version

Summary of OsREG434 (All List)

OrganismOryza sativa  
IDOsREG434  
SequenceACACGTGG  
Annotation  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE Motif 
Total Entry Count2443  

Entry Sequences (2443 entries)

LocusGene modelSequenceDescription
Os01g0149800009-003-D05GCCACGTGTNONE 
009-075-F04GCCACGTGTNONE 
009-164-H05GCCACGTGTNONE 
J013021G22GCCACGTGTNONE 
J013026A08GCCACGTGTNONE 
J013055B05GCCACGTGTNONE 
J013064G22GCCACGTGTNONE 
J013105C09GCCACGTGTNONE 
J013129K15GCCACGTGTNONE 
J023129B01GCCACGTGTNONE 
J033036H01GCCACGTGTNONE 
J033057B09GCCACGTGTNONE 
J043037E20GCCACGTGTNONE 
J043039C11GCCACGTGTNONE 
J043039D02GCCACGTGTNONE 
J043039G15GCCACGTGTNONE 
J043040L16GCCACGTGTNONE 
J053034B13GCCACGTGTNONE 
J053061F14GCCACGTGTNONE 
J053097D22GCCACGTGTNONE 
J065032N05GCCACGTGTNONE 
J065050F21GCCACGTGTNONE 
J065052D11GCCACGTGTNONE 
J065097I08GCCACGTGTNONE 
J065109M12GCCACGTGTNONE 
J065162C19GCCACGTGTNONE 
J065162C20GCCACGTGTNONE 
J065171G23GCCACGTGTNONE 
J065206I03GCCACGTGTNONE 
J065218O18GCCACGTGTNONE 
J080020M17GCCACGTGTNONE 
J080030J11GCCACGTGTNONE 
J080032A22GCCACGTGTNONE 
J080036E19GCCACGTGTNONE 
J080037I16GCCACGTGTNONE 
J080051D03GCCACGTGTNONE 
J080051D05GCCACGTGTNONE 
J080054K06GCCACGTGTNONE 
J080076G01GCCACGTGTNONE 
J080077P08GCCACGTGTNONE 
J080085E13GCCACGTGTNONE 
J080087A22GCCACGTGTNONE 
J080310A13GCCACGTGTNONE 
J090080A15GCCACGTGTNONE 
J090087N14GCCACGTGTNONE 
J100017E03GCCACGTGTNONE 
J100024B10GCCACGTGTNONE 
J100025A07GCCACGTGTNONE 
J100026G16GCCACGTGTNONE 
J100030A10GCCACGTGTNONE 
J100030M18GCCACGTGTNONE 
J100044D08GCCACGTGTNONE 
J100045F20GCCACGTGTNONE 
J100046L06GCCACGTGTNONE 
J100050J10GCCACGTGTNONE 
J100054E07GCCACGTGTNONE 
J100054G22GCCACGTGTNONE 
J100054L21GCCACGTGTNONE 
J100058A12GCCACGTGTNONE 
J100064O14GCCACGTGTNONE 
J100069M10GCCACGTGTNONE 
J100073C18GCCACGTGTNONE 
J100077H21GCCACGTGTNONE 
J100078A09GCCACGTGTNONE 
J100081F01GCCACGTGTNONE 
J100082H17GCCACGTGTNONE 
J100090C20GCCACGTGTNONE 
U43530GCCACGTGTMetallothionein-like protein type 2. 
Os01g0151600AK063435GCCGGCCCGCCACGTGTConserved hypothetical protein. 
J065010E12GCCGGCCCGCCACGTGTNONE 
J065067D06GCCGGCCCGCCACGTGTNONE 
J090043F21GCCGGCCCGCCACGTGTNONE 
Os01g0175100AK071289CGCCACGTGTCCKv1.4 voltage-gated K+ channel family protein. 
J023088B10CGCCACGTGTCCNONE 
J065122H15CGCCACGTGTCCNONE 
J065140B19CGCCACGTGTCCNONE 
J100031E12CGCCACGTGTCCNONE 
J100068J03CGCCACGTGTCCNONE 
J100083E12CGCCACGTGTCCNONE 
Os01g0176500AK102552CCCACGTGTCCCTCAConserved hypothetical protein. 
Os01g0180300AK120377ACACGTGGCGLipoprotein, type 6 family protein. 
J013071N06ACACGTGGCGNONE 
J023088F12ACACGTGGCGNONE 
J100027H24ACACGTGGCGNONE 
J100053K15ACACGTGGCGNONE 
J100082M15ACACGTGGCGNONE 
Os01g0198100AK119908CGACACGTGGCConserved hypothetical protein. 
