
J053075I19GAAGCCCATTANONE 
Os03g0770900AK106660CCAACGGCTAATGGGCTConserved hypothetical protein. 
Os03g0786000AK061286ACAGCCCATTAConserved hypothetical protein. 
AK073187ACAGCCCATTANONE 
Os03g0793100AK067897AATGGGCTGlycosyl transferase, family 43 protein. 
J033125G24AATGGGCTNONE 
J065132N21AATGGGCTNONE 
Os03g0807800AK064984AATGGGCTTASimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14AATGGGCTTANONE 
J065015J20AATGGGCTTANONE 
J065122L11AATGGGCTTANONE 
J065217E10AATGGGCTTANONE 
J075023C02AATGGGCTTANONE 
J075102O04AATGGGCTTANONE 
J080024G24AATGGGCTTANONE 
J080033F02AATGGGCTTANONE 
J080047M13AATGGGCTTANONE 
J080048A22AATGGGCTTANONE 
J080056E06AATGGGCTTANONE 
J080064O11AATGGGCTTANONE 
Os03g0809300011-024-C02AAAGCCCATTTNONE 
016-071-E09AAAGCCCATTTNONE 
AK103140AAAGCCCATTTProtein phosphatase 2C-like domain containing protein. 
J013030O08AAAGCCCATTTNONE 
J013108D19AAAGCCCATTTNONE 
J013124D15AAAGCCCATTTNONE 
J013128F17AAAGCCCATTTNONE 
J013146J06AAAGCCCATTTNONE 
J013149D12AAAGCCCATTTNONE 
J013154P12AAAGCCCATTTNONE 
J013162N01AAAGCCCATTTNONE 
J013170G15AAAGCCCATTTNONE 
J013170H16AAAGCCCATTTNONE 
J023022I09AAAGCCCATTTNONE 
J023072B19AAAGCCCATTTNONE 
J023106H09AAAGCCCATTTNONE 
J023135C03AAAGCCCATTTNONE 
J023141C09AAAGCCCATTTNONE 
J033091K23AAAGCCCATTTNONE 
J033107I05AAAGCCCATTTNONE 
J033112M18AAAGCCCATTTNONE 
J033120G10AAAGCCCATTTNONE 
J033144G06AAAGCCCATTTNONE 
J043017L21AAAGCCCATTTNONE 
J043024O10AAAGCCCATTTNONE 
J053023K04AAAGCCCATTTNONE 
J053035D01AAAGCCCATTTNONE 
J053037P10AAAGCCCATTTNONE 
J053042K15AAAGCCCATTTNONE 
J053047C14AAAGCCCATTTNONE 
J053054A06AAAGCCCATTTNONE 
J053071H03AAAGCCCATTTNONE 
J053073G08AAAGCCCATTTNONE 
J053090D04AAAGCCCATTTNONE 
J053095E17AAAGCCCATTTNONE 
J090007O03AAAGCCCATTTNONE 
J090024G24AAAGCCCATTTNONE 
J090042M08AAAGCCCATTTNONE 
J090045I16AAAGCCCATTTNONE 
J090051E13AAAGCCCATTTNONE 
J090073B15AAAGCCCATTTNONE 
J090096F19AAAGCCCATTTNONE 
J100030M23AAAGCCCATTTNONE 
Os03g0811800AK063320ACTGGGCCACTAATGGGCTTGGRibosomal protein L36 family protein. 
J065094F18ACTGGGCCACTAATGGGCTTGGNONE 
J090029B04ACTGGGCCACTAATGGGCTTGGNONE 
Os03g0851900AK102145TCAGCCCATTAAFG1-like ATPase family protein. 
J033086B08TCAGCCCATTANONE 
Os03g0854000009-186-C03TAATGGGCTGGNONE 
AK061374TAATGGGCTGGProtein of unknown function UPF0131 family protein. 
J065138B11TAATGGGCTGGNONE 
Os03g0855600006-029-G09TAATGGGCTTTNONE 
006-033-E02TAATGGGCTTTNONE 
006-069-G07TAATGGGCTTTNONE 
006-083-A02TAATGGGCTTTNONE 
006-098-H04TAATGGGCTTTNONE 
009-054-C04TAATGGGCTTTNONE 
AK060030TAATGGGCTTTNONE 
AK061467TAATGGGCTTTConserved hypothetical protein. 
AK067858TAATGGGCTTTNONE 
AK106030TAATGGGCTTTNONE 
J013123A10TAATGGGCTTTNONE 
J065001I24TAATGGGCTTTNONE 
J065015N21TAATGGGCTTTNONE 
J065016H07TAATGGGCTTTNONE 
J065040A05TAATGGGCTTTNONE 
J065040F01TAATGGGCTTTNONE 
J065066G17TAATGGGCTTTNONE 
J065077I09TAATGGGCTTTNONE 
J065099M22TAATGGGCTTTNONE 
J065135B13TAATGGGCTTTNONE 
J065144H19TAATGGGCTTTNONE 
J065146I03TAATGGGCTTTNONE 
J065169E02TAATGGGCTTTNONE 
J065177D21TAATGGGCTTTNONE 
J065189L20TAATGGGCTTTNONE 
J065207H13TAATGGGCTTTNONE 
J065210D24TAATGGGCTTTNONE 
J065212I03TAATGGGCTTTNONE 
J075007E21TAATGGGCTTTNONE 
J075013H07TAATGGGCTTTNONE 
J075023K06TAATGGGCTTTNONE 
J075031D23TAATGGGCTTTNONE 
J075038K09TAATGGGCTTTNONE 
J075084C08TAATGGGCTTTNONE 
J075098K20TAATGGGCTTTNONE 
J090028E04TAATGGGCTTTNONE 
J090031E20TAATGGGCTTTNONE 
J090042F06TAATGGGCTTTNONE 
J090049L05TAATGGGCTTTNONE 
J090086G03TAATGGGCTTTNONE 
J090096J04TAATGGGCTTTNONE 
J100035O03TAATGGGCTTTNONE 
J100053H24TAATGGGCTTTNONE 
J100056L17TAATGGGCTTTNONE 
J100058K06TAATGGGCTTTNONE 
J100059G09TAATGGGCTTTNONE 
J100081C15TAATGGGCTTTNONE 
Os04g0334700AK109756AGCCCATTNONE 
AK120870AGCCCATTPeptidase A1, pepsin family protein. 
