version

Summary of OsREG433 (All List)

OrganismOryza sativa  
IDOsREG433  
SequenceAATTGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1718  

Entry Sequences (1718 entries)

LocusGene modelSequenceDescription
Os01g0134200AK102394AATTGGGCCGGCConserved hypothetical protein. 
Os01g0155600006-048-F03GCCCACCAATTGGGCNONE 
AK060171GCCCACCAATTGGGCNONE 
AK071635GCCCACCAATTGGGCSimilar to Splicing factor RSZ33. 
J023080A03GCCCACCAATTGGGCNONE 
J023100L15GCCCACCAATTGGGCNONE 
J033075I17GCCCACCAATTGGGCNONE 
J033085O09GCCCACCAATTGGGCNONE 
J033105E15GCCCACCAATTGGGCNONE 
J033132N10GCCCACCAATTGGGCNONE 
J033132P12GCCCACCAATTGGGCNONE 
J033149H12GCCCACCAATTGGGCNONE 
J043026M03GCCCACCAATTGGGCNONE 
J080305J10GCCCACCAATTGGGCNONE 
J080308K03GCCCACCAATTGGGCNONE 
J090023M04GCCCACCAATTGGGCNONE 
J090078F24GCCCACCAATTGGGCNONE 
J100066P05GCCCACCAATTGGGCNONE 
Os01g0179901J075009I05TGCGGCCCAATTAGGGCCCAACTNONE 
J075058D09TGCGGCCCAATTAGGGCCCAACTNONE 
J075153K16TGCGGCCCAATTAGGGCCCAACTConserved hypothetical protein. 
Os01g0221300011-021-E12AAGGCCCAATTNONE 
AK073330AAGGCCCAATTConserved hypothetical protein. 
J013130J18AAGGCCCAATTNONE 
J033024A12AAGGCCCAATTNONE 
J065063H09AAGGCCCAATTNONE 
J065093G05AAGGCCCAATTNONE 
J090007K12AAGGCCCAATTNONE 
Os01g0283700AK107149AGCCCAATTSimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44). 
Os01g0301100AK105556AATTGGGCCGAConserved hypothetical protein. 
Os01g0384800009-073-F04AATTGGGCNONE 
009-149-E07AATTGGGCNONE 
AK119688AATTGGGCConserved hypothetical protein. 
AK120910AATTGGGCNONE 
J013033N16AATTGGGCNONE 
J023034B07AATTGGGCNONE 
J023034J16AATTGGGCNONE 
J065105O09AATTGGGCNONE 
J065194F07AATTGGGCNONE 
J075070L22AATTGGGCNONE 
J075128L01AATTGGGCNONE 
J075164C09AATTGGGCNONE 
J100028M15AATTGGGCNONE 
J100042M14AATTGGGCNONE 
J100063D20AATTGGGCNONE 
J100066A19AATTGGGCNONE 
J100079K09AATTGGGCNONE 
J100079K17AATTGGGCNONE 
Os01g0530300AK111105AAGGCCCAATTGGGCCGAHypothetical protein. 
J090023M11AAGGCCCAATTGGGCCGANONE 
J090053G13AAGGCCCAATTGGGCCGANONE 
Os01g0560200AK102003AAATGGGCAAGGCCCAATTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
J033079N06AAATGGGCAAGGCCCAATTNONE 
J065092F14AAATGGGCAAGGCCCAATTNONE 
J065106D04AAATGGGCAAGGCCCAATTNONE 
J065194K23AAATGGGCAAGGCCCAATTNONE 
Os01g0591300AK101427AATTGGGCCAASimilar to Cytosolic aldehyde dehydrogenase RF2D. 
Os01g0595900AK100625AATTGGGCCCACACyclin-like F-box domain containing protein. 
Os01g0621700AK108938AATTGGGCCCAAAMyosin tail 2 domain containing protein. 
J100033P13AATTGGGCCCAAANONE 
Os01g0626300016-070-G04AATTGGGCTGTNONE 
AK122071AATTGGGCTGTSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04AATTGGGCTGTNONE 
J033117J08AATTGGGCTGTNONE 
J065007O12AATTGGGCTGTNONE 
J065020K12AATTGGGCTGTNONE 
J065142D24AATTGGGCTGTNONE 
J065157K19AATTGGGCTGTNONE 
J080307H19AATTGGGCTGTNONE 
J080311D16AATTGGGCTGTNONE 
J080316C12AATTGGGCTGTNONE 
J080316E03AATTGGGCTGTNONE 
J100033K16AATTGGGCTGTNONE 
J100042J21AATTGGGCTGTNONE 
J100051E06AATTGGGCTGTNONE 
J100071E22AATTGGGCTGTNONE 
Os01g0645900013-081-F03GCCCAATTNONE 
AK100928GCCCAATTConserved hypothetical protein. 
J013038F24GCCCAATTNONE 
J013039G23GCCCAATTNONE 
J013055O20GCCCAATTNONE 
J013155H06GCCCAATTNONE 
J023025B08GCCCAATTNONE 
J023052H06GCCCAATTNONE 
J023135A05GCCCAATTNONE 
J033028I24GCCCAATTNONE 
J033070J19GCCCAATTNONE 
J065052F03GCCCAATTNONE 
J065195D09GCCCAATTNONE 
J100069N13GCCCAATTNONE 
J100080M03GCCCAATTNONE 
Os01g0685900AK064024GCCCAATTNONE 
AK102005GCCCAATTSimilar to 65kD microtubule associated protein. 
Os01g0693800006-060-A01GCCCAATTNONE 
006-074-B11GCCCAATTNONE 
AK073138GCCCAATTSimilar to Threonine synthase, chloroplast precursor (EC 4.2.3.1) (TS). 
AK109336GCCCAATTNONE 
J033024E01GCCCAATTNONE 
Os01g0748100AK071261AATTGGGCCATHypothetical protein. 
J023084C08AATTGGGCCATNONE 
J065058A07AATTGGGCCATNONE 
Os01g0781100AY044444AATTGGGCSimilar to NBS-LRR protein (Fragment). 
J100023D19AATTGGGCNONE 
Os01g0810000AK102143ATATGGGCCGTCAGGCCCAATTNONE 
AK120752ATATGGGCCGTCAGGCCCAATTUtp11 family protein. 
J023006E09ATATGGGCCGTCAGGCCCAATTNONE 
J033086A13ATATGGGCCGTCAGGCCCAATTNONE 
J033133K07ATATGGGCCGTCAGGCCCAATTNONE 
J065066L16ATATGGGCCGTCAGGCCCAATTNONE 
J065161C01ATATGGGCCGTCAGGCCCAATTNONE 
J100027D18ATATGGGCCGTCAGGCCCAATTNONE 
J100063J12ATATGGGCCGTCAGGCCCAATTNONE 
Os01g0810100AK071916ATGGCCCAGCCCAATTRibonuclease III domain containing protein. 
AK099056ATGGCCCAGCCCAATTNONE 
AK104320ATGGCCCAGCCCAATTNONE 
Os01g0821800015-005-A04TACGGCCCAATTNONE 
AK073951TACGGCCCAATTNONE 
AK103171TACGGCCCAATTNONE 
AK119168TACGGCCCAATTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J023031A22TACGGCCCAATTNONE 
J033098N09TACGGCCCAATTNONE 
J033121G11TACGGCCCAATTNONE 
J090030L03TACGGCCCAATTNONE 
Os01g0851700011-055-A03GCCCAATTNONE 
AF326977GCCCAATTNONE 
AK103367GCCCAATTSimilar to Cytosolic starch phosphorylase (Fragment). 
AK105410GCCCAATTNONE 
J033117F10GCCCAATTNONE 
J033126P09GCCCAATTNONE 
J090030E12GCCCAATTNONE 
Os01g0853800006-033-H02TCAGGCCCAATTNONE 
006-037-A10TCAGGCCCAATTNONE 
006-038-F10TCAGGCCCAATTNONE 
006-054-E01TCAGGCCCAATTNONE 
006-067-E10TCAGGCCCAATTNONE 
012-015-G05TCAGGCCCAATTNONE 
AK069147TCAGGCCCAATTC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK105929TCAGGCCCAATTNONE 
AK106144TCAGGCCCAATTNONE 
AK106186TCAGGCCCAATTNONE 
J023007P09TCAGGCCCAATTNONE 
J023007P10TCAGGCCCAATTNONE 
J065084L10TCAGGCCCAATTNONE 
J065179B10TCAGGCCCAATTNONE 
J065186D16TCAGGCCCAATTNONE 
J075040I08TCAGGCCCAATTNONE 
J075043K21TCAGGCCCAATTNONE 
J075051J08TCAGGCCCAATTNONE 
J075061D24TCAGGCCCAATTNONE 
J075095H04TCAGGCCCAATTNONE 
J075145J12TCAGGCCCAATTNONE 
J075148O18TCAGGCCCAATTNONE 
J075187J05TCAGGCCCAATTNONE 
J090042A20TCAGGCCCAATTNONE 
J100025K01TCAGGCCCAATTNONE 
Os01g0859100AK064334GCCCAATTSimilar to WIP1 protein (Fragment). 
Os01g0911100AK062123ATGGCCCAATTNONE 
J013000B12ATGGCCCAATTNONE 
J013071L21ATGGCCCAATTNONE 
J013072J22ATGGCCCAATTNONE 
J065152F12ATGGCCCAATTNONE 
J065191K04ATGGCCCAATTNONE 
J100034F15ATGGCCCAATTNONE 
J100035A02ATGGCCCAATTNONE 
J100040O20ATGGCCCAATTNONE 
J100045D02ATGGCCCAATTNONE 
J100070A17ATGGCCCAATTNONE 
J100089B06ATGGCCCAATTNONE 
Os01g0916300011-018-B12AATTGGGCTNONE 
AK063922AATTGGGCTSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
AK103107AATTGGGCTNONE 
AK121061AATTGGGCTNONE 
AK121997AATTGGGCTNONE 
J033118P14AATTGGGCTNONE 
J065002N16AATTGGGCTNONE 
J065079B04AATTGGGCTNONE 
J065102J07AATTGGGCTNONE 
J065128F16AATTGGGCTNONE 
J065184D11AATTGGGCTNONE 
J065186A07AATTGGGCTNONE 
J075115C07AATTGGGCTNONE 
J075147C04AATTGGGCTNONE 
Os01g0920400016-005-B10AATTGGGCCTANONE 
AK073965AATTGGGCCTASimilar to Dynamin-related protein 3A (Dynamin-like protein 2) (Dynamin-like protein 2a). Splice isoform 2. 
J013023K02AATTGGGCCTANONE 
J023008G04AATTGGGCCTANONE 
J033072A13AATTGGGCCTANONE 
J033106F08AATTGGGCCTANONE 
J043009F23AATTGGGCCTANONE 
J043027F03AATTGGGCCTANONE 
J065009O17AATTGGGCCTANONE 
J065046M03AATTGGGCCTANONE 
J065051H14AATTGGGCCTANONE 
J065077G12AATTGGGCCTANONE 
J065082M20AATTGGGCCTANONE 
J065087O20AATTGGGCCTANONE 
J065123N10AATTGGGCCTANONE 
J065124O16AATTGGGCCTANONE 
J065163P15AATTGGGCCTANONE 
J065166D19AATTGGGCCTANONE 
J065212C15AATTGGGCCTANONE 
J065219F23AATTGGGCCTANONE 
J075068F08AATTGGGCCTANONE 
J075139J12AATTGGGCCTANONE 
J075196K05AATTGGGCCTANONE 
J090050D18AATTGGGCCTANONE 
J090099H08AATTGGGCCTANONE 
J100029L12AATTGGGCCTANONE 
J100044C19AATTGGGCCTANONE 
J100056L03AATTGGGCCTANONE 
J100078E23AATTGGGCCTANONE 
J100087E19AATTGGGCCTANONE 
Os02g0100800009-070-H03GCCCAATTNONE 
AK062555GCCCAATTHypothetical protein. 