Os01g0227300006-106-E11CCACGTGTNONE 
AK059958CCACGTGTNONE 
AK070320CCACGTGTSimilar to RAB7D. 
J023052D24CCACGTGTNONE 
J033040I05CCACGTGTNONE 
J090072O16CCACGTGTNONE 
J090075F16CCACGTGTNONE 
Os01g0246400009-143-G05CACTGACACGTGGCNONE 
AK062972CACTGACACGTGGCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP). 
Os01g0258600J075028F17ACACGTGGGTCCNONE 
J075061L04ACACGTGGGTCCConserved hypothetical protein. 
J075071B09ACACGTGGGTCCNONE 
J075093E04ACACGTGGGTCCNONE 
J100033B11ACACGTGGGTCCNONE 
Os01g0270100006-096-H09CGCCACGTGTNONE 
009-009-C10CGCCACGTGTNONE 
009-054-E06CGCCACGTGTNONE 
014-085-F09CGCCACGTGTNONE 
AK073275CGCCACGTGTNONE 
AK104155CGCCACGTGTNONE 
AK119511CGCCACGTGTSimilar to Cysteine protease inhibitor. 
J033025K21CGCCACGTGTNONE 
J075065H10CGCCACGTGTNONE 
J075143G10CGCCACGTGTNONE 
J100059J02CGCCACGTGTNONE 
Os01g0280200J065103B05GCCACGTGTNONE 
J065183G15GCCACGTGTConserved hypothetical protein. 
Os01g0281100AK109672GGTGGGACCCACGTGGACACGTGGCConserved hypothetical protein. 
J065013K07GGTGGGACCCACGTGGACACGTGGCNONE 
J065040E15GGTGGGACCCACGTGGACACGTGGCNONE 
J065127F12GGTGGGACCCACGTGGACACGTGGCNONE 
J075155K23GGTGGGACCCACGTGGACACGTGGCNONE 
Os01g0303300J053035N19GCCCCCACACACGTGGCNONE 
J075042F02GCCCCCACACACGTGGCNONE 
J075068E10GCCCCCACACACGTGGCNONE 
J075116E19GCCCCCACACACGTGGCNONE 
J075131C10GCCCCCACACACGTGGCNONE 
J075145J11GCCCCCACACACGTGGCNONE 
J075157P20GCCCCCACACACGTGGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12GCCCCCACACACGTGGCNONE 
Os01g0305900Os01g0305900CCCACGTGTCSimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0314000015-084-B08ACACGTGGNONE 
AK106418ACACGTGGNONE 
Os01g0314800AF323612ACACGTGGCGLate embryogenesis abundant protein 3 family protein. 
J043003O18ACACGTGGCGNONE 
J065105K07ACACGTGGCGNONE 
J065123H16ACACGTGGCGNONE 
J065198K17ACACGTGGCGNONE 
J100027C20ACACGTGGCGNONE 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE 
Os01g0373400AK110973CCACGTGTHomeodomain-like containing protein. 
Os01g0382450J065084M05GCCACGTGTCCHypothetical protein. 
J065155G18GCCACGTGTCCNONE 
Os01g0533400AK119447GCCCACGTGTGlycoside hydrolase, family 35 protein. 
Os01g0571700AK120410ACACGTGGCNucleic acid-binding, OB-fold domain containing protein. 
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein. 
Os01g0646300AY464568CCACGTGTSimilar to RGA2 protein. 
J080011P15CCACGTGTNONE 
J080017D01CCACGTGTNONE 
J080017H05CCACGTGTNONE 
J080027A16CCACGTGTNONE 
J080039F17CCACGTGTNONE 
J080063E23CCACGTGTNONE 
J080067L23CCACGTGTNONE 
J080068H01CCACGTGTNONE 
J080071F01CCACGTGTNONE 
J080076J05CCACGTGTNONE 
J080092L17CCACGTGTNONE 
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein. 
Os01g0685900AK064024CCCACGTGTCCNONE 
AK102005CCCACGTGTCCSimilar to 65kD microtubule associated protein. 
Os01g0718500AK111346ACACGTGGCConserved hypothetical protein. 
Os01g0733200AK066316GCCACACGTGGCSimilar to Heat shock transcription factor 29 (Fragment). 