Os04g0437600AK061622CAAGCCCATTNONE 
Os04g0462900006-094-A02AGCCCATTANONE 
006-094-A02AGCCCATTTNONE 
006-097-F05AGCCCATTANONE 
006-097-F05AGCCCATTTNONE 
009-129-A10AGCCCATTANONE 
009-129-A10AGCCCATTTNONE 
015-042-F07AGCCCATTANONE 
015-042-F07AGCCCATTTNONE 
AK058481AGCCCATTANONE 
AK058481AGCCCATTTNONE 
AK059483AGCCCATTANONE 
AK059483AGCCCATTTNONE 
AK061324AGCCCATTANONE 
AK061324AGCCCATTTNONE 
AK099100AGCCCATTANONE 
AK099100AGCCCATTTNONE 
AK102579AGCCCATTANONE 
AK102579AGCCCATTTNONE 
AK106322AGCCCATTASimilar to Prohibitin. 
AK106322AGCCCATTTSimilar to Prohibitin. 
J065059J20AGCCCATTANONE 
J065059J20AGCCCATTTNONE 
J065085I02AGCCCATTANONE 
J065085I02AGCCCATTTNONE 
J065118N23AGCCCATTANONE 
J065118N23AGCCCATTTNONE 
J065208K24AGCCCATTANONE 
J065208K24AGCCCATTTNONE 
J075053B14AGCCCATTANONE 
J075053B14AGCCCATTTNONE 
J075097M22AGCCCATTANONE 
J075097M22AGCCCATTTNONE 
J075184B07AGCCCATTANONE 
J075184B07AGCCCATTTNONE 
J075194A15AGCCCATTANONE 
J075194A15AGCCCATTTNONE 
J080315G03AGCCCATTANONE 
J080315G03AGCCCATTTNONE 
J090088H19AGCCCATTANONE 
J090088H19AGCCCATTTNONE 
Os04g0473400AK067896GAAGCCCATTASimilar to 60S ribosomal protein L6-B (L17) (YL16) (RP18). 
J013123D20GAAGCCCATTANONE 
J033108A09GAAGCCCATTANONE 
J065196E24GAAGCCCATTANONE 
J100066B16GAAGCCCATTANONE 
Os04g0475300AK066351GCAGCCCATTAConserved hypothetical protein. 
J065138J21GCAGCCCATTANONE 
Os04g0476000Os04g0476000ACAGCCCATTTetratricopeptide-like helical domain containing protein. 
Os04g0498700AK059661AGCCCATTAHaem peroxidase family protein. 
AK121011AGCCCATTANONE 
Os04g0551800016-049-G12TAATGGGCTGGGCTNONE 
AK121568TAATGGGCTGGGCTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06TAATGGGCTGGGCTNONE 
J013111B11TAATGGGCTGGGCTNONE 
J013121H23TAATGGGCTGGGCTNONE 
J023012A17TAATGGGCTGGGCTNONE 
J023092M05TAATGGGCTGGGCTNONE 
J033026P14TAATGGGCTGGGCTNONE 
J033033C10TAATGGGCTGGGCTNONE 
J033033M10TAATGGGCTGGGCTNONE 
J033035C24TAATGGGCTGGGCTNONE 
J033052E19TAATGGGCTGGGCTNONE 
J033140K19TAATGGGCTGGGCTNONE 
J065036F18TAATGGGCTGGGCTNONE 
J065067L12TAATGGGCTGGGCTNONE 
J065095G09TAATGGGCTGGGCTNONE 
J065115B08TAATGGGCTGGGCTNONE 
J065218E24TAATGGGCTGGGCTNONE 
J090002N13TAATGGGCTGGGCTNONE 
J090008B12TAATGGGCTGGGCTNONE 
J090016F24TAATGGGCTGGGCTNONE 
J090019H14TAATGGGCTGGGCTNONE 
J090020G20TAATGGGCTGGGCTNONE 
J090029L18TAATGGGCTGGGCTNONE 
J090057C23TAATGGGCTGGGCTNONE 
J090073H23TAATGGGCTGGGCTNONE 
J090081C16TAATGGGCTGGGCTNONE 
J090081E21TAATGGGCTGGGCTNONE 
J090084L14TAATGGGCTGGGCTNONE 
J090086M01TAATGGGCTGGGCTNONE 
J090089E16TAATGGGCTGGGCTNONE 
J100031P12TAATGGGCTGGGCTNONE 
J100090N23TAATGGGCTGGGCTNONE 
Os04g0555900009-154-G03AAATGGGCTNONE 
AK063168AAATGGGCTPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
J065012D11AAATGGGCTNONE 
Os04g0556900015-052-H08AAATGGGCTNONE 
AK064112AAATGGGCTConserved hypothetical protein. 
Os04g0592500AK066893AAATGGGCTPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18AAATGGGCTNONE 
Os04g0625600AK070994AAATGGGCTTRAF-like domain containing protein. 
J023080H04AAATGGGCTNONE 
J023086H15AAATGGGCTNONE 
J033037L21AAATGGGCTNONE 
J033044P14AAATGGGCTNONE 
J065075C23AAATGGGCTNONE 
J065167C18AAATGGGCTNONE 
J100024E02AAATGGGCTNONE 
J100068N24AAATGGGCTNONE 
J100070G20AAATGGGCTNONE 
Os04g0634500AK071656AAAGCCCATTASimilar to S-receptor kinase-like protein 2. 
Os04g0650500AK066690AATGGGCTGGGCCTGAConserved hypothetical protein. 
AK104273AATGGGCTGGGCCTGANONE 
Os04g0658200J075021C22AAATGGGCTGCConserved hypothetical protein. 
Os04g0676100Os04g0676100AATGGGCTTCSimilar to Thioredoxin X, chloroplast precursor. 
Os04g0687900009-068-D03AATGGGCTNONE 
015-097-H12AATGGGCTNONE 
AK062547AATGGGCTNONE 
AK066910AATGGGCTNONE 
AK098928AATGGGCTSimilar to T24D18.17 protein (Tubby-like protein TULP8). 