Os02g0110700006-061-H08AATTGGGCNONE 
AK061065AATTGGGCNONE 
Os02g0133800006-092-D12CCTGGGCCAAAGCCCAATTNONE 
006-111-G01CCTGGGCCAAAGCCCAATTNONE 
AK103646CCTGGGCCAAAGCCCAATTNONE 
AK109376CCTGGGCCAAAGCCCAATTProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886CCTGGGCCAAAGCCCAATTNONE 
J033135B19CCTGGGCCAAAGCCCAATTNONE 
J065200F01CCTGGGCCAAAGCCCAATTNONE 
J065213J11CCTGGGCCAAAGCCCAATTNONE 
J075031N16CCTGGGCCAAAGCCCAATTNONE 
J075032N17CCTGGGCCAAAGCCCAATTNONE 
J075047P04CCTGGGCCAAAGCCCAATTNONE 
J075063D01CCTGGGCCAAAGCCCAATTNONE 
J075105F23CCTGGGCCAAAGCCCAATTNONE 
J075121E16CCTGGGCCAAAGCCCAATTNONE 
J075176F10CCTGGGCCAAAGCCCAATTNONE 
J075182M16CCTGGGCCAAAGCCCAATTNONE 
J075190E09CCTGGGCCAAAGCCCAATTNONE 
J075191B14CCTGGGCCAAAGCCCAATTNONE 
J100055J24CCTGGGCCAAAGCCCAATTNONE 
J100066H24CCTGGGCCAAAGCCCAATTNONE 
J100073N01CCTGGGCCAAAGCCCAATTNONE 
Os02g0135600AK069843TGCGGCCCAATTCAGCCCATGTConserved hypothetical protein. 
J023034H09TGCGGCCCAATTCAGCCCATGTNONE 
J033090D08TGCGGCCCAATTCAGCCCATGTNONE 
J100025N07TGCGGCCCAATTCAGCCCATGTNONE 
J100075G18TGCGGCCCAATTCAGCCCATGTNONE 
Os02g0135700AK100570ACATGGGCTGAATTGGGCCGCADNA polymerase V family protein. 
Os02g0162500009-181-F03ACCGGCCCAATTNONE 
AK058907ACCGGCCCAATTNONE 
AK121223ACCGGCCCAATTSimilar to 40S ribosomal protein S14. 
J023090I10ACCGGCCCAATTNONE 
J023136J11ACCGGCCCAATTNONE 
J053097J20ACCGGCCCAATTNONE 
J053098F01ACCGGCCCAATTNONE 
J065065B09ACCGGCCCAATTNONE 
J065082M04ACCGGCCCAATTNONE 
J065188O05ACCGGCCCAATTNONE 
J075057P15ACCGGCCCAATTNONE 
J075061J08ACCGGCCCAATTNONE 
J075061N15ACCGGCCCAATTNONE 
J075131I08ACCGGCCCAATTNONE 
J075141H13ACCGGCCCAATTNONE 
J080062E14ACCGGCCCAATTNONE 
J080062P15ACCGGCCCAATTNONE 
J080318G17ACCGGCCCAATTNONE 
J080319G19ACCGGCCCAATTNONE 
J090001L10ACCGGCCCAATTNONE 
J090024I18ACCGGCCCAATTNONE 
J090033F24ACCGGCCCAATTNONE 
J090036M16ACCGGCCCAATTNONE 
J090040I24ACCGGCCCAATTNONE 
J090048P06ACCGGCCCAATTNONE 
J090049B12ACCGGCCCAATTNONE 
J090068C02ACCGGCCCAATTNONE 
J090069O04ACCGGCCCAATTNONE 
J090084H22ACCGGCCCAATTNONE 
J100022L03ACCGGCCCAATTNONE 
J100028O14ACCGGCCCAATTNONE 
J100028O18ACCGGCCCAATTNONE 
J100032A15ACCGGCCCAATTNONE 
J100033D21ACCGGCCCAATTNONE 
J100034J23ACCGGCCCAATTNONE 
J100043K22ACCGGCCCAATTNONE 
J100052M22ACCGGCCCAATTNONE 
J100053N03ACCGGCCCAATTNONE 
J100074N24ACCGGCCCAATTNONE 
J100082J10ACCGGCCCAATTNONE 
Os02g0167700AK069128GCCCAATTArmadillo-like helical domain containing protein. 
Os02g0190900AK111037GCCCAATTTGGGCCGGGCCGTGPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CACGGCCCGGCCCAAATTGGGCConserved hypothetical protein. 
J075117E23CACGGCCCGGCCCAAATTGGGCNONE 
J075117F23CACGGCCCGGCCCAAATTGGGCNONE 
J075144M12CACGGCCCGGCCCAAATTGGGCNONE 
J075145H10CACGGCCCGGCCCAAATTGGGCNONE 
J075186B15CACGGCCCGGCCCAAATTGGGCNONE 
Os02g0193600AK060499AAAAGCCCAATTMad3/BUB1 homology region 1 domain containing protein. 
Os02g0219200016-016-C03AATTGGGCCGCANONE 
AK059059AATTGGGCCGCASimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase) (Exo-(1-->4)-beta-D-galactanase). 
Os02g0235600009-009-H04AATTGGGCCCATCCANONE 
009-165-G06AATTGGGCCCATCCANONE 
AK120417AATTGGGCCCATCCASimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14AATTGGGCCCATCCANONE 
J023106P11AATTGGGCCCATCCANONE 
J033080L09AATTGGGCCCATCCANONE 
J033123O05AATTGGGCCCATCCANONE 
J065197A18AATTGGGCCCATCCANONE 
J065216P16AATTGGGCCCATCCANONE 
J075017F02AATTGGGCCCATCCANONE 
J075025L16AATTGGGCCCATCCANONE 
J075027P04AATTGGGCCCATCCANONE 
J075039N01AATTGGGCCCATCCANONE 
J075101F24AATTGGGCCCATCCANONE 
J075132J15AATTGGGCCCATCCANONE 
J075164K16AATTGGGCCCATCCANONE 
J075174E19AATTGGGCCCATCCANONE 
J100043C23AATTGGGCCCATCCANONE 
J100067B11AATTGGGCCCATCCANONE 
Os02g0236100AK120541AAGGCCCAATTSimilar to SERK1 (Fragment). 
AK120541GCCCAATTSimilar to SERK1 (Fragment). 
Os02g0285300009-064-E02GCCCAATTNONE 
AK058613GCCCAATTDREPP plasma membrane polypeptide family protein. 
Os02g0499300AK106994CAAGCCCAATTConserved hypothetical protein. 
Os02g0638400AK060633AATTGGGCCAGABRO1 domain containing protein. 
J065083J17AATTGGGCCAGANONE 
Os02g0655700AK101068AATTGGGCCATAmino acid/polyamine transporter I family protein. 
J013026C06AATTGGGCCATNONE 
J033023I17AATTGGGCCATNONE 
Os02g0682600AK108470TACGGCCCAATTZinc finger, Tim10/DDP-type family protein. 
J065019B06TACGGCCCAATTNONE 
J065065L01TACGGCCCAATTNONE 
Os02g0727500009-018-G06CACGGCCCAATTNONE 
AK121427CACGGCCCAATTConserved hypothetical protein. 
J023136B21CACGGCCCAATTNONE 
J033044C13CACGGCCCAATTNONE 
J043037O12CACGGCCCAATTNONE 
J053072C14CACGGCCCAATTNONE 
J065008B15CACGGCCCAATTNONE 
J065033I12CACGGCCCAATTNONE 
J065077I18CACGGCCCAATTNONE 
J065149G03CACGGCCCAATTNONE 
J065159H07CACGGCCCAATTNONE 
J065162I17CACGGCCCAATTNONE 
J065168H02CACGGCCCAATTNONE 
J065176N09CACGGCCCAATTNONE 
J065178K23CACGGCCCAATTNONE 
J065216N03CACGGCCCAATTNONE 
J080001G08CACGGCCCAATTNONE 
J080002C09CACGGCCCAATTNONE 
J080007N17CACGGCCCAATTNONE 
J080009B04CACGGCCCAATTNONE 
J080009B17CACGGCCCAATTNONE 
J080011O15CACGGCCCAATTNONE 
J080022B06CACGGCCCAATTNONE 
J080022C13CACGGCCCAATTNONE 
J080024L04CACGGCCCAATTNONE 
J080031G21CACGGCCCAATTNONE 
J080035N14CACGGCCCAATTNONE 
J080036O14CACGGCCCAATTNONE 
J080040P10CACGGCCCAATTNONE 
J080042D03CACGGCCCAATTNONE 
J080042H05CACGGCCCAATTNONE 
J080042I20CACGGCCCAATTNONE 
J080043A01CACGGCCCAATTNONE 
J080043F17CACGGCCCAATTNONE 
J080046I19CACGGCCCAATTNONE 
J080053L20CACGGCCCAATTNONE 
J080055A20CACGGCCCAATTNONE 
J080055F01CACGGCCCAATTNONE 
J080056L02CACGGCCCAATTNONE 
J080058H02CACGGCCCAATTNONE 
J080059F11CACGGCCCAATTNONE 
J080062C03CACGGCCCAATTNONE 
J080064A07CACGGCCCAATTNONE 
J080064K15CACGGCCCAATTNONE 
J080067M17CACGGCCCAATTNONE 
J080067N17CACGGCCCAATTNONE 
J080068G07CACGGCCCAATTNONE 
J080069H15CACGGCCCAATTNONE 
J080069L08CACGGCCCAATTNONE 
J080069L20CACGGCCCAATTNONE 
J080069L21CACGGCCCAATTNONE 
J080069N20CACGGCCCAATTNONE 
J080071N24CACGGCCCAATTNONE 
J080074K17CACGGCCCAATTNONE 
J080076H08CACGGCCCAATTNONE 
J080082F19CACGGCCCAATTNONE 
J080086O16CACGGCCCAATTNONE 
J090025A19CACGGCCCAATTNONE 
J090025M06CACGGCCCAATTNONE 
J090070D02CACGGCCCAATTNONE 
Os02g0731700AK072346AATTGGGCCCCASimilar to CONSTANS-like 1 protein. 
AK120314AATTGGGCCCCANONE 
Os02g0767100011-054-E05AATTGGGCCCGNONE 
AK063351AATTGGGCCCGNONE 
AK103640AATTGGGCCCGConserved hypothetical protein. 
J090022G11AATTGGGCCCGNONE 
J090072L18AATTGGGCCCGNONE 
Os02g0796900009-121-E06AGCCCAATTNONE 
D29725AGCCCAATTSimilar to 60S ribosomal protein L39. 
J075016N24AGCCCAATTNONE 
J075085F03AGCCCAATTNONE 
J075147P11AGCCCAATTNONE 
J075180E16AGCCCAATTNONE 
J075182A19AGCCCAATTNONE 
Os02g0815500AK099733CCCGGCCCAATTAlcohol dehydrogenase class III (EC 1.1.1.1) (Glutathione-dependent formaldehyde dehydrogenase) (EC 1.2.1.1) (FDH) (FALDH) (GSH-FDH). 
J013089P19CCCGGCCCAATTNONE 
J043022H19CCCGGCCCAATTNONE 
J065008L14CCCGGCCCAATTNONE 
J065016G09CCCGGCCCAATTNONE 
J065023C22CCCGGCCCAATTNONE 
J065024K13CCCGGCCCAATTNONE 
J065043D14CCCGGCCCAATTNONE 
J065052K16CCCGGCCCAATTNONE 
J065058D17CCCGGCCCAATTNONE 
J065087L03CCCGGCCCAATTNONE 
J065107H15CCCGGCCCAATTNONE 
J065110E12CCCGGCCCAATTNONE 
J065124P14CCCGGCCCAATTNONE 
J065131B20CCCGGCCCAATTNONE 
J065155I10CCCGGCCCAATTNONE 
J065172J02CCCGGCCCAATTNONE 
J065184D04CCCGGCCCAATTNONE 
J065189D21CCCGGCCCAATTNONE 
J065201O14CCCGGCCCAATTNONE 
J065203D20CCCGGCCCAATTNONE 
J065206M13CCCGGCCCAATTNONE 
J065211E14CCCGGCCCAATTNONE 
J065217J21CCCGGCCCAATTNONE 
J090004A20CCCGGCCCAATTNONE 
Os02g0816700009-132-E07AGTTGGGCCCAATTNONE 
009-132-E07GAGGCCCAATTNONE 
AK059572AGTTGGGCCCAATTConserved hypothetical protein. 