AK104333AATGGGCTNONE 
J013023N16AATGGGCTNONE 
J013031I07AATGGGCTNONE 
J013063L06AATGGGCTNONE 
J013091C11AATGGGCTNONE 
J013123M06AATGGGCTNONE 
J013126D14AATGGGCTNONE 
J023023E09AATGGGCTNONE 
J023039C19AATGGGCTNONE 
J023068D23AATGGGCTNONE 
J023080C21AATGGGCTNONE 
J033092J17AATGGGCTNONE 
J033112P12AATGGGCTNONE 
J033135O08AATGGGCTNONE 
J053023C13AATGGGCTNONE 
J065030O05AATGGGCTNONE 
J065065P07AATGGGCTNONE 
J065190O06AATGGGCTNONE 
J090011M19AATGGGCTNONE 
J090061F08AATGGGCTNONE 
J090064H09AATGGGCTNONE 
J090064P11AATGGGCTNONE 
Os05g0103100AK103317AAATGGGCTGATGGGCTranslocon-associated beta family protein. 
J033125H15AAATGGGCTGATGGGCNONE 
J065021L01AAATGGGCTGATGGGCNONE 
J065029M01AAATGGGCTGATGGGCNONE 
J065089F17AAATGGGCTGATGGGCNONE 
J065112N04AAATGGGCTGATGGGCNONE 
J065163L03AAATGGGCTGATGGGCNONE 
J065175B04AAATGGGCTGATGGGCNONE 
J065192E02AAATGGGCTGATGGGCNONE 
J075046C20AAATGGGCTGATGGGCNONE 
J075192A01AAATGGGCTGATGGGCNONE 
J100018H13AAATGGGCTGATGGGCNONE 
J100067K20AAATGGGCTGATGGGCNONE 
J100080N03AAATGGGCTGATGGGCNONE 
Os05g0128100009-051-B07ACAGCCCATTTNONE 
009-051-B07TAATGGGCTTCNONE 
009-127-B08ACAGCCCATTTNONE 
009-127-B08TAATGGGCTTCNONE 
009-144-H03ACAGCCCATTTNONE 
009-144-H03TAATGGGCTTCNONE 
009-176-B05ACAGCCCATTTNONE 
009-176-B05TAATGGGCTTCNONE 
AK108556ACAGCCCATTTNONE 
AK108556TAATGGGCTTCNONE 
AK119308ACAGCCCATTTNONE 
AK119308TAATGGGCTTCNONE 
AK120934ACAGCCCATTTConserved hypothetical protein. 
AK120934TAATGGGCTTCConserved hypothetical protein. 
J023036J15ACAGCCCATTTNONE 
J023036J15TAATGGGCTTCNONE 
J065122L01ACAGCCCATTTNONE 
J065122L01TAATGGGCTTCNONE 
J075104P10ACAGCCCATTTNONE 
J075104P10TAATGGGCTTCNONE 
Os05g0132800AK108629AAATGGGCTConserved hypothetical protein. 
Os05g0150300AK100732TAAGCCCATTSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
Os05g0194600AK102487AATGGGCTATTGGGCCGAPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01AATGGGCTATTGGGCCGANONE 
J100041A08AATGGGCTATTGGGCCGANONE 
Os05g0363600AK108572TAATGGGCTTCConserved hypothetical protein. 
Os05g0387200AK060744AGCCCATTSimilar to UDP-sulfoquinovose synthase, chloroplast precursor (EC 3.13.1.1) (Sulfite:UDP-glucose sulfotransferase) (Sulfolipid biosynthesis protein) (SoSQD1). 
AK065310AGCCCATTNONE 
Os05g0392801J090025K15AGCCCATTConserved hypothetical protein. 
J090053E06AGCCCATTNONE 
Os05g0461000006-113-A06AATGGGCTTGNONE 
AB042259AATGGGCTTGNONE 
AK059189AATGGGCTTGNONE 
AK066739AATGGGCTTGClathrin adaptor complex, small chain family protein. 
AK099044AATGGGCTTGNONE 
AK104166AATGGGCTTGNONE 
Os05g0469900AK109700AAATGGGCTGGGConserved hypothetical protein. 
Os05g0480700AK100850TAATGGGCTSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11TAATGGGCTNONE 
Os05g0512500009-036-D05AAATGGGCTTCNONE 
AK062441AAATGGGCTTCCT20 family protein. 
J080003C10AAATGGGCTTCNONE 
J080046G11AAATGGGCTTCNONE 
Os05g0521500AK066030AATGGGCTPeptidase S16, lon N-terminal domain containing protein. 
Os05g0526300AK099438GAAGCCCATTANONE 
Os05g0541900009-130-F05TCAGCCCATTNONE 
009-200-E07TCAGCCCATTNONE 
013-057-G09TCAGCCCATTNONE 
Os05g0542600AK060408AGCCCATTTNONE 
AK101373AGCCCATTTMov34/MPN/PAD-1 family protein. 
J023081F17AGCCCATTTNONE 
J033035N15AGCCCATTTNONE 
J033124K20AGCCCATTTNONE 
Os06g0101600AF093636AATGGGCTGCNONE 
AK070447AATGGGCTGCPlastocyanin, chloroplast precursor. 