AK059572GAGGCCCAATTConserved hypothetical protein. 
Os02g0816800013-089-A09AATTGGGCCCAACTNONE 
013-089-A09AATTGGGCCTCNONE 
AK102271AATTGGGCCCAACTNAD-dependent epimerase/dehydratase family protein. 
AK102271AATTGGGCCTCNAD-dependent epimerase/dehydratase family protein. 
J013105O04AATTGGGCCCAACTNONE 
J013105O04AATTGGGCCTCNONE 
J013124I08AATTGGGCCCAACTNONE 
J013124I08AATTGGGCCTCNONE 
J023002E08AATTGGGCCCAACTNONE 
J023002E08AATTGGGCCTCNONE 
J023025C01AATTGGGCCCAACTNONE 
J023025C01AATTGGGCCTCNONE 
J023037O12AATTGGGCCCAACTNONE 
J023037O12AATTGGGCCTCNONE 
J023049N06AATTGGGCCCAACTNONE 
J023049N06AATTGGGCCTCNONE 
J023069G18AATTGGGCCCAACTNONE 
J023069G18AATTGGGCCTCNONE 
J033029M02AATTGGGCCCAACTNONE 
J033029M02AATTGGGCCTCNONE 
J033037L22AATTGGGCCCAACTNONE 
J033037L22AATTGGGCCTCNONE 
J033089A08AATTGGGCCCAACTNONE 
J033089A08AATTGGGCCTCNONE 
J033103L07AATTGGGCCCAACTNONE 
J033103L07AATTGGGCCTCNONE 
J033125L19AATTGGGCCCAACTNONE 
J033125L19AATTGGGCCTCNONE 
J090008N20AATTGGGCCCAACTNONE 
J090008N20AATTGGGCCTCNONE 
J090041F23AATTGGGCCCAACTNONE 
J090041F23AATTGGGCCTCNONE 
J090092H16AATTGGGCCCAACTNONE 
J090092H16AATTGGGCCTCNONE 
Os02g0819700AK067374AGGGCCCAATTZinc finger, Zim17-type family protein. 
AK067374TAGGCCCAATTZinc finger, Zim17-type family protein. 
AK099160AGGGCCCAATTNONE 
AK099160TAGGCCCAATTNONE 
J100086K17AGGGCCCAATTNONE 
J100086K17TAGGCCCAATTNONE 
Os02g0824400AK121390GAGGCCCAATTConserved hypothetical protein. 
J023128P21GAGGCCCAATTNONE 
J053097O16GAGGCCCAATTNONE 
J065012I02GAGGCCCAATTNONE 
J065049C06GAGGCCCAATTNONE 
J065051H02GAGGCCCAATTNONE 
J065069A13GAGGCCCAATTNONE 
J065082E04GAGGCCCAATTNONE 
J065102N09GAGGCCCAATTNONE 
J065157O10GAGGCCCAATTNONE 
J065188N23GAGGCCCAATTNONE 
J065190J11GAGGCCCAATTNONE 
J065202M09GAGGCCCAATTNONE 
Os02g0824700009-023-E06AATTGGGCCGCSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18AATTGGGCCGCNONE 
J065017H21AATTGGGCCGCNONE 
J065052N02AATTGGGCCGCNONE 
J065053M01AATTGGGCCGCNONE 
J065064B14AATTGGGCCGCNONE 
J065146K22AATTGGGCCGCNONE 
Os03g0126300AK061256TCAGGCCCAATTATGGCCCATAANONE 
AK061961TCAGGCCCAATTATGGCCCATAANONE 
AY346336TCAGGCCCAATTATGGCCCATAASAM (and some other nucleotide) binding motif domain containing protein. 
J065023J17TCAGGCCCAATTATGGCCCATAANONE 
J090023H12TCAGGCCCAATTATGGCCCATAANONE 
Os03g0172200AK069130AATTGGGCCGGCArmadillo-like helical domain containing protein. 
Os03g0219200011-045-E01GCGGCCCAATTNONE 
AK073785GCGGCCCAATTSimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19GCGGCCCAATTNONE 
J043009H23GCGGCCCAATTNONE 
Os03g0255200AK058212GGTTGGGCTGGGCCCAATTNONE 
AK071625GGTTGGGCTGGGCCCAATTHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0256400AK073854TGTGGGCTGAATTGGGCCTTSimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0257900009-150-G06AATTGGGCCTTTTTGGGCCGANONE 
009-181-H05AATTGGGCCTTTTTGGGCCGANONE 
AK063892AATTGGGCCTTTTTGGGCCGANONE 
AK100114AATTGGGCCTTTTTGGGCCGASimilar to Lectin-like receptor kinase 7;2. 
AK103486AATTGGGCCTTTTTGGGCCGANONE 
J023006K11AATTGGGCCTTTTTGGGCCGANONE 
J075005E15AATTGGGCCTTTTTGGGCCGANONE 
J075007K24AATTGGGCCTTTTTGGGCCGANONE 
J075034G06AATTGGGCCTTTTTGGGCCGANONE 
J075051I19AATTGGGCCTTTTTGGGCCGANONE 
J075076A08AATTGGGCCTTTTTGGGCCGANONE 
J075096H04AATTGGGCCTTTTTGGGCCGANONE 
J075115I09AATTGGGCCTTTTTGGGCCGANONE 
J075132K23AATTGGGCCTTTTTGGGCCGANONE 
J075147C17AATTGGGCCTTTTTGGGCCGANONE 
J090059O20AATTGGGCCTTTTTGGGCCGANONE 
Os03g0324800AK059868AATTGGGCNONE 
AK071431AATTGGGCHypothetical protein. 
Os03g0355800AK069271AATTGGGCTTTNONE 
AK103902AATTGGGCTTTSimilar to Diphthine synthase (EC 2.1.1.98) (Diphthamide biosynthesis methyltransferase). 
Os03g0569900009-027-A11AATTGGGCNONE 
AK063783AATTGGGCNONE 
Os03g0598900J053098D07AATTGGGCCTGGGCCATNONE 
J065063O13AATTGGGCCTGGGCCATDSBA oxidoreductase family protein. 
Os03g0681900006-042-F08TCGGCCCAATTNONE 
009-043-F12TCGGCCCAATTNONE 
AK061750TCGGCCCAATTNONE 
AK062094TCGGCCCAATTSimilar to RGP-3 (Fragment). 
J033034F01TCGGCCCAATTNONE 
J033131F11TCGGCCCAATTNONE 
J033143N03TCGGCCCAATTNONE 
Os03g0699100AK110715AGCCCAATTWD40-like domain containing protein. 
Os03g0719100AK065127AGCCCAATTDNA-binding SAP domain containing protein. 
J013001P07AGCCCAATTNONE 
J065102J01AGCCCAATTNONE 
J065205K05AGCCCAATTNONE 
Os03g0740700011-093-H12AATTGGGCTGANONE 
AK102723AATTGGGCTGAProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19AATTGGGCTGANONE 
J013126N16AATTGGGCTGANONE 
J033105J16AATTGGGCTGANONE 
J090059D19AATTGGGCTGANONE 
Os03g0752800AB041020AATTGGGCNONE 
AF058697AATTGGGCMADS14 protein. 
AF139664AATTGGGCNONE 
AK121171AATTGGGCNONE 
AY332478AATTGGGCNONE 
AY551916AATTGGGCNONE 
J023081C04AATTGGGCNONE 
Os03g0766900AK066137CACGGCCCAATTAllene oxide synthase. 
AK071361CACGGCCCAATTNONE 
AK103989CACGGCCCAATTNONE 
J023090K09CACGGCCCAATTNONE 
J043022H11CACGGCCCAATTNONE 
J053078F12CACGGCCCAATTNONE 
Os03g0776900AK107941CCCGGCCCAATTSimilar to DNAJ protein-like. 
J053100E14CCCGGCCCAATTNONE 
J075111A12CCCGGCCCAATTNONE 
Os03g0784400AK103474AAATGGGCCCAATTProtein of unknown function DUF1692 domain containing protein. 
J023135I15AAATGGGCCCAATTNONE 
J033130D12AAATGGGCCCAATTNONE 
J043035E20AAATGGGCCCAATTNONE 
J065206K15AAATGGGCCCAATTNONE 
J075053J20AAATGGGCCCAATTNONE 
J075129B11AAATGGGCCCAATTNONE 
J090003E22AAATGGGCCCAATTNONE 
J100023E23AAATGGGCCCAATTNONE 
Os03g0786700AK067936AATTGGGCCCATCCN2,N2-dimethylguanosine tRNA methyltransferase family protein. 
Os03g0803800012-043-D10TCCGGCCCAATTNONE 
AK063484TCCGGCCCAATTConserved hypothetical protein. 
Os03g0820100011-030-A10ATGGCCCAATTNONE 
011-031-C01ATGGCCCAATTNONE 
AK111534ATGGCCCAATTSimilar to Auxin-resistance protein AXR1. 
J013033L14ATGGCCCAATTNONE 
J013034D14ATGGCCCAATTNONE 
J013065N20ATGGCCCAATTNONE 
J013127A04ATGGCCCAATTNONE 
J013146A11ATGGCCCAATTNONE 
J023025D19ATGGCCCAATTNONE 
J023083K15ATGGCCCAATTNONE 
J033037N01ATGGCCCAATTNONE 
J033041H02ATGGCCCAATTNONE 
J043009M22ATGGCCCAATTNONE 
J090039L03ATGGCCCAATTNONE 
J090050L08ATGGCCCAATTNONE 
J090053J21ATGGCCCAATTNONE 
J090088G07ATGGCCCAATTNONE 
Os03g0826000AK072695AATTGGGCConserved hypothetical protein. 
Os03g0837300AK111243AAAGCCCAATTNONE 
AK121140AAAGCCCAATTNicotinate phosphoribosyltransferase and related family protein. 
AY214337AAAGCCCAATTNONE 
J023077G12AAAGCCCAATTNONE 
J023078M10AAAGCCCAATTNONE 
J033031B10AAAGCCCAATTNONE 
J033067L18AAAGCCCAATTNONE 
J043005P09AAAGCCCAATTNONE 
J090013J15AAAGCCCAATTNONE 
J090042E10AAAGCCCAATTNONE 
J090045A20AAAGCCCAATTNONE 
J100022H02AAAGCCCAATTNONE 
Os03g0845700009-075-D05AATTGGGCCTTGNONE 
AK062622AATTGGGCCTTGSimilar to RPB17 (Fragment). 
J065068H03AATTGGGCCTTGNONE 
J065075A18AATTGGGCCTTGNONE 
J065118C19AATTGGGCCTTGNONE 
J075001B15AATTGGGCCTTGNONE 
J075048D11AATTGGGCCTTGNONE 
J075056D01AATTGGGCCTTGNONE 
J075092P03AATTGGGCCTTGNONE 
J075111I04AATTGGGCCTTGNONE 
Os04g0103200003-106-F06AATTGGGCCGAANONE 
015-058-G03AATTGGGCCGAANONE 
AK060850AATTGGGCCGAANONE 
AK066032AATTGGGCCGAAProteasome component region PCI domain containing protein. 
J013046D12AATTGGGCCGAANONE 
J013088L18AATTGGGCCGAANONE 
J013093J06AATTGGGCCGAANONE 
J013111I01AATTGGGCCGAANONE 
J013120B15AATTGGGCCGAANONE 
J013149K17AATTGGGCCGAANONE 
J023010J08AATTGGGCCGAANONE 
J023034J10AATTGGGCCGAANONE 
J023055D05AATTGGGCCGAANONE 
J033023L03AATTGGGCCGAANONE 
J033025N21AATTGGGCCGAANONE 
J033026A19AATTGGGCCGAANONE 
J033026M14AATTGGGCCGAANONE 
J033046J22AATTGGGCCGAANONE 
J033052H11AATTGGGCCGAANONE 
J033058P05AATTGGGCCGAANONE 
J033064A11AATTGGGCCGAANONE 
J033067K11AATTGGGCCGAANONE 
J033076H02AATTGGGCCGAANONE 
J033094E04AATTGGGCCGAANONE 
J033106A02AATTGGGCCGAANONE 
J033108N14AATTGGGCCGAANONE 
J033114I06AATTGGGCCGAANONE 
J033118H18AATTGGGCCGAANONE 
J033148C05AATTGGGCCGAANONE 
J043010I24AATTGGGCCGAANONE 
J043037C07AATTGGGCCGAANONE 
J053025M02AATTGGGCCGAANONE 
J053026N08AATTGGGCCGAANONE 
J053027O14AATTGGGCCGAANONE 
J065038N11AATTGGGCCGAANONE 
J065219C03AATTGGGCCGAANONE 
J090011F14AATTGGGCCGAANONE 
J090027C03AATTGGGCCGAANONE 
J090067M19AATTGGGCCGAANONE 
J090069C17AATTGGGCCGAANONE 
J090070P21AATTGGGCCGAANONE 
J090075N11AATTGGGCCGAANONE 
J090095C22AATTGGGCCGAANONE 
J100027O14AATTGGGCCGAANONE 
J100055E01AATTGGGCCGAANONE 
Os04g0117800Os04g0117800AATTGGGCCTCAmidase family protein. 
Os04g0194000AK102654AATTGGGCCTTGCyclin-like F-box domain containing protein. 
J033101G08AATTGGGCCTTGNONE 
J090084B18AATTGGGCCTTGNONE 
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein. 
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
Os04g0381100AK121764TAAGCCCAATTBile acid:sodium symporter family protein. 
Os04g0440000AK073064GCAGCCCAATTNONE 
AK101691GCAGCCCAATTConserved hypothetical protein. 
AK102407GCAGCCCAATTNONE 
Os04g0440100AK101324AAGGCCCAATTNONE 
AK105415AAGGCCCAATTNonsense-mediated decay UPF3 domain containing protein. 
Os04g0446500015-073-B06CCAGGCCCAATTNONE 
AB118009CCAGGCCCAATTNONE 
AK073743CCAGGCCCAATTNONE 
AK103814CCAGGCCCAATTSimilar to FK506-binding protein 2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (FKBP-13) (FKBP-15). 
J033055H15CCAGGCCCAATTNONE 
J033067L09CCAGGCCCAATTNONE 
J033147C19CCAGGCCCAATTNONE 
J033147C20CCAGGCCCAATTNONE 
Os04g0476400J033082D17AGCCCAATTNONE 
Os04g0577000AK073711AATTGGGCCCTUbiquitin fusion degradation protein UFD1 family protein. 
AK119957AATTGGGCCCTNONE 
J013127H04AATTGGGCCCTNONE 
J033035G06AATTGGGCCCTNONE 
J033061G23AATTGGGCCCTNONE 
J033127L07AATTGGGCCCTNONE 
J065015F17AATTGGGCCCTNONE 
J065062G08AATTGGGCCCTNONE 
J065132M07AATTGGGCCCTNONE 
J065155C12AATTGGGCCCTNONE 
J075055I08AATTGGGCCCTNONE 
J075140D07AATTGGGCCCTNONE 
J090055B21AATTGGGCCCTNONE 
J100031D23AATTGGGCCCTNONE 
Os04g0611300009-006-G08TATTGGGCTGGCCCAATTNONE 
009-011-C01TATTGGGCTGGCCCAATTNONE 
009-036-B09TATTGGGCTGGCCCAATTNONE 
009-116-G09TATTGGGCTGGCCCAATTNONE 
009-126-E09TATTGGGCTGGCCCAATTNONE 
009-132-F09TATTGGGCTGGCCCAATTNONE 
009-151-G07TATTGGGCTGGCCCAATTNONE 
009-155-C07TATTGGGCTGGCCCAATTNONE 
009-163-G01TATTGGGCTGGCCCAATTNONE 
009-169-G08TATTGGGCTGGCCCAATTNONE 
009-191-B02TATTGGGCTGGCCCAATTNONE 
009-196-A08TATTGGGCTGGCCCAATTNONE 
009-198-E07TATTGGGCTGGCCCAATTNONE 
014-015-F04TATTGGGCTGGCCCAATTNONE 
015-087-H04TATTGGGCTGGCCCAATTNONE 
AK062605TATTGGGCTGGCCCAATTNONE 
AK063022TATTGGGCTGGCCCAATTConserved hypothetical protein. 
AK066749TATTGGGCTGGCCCAATTNONE 
AK104924TATTGGGCTGGCCCAATTNONE 
J065002M20TATTGGGCTGGCCCAATTNONE 
J065045L23TATTGGGCTGGCCCAATTNONE 
J065101E05TATTGGGCTGGCCCAATTNONE 
J065140J23TATTGGGCTGGCCCAATTNONE 
J065179G11TATTGGGCTGGCCCAATTNONE 
J065191B18TATTGGGCTGGCCCAATTNONE 
J065192E03TATTGGGCTGGCCCAATTNONE 
J065199H21TATTGGGCTGGCCCAATTNONE 
J075067F01TATTGGGCTGGCCCAATTNONE 
J075089L01TATTGGGCTGGCCCAATTNONE 
J075147K22TATTGGGCTGGCCCAATTNONE 
J080069G23TATTGGGCTGGCCCAATTNONE 
J100053D10TATTGGGCTGGCCCAATTNONE 
J100078C10TATTGGGCTGGCCCAATTNONE 
Os04g0654700006-097-D06AATTGGGCCGTCCNONE 
013-016-H01AATTGGGCCGTCCNONE 
AB055495AATTGGGCCGTCCNONE 
AF072849AATTGGGCCGTCCNONE 
AK062107AATTGGGCCGTCCNONE 
AK099088AATTGGGCCGTCCSimilar to COP9 signalosome complex subunit 5b (EC 3.4.-.-) (Signalosome subunit 5b) (Jun activation domain-binding homolog 1). 
J013038I16AATTGGGCCGTCCNONE 
J013038J23AATTGGGCCGTCCNONE 
J013038L17AATTGGGCCGTCCNONE 
J013038N18AATTGGGCCGTCCNONE 
J013038O18AATTGGGCCGTCCNONE 
J013124A09AATTGGGCCGTCCNONE 
J023007N04AATTGGGCCGTCCNONE 
J033023C02AATTGGGCCGTCCNONE 
J033030M18AATTGGGCCGTCCNONE 
J033068I09AATTGGGCCGTCCNONE 
J033100E04AATTGGGCCGTCCNONE 
J065153E19AATTGGGCCGTCCNONE 
J065207I02AATTGGGCCGTCCNONE 
J075007A07AATTGGGCCGTCCNONE 
J075036M04AATTGGGCCGTCCNONE 
J075147I03AATTGGGCCGTCCNONE 
J075197L11AATTGGGCCGTCCNONE 
Os04g0660600009-113-A11CCCGGGCCCAATTNONE 
AK120899CCCGGGCCCAATTATPase, V0 complex, subunit H family protein. 
J023030J05CCCGGGCCCAATTNONE 
J065068M07CCCGGGCCCAATTNONE 
J065120G22CCCGGGCCCAATTNONE 
J065168J18CCCGGGCCCAATTNONE 
J065211M10CCCGGGCCCAATTNONE 
J075175E21CCCGGGCCCAATTNONE 
J090021C06CCCGGGCCCAATTNONE 
J090032P15CCCGGGCCCAATTNONE 
J090082E05CCCGGGCCCAATTNONE 
J100090O11CCCGGGCCCAATTNONE 
Os05g0110100009-015-D08AATTGGGCCAANONE 
009-023-C09AATTGGGCCAANONE 
009-031-B11AATTGGGCCAANONE 
009-034-C02AATTGGGCCAANONE 
009-050-B08AATTGGGCCAANONE 
009-065-D12AATTGGGCCAANONE 
009-090-G08AATTGGGCCAANONE 
009-111-H07AATTGGGCCAANONE 
009-136-F12AATTGGGCCAANONE 
009-138-E06AATTGGGCCAANONE 
009-138-G12AATTGGGCCAANONE 
009-141-D08AATTGGGCCAANONE 
009-143-D01AATTGGGCCAANONE 
009-179-D09AATTGGGCCAANONE 
009-179-E03AATTGGGCCAANONE 
009-196-A09AATTGGGCCAANONE 
009-199-F04AATTGGGCCAANONE 
013-021-E05AATTGGGCCAANONE 
013-076-C04AATTGGGCCAANONE 
013-096-F06AATTGGGCCAANONE 
014-071-A05AATTGGGCCAANONE 
014-077-F09AATTGGGCCAANONE 
AK099779AATTGGGCCAANONE 
AK121142AATTGGGCCAAConserved hypothetical protein. 
J013095A16AATTGGGCCAANONE 
J013111A17AATTGGGCCAANONE 
J013132G04AATTGGGCCAANONE 
J023077M04AATTGGGCCAANONE 
J065001B11AATTGGGCCAANONE 
J065001E11AATTGGGCCAANONE 
J065057G10AATTGGGCCAANONE 
J065057L08AATTGGGCCAANONE 
J065080E07AATTGGGCCAANONE 
J065087K10AATTGGGCCAANONE 
J065091M15AATTGGGCCAANONE 
J065167A15AATTGGGCCAANONE 
J075018F02AATTGGGCCAANONE 
J075063F20AATTGGGCCAANONE 
J075064F18AATTGGGCCAANONE 
J075066N19AATTGGGCCAANONE 
J075073I02AATTGGGCCAANONE 
J075080P17AATTGGGCCAANONE 
J075081F11AATTGGGCCAANONE 
J075085E03AATTGGGCCAANONE 
J075101G18AATTGGGCCAANONE 
J075149N08AATTGGGCCAANONE 
J075158I21AATTGGGCCAANONE 
J075161M20AATTGGGCCAANONE 
J075190F12AATTGGGCCAANONE 
J075194K16AATTGGGCCAANONE 
J080001E08AATTGGGCCAANONE 
J080001F21AATTGGGCCAANONE 
J080001H19AATTGGGCCAANONE 
J080001O15AATTGGGCCAANONE 
J080005I22AATTGGGCCAANONE 
J080006K23AATTGGGCCAANONE 
J080014D20AATTGGGCCAANONE 
J080014I05AATTGGGCCAANONE 
J080014K21AATTGGGCCAANONE 
J080017I24AATTGGGCCAANONE 
J080017K11AATTGGGCCAANONE 
J080018F11AATTGGGCCAANONE 
J080022L18AATTGGGCCAANONE 
J080024N23AATTGGGCCAANONE 
J080027J23AATTGGGCCAANONE 
J080029B14AATTGGGCCAANONE 
J080032F14AATTGGGCCAANONE 
J080032K19AATTGGGCCAANONE 
J080032O21AATTGGGCCAANONE 
J080033P17AATTGGGCCAANONE 
J080034I06AATTGGGCCAANONE 
J080039F24AATTGGGCCAANONE 
J080040O13AATTGGGCCAANONE 
J080042B02AATTGGGCCAANONE 
J080043E12AATTGGGCCAANONE 
J080043J15AATTGGGCCAANONE 
J080043N09AATTGGGCCAANONE 
J080052J08AATTGGGCCAANONE 
J080053K01AATTGGGCCAANONE 
J080053K19AATTGGGCCAANONE 
J080055J09AATTGGGCCAANONE 
J080058D07AATTGGGCCAANONE 
J080062F11AATTGGGCCAANONE 
J080063J24AATTGGGCCAANONE 
J080066H04AATTGGGCCAANONE 
J080066I09AATTGGGCCAANONE 
J080067B02AATTGGGCCAANONE 
J080067N09AATTGGGCCAANONE 
J080068D22AATTGGGCCAANONE 
J080068K13AATTGGGCCAANONE 
J080069N19AATTGGGCCAANONE 
J080070D07AATTGGGCCAANONE 
J080070E05AATTGGGCCAANONE 
J080071G04AATTGGGCCAANONE 
J080077G05AATTGGGCCAANONE 
J080077O06AATTGGGCCAANONE 
J080085F05AATTGGGCCAANONE 
J080086E07AATTGGGCCAANONE 
J080089G16AATTGGGCCAANONE 
J080092K15AATTGGGCCAANONE 
J080094A08AATTGGGCCAANONE 
J080097A09AATTGGGCCAANONE 
J080097J07AATTGGGCCAANONE 
J090027N01AATTGGGCCAANONE 
J090081J05AATTGGGCCAANONE 
Os05g0111000AK073598TCAGCCCAATTSimilar to Gag polyprotein [Contains: Core protein p15 (Matrix protein); Core protein p24; Core protein p12]. 