J065001A20AATGGGCTGCNONE 
J065019M17AATGGGCTGCNONE 
J065021H18AATGGGCTGCNONE 
J065061A17AATGGGCTGCNONE 
J065073L02AATGGGCTGCNONE 
J065099F17AATGGGCTGCNONE 
J065101C23AATGGGCTGCNONE 
J065121E23AATGGGCTGCNONE 
J065122N04AATGGGCTGCNONE 
J065141N05AATGGGCTGCNONE 
J065143N21AATGGGCTGCNONE 
J065161H09AATGGGCTGCNONE 
J065161J04AATGGGCTGCNONE 
J065162P20AATGGGCTGCNONE 
J065182K10AATGGGCTGCNONE 
J065184M05AATGGGCTGCNONE 
J065186H24AATGGGCTGCNONE 
J065189G21AATGGGCTGCNONE 
J065190N14AATGGGCTGCNONE 
J065191H08AATGGGCTGCNONE 
J065205H17AATGGGCTGCNONE 
J075001E03AATGGGCTGCNONE 
J075001H21AATGGGCTGCNONE 
J075003J23AATGGGCTGCNONE 
J075003K01AATGGGCTGCNONE 
J075005I11AATGGGCTGCNONE 
J075007F16AATGGGCTGCNONE 
J075017I11AATGGGCTGCNONE 
J075018O05AATGGGCTGCNONE 
J075019G24AATGGGCTGCNONE 
J075032D04AATGGGCTGCNONE 
J075032N13AATGGGCTGCNONE 
J075033C09AATGGGCTGCNONE 
J075033D11AATGGGCTGCNONE 
J075039A20AATGGGCTGCNONE 
J075058P12AATGGGCTGCNONE 
J075062E10AATGGGCTGCNONE 
J075062P16AATGGGCTGCNONE 
J075063C17AATGGGCTGCNONE 
J075066E07AATGGGCTGCNONE 
J075066I20AATGGGCTGCNONE 
J075075K21AATGGGCTGCNONE 
J075078F03AATGGGCTGCNONE 
J075082F10AATGGGCTGCNONE 
J075086G16AATGGGCTGCNONE 
J075087E07AATGGGCTGCNONE 
J075087K06AATGGGCTGCNONE 
J075087L04AATGGGCTGCNONE 
J075088B16AATGGGCTGCNONE 
J075088D02AATGGGCTGCNONE 
J075094H21AATGGGCTGCNONE 
J075094I24AATGGGCTGCNONE 
J075094K10AATGGGCTGCNONE 
J075095C18AATGGGCTGCNONE 
J075097B05AATGGGCTGCNONE 
J075099C13AATGGGCTGCNONE 
J075099H22AATGGGCTGCNONE 
J075099L16AATGGGCTGCNONE 
J075104K08AATGGGCTGCNONE 
J075118O06AATGGGCTGCNONE 
J075119E15AATGGGCTGCNONE 
J075124N06AATGGGCTGCNONE 
J075126G02AATGGGCTGCNONE 
J075127L24AATGGGCTGCNONE 
J075131E23AATGGGCTGCNONE 
J075140H06AATGGGCTGCNONE 
J075146I20AATGGGCTGCNONE 
J075146N24AATGGGCTGCNONE 
J075147I19AATGGGCTGCNONE 
J075155K07AATGGGCTGCNONE 
J075156C05AATGGGCTGCNONE 
J075161G07AATGGGCTGCNONE 
J075164G01AATGGGCTGCNONE 
J075170J18AATGGGCTGCNONE 
J075172G17AATGGGCTGCNONE 
J075176G10AATGGGCTGCNONE 
J075178C05AATGGGCTGCNONE 
J075179G01AATGGGCTGCNONE 
J075181E24AATGGGCTGCNONE 
J080029D19AATGGGCTGCNONE 
J080034L11AATGGGCTGCNONE 
J080039G07AATGGGCTGCNONE 
J080062M23AATGGGCTGCNONE 
J080302A01AATGGGCTGCNONE 
J100042I15AATGGGCTGCNONE 
J100043G22AATGGGCTGCNONE 
J100056L12AATGGGCTGCNONE 
J100061A12AATGGGCTGCNONE 
J100073O20AATGGGCTGCNONE 
J100082I08AATGGGCTGCNONE 
Os06g0116400006-082-G06AGCCCATTANONE 
AK058327AGCCCATTANONE 
AK105979AGCCCATTAHigh-affinity nickel-transporter family protein. 
J065083I24AGCCCATTANONE 
J100072O18AGCCCATTANONE 
Os06g0128400AK064390AATGGGCTGATAAGCCCATGGNONE 
AK121983AATGGGCTGATAAGCCCATGGWD40-like domain containing protein. 
Os06g0134300AK071534AAATGGGCTConserved hypothetical protein. 
J023106E03AAATGGGCTNONE 
J075172D02AAATGGGCTNONE 
J100047B13AAATGGGCTNONE 
Os06g0304500AK119441CCAGCCCATTACRS1/YhbY domain containing protein. 
AK119441GAAGCCCATTAAGGCCCACTCRS1/YhbY domain containing protein. 
J075143M24CCAGCCCATTANONE 
J075143M24GAAGCCCATTAAGGCCCACTNONE 
J075194D03CCAGCCCATTANONE 
J075194D03GAAGCCCATTAAGGCCCACTNONE 
Os06g0542200AK058589AGCCCATTTNADP oxidoreductase, coenzyme F420-dependent family protein. 
Os06g0581300AK070987CCAGCCCATTProtein of unknown function DUF1475 family protein. 
AK073185CCAGCCCATTNONE 
J065209C10CCAGCCCATTNONE 
J075060B03CCAGCCCATTNONE 
J075117M08CCAGCCCATTNONE 
J075126E04CCAGCCCATTNONE 
J075189G04CCAGCCCATTNONE 
J075189L16CCAGCCCATTNONE 
J100061E16CCAGCCCATTNONE 
Os06g0603400AK060002AGCCCATTTNONE 
AK102325AGCCCATTTNONE 
AK106905AGCCCATTTSimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
J090039I22AGCCCATTTNONE 
J100022N15AGCCCATTTNONE 
J100023E09AGCCCATTTNONE 
J100052D21AGCCCATTTNONE 
Os06g0607800012-010-G03AAATGGGCTGANONE 
AB070254AAATGGGCTGANONE 
AK063158AAATGGGCTGASimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695AAATGGGCTGANONE 
J013074G13AAATGGGCTGANONE 
J090015C16AAATGGGCTGANONE 
J090069H10AAATGGGCTGANONE 
Os06g0608500AK060097TAAGCCCATTNONE 
AK070667TAAGCCCATTSnf7 family protein. 
Os06g0646600AB061818AAATGGGCTKNOX family class 2 homeodomain protein. 
J023088C09AAATGGGCTNONE 
J065162G03AAATGGGCTNONE 
Os06g0646900AY222862GCGGCCCAATGGGCTGANONE 
Os06g0667600AK058606AAAAGCCCATTANONE 
AK058606AAAGCCCATTNONE 
AK071621AAAAGCCCATTASimilar to Glycine decarboxylase complex H-protein. 
AK071621AAAGCCCATTSimilar to Glycine decarboxylase complex H-protein. 
J023101D03AAAAGCCCATTANONE 
J023101D03AAAGCCCATTNONE 
J033095E17AAAAGCCCATTANONE 
J033095E17AAAGCCCATTNONE 
J065020B16AAAAGCCCATTANONE 
J065020B16AAAGCCCATTNONE 
Os06g0712500AK068531AAATGGGCTTTTSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os07g0130500AK066085TAATGGGCTNONE 
AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
AK068045TAATGGGCTNONE 
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
J013050A21TAATGGGCTNONE 
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
Os07g0133700J065005A21AAATGGGCTAATTGGGCCTTHypothetical protein. 
J065096D02AAATGGGCTAATTGGGCCTTNONE 
J065097G13AAATGGGCTAATTGGGCCTTNONE 
Os07g0155200006-036-E03AAAGCCCATTTAGGCCCAGCCNONE 
006-036-E04AAAGCCCATTTAGGCCCAGCCNONE 
AK061006AAAGCCCATTTAGGCCCAGCCProtein of unknown function DUF150 family protein. 