Os05g0149600012-070-F05GCAGCCCAATTNONE 
012-080-A12GCAGCCCAATTNONE 
012-082-C06GCAGCCCAATTNONE 
AK073947GCAGCCCAATTSimilar to Cullin-1. 
J023063A09GCAGCCCAATTNONE 
J033073A13GCAGCCCAATTNONE 
J033093B09GCAGCCCAATTNONE 
J065017B10GCAGCCCAATTNONE 
J065037P19GCAGCCCAATTNONE 
J065142G16GCAGCCCAATTNONE 
J065147F13GCAGCCCAATTNONE 
J065195M20GCAGCCCAATTNONE 
J090011L24GCAGCCCAATTNONE 
J090018I19GCAGCCCAATTNONE 
J090040M12GCAGCCCAATTNONE 
J090054K21GCAGCCCAATTNONE 
J090059G09GCAGCCCAATTNONE 
J090070H17GCAGCCCAATTNONE 
J090071G17GCAGCCCAATTNONE 
J090077L09GCAGCCCAATTNONE 
J090091C15GCAGCCCAATTNONE 
J100032J17GCAGCCCAATTNONE 
J100061E08GCAGCCCAATTNONE 
Os05g0155300AK069217AGCCCAATTSimilar to HIRA interacting protein 5. 
Os05g0156200AK071622GCCGGCCCAATTConserved hypothetical protein. 
J023099E19GCCGGCCCAATTNONE 
J090025C09GCCGGCCCAATTNONE 
J090071K23GCCGGCCCAATTNONE 
Os05g0168400006-039-A06AATTGGGCCAANONE 
AK069800AATTGGGCCAANONE 
AK106195AATTGGGCCAAConserved hypothetical protein. 
J065086N09AATTGGGCCAANONE 
J065137B10AATTGGGCCAANONE 
J075062B04AATTGGGCCAANONE 
J075193I07AATTGGGCCAANONE 
J075193K24AATTGGGCCAANONE 
J075194D10AATTGGGCCAANONE 
J100037F01AATTGGGCCAANONE 
J100071E09AATTGGGCCAANONE 
Os05g0194600AK102487TTTTGGGCTTAAGGGCCCAATTPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01TTTTGGGCTTAAGGGCCCAATTNONE 
J100041A08TTTTGGGCTTAAGGGCCCAATTNONE 
Os05g0220900AK109172CCCAGCCCAATTNONE 
AK109456CCCAGCCCAATTPrefoldin domain containing protein. 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0355900009-173-H04AATTGGGCNONE 
AK063096AATTGGGCConserved hypothetical protein. 
Os05g0447000AK108280AATTGGGCTTTTAGCCCATGTSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0461000006-113-A06TCCGGCCCAATTNONE 
AB042259TCCGGCCCAATTNONE 
AK059189TCCGGCCCAATTNONE 
AK066739TCCGGCCCAATTClathrin adaptor complex, small chain family protein. 
AK099044TCCGGCCCAATTNONE 
AK104166TCCGGCCCAATTNONE 
Os05g0461300AK111917AATTGGGCCCCACTCCSimilar to RAB8C. 
AK111946AATTGGGCCCCACTCCNONE 
AK111972AATTGGGCCCCACTCCNONE 
AK112021AATTGGGCCCCACTCCNONE 
J033135H16AATTGGGCCCCACTCCNONE 
J043036O11AATTGGGCCCCACTCCNONE 
Os05g0482400AK109526GCCCAATTCytochrome P450 family protein. 
Os05g0506900AK106697AATTGGGCCGAGBrix domain containing protein. 
Os05g0539300Os05g0539300AATTGGGCCGCAProtein of unknown function DUF295 family protein. 
Os05g0540100AB021666AATTGGGCCGAAANONE 
AK060623AATTGGGCCGAAANONE 
AK103819AATTGGGCCGAAAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0540600AK072324GCCCAATTCyclin-like F-box domain containing protein. 
AK099110GCCCAATTNONE 
J023031J01GCCCAATTNONE 
Os05g0542900AK102925GCCCAATTVirulence factor, pectin lyase fold family protein. 
Os05g0552900AK102095CCAGCCCAATTMAP65/ASE1 family protein. 
Os05g0557200AK062090AATTGGGCTNONE 
AK102111AATTGGGCTArmadillo-like helical domain containing protein. 
J013047E13AATTGGGCTNONE 
J013089P04AATTGGGCTNONE 
J013130H17AATTGGGCTNONE 
J013132C20AATTGGGCTNONE 
J023001E06AATTGGGCTNONE 
J023108C09AATTGGGCTNONE 
J023125C12AATTGGGCTNONE 
J033023O10AATTGGGCTNONE 
J033033K16AATTGGGCTNONE 
J033064C11AATTGGGCTNONE 
J033071P07AATTGGGCTNONE 
J033072H14AATTGGGCTNONE 
J033084F06AATTGGGCTNONE 
J033084H11AATTGGGCTNONE 
J033097C05AATTGGGCTNONE 
J043009E20AATTGGGCTNONE 
J053035M10AATTGGGCTNONE 
J053043J22AATTGGGCTNONE 
J053082K10AATTGGGCTNONE 
J053094N13AATTGGGCTNONE 
Os05g0575300AK068873AATTGGGCCCAAGNONE 
J013170P17AATTGGGCCCAAGNONE 
Os05g0576300015-055-B11GCCCAATTNONE 
AK106354GCCCAATTZinc finger, CCCH-type domain containing protein. 
Os06g0101300013-080-G09AGTTGGGCCTAATTGGGCCTGGNONE 
015-006-A01AGTTGGGCCTAATTGGGCCTGGNONE 
015-044-F09AGTTGGGCCTAATTGGGCCTGGNONE 
AK109515AGTTGGGCCTAATTGGGCCTGGZinc finger, RING-type domain containing protein. 
AK121897AGTTGGGCCTAATTGGGCCTGGNONE 
J033084O06AGTTGGGCCTAATTGGGCCTGGNONE 
J033105E24AGTTGGGCCTAATTGGGCCTGGNONE 
J033126H24AGTTGGGCCTAATTGGGCCTGGNONE 
J065001F05AGTTGGGCCTAATTGGGCCTGGNONE 
J065002H03AGTTGGGCCTAATTGGGCCTGGNONE 
J065026B12AGTTGGGCCTAATTGGGCCTGGNONE 
J065093E11AGTTGGGCCTAATTGGGCCTGGNONE 
J065122E04AGTTGGGCCTAATTGGGCCTGGNONE 
J065164O07AGTTGGGCCTAATTGGGCCTGGNONE 
J065182M16AGTTGGGCCTAATTGGGCCTGGNONE 
J065217N11AGTTGGGCCTAATTGGGCCTGGNONE 
J090002P22AGTTGGGCCTAATTGGGCCTGGNONE 
Os06g0110000AK069429AATTGGGCSimilar to DWARF3 (Fragment). 
Os06g0174350J043034B05AATTGGGCConserved hypothetical protein. 
Os06g0220800AK059876AATTGGGCCCATGANONE 
AY739306AATTGGGCCCATGAThioredoxin domain 2 containing protein. 
J075093C09AATTGGGCCCATGANONE 
J100026J18AATTGGGCCCATGANONE 
J100041O16AATTGGGCCCATGANONE 
J100089K16AATTGGGCCCATGANONE 
Os06g0257200J053059P05AATTGGGCCCATGGNONE 
J075006K03AATTGGGCCCATGGNONE 
J075067F07AATTGGGCCCATGGNONE 
J075068F14AATTGGGCCCATGGNONE 
J075068H14AATTGGGCCCATGGNONE 
J075098N06AATTGGGCCCATGGNONE 
J075099F08AATTGGGCCCATGGNONE 
J075154G24AATTGGGCCCATGGNONE 
J075195H09AATTGGGCCCATGGNONE 
Os06g0320000009-030-C04CAAGGCCCAATTNONE 
009-135-F08CAAGGCCCAATTNONE 
J075103B05CAAGGCCCAATTProtein of unknown function DUF953, thioredoxin-like family protein. 
J075187J24CAAGGCCCAATTNONE 
Os06g0567900AB004799AGCCCAATTSimilar to L-ascorbate oxidase precursor (EC 1.10.3.3) (Ascorbase) (ASO). 
AK105605AGCCCAATTNONE 
Os06g0591200009-125-G07GGGGCCCAATTNONE 
009-177-A08GGGGCCCAATTNONE 
AK062563GGGGCCCAATTConserved hypothetical protein. 
AK120112GGGGCCCAATTNONE 
J013025D20GGGGCCCAATTNONE 
J100018M02GGGGCCCAATTNONE 
J100021J11GGGGCCCAATTNONE 
J100024D08GGGGCCCAATTNONE 
J100044L11GGGGCCCAATTNONE 
J100077A22GGGGCCCAATTNONE 
J100090B19GGGGCCCAATTNONE 
Os06g0622700AK107021TCTCGGCCCAATTEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTCGGCCCAATTNONE 
J065100L18TCTCGGCCCAATTNONE 
J065129N15TCTCGGCCCAATTNONE 
J065152M08TCTCGGCCCAATTNONE 
J065198M12TCTCGGCCCAATTNONE 
J090077J22TCTCGGCCCAATTNONE 
J100024G23TCTCGGCCCAATTNONE 
J100027L01TCTCGGCCCAATTNONE 
J100047C06TCTCGGCCCAATTNONE 
J100055D01TCTCGGCCCAATTNONE 
J100067M05TCTCGGCCCAATTNONE 
J100077M16TCTCGGCCCAATTNONE 
J100078M22TCTCGGCCCAATTNONE 
Os06g0667600AK058606AGCCCAATTNONE 
AK071621AGCCCAATTSimilar to Glycine decarboxylase complex H-protein. 
J023101D03AGCCCAATTNONE 
J033095E17AGCCCAATTNONE 
J065020B16AGCCCAATTNONE 
Os06g0688100AK063450AATTGGGCCGCNONE 
AK101144AATTGGGCCGCRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0711800AK069642GCCCAATTPectinesterase inhibitor domain containing protein. 
J075094A19GCCCAATTNONE 
Os06g0715000AK107114TTCGGCCCAATTConserved hypothetical protein. 
Os06g0729400AK059502AATTGGGCSimilar to Gibberellin-regulated protein 2 precursor. 
J075059J17AATTGGGCNONE 
J075087D08AATTGGGCNONE 
Os07g0100300AK066040GCCCAATTConserved hypothetical protein. 
AK109623GCCCAATTNONE 
J065041I01GCCCAATTNONE 
J065091G11GCCCAATTNONE 
Os07g0109600AK063942AATTGGGCGTCCGATLeo1-like protein family protein. 
Os07g0133700J065005A21AAATGGGCTAATTGGGCCTTHypothetical protein. 
J065096D02AAATGGGCTAATTGGGCCTTNONE 
J065097G13AAATGGGCTAATTGGGCCTTNONE 
Os07g0150200009-152-C07GAGGCCCAATTNONE 
AK058680GAGGCCCAATTNONE 
AK121635GAGGCCCAATTSimilar to 40S ribosomal protein S12-1. 
J033051C16GAGGCCCAATTNONE 
J033123H15GAGGCCCAATTNONE 
J065093I01GAGGCCCAATTNONE 
J065197C05GAGGCCCAATTNONE 
J075037B11GAGGCCCAATTNONE 
J075114B08GAGGCCCAATTNONE 
J075123N01GAGGCCCAATTNONE 
J075129O04GAGGCCCAATTNONE 
J075160H17GAGGCCCAATTNONE 
J075166H17GAGGCCCAATTNONE 
J080310F11GAGGCCCAATTNONE 
J080315P11GAGGCCCAATTNONE 
J090025A22GAGGCCCAATTNONE 
Os07g0155200006-036-E03AATTGGGCCCATGTNONE 
006-036-E04AATTGGGCCCATGTNONE 
AK061006AATTGGGCCCATGTProtein of unknown function DUF150 family protein. 
AK104606AATTGGGCCCATGTNONE 
Os07g0158300006-049-G04TAGGCCCAATTNONE 
AK099188TAGGCCCAATTNONE 
AK104773TAGGCCCAATTNONE 
J013106F16TAGGCCCAATTNONE 
J013123H22TAGGCCCAATTNONE 
J023029J02TAGGCCCAATTNONE 
J023029J03TAGGCCCAATTNONE 
J033138N08TAGGCCCAATTNONE 
J075011F05TAGGCCCAATTNONE 
J075022F10TAGGCCCAATTNONE 
J075071L13TAGGCCCAATTNONE 
J075094B08TAGGCCCAATTNONE 
J075119B21TAGGCCCAATTNONE 
J075140L02TAGGCCCAATTNONE 
J075199O21TAGGCCCAATTNONE 
J080001I17TAGGCCCAATTNONE 
J080005M04TAGGCCCAATTNONE 
J080011P17TAGGCCCAATTNONE 
J080026B14TAGGCCCAATTNONE 
J080026C12TAGGCCCAATTNONE 
J080030N16TAGGCCCAATTNONE 
J080035K23TAGGCCCAATTNONE 
J080039J22TAGGCCCAATTNONE 
J080045D04TAGGCCCAATTNONE 
J080050C06TAGGCCCAATTNONE 
J080050K14TAGGCCCAATTNONE 
J080051I09TAGGCCCAATTNONE 
J080053F18TAGGCCCAATTNONE 
J080053G10TAGGCCCAATTNONE 
J080055F05TAGGCCCAATTNONE 
J080057E22TAGGCCCAATTNONE 
J080058F17TAGGCCCAATTNONE 
J080063C18TAGGCCCAATTNONE 
J080065E02TAGGCCCAATTNONE 
J080066E06TAGGCCCAATTNONE 
J080067O05TAGGCCCAATTNONE 
J080068N15TAGGCCCAATTNONE 
J080071O04TAGGCCCAATTNONE 
J080074A20TAGGCCCAATTNONE 
J080074E14TAGGCCCAATTNONE 
J080074L05TAGGCCCAATTNONE 
J080075E08TAGGCCCAATTNONE 
J080075H07TAGGCCCAATTNONE 
J080077D04TAGGCCCAATTNONE 
J080077N15TAGGCCCAATTNONE 
J080078A07TAGGCCCAATTNONE 
J080079H22TAGGCCCAATTNONE 
J080080F20TAGGCCCAATTNONE 
J080080M22TAGGCCCAATTNONE 
J080081K09TAGGCCCAATTNONE 
J080081L04TAGGCCCAATTNONE 
J080090K09TAGGCCCAATTNONE 
J080093O13TAGGCCCAATTNONE 
J080094A18TAGGCCCAATTNONE 
J080094E10TAGGCCCAATTNONE 
J080094H06TAGGCCCAATTNONE 
J080096I21TAGGCCCAATTNONE 
J100081A19TAGGCCCAATTNONE 
Os07g0176600AK066812TCAGCCCAATTNONE 
AK067073TCAGCCCAATTSimilar to Kinase-like protein. 
Os07g0190900012-063-F11AATTGGGCCTANONE 
AK073533AATTGGGCCTASMAD/FHA domain containing protein. 
J013110O09AATTGGGCCTANONE 
J033041I12AATTGGGCCTANONE 
J033046D05AATTGGGCCTANONE 
J033101K24AATTGGGCCTANONE 
J090009F10AATTGGGCCTANONE 
J090095B17AATTGGGCCTANONE 
Os07g0191000AK071379TAGGCCCAATTInositol monophosphatase family protein. 
AK103440TAGGCCCAATTNONE 
Os07g0225000J090009I07GCCCAATTConserved hypothetical protein. 
Os07g0256200AK072904AATTGGGCCTARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23AATTGGGCCTANONE 
Os07g0296900J075050I18ATTTGGGCCCAATTConserved hypothetical protein. 
Os07g0513200015-004-B02AGCCCAATTNONE 
AK101410AGCCCAATTNONE 
AK106227AGCCCAATTNONE 
AK119451AGCCCAATTProtein prenyltransferase domain containing protein. 
Os07g0595700003-103-G05GAGGCCCAATTNONE 
AK108488GAGGCCCAATTConserved hypothetical protein. 
J065136O05GAGGCCCAATTNONE 
Os07g0595800011-069-G09AATTGGGCCTCNONE 
AK066349AATTGGGCCTCPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05AATTGGGCCTCNONE 
Os07g0611700AK109158GAAGCCCATACTGGCCCAATTPeptidase C1A, papain family protein. 
Os07g0611800Os07g0611800GAAGCCCATACTGGCCCAATTNONE 
Os07g0626300AK100052TCGGCCCAATTConserved hypothetical protein. 
Os07g0631300009-145-C11AATTGGGCATTGGGCCTCNONE 
AK063855AATTGGGCATTGGGCCTCConserved hypothetical protein. 
J043012K22AATTGGGCATTGGGCCTCNONE 
J043020D08AATTGGGCATTGGGCCTCNONE 
J065015L18AATTGGGCATTGGGCCTCNONE 
J065021G12AATTGGGCATTGGGCCTCNONE 
J065021H11AATTGGGCATTGGGCCTCNONE 
J065042D02AATTGGGCATTGGGCCTCNONE 
J065067O21AATTGGGCATTGGGCCTCNONE 
J065078J12AATTGGGCATTGGGCCTCNONE 
J065094B22AATTGGGCATTGGGCCTCNONE 
J065106N18AATTGGGCATTGGGCCTCNONE 
J065150G13AATTGGGCATTGGGCCTCNONE 
J065157K08AATTGGGCATTGGGCCTCNONE 
J065164B05AATTGGGCATTGGGCCTCNONE 
J065172G19AATTGGGCATTGGGCCTCNONE 
J065173F12AATTGGGCATTGGGCCTCNONE 
J065174D16AATTGGGCATTGGGCCTCNONE 
J065185B02AATTGGGCATTGGGCCTCNONE 
J065207B14AATTGGGCATTGGGCCTCNONE 
J065207J19AATTGGGCATTGGGCCTCNONE 
J065212L20AATTGGGCATTGGGCCTCNONE 
J100053C03AATTGGGCATTGGGCCTCNONE 
Os07g0644300AK066726CTCGGCCCAATTSimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK066726TAAGCCCAATTSimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483CTCGGCCCAATTNONE 
AK101483TAAGCCCAATTNONE 
Os07g0653100J065130E21AATTGGGCTTCConserved hypothetical protein. 
J065186P07AATTGGGCTTCNONE 
Os07g0672500AK067432GCCCAATTSMAD/FHA domain containing protein. 
AK119940GCCCAATTNONE 
Os07g0673000011-058-G06AATTGGGCCAANONE 
AK063364AATTGGGCCAAConserved hypothetical protein. 
Os07g0690300012-048-A07AGCCCAATTNONE 
AK099674AGCCCAATTChromatin SPT2 family protein. 
J013028F12AGCCCAATTNONE 
J013069F21AGCCCAATTNONE 
J013104E17AGCCCAATTNONE 
J013153M16AGCCCAATTNONE 
J023012L09AGCCCAATTNONE 
J023069A08AGCCCAATTNONE 
J023132L23AGCCCAATTNONE 
J033120P19AGCCCAATTNONE 
J065173J03AGCCCAATTNONE 
J075008H06AGCCCAATTNONE 
J075043J15AGCCCAATTNONE 
J075147I12AGCCCAATTNONE 
J090041G07AGCCCAATTNONE 
Os08g0107500013-094-H02TCCGGCCCACGAACCAGCCCAATTNONE 
013-095-E07TCCGGCCCACGAACCAGCCCAATTNONE 
AK064053TCCGGCCCACGAACCAGCCCAATTShwachman-Bodian-Diamond syndrome proteins family protein. 
AK101418TCCGGCCCACGAACCAGCCCAATTNONE 
J033037P14TCCGGCCCACGAACCAGCCCAATTNONE 
J090025I15TCCGGCCCACGAACCAGCCCAATTNONE 
J100022F23TCCGGCCCACGAACCAGCCCAATTNONE 
Os08g0107900014-055-C03TCCGGCCCAATTNONE 
J065062G20TCCGGCCCAATTNONE 
Os08g0113800J033069I12TAAGCCCAATTNONE 
J053050I07TAAGCCCAATTNONE 
J065006J11TAAGCCCAATTNONE 
J065013D02TAAGCCCAATTNONE 
J065055L24TAAGCCCAATTNONE 
J065071I11TAAGCCCAATTConserved hypothetical protein. 
J065093G12TAAGCCCAATTNONE 
J065101N03TAAGCCCAATTNONE 
Os08g0139100006-027-E12AATTGGGCCTCNONE 
006-089-E06AATTGGGCCTCNONE 
006-113-G02AATTGGGCCTCNONE 
AK061429AATTGGGCCTCNONE 
AK099590AATTGGGCCTCSimilar to DAG protein, chloroplast precursor. 
AK104727AATTGGGCCTCNONE 
J013043H11AATTGGGCCTCNONE 
J013049N13AATTGGGCCTCNONE 
J065079F01AATTGGGCCTCNONE 
J065122N24AATTGGGCCTCNONE 
J065142J24AATTGGGCCTCNONE 
J065193N03AATTGGGCCTCNONE 
J075041I21AATTGGGCCTCNONE 
J075145E04AATTGGGCCTCNONE 
Os08g0150800AK101530AGCCCAATTSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0158900AK067062AAAAGCCCAATTGTP1/OBG domain containing protein. 
J013089F04AAAAGCCCAATTNONE 
J013092D16AAAAGCCCAATTNONE 
J033120K14AAAAGCCCAATTNONE 
J033133F24AAAAGCCCAATTNONE 
J033145A10AAAAGCCCAATTNONE 
J033145A11AAAAGCCCAATTNONE 
J053048H24AAAAGCCCAATTNONE 
J053075H10AAAAGCCCAATTNONE 
Os08g0159000AK073617AATTGGGCTTTTNONE 
AK103973AATTGGGCTTTTSimilar to DnaJ homolog subfamily C member 1. 
J023130H14AATTGGGCTTTTNONE 
J033051J11AATTGGGCTTTTNONE 
J065101C10AATTGGGCTTTTNONE 
J065168B04AATTGGGCTTTTNONE 
J065184E22AATTGGGCTTTTNONE 
J080021D11AATTGGGCTTTTNONE 
J080025H10AATTGGGCTTTTNONE 
J080026N19AATTGGGCTTTTNONE 
J080034A12AATTGGGCTTTTNONE 
J080040L02AATTGGGCTTTTNONE 
J080042H19AATTGGGCTTTTNONE 
J080047B05AATTGGGCTTTTNONE 
J080047E09AATTGGGCTTTTNONE 
J080047I01AATTGGGCTTTTNONE 
J080052H19AATTGGGCTTTTNONE 
J080062K13AATTGGGCTTTTNONE 
J080063A22AATTGGGCTTTTNONE 
J080068G18AATTGGGCTTTTNONE 
J080068N19AATTGGGCTTTTNONE 
J080076G08AATTGGGCTTTTNONE 
J080077H13AATTGGGCTTTTNONE 
J080077K06AATTGGGCTTTTNONE 
J080093D15AATTGGGCTTTTNONE 
J080094D21AATTGGGCTTTTNONE 
J080097A20AATTGGGCTTTTNONE 
J080097E21AATTGGGCTTTTNONE 
J080097N17AATTGGGCTTTTNONE 
J100071K18AATTGGGCTTTTNONE 
J100072F09AATTGGGCTTTTNONE 
Os08g0167500006-063-D04AATTGGGCCGCANONE 
006-066-G09AATTGGGCCGCANONE 
AK061061AATTGGGCCGCAConserved hypothetical protein. 