AK104606AAAGCCCATTTAGGCCCAGCCNONE 
Os07g0158300006-049-G04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK099188CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK104773CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013106F16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013123H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J03CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J033138N08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075011F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075022F10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075071L13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075094B08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075119B21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075140L02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075199O21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080001I17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080005M04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080011P17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026B14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026C12CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080030N16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080035K23CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080039J22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080045D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050C06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050K14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080051I09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053F18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053G10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080055F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080057E22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080058F17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080063C18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080065E02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080066E06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080067O05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080068N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080071O04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074A20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074E14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074L05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075E08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075H07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080078A07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080079H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080F20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080M22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081L04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080090K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080093O13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094A18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094E10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094H06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080096I21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J100081A19CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
Os07g0189400AK106788TAATGGGCTCyclin-like F-box domain containing protein. 
Os07g0242600AK065752AGCCCATTTAAGCCCACACyclin-like F-box domain containing protein. 
J013037K22AGCCCATTTAAGCCCACANONE 
Os07g0270900015-039-A02AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
AK068904AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J013169N21AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065039I11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065081J11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065162P04AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
Os07g0418600006-074-A11AATGGGCTGGTGGGCNONE 
009-043-A03AATGGGCTGGTGGGCNONE 
013-024-A10AATGGGCTGGTGGGCNONE 
AK105956AATGGGCTGGTGGGCConserved hypothetical protein. 
J065107I10AATGGGCTGGTGGGCNONE 
J075110E12AATGGGCTGGTGGGCNONE 
Os07g0475400AK102489AATGGGCTSimilar to Expansin-like protein A (Fragment). 
AY100694AATGGGCTNONE 
Os07g0506700AK073959AGCCCATTGGGCCAAWD40-like domain containing protein. 
Os07g0507300015-011-B09AGCCCATTTNONE 
AK102538AGCCCATTTSimilar to GCK-like kinase MIK. 
AK106514AGCCCATTTNONE 
J033033M12AGCCCATTTNONE 
J033044C06AGCCCATTTNONE 
J033129B15AGCCCATTTNONE 
Os07g0543000AB110196TCAGCCCATTANONE 
AK058889TCAGCCCATTASimilar to Helix-loop-helix-like protein (Fragment). 
Os07g0549200006-072-D03TCAGCCCATTNONE 
AK073657TCAGCCCATTNONE 
AK109365TCAGCCCATTProtein prenyltransferase domain containing protein. 
J033051K19TCAGCCCATTNONE 
J100084G13TCAGCCCATTNONE 
Os07g0568100AK099778AGCCCATTSimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0573800AK072835AATGGGCTPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
AK072835CCAGCCCATTPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
AK104154AATGGGCTNONE 
AK104154CCAGCCCATTNONE 
AK104308AATGGGCTNONE 
AK104308CCAGCCCATTNONE 
AK107962AATGGGCTNONE 
AK107962CCAGCCCATTNONE 
J023134F17AATGGGCTNONE 
J023134F17CCAGCCCATTNONE 
J043027A09AATGGGCTNONE 
J043027A09CCAGCCCATTNONE 
Os07g0625500AK064628TCAGCCCATTSimilar to Fimbriata-associated protein (Fragment). 
Os07g0681600AK073504TAATGGGCTATP-dependent DNA helicase RecQ family protein. 
Os07g0687300AK073043AAATGGGCTTAGGCCCATTSimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0100500006-093-G03ACAGCCCATTNONE 
AK109496ACAGCCCATTNONE 
J013097K15ACAGCCCATTNONE 
J023027K12ACAGCCCATTNONE 
J033046J03ACAGCCCATTNONE 
J075012A04ACAGCCCATTNONE 
J075056N17ACAGCCCATTNONE 
J075104O11ACAGCCCATTNONE 
J075177A17ACAGCCCATTNONE 
J090012E07ACAGCCCATTNONE 
J090054H18ACAGCCCATTNONE 
J090061K07ACAGCCCATTNONE 
Os08g0113800J033069I12AAAAGCCCATTTNONE 
J053050I07AAAAGCCCATTTNONE 
J065006J11AAAAGCCCATTTNONE 
J065013D02AAAAGCCCATTTNONE 
J065055L24AAAAGCCCATTTNONE 
J065071I11AAAAGCCCATTTConserved hypothetical protein. 
J065093G12AAAAGCCCATTTNONE 
J065101N03AAAAGCCCATTTNONE 
Os08g0116800AK063695CCAGCCCATTExoribonuclease domain containing protein. 
Os08g0137250J075030L12AAAAGCCCATTTAGCCCATCCANONE 
J075037O21AAAAGCCCATTTAGCCCATCCANONE 
J075078E23AAAAGCCCATTTAGCCCATCCANONE 
J075079C23AAAAGCCCATTTAGCCCATCCANONE 
J075092K02AAAAGCCCATTTAGCCCATCCANONE 
J075108M04AAAAGCCCATTTAGCCCATCCANONE 
J075112N13AAAAGCCCATTTAGCCCATCCANONE 
J075132M13AAAAGCCCATTTAGCCCATCCANONE 
J075146E07AAAAGCCCATTTAGCCCATCCANONE 
J075159F16AAAAGCCCATTTAGCCCATCCANONE 
J075166M12AAAAGCCCATTTAGCCCATCCANONE 
J075185B10AAAAGCCCATTTAGCCCATCCANONE 
J075193J10AAAAGCCCATTTAGCCCATCCANONE 
Os08g0150800AK101530AAATGGGCTCGGCCCACASimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0230000014-096-F01ACAGCCCATTNONE 
AK067127ACAGCCCATTConserved hypothetical protein. 
J013096C05ACAGCCCATTNONE 
J100032D12ACAGCCCATTNONE 
Os08g0290500004-010-C07AGCCCATTNONE 
009-111-A08AGCCCATTNONE 
011-046-F10AGCCCATTNONE 
AK066894AGCCCATTNONE 
AK067122AGCCCATTNONE 
AK102868AGCCCATTSimilar to AF-10 protein. 
J013089O21AGCCCATTNONE 
J033072D17AGCCCATTNONE 
J033095M14AGCCCATTNONE 
J033111N23AGCCCATTNONE 
J043024M17AGCCCATTNONE 
J065176I24AGCCCATTNONE 
J090035C05AGCCCATTNONE 
Os08g0322400AK120116AAATGGGCTTGGNucleotide-binding, alpha-beta plait domain containing protein. 