AK071197AATTGGGCCGCANONE 
J023082N10AATTGGGCCGCANONE 
Os08g0178100AK101717AATTGGGCPep3/Vps18/deep orange domain containing protein. 
AK101717AATTGGGCCACGGCCCATGAPep3/Vps18/deep orange domain containing protein. 
Os08g0243500AK068915CGCGTCGCGCGCCCAATTSimilar to NADPH-cytochrome P450 oxydoreductase isoform 2. 
AK099083CGCGTCGCGCGCCCAATTNONE 
Os08g0430600009-181-E04ACAGCCCAATTNONE 
AK060045ACAGCCCAATTConserved hypothetical protein. 
AK068922ACAGCCCAATTNONE 
J013170B19ACAGCCCAATTNONE 
J065076C03ACAGCCCAATTNONE 
J065218G16ACAGCCCAATTNONE 
J090045N10ACAGCCCAATTNONE 
J100028O03ACAGCCCAATTNONE 
Os08g0435800AK121712AATTGGGCCCACACGAATGGGCCACSimilar to Lipoate protein ligase-like protein. 
J065121P15AATTGGGCCCACACGAATGGGCCACNONE 
Os08g0468400011-057-F06AATTGGGCNONE 
AK063363AATTGGGCHEC/Ndc80p family protein. 
J100048N11AATTGGGCNONE 
Os08g0473650J065031A07AATTGGGCCCACGTGTCHypothetical protein. 
J065129E01AATTGGGCCCACGTGTCNONE 
J065134I05AATTGGGCCCACGTGTCNONE 
J065212K13AATTGGGCCCACGTGTCNONE 
J065217M14AATTGGGCCCACGTGTCNONE 
Os08g0521400006-047-C11AGGGCCCACCTAGTGGGCCCAATTNONE 
016-014-E07AGGGCCCACCTAGTGGGCCCAATTNONE 
AK070148AGGGCCCACCTAGTGGGCCCAATTNONE 
AK101704AGGGCCCACCTAGTGGGCCCAATTZinc finger, RanBP2-type domain containing protein. 
AK105045AGGGCCCACCTAGTGGGCCCAATTNONE 
J013108K14AGGGCCCACCTAGTGGGCCCAATTNONE 
J013129E16AGGGCCCACCTAGTGGGCCCAATTNONE 
J013159M23AGGGCCCACCTAGTGGGCCCAATTNONE 
J023041G22AGGGCCCACCTAGTGGGCCCAATTNONE 
J033060G13AGGGCCCACCTAGTGGGCCCAATTNONE 
J033060J15AGGGCCCACCTAGTGGGCCCAATTNONE 
J065120J24AGGGCCCACCTAGTGGGCCCAATTNONE 
J065160I01AGGGCCCACCTAGTGGGCCCAATTNONE 
J065179A16AGGGCCCACCTAGTGGGCCCAATTNONE 
J065189K04AGGGCCCACCTAGTGGGCCCAATTNONE 
J090032O15AGGGCCCACCTAGTGGGCCCAATTNONE 
J090045A18AGGGCCCACCTAGTGGGCCCAATTNONE 
J090060B21AGGGCCCACCTAGTGGGCCCAATTNONE 
J090086F23AGGGCCCACCTAGTGGGCCCAATTNONE 
J090098O22AGGGCCCACCTAGTGGGCCCAATTNONE 
J100018K20AGGGCCCACCTAGTGGGCCCAATTNONE 
J100048P22AGGGCCCACCTAGTGGGCCCAATTNONE 
J100052I06AGGGCCCACCTAGTGGGCCCAATTNONE 
Os08g0522400AK065893AATTGGGCHaem peroxidase family protein. 
Os08g0557100AK070743AATTGGGCCCAGTANONE 
AK101214AATTGGGCCCAGTASimilar to Nucleic acid-binding protein precursor. 
AK105901AATTGGGCCCAGTANONE 
J033031B04AATTGGGCCCAGTANONE 
J080004F08AATTGGGCCCAGTANONE 
J080004H12AATTGGGCCCAGTANONE 
J080005H08AATTGGGCCCAGTANONE 
J080005I02AATTGGGCCCAGTANONE 
J080008N16AATTGGGCCCAGTANONE 
J080009H23AATTGGGCCCAGTANONE 
J080012H17AATTGGGCCCAGTANONE 
J080012J21AATTGGGCCCAGTANONE 
J080013I20AATTGGGCCCAGTANONE 
J080016E07AATTGGGCCCAGTANONE 
J080018O04AATTGGGCCCAGTANONE 
J080020B18AATTGGGCCCAGTANONE 
J080021I16AATTGGGCCCAGTANONE 
J080022N01AATTGGGCCCAGTANONE 
J080023G08AATTGGGCCCAGTANONE 
J080023N09AATTGGGCCCAGTANONE 
J080024J24AATTGGGCCCAGTANONE 
J080025M12AATTGGGCCCAGTANONE 
J080028A22AATTGGGCCCAGTANONE 
J080028I01AATTGGGCCCAGTANONE 
J080029D22AATTGGGCCCAGTANONE 
J080030M02AATTGGGCCCAGTANONE 
J080031B06AATTGGGCCCAGTANONE 
J080035G08AATTGGGCCCAGTANONE 
J080036F19AATTGGGCCCAGTANONE 
J080038P14AATTGGGCCCAGTANONE 
J080039C17AATTGGGCCCAGTANONE 
J080043A10AATTGGGCCCAGTANONE 
J080044H02AATTGGGCCCAGTANONE 
J080044P12AATTGGGCCCAGTANONE 
J080047L06AATTGGGCCCAGTANONE 
J080050L06AATTGGGCCCAGTANONE 
J080052J11AATTGGGCCCAGTANONE 
J080052M10AATTGGGCCCAGTANONE 
J080053E20AATTGGGCCCAGTANONE 
J080054J01AATTGGGCCCAGTANONE 
J080059N09AATTGGGCCCAGTANONE 
J080064F19AATTGGGCCCAGTANONE 
J080064N22AATTGGGCCCAGTANONE 
J080065K14AATTGGGCCCAGTANONE 
J080065M12AATTGGGCCCAGTANONE 
J080068O07AATTGGGCCCAGTANONE 
J080076P20AATTGGGCCCAGTANONE 
J080087D08AATTGGGCCCAGTANONE 
J080087H16AATTGGGCCCAGTANONE 
J080090N23AATTGGGCCCAGTANONE 
J080091H04AATTGGGCCCAGTANONE 
J080091P13AATTGGGCCCAGTANONE 
J080094O15AATTGGGCCCAGTANONE 
J080094P14AATTGGGCCCAGTANONE 
J080095I07AATTGGGCCCAGTANONE 
J080097E22AATTGGGCCCAGTANONE 
Os08g0565800009-034-G02AATTGGGCTGCNONE 
009-111-D12AATTGGGCTGCNONE 
AK062431AATTGGGCTGCSimilar to Glutaredoxin. 
AK062820AATTGGGCTGCNONE 
J075022E05AATTGGGCTGCNONE 
J075066F07AATTGGGCTGCNONE 
J075146B21AATTGGGCTGCNONE 
Os09g0109500AK067482GTATGGGCTGGCCCAATTUNC-50 family protein. 
J013107E18GTATGGGCTGGCCCAATTNONE 
J023138C21GTATGGGCTGGCCCAATTNONE 
J065117D01GTATGGGCTGGCCCAATTNONE 
J065179F23GTATGGGCTGGCCCAATTNONE 
J100029N14GTATGGGCTGGCCCAATTNONE 
Os09g0112400AK109186AATTGGGCCCAAATSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0325300011-005-H08TTTCGGCCCAATTNONE 
AK068435TTTCGGCCCAATTConserved hypothetical protein. 
AK073998TTTCGGCCCAATTNONE 
J033071H21TTTCGGCCCAATTNONE 
J065214H05TTTCGGCCCAATTNONE 
Os09g0347900AK071224CAAGCCCAATTConserved hypothetical protein. 
J023087B12CAAGCCCAATTNONE 
Os09g0385300AK073247AATTGGGCCTGGGCCATHypothetical protein. 
AK120455AATTGGGCCTGGGCCATNONE 
J013104G23AATTGGGCCTGGGCCATNONE 
J023110A14AATTGGGCCTGGGCCATNONE 
J033143F07AATTGGGCCTGGGCCATNONE 
J065036P14AATTGGGCCTGGGCCATNONE 
J065041I11AATTGGGCCTGGGCCATNONE 
J065103K11AATTGGGCCTGGGCCATNONE 
J065138M15AATTGGGCCTGGGCCATNONE 
J065138P09AATTGGGCCTGGGCCATNONE 
J065141J20AATTGGGCCTGGGCCATNONE 
J075063J16AATTGGGCCTGGGCCATNONE 
J075063K19AATTGGGCCTGGGCCATNONE 
J075085H08AATTGGGCCTGGGCCATNONE 
J075093C12AATTGGGCCTGGGCCATNONE 
J075127N08AATTGGGCCTGGGCCATNONE 
J075134E09AATTGGGCCTGGGCCATNONE 
J075166D06AATTGGGCCTGGGCCATNONE 
J075168K24AATTGGGCCTGGGCCATNONE 
J075197G05AATTGGGCCTGGGCCATNONE 
J080034J24AATTGGGCCTGGGCCATNONE 
Os09g0419500016-067-D11CCAGCCCAATTNONE 
AK064394CCAGCCCAATTZinc finger, RING-type domain containing protein. 
AK073786CCAGCCCAATTNONE 
J033067G01CCAGCCCAATTNONE 
Os09g0459200AK110733AATTGGGCTGAConserved hypothetical protein. 
J065131C07AATTGGGCTGANONE 
Os09g0470900AK065853AGCCCAATTConserved hypothetical protein. 
AK072191AGCCCAATTNONE 
J075129F12AGCCCAATTNONE 
J100024L18AGCCCAATTNONE 
Os09g0509200AK069525GGGCCGGCCCAATTSimilar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1). 
Os09g0530700AK058211ACAGCCCAATTConserved hypothetical protein. 
AK100759ACAGCCCAATTNONE 
J065039L02ACAGCCCAATTNONE 
J065043O03ACAGCCCAATTNONE 
J065070M16ACAGCCCAATTNONE 
Os09g0557900AK107999GCCCAATTNONE 
AK108807GCCCAATTSimilar to Protein phosphatase 2C gamma isoform (EC 3.1.3.16) (PP2C-gamma) (Protein phosphatase magnesium-dependent 1 gamma) (Protein phosphatase 1C) (Fibroblast growth factor inducible protein 13) (FIN13). 
J075028G15GCCCAATTNONE 
J075129K23GCCCAATTNONE 
J075159K01GCCCAATTNONE 
J075192F10GCCCAATTNONE 
J080018P13GCCCAATTNONE 
J080021E17GCCCAATTNONE 
J080022I11GCCCAATTNONE 
J080029C07GCCCAATTNONE 
J080034N15GCCCAATTNONE 
J080038L24GCCCAATTNONE 
J080039C15GCCCAATTNONE 
J080040E11GCCCAATTNONE 
J080055L15GCCCAATTNONE 
J080077G08GCCCAATTNONE 
J080080A20GCCCAATTNONE 
Os11g0162200009-059-H04AGCCCAATTCAGCCCATCTNONE 
AK060396AGCCCAATTCAGCCCATCTSimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11AGCCCAATTCAGCCCATCTNONE 
J065105K09AGCCCAATTCAGCCCATCTNONE 
J075024G12AGCCCAATTCAGCCCATCTNONE 
J075040K04AGCCCAATTCAGCCCATCTNONE 
J075066D13AGCCCAATTCAGCCCATCTNONE 
J075108A11AGCCCAATTCAGCCCATCTNONE 
J100031D04AGCCCAATTCAGCCCATCTNONE 
J100060O05AGCCCAATTCAGCCCATCTNONE 
J100075M22AGCCCAATTCAGCCCATCTNONE 
Os11g0209100016-063-F03AATTGGGCCNONE 
AK064391AATTGGGCCCyclin-like F-box domain containing protein. 
J075027K02AATTGGGCCNONE 
J075154K15AATTGGGCCNONE 
Os11g0220300AK068820AATTGGGCCCCAGConserved hypothetical protein. 
Os11g0286800AK072702AATTGGGCCTATerpene synthase family protein. 
AK100763AATTGGGCCTANONE 
AK107355AATTGGGCCTANONE 
J013026O22AATTGGGCCTANONE 
J013065A14AATTGGGCCTANONE 
J013129G22AATTGGGCCTANONE 
J023119J04AATTGGGCCTANONE 
Os11g0425800AK066603GAAGCCCAATTSimilar to 60S ribosomal protein L13a. 
J065063A20GAAGCCCAATTNONE 
J075021H08GAAGCCCAATTNONE 
J075058J10GAAGCCCAATTNONE 
J075088B15GAAGCCCAATTNONE 
J075099E15GAAGCCCAATTNONE 
J075110F13GAAGCCCAATTNONE 
J075150G18GAAGCCCAATTNONE 
J080312E14GAAGCCCAATTNONE 
Os11g0549655J065008P04AGATGGGCTAATTGGGCCGGTGGCCCGGCNONE 
J065148G18AGATGGGCTAATTGGGCCGGTGGCCCGGCMaf-like protein family protein. 
Os11g0640000Os11g0640000GCGGCCCAATTNB-ARC domain containing protein. 
Os12g0156400012-065-D02AATTGGGCCTCNONE 
AK072086AATTGGGCCTCNONE 
AK099278AATTGGGCCTCDcp1-like decapping family protein. 
J013063H09AATTGGGCCTCNONE 
J023125D09AATTGGGCCTCNONE 
J023149G21AATTGGGCCTCNONE 
J033064E07AATTGGGCCTCNONE 
J033093C07AATTGGGCCTCNONE 
J033107E06AATTGGGCCTCNONE 
J075172A11AATTGGGCCTCNONE 
J090009E07AATTGGGCCTCNONE 
J090023F13AATTGGGCCTCNONE 
J090071N18AATTGGGCCTCNONE 
Os12g0188700005-011-B12GCCCAATTNONE 
006-024-G04GCCCAATTNONE 
006-065-G03GCCCAATTNONE 
006-085-A08GCCCAATTNONE 
006-103-A05GCCCAATTNONE 
006-103-H09GCCCAATTNONE 
009-070-G10GCCCAATTNONE 
009-156-H08GCCCAATTNONE 
009-158-A03GCCCAATTNONE 
009-163-B11GCCCAATTNONE 
AJ005841GCCCAATTNONE 
AK061678GCCCAATTSimilar to Thioredoxin (TRX). 
AK120500GCCCAATTNONE 
J013040H19GCCCAATTNONE 
J013041B20GCCCAATTNONE 
J013122B18GCCCAATTNONE 
J013128C16GCCCAATTNONE 
J023126A11GCCCAATTNONE 
J023149O08GCCCAATTNONE 
J033113L02GCCCAATTNONE 
J065026F18GCCCAATTNONE 
J065027A10GCCCAATTNONE 
J065029H04GCCCAATTNONE 
J065036L19GCCCAATTNONE 
J065053G22GCCCAATTNONE 
J065060P10GCCCAATTNONE 
J065063G08GCCCAATTNONE 
J065070F04GCCCAATTNONE 
J065071J12GCCCAATTNONE 
J065082A20GCCCAATTNONE 
J065088K18GCCCAATTNONE 
J065090J21GCCCAATTNONE 
J065110I15GCCCAATTNONE 
J065142N11GCCCAATTNONE 
J065152O15GCCCAATTNONE 
J065175N18GCCCAATTNONE 
J065181H15GCCCAATTNONE 
J065217M05GCCCAATTNONE 
J075005B13GCCCAATTNONE 
J075010A01GCCCAATTNONE 
J075025N08GCCCAATTNONE 
J075025O15GCCCAATTNONE 
J075026N03GCCCAATTNONE 
J075029K03GCCCAATTNONE 
J075046J23GCCCAATTNONE 
J075048H19GCCCAATTNONE 
J075055G13GCCCAATTNONE 
J075057N05GCCCAATTNONE 
J075074K15GCCCAATTNONE 
J075078O08GCCCAATTNONE 
J075083L08GCCCAATTNONE 
J075085A13GCCCAATTNONE 
J075090M08GCCCAATTNONE 
J075099F01GCCCAATTNONE 
J075102M01GCCCAATTNONE 
J075122C01GCCCAATTNONE 
J075127M13GCCCAATTNONE 
J075130F22GCCCAATTNONE 
J075148P15GCCCAATTNONE 
J075154P15GCCCAATTNONE 
J075164F18GCCCAATTNONE 
J075169C02GCCCAATTNONE 
J075182G19GCCCAATTNONE 
J075185N19GCCCAATTNONE 
J075191F06GCCCAATTNONE 
J075195E16GCCCAATTNONE 
J080001I12GCCCAATTNONE 
J080001N15GCCCAATTNONE 
J080003E01GCCCAATTNONE 
J080003F14GCCCAATTNONE 
J080005L24GCCCAATTNONE 
J080008B17GCCCAATTNONE 
J080008L13GCCCAATTNONE 
J080011M03GCCCAATTNONE 
J080012E12GCCCAATTNONE 
J080014N04GCCCAATTNONE 
J080014N16GCCCAATTNONE 
J080015K01GCCCAATTNONE 
J080015K02GCCCAATTNONE 
J080022N08GCCCAATTNONE 
J080028B14GCCCAATTNONE 
J080028P05GCCCAATTNONE 
J080030O11GCCCAATTNONE 
J080031B13GCCCAATTNONE 
J080032B10GCCCAATTNONE 
J080032L01GCCCAATTNONE 
J080034F05GCCCAATTNONE 
J080034H02GCCCAATTNONE 
J080034L14GCCCAATTNONE 
J080036D23GCCCAATTNONE 
J080036E01GCCCAATTNONE 
J080039D04GCCCAATTNONE 
J080039E23GCCCAATTNONE 
J080041B09GCCCAATTNONE 
J080043J21GCCCAATTNONE 
J080043N22GCCCAATTNONE 
J080044M16GCCCAATTNONE 
J080045L05GCCCAATTNONE 
J080046F10GCCCAATTNONE 
J080046N09GCCCAATTNONE 
J080047B16GCCCAATTNONE 
J080050P20GCCCAATTNONE 
J080052G21GCCCAATTNONE 
J080054C21GCCCAATTNONE 
J080054E05GCCCAATTNONE 
J080054P09GCCCAATTNONE 
J080061F01GCCCAATTNONE 
J080061O22GCCCAATTNONE 
J080063B22GCCCAATTNONE 
J080063F13GCCCAATTNONE 
J080063P19GCCCAATTNONE 
J080064D03GCCCAATTNONE 
J080066K22GCCCAATTNONE 
J080068J07GCCCAATTNONE 
J080068N24GCCCAATTNONE 
J080069G17GCCCAATTNONE 
J080072D03GCCCAATTNONE 
J080072H18GCCCAATTNONE 
J080076N01GCCCAATTNONE 
J080078N04GCCCAATTNONE 
J080080D16GCCCAATTNONE 
J080080P08GCCCAATTNONE 
J080083K02GCCCAATTNONE 
J080086E05GCCCAATTNONE 
J080086P10GCCCAATTNONE 
J080091G21GCCCAATTNONE 
J080091K23GCCCAATTNONE 
J080095G02GCCCAATTNONE 
J080096L19GCCCAATTNONE 
J080097G11GCCCAATTNONE 
J080097H16GCCCAATTNONE 
J080303H17GCCCAATTNONE 
J080303M11GCCCAATTNONE 
J080304C19GCCCAATTNONE 
J080304E11GCCCAATTNONE 
J080306N11GCCCAATTNONE 
J080307N23GCCCAATTNONE 
J080308G14GCCCAATTNONE 
J080309F13GCCCAATTNONE 
J080313I18GCCCAATTNONE 
J080315E23GCCCAATTNONE 
J080316D18GCCCAATTNONE 
J080319M07GCCCAATTNONE 
J080319O18GCCCAATTNONE 
J090006J15GCCCAATTNONE 
J090024O07GCCCAATTNONE 
J090095K21GCCCAATTNONE 
J100031C19GCCCAATTNONE 
J100040B18GCCCAATTNONE 
J100042M17GCCCAATTNONE 
J100060L05GCCCAATTNONE 
J100060O12GCCCAATTNONE 
J100063O11GCCCAATTNONE 
J100070B22GCCCAATTNONE 
J100077D15GCCCAATTNONE 
J100090B05GCCCAATTNONE 
Os12g0190100AK109819GCCCAATTSimilar to Auxin-independent growth promoter-like protein. 
Os12g0228900J033132F01AATTGGGCCCNONE 
J043003P05AATTGGGCCCNONE 
J065079N16AATTGGGCCCNONE 
J065141L03AATTGGGCCCNONE 
J075001I21AATTGGGCCCNONE 
J075032L11AATTGGGCCCNONE 
J075126O12AATTGGGCCCNONE 
J100079E06AATTGGGCCCNONE 
Os12g0287200009-067-B11GCCGGCCCATTTGGGCCCAATTNONE 
009-130-F06GCCGGCCCATTTGGGCCCAATTNONE 
009-185-H10GCCGGCCCATTTGGGCCCAATTNONE 
AF338343GCCGGCCCATTTGGGCCCAATTNONE 
AK063847GCCGGCCCATTTGGGCCCAATTSimilar to Mago nashi protein. 
AK121477GCCGGCCCATTTGGGCCCAATTNONE 
J023149H05GCCGGCCCATTTGGGCCCAATTNONE 
J065019G18GCCGGCCCATTTGGGCCCAATTNONE 
J065049J18GCCGGCCCATTTGGGCCCAATTNONE 
J065143C22GCCGGCCCATTTGGGCCCAATTNONE 
J075130D23GCCGGCCCATTTGGGCCCAATTNONE 
J090014I22GCCGGCCCATTTGGGCCCAATTNONE 
J090018A06GCCGGCCCATTTGGGCCCAATTNONE 
J090053H11GCCGGCCCATTTGGGCCCAATTNONE 
J090080N13GCCGGCCCATTTGGGCCCAATTNONE 
J100019H19GCCGGCCCATTTGGGCCCAATTNONE 
Os12g0503200014-087-C11TAGGCCCAATTNONE 
AK105377TAGGCCCAATTNONE 
Os12g0517100012-071-A03AGCCCATCCAGCCCAATTNONE 
AK073020AGCCCATCCAGCCCAATTCyclin-like F-box domain containing protein. 
J023149K21AGCCCATCCAGCCCAATTNONE 
Os12g0554800AK105676CCAAGCCCAATTSimilar to Polygalacturonase-like protein. 
Os12g0574800AK073004ATTTGGGCCTAATTGGGCCGTGNONE 
AK102465ATTTGGGCCTAATTGGGCCGTGBromodomain transcription factor containing protein. 
AK121687ATTTGGGCCTAATTGGGCCGTGNONE 
J033070O18ATTTGGGCCTAATTGGGCCGTGNONE 
J075097O17ATTTGGGCCTAATTGGGCCGTGNONE 
J080069F02ATTTGGGCCTAATTGGGCCGTGNONE 
Os12g0588900AK069966GACGGCCCAGCTAGGCCCAATTConserved hypothetical protein. 
J023038A10GACGGCCCAGCTAGGCCCAATTNONE 
J065061J23GACGGCCCAGCTAGGCCCAATTNONE 
J065176O08GACGGCCCAGCTAGGCCCAATTNONE 
J075143K13GACGGCCCAGCTAGGCCCAATTNONE 
Os12g0610100Os12g0610100CAGGCCCAATTConserved hypothetical protein. 
Os12g0616900AK063753AATTGGGCCTTSimilar to Pyruvate dehydrogenase E1 beta subunit (Fragment). 
AK101464AATTGGGCCTTNONE 
J033126J16AATTGGGCCTTNONE 
J065140B05AATTGGGCCTTNONE 
Os12g0623500AK059703AATTGGGCNONE 
AK064822AATTGGGCSimilar to Cationic amino acid transporter-like protein. 
Os12g0636600AK111056AATTGGGCCGTTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.