J013025M20AAATGGGCTTGGNONE 
J013096J15AAATGGGCTTGGNONE 
Os08g0386300AK059323TAAGCCCATTGGGCTGANONE 
AK070379TAAGCCCATTGGGCTGACytochrome b5 domain containing protein. 
J023054P20TAAGCCCATTGGGCTGANONE 
J033089H01TAAGCCCATTGGGCTGANONE 
J065013I01TAAGCCCATTGGGCTGANONE 
J065212E17TAAGCCCATTGGGCTGANONE 
J080317O15TAAGCCCATTGGGCTGANONE 
J090018O07TAAGCCCATTGGGCTGANONE 
Os08g0387200AK120787TAATGGGCTGCProtein of unknown function DUF81 family protein. 
Os08g0471900015-099-E10TAAGCCCAGCCCATTTNONE 
AK069434TAAGCCCAGCCCATTTZinc finger, ZPR1-type domain containing protein. 
Os08g0492100AK060178AAATGGGCTGTATTTGGGCCAANONE 
AK071053AAATGGGCTGTATTTGGGCCAAParaneoplastic encephalomyelitis antigen family protein. 
AK100101AAATGGGCTGTATTTGGGCCAANONE 
J023004I20AAATGGGCTGTATTTGGGCCAANONE 
J023067D13AAATGGGCTGTATTTGGGCCAANONE 
J033028G05AAATGGGCTGTATTTGGGCCAANONE 
J033060L15AAATGGGCTGTATTTGGGCCAANONE 
J033103N12AAATGGGCTGTATTTGGGCCAANONE 
J033125B19AAATGGGCTGTATTTGGGCCAANONE 
J065132A12AAATGGGCTGTATTTGGGCCAANONE 
J065161F02AAATGGGCTGTATTTGGGCCAANONE 
J065162L05AAATGGGCTGTATTTGGGCCAANONE 
J090093I18AAATGGGCTGTATTTGGGCCAANONE 
J100061I05AAATGGGCTGTATTTGGGCCAANONE 
J100081G13AAATGGGCTGTATTTGGGCCAANONE 
Os08g0496000011-009-D02AGCCCATTCGGCCCAAACNONE 
AK103187AGCCCATTCGGCCCAAACCytochrome oxidase assembly family protein. 
J033121L24AGCCCATTCGGCCCAAACNONE 
J033149A07AGCCCATTCGGCCCAAACNONE 
J065198L20AGCCCATTCGGCCCAAACNONE 
J090096F24AGCCCATTCGGCCCAAACNONE 
Os08g0496400AK110964ACAGCCCATTAConserved hypothetical protein. 
Os08g0511000AK107578AATGGGCTGAProtein prenyltransferase domain containing protein. 
Os08g0517900015-019-D06AAAAGCCCATTACGGCCCACACNONE 
015-019-D06CAAGCCCATTANONE 
AK064304AAAAGCCCATTACGGCCCACACSimilar to 30S ribosomal protein S16. 
AK064304CAAGCCCATTASimilar to 30S ribosomal protein S16. 
Os08g0526500016-063-D04CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
AK073431CCAGCCCAGTTAGGCCCAAGCCCATTASimilar to SOX-1 protein. 
J033042D10CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
J065019E02CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
Os09g0341500AK073913GCAGCCCATTTConserved hypothetical protein. 
J033076F19GCAGCCCATTTNONE 
J100085E04GCAGCCCATTTNONE 
Os09g0392400AK106799TAAGCCCATTTNONE 
Os09g0415700AK102287CAAGCCCATTProtein of unknown function DUF248, methyltransferase putative family protein. 
J013095G13CAAGCCCATTNONE 
J013128E08CAAGCCCATTNONE 
J023072N21CAAGCCCATTNONE 
J023083D13CAAGCCCATTNONE 
J023090E24CAAGCCCATTNONE 
J023097A14CAAGCCCATTNONE 
J023122E02CAAGCCCATTNONE 
J023130H06CAAGCCCATTNONE 
J033052I04CAAGCCCATTNONE 
J033071G04CAAGCCCATTNONE 
J033089J21CAAGCCCATTNONE 
J033090L16CAAGCCCATTNONE 
J033100P19CAAGCCCATTNONE 
J033102C11CAAGCCCATTNONE 
J033124H23CAAGCCCATTNONE 
J033129E23CAAGCCCATTNONE 
J043003I16CAAGCCCATTNONE 
J090029J24CAAGCCCATTNONE 
J090033P05CAAGCCCATTNONE 
J090068G20CAAGCCCATTNONE 
J090094K13CAAGCCCATTNONE 
Os09g0458400AK070055ACTGACAGCCCAGCCCATTAConserved hypothetical protein. 
AK120321ACTGACAGCCCAGCCCATTANONE 
J065064N11ACTGACAGCCCAGCCCATTANONE 
J065083J06ACTGACAGCCCAGCCCATTANONE 
J065121D24ACTGACAGCCCAGCCCATTANONE 
J065156I22ACTGACAGCCCAGCCCATTANONE 
J065163J24ACTGACAGCCCAGCCCATTANONE 
J075001I02ACTGACAGCCCAGCCCATTANONE 
J090088O06ACTGACAGCCCAGCCCATTANONE 
Os09g0487500AK108131AAAGCCCAGCCCATTTConserved hypothetical protein. 
J080062L16AAAGCCCAGCCCATTTNONE 
Os09g0513900AK107699AAAGCCCATTTConserved hypothetical protein. 
Os09g0540600AK101798ATATGGGCTTTACGGCCCATAAAAGCCCATTANONE 
AK101798TAATGGGCTAATGGGCCTCNONE 
AK103397ATATGGGCTTTACGGCCCATAAAAGCCCATTASimilar to WD-40 repeat protein MSI1. 
AK103397TAATGGGCTAATGGGCCTCSimilar to WD-40 repeat protein MSI1. 
Os09g0549700J053039F06TAATGGGCTTTCGGCCCATGTNONE 
J065089F23TAATGGGCTTTCGGCCCATGTRibosomal protein L18P/L5E family protein. 
J065090G14TAATGGGCTTTCGGCCCATGTNONE 
J065093M17TAATGGGCTTTCGGCCCATGTNONE 
J065096L23TAATGGGCTTTCGGCCCATGTNONE 
J065152A18TAATGGGCTTTCGGCCCATGTNONE 
J065155H12TAATGGGCTTTCGGCCCATGTNONE 
Os09g0571400AK103109AAATGGGCTGGGCTTGCyclophilin 1. 
AK103109AGCCCATTAAGCCCATTCyclophilin 1. 
J023011A12AAATGGGCTGGGCTTGNONE 
J023011A12AGCCCATTAAGCCCATTNONE 
J033119A20AAATGGGCTGGGCTTGNONE 
J033119A20AGCCCATTAAGCCCATTNONE 
J053034N16AAATGGGCTGGGCTTGNONE 
J053034N16AGCCCATTAAGCCCATTNONE 
J053045N23AAATGGGCTGGGCTTGNONE 
J053045N23AGCCCATTAAGCCCATTNONE 
J053052J12AAATGGGCTGGGCTTGNONE 
J053052J12AGCCCATTAAGCCCATTNONE 
J053052K04AAATGGGCTGGGCTTGNONE 
J053052K04AGCCCATTAAGCCCATTNONE 
J053099M15AAATGGGCTGGGCTTGNONE 
J053099M15AGCCCATTAAGCCCATTNONE 
J065071H23AAATGGGCTGGGCTTGNONE 
J065071H23AGCCCATTAAGCCCATTNONE 
J065131B16AAATGGGCTGGGCTTGNONE 
J065131B16AGCCCATTAAGCCCATTNONE 
J075003F19AAATGGGCTGGGCTTGNONE 
J075003F19AGCCCATTAAGCCCATTNONE 
J075116F02AAATGGGCTGGGCTTGNONE 
J075116F02AGCCCATTAAGCCCATTNONE 
J075126G05AAATGGGCTGGGCTTGNONE 
J075126G05AGCCCATTAAGCCCATTNONE 
J075145E09AAATGGGCTGGGCTTGNONE 
J075145E09AGCCCATTAAGCCCATTNONE 
J075149O22AAATGGGCTGGGCTTGNONE 
J075149O22AGCCCATTAAGCCCATTNONE 
J075163A09AAATGGGCTGGGCTTGNONE 
J075163A09AGCCCATTAAGCCCATTNONE 
J075194A09AAATGGGCTGGGCTTGNONE 
J075194A09AGCCCATTAAGCCCATTNONE 
L29471AAATGGGCTGGGCTTGNONE 
L29471AGCCCATTAAGCCCATTNONE 
Os11g0169900006-048-A03AATGGGCTGGNONE 
006-066-G11AATGGGCTGGNONE 
006-117-D09AATGGGCTGGNONE 
009-188-B11AATGGGCTGGNONE 
AK105044AATGGGCTGGSimilar to Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14) (V- ATPase 16 kDa proteolipid subunit) (Fragment). 
AK121233AATGGGCTGGNONE 
D21104AATGGGCTGGNONE 
J013108B05AATGGGCTGGNONE 
J013118B15AATGGGCTGGNONE 
J023008C14AATGGGCTGGNONE 
J023024D08AATGGGCTGGNONE 
J023093E21AATGGGCTGGNONE 
J065024J08AATGGGCTGGNONE 
J065070G07AATGGGCTGGNONE 
J065103B06AATGGGCTGGNONE 
J080011O10AATGGGCTGGNONE 
J080012O15AATGGGCTGGNONE 
J080016F12AATGGGCTGGNONE 
J080022P11AATGGGCTGGNONE 
J080023C02AATGGGCTGGNONE 
J080024I11AATGGGCTGGNONE 
J080024L13AATGGGCTGGNONE 
J080034N23AATGGGCTGGNONE 
J080036D13AATGGGCTGGNONE 
J080036M18AATGGGCTGGNONE 
J080037G09AATGGGCTGGNONE 
J080037G12AATGGGCTGGNONE 
J080049K01AATGGGCTGGNONE 
J080052J04AATGGGCTGGNONE 
J080057A14AATGGGCTGGNONE 
J080068O21AATGGGCTGGNONE 
J080072A14AATGGGCTGGNONE 
J080077E17AATGGGCTGGNONE 
J080080D15AATGGGCTGGNONE 
J080080H12AATGGGCTGGNONE 
J080083C19AATGGGCTGGNONE 
J080084M21AATGGGCTGGNONE 
J080088A08AATGGGCTGGNONE 
J080090B13AATGGGCTGGNONE 
J080094B08AATGGGCTGGNONE 
J080094F23AATGGGCTGGNONE 
J080095N07AATGGGCTGGNONE 
J090050G07AATGGGCTGGNONE 
U27098AATGGGCTGGNONE 
Os11g0171700AK099115AAATGGGCTSMAD/FHA domain containing protein. 
Os11g0227600AK101375TAATGGGCTTAGCGTGGGCCGGAConserved hypothetical protein. 
AK102193TAATGGGCTTAGCGTGGGCCGGANONE 
J033087C03TAATGGGCTTAGCGTGGGCCGGANONE 
Os11g0231400AK108047TAATGGGCTTCProtein of unknown function DUF295 family protein. 
Os11g0621400009-043-B05AAATGGGCTNONE 
009-043-B05AATGGGCTNONE 
AK062468AAATGGGCTConserved hypothetical protein. 
AK062468AATGGGCTConserved hypothetical protein. 
Os11g0642100AK107010AGCCCATTTCyclin-like F-box domain containing protein. 
Os11g0657200AK059959ACAGCCCATTT2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07AAATGGGCTGTNONE 
AK062752AAATGGGCTGTSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0669100AK068628AGCCCATTTCalmodulin binding protein-like family protein. 
Os12g0167900005-004-A06AAAAGCCCATTNONE 
005-004-A06CAAGCCCATTNONE 
006-024-H01AAAAGCCCATTNONE 
006-024-H01CAAGCCCATTNONE 
006-044-H12AAAAGCCCATTNONE 
006-044-H12CAAGCCCATTNONE 
006-053-B08AAAAGCCCATTNONE 
006-053-B08CAAGCCCATTNONE 
015-080-F12AAAAGCCCATTNONE 
015-080-F12CAAGCCCATTNONE 
AK060925AAAAGCCCATT60S ribosomal protein L3. 
AK060925CAAGCCCATT60S ribosomal protein L3. 
D10403AAAAGCCCATTNONE 
D10403CAAGCCCATTNONE 
D12630AAAAGCCCATTNONE 
D12630CAAGCCCATTNONE 
J013046A17AAAAGCCCATTNONE 
J013046A17CAAGCCCATTNONE 
J013048A16AAAAGCCCATTNONE 
J013048A16CAAGCCCATTNONE 
J013057L14AAAAGCCCATTNONE 
J013057L14CAAGCCCATTNONE 
J023058G08AAAAGCCCATTNONE 
J023058G08CAAGCCCATTNONE 
J023058I08AAAAGCCCATTNONE 
J023058I08CAAGCCCATTNONE 
J023078E17AAAAGCCCATTNONE 
J023078E17CAAGCCCATTNONE 
J023087E03AAAAGCCCATTNONE 
J023087E03CAAGCCCATTNONE 
J023097D18AAAAGCCCATTNONE 
J023097D18CAAGCCCATTNONE 
J023141E14AAAAGCCCATTNONE 
J023141E14CAAGCCCATTNONE 
J023150P21AAAAGCCCATTNONE 
J023150P21CAAGCCCATTNONE 
J033045K05AAAAGCCCATTNONE 
J033045K05CAAGCCCATTNONE 
J033071G03AAAAGCCCATTNONE 
J033071G03CAAGCCCATTNONE 
J033071I15AAAAGCCCATTNONE 
J033071I15CAAGCCCATTNONE 
J033136D08AAAAGCCCATTNONE 
J033136D08CAAGCCCATTNONE 
J043012M21AAAAGCCCATTNONE 
J043012M21CAAGCCCATTNONE 
J043015C13AAAAGCCCATTNONE 
J043015C13CAAGCCCATTNONE 
J053031L19AAAAGCCCATTNONE 
J053031L19CAAGCCCATTNONE 
J053050C01AAAAGCCCATTNONE 
J053050C01CAAGCCCATTNONE 
J053055I20AAAAGCCCATTNONE 
J053055I20CAAGCCCATTNONE 
J053074B18AAAAGCCCATTNONE 
J053074B18CAAGCCCATTNONE 
J053091I08AAAAGCCCATTNONE 
J053091I08CAAGCCCATTNONE 
J053097N01AAAAGCCCATTNONE 
J053097N01CAAGCCCATTNONE 
J065058A02AAAAGCCCATTNONE 
J065058A02CAAGCCCATTNONE 
J065141H11AAAAGCCCATTNONE 
J065141H11CAAGCCCATTNONE 
J075019D10AAAAGCCCATTNONE 
J075019D10CAAGCCCATTNONE 
J075078G18AAAAGCCCATTNONE 
J075078G18CAAGCCCATTNONE 
J075094C12AAAAGCCCATTNONE 
J075094C12CAAGCCCATTNONE 
J075165H12AAAAGCCCATTNONE 
J075165H12CAAGCCCATTNONE 
J090011E05AAAAGCCCATTNONE 
J090011E05CAAGCCCATTNONE 
J090021H18AAAAGCCCATTNONE 
J090021H18CAAGCCCATTNONE 
J090027N07AAAAGCCCATTNONE 
J090027N07CAAGCCCATTNONE 
J090035F04AAAAGCCCATTNONE 
J090035F04CAAGCCCATTNONE 
J090050F21AAAAGCCCATTNONE 
J090050F21CAAGCCCATTNONE 
J090051M02AAAAGCCCATTNONE 
J090051M02CAAGCCCATTNONE 
J090060F21AAAAGCCCATTNONE 
J090060F21CAAGCCCATTNONE 
J090075G15AAAAGCCCATTNONE 
J090075G15CAAGCCCATTNONE 
J090092P11AAAAGCCCATTNONE 
J090092P11CAAGCCCATTNONE 
J090097B18AAAAGCCCATTNONE 
J090097B18CAAGCCCATTNONE 
J100019C17AAAAGCCCATTNONE 
J100019C17CAAGCCCATTNONE 
J100022O04AAAAGCCCATTNONE 
J100022O04CAAGCCCATTNONE 
J100034G13AAAAGCCCATTNONE 
J100034G13CAAGCCCATTNONE 
J100048A13AAAAGCCCATTNONE 
J100048A13CAAGCCCATTNONE 
J100050P18AAAAGCCCATTNONE 
J100050P18CAAGCCCATTNONE 
J100054B21AAAAGCCCATTNONE 
J100054B21CAAGCCCATTNONE 
J100062L01AAAAGCCCATTNONE 
J100062L01CAAGCCCATTNONE 
J100065E11AAAAGCCCATTNONE 
J100065E11CAAGCCCATTNONE 
J100074P09AAAAGCCCATTNONE 
J100074P09CAAGCCCATTNONE 
J100086E10AAAAGCCCATTNONE 
J100086E10CAAGCCCATTNONE 
Os12g0413400009-084-D12AATGGGCTNONE 
AK062663AATGGGCTConserved hypothetical protein. 
Os12g0488800015-085-F11AAATGGGCTGTNONE 
AK064347AAATGGGCTGTRNA polymerase II, RPB4 domain containing protein. 
J033065H11AAATGGGCTGTNONE 
J033145P10AAATGGGCTGTNONE 
J065137L04AAATGGGCTGTNONE 
J065171P08AAATGGGCTGTNONE 
Os12g0508300009-006-G07AAAAGCCCATTANONE 
009-133-E05AAAAGCCCATTANONE 
009-137-F10AAAAGCCCATTANONE 
014-024-A06AAAAGCCCATTANONE 
AK059123AAAAGCCCATTARibosomal protein S14 family protein. 
J100088E22AAAAGCCCATTANONE 
Os12g0540000AK108630TAATGGGCTTGGGCTConserved hypothetical protein. 
J065046N02TAATGGGCTTGGGCTNONE 
J065100H24TAATGGGCTTGGGCTNONE 
J065142M24TAATGGGCTTGGGCTNONE 
Os12g0588900AK069966AAAGCCCATTGGGCCTGGConserved hypothetical protein. 
J023038A10AAAGCCCATTGGGCCTGGNONE 
J065061J23AAAGCCCATTGGGCCTGGNONE 
J065176O08AAAGCCCATTGGGCCTGGNONE 
J075143K13AAAGCCCATTGGGCCTGGNONE 
Os12g0595800AK072425TCAGCCCATTNONE 
AK101874TCAGCCCATTNONE 
Os12g0599900AK101252TAAGCCCATTTTetratricopeptide region domain containing protein. 
J033032F05TAAGCCCATTTNONE 
Os12g0634600009-019-G12TAATGGGCTTCNONE 
AK070357TAATGGGCTTCConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.