AY344493GCCACACGTGGCNONE 
J013066G03GCCACACGTGGCNONE 
J090034J08GCCACACGTGGCNONE 
Os01g0762900014-046-H02ACACGTGGNONE 
J065155C07ACACGTGGConserved hypothetical protein. 
J075129E21ACACGTGGNONE 
Os01g0787400006-097-H03CGCCACGTGTNONE 
AK061223CGCCACGTGTConserved hypothetical protein. 
J065011G11CGCCACGTGTNONE 
J065161F18CGCCACGTGTNONE 
Os01g0800800AK108093CCACGTGTConserved hypothetical protein. 
Os01g0835500AK100241GCCCACGTGTCCSimilar to Respiratory burst oxidase protein. 
Os01g0841600006-045-E03GCCACGTGTNONE 
AK059805GCCACGTGTSimilar to Triosephosphate isomerase, cytosolic (EC 5.3.1.1) (TIM) (Triose- phosphate isomerase). 
AK099310GCCACGTGTNONE 
AK100708GCCACGTGTNONE 
AK104017GCCACGTGTNONE 
AK104461GCCACGTGTNONE 
J065211F22GCCACGTGTNONE 
J090054P20GCCACGTGTNONE 
Os01g0846300AK065949CCACGTGTTGCGGGCCGGGCCGGGSimilar to Protein phosphatase 2C. 
Os01g0860700009-026-D05CCACGTGTCGNONE 
AK062402CCACGTGTCGConserved hypothetical protein. 
Os01g0891700AK105471CCACGTGTLeucine rich repeat, N-terminal domain containing protein. 
Os01g0911700012-079-H01CGCCACGTGTGGGCCGCANONE 
012-088-G05CGCCACGTGTGGGCCGCANONE 
012-099-A01CGCCACGTGTGGGCCGCANONE 
015-009-H07CGCCACGTGTGGGCCGCANONE 
015-035-H12CGCCACGTGTGGGCCGCANONE 
016-054-G03CGCCACGTGTGGGCCGCANONE 
AK073805CGCCACGTGTGGGCCGCASimilar to Regulatory protein viviparous-1. 
AK105441CGCCACGTGTGGGCCGCANONE 
J033069I02CGCCACGTGTGGGCCGCANONE 
J033086K01CGCCACGTGTGGGCCGCANONE 
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CCCGGGCCCACGTGTCNONE 
J013109E03CCCGGGCCCACGTGTCNONE 
J023081J12CCCGGGCCCACGTGTCNONE 
J023091E24CCCGGGCCCACGTGTCNONE 
J033022A01CCCGGGCCCACGTGTCNONE 
J033074C13CCCGGGCCCACGTGTCNONE 
J065199E03CCCGGGCCCACGTGTCNONE 
J075172O04CCCGGGCCCACGTGTCNONE 
J090007G18CCCGGGCCCACGTGTCNONE 
J090052B17CCCGGGCCCACGTGTCNONE 
J090074H01CCCGGGCCCACGTGTCNONE 
J100043J09CCCGGGCCCACGTGTCNONE 
J100059J05CCCGGGCCCACGTGTCNONE 
Os01g0923300AK067520CCCCACGTGTCBS domain containing protein. 
Os01g0952700AK103457GCCACGTGTMetallo-dependent hydrolase, composite domain containing protein. 
Os01g0964000AK073599ACACGTGGGCSimilar to VAMP-like protein YKT61 (AtYKT61) (Geranylgeranylated protein 1) (AtGP1). 
AK104012ACACGTGGGCNONE 
AK104190ACACGTGGGCNONE 
Os02g0105500AK063929ACACGTGGCNONE 
AK102953ACACGTGGCIQ calmodulin-binding region domain containing protein. 
Os02g0115900AF006825CCACGTGTCGNONE 
AK065743CCACGTGTCGEndosperm lumenal binding protein. 
AK119653CCACGTGTCGNONE 
Os02g0119400AK060055TTGGCCCACGTGTCCNONE 
AK102774TTGGCCCACGTGTCCSimilar to Syntaxin 52 (AtSYP52). 
J033107H09TTGGCCCACGTGTCCNONE 
J075175F09TTGGCCCACGTGTCCNONE 
J090011H05TTGGCCCACGTGTCCNONE 
J090091O05TTGGCCCACGTGTCCNONE 
Os02g0135600AK069843GACACGTGGGGConserved hypothetical protein. 
AK069843GACACGTGGGGGConserved hypothetical protein. 
J023034H09GACACGTGGGGNONE 
J023034H09GACACGTGGGGGNONE 
J033090D08GACACGTGGGGNONE 
J033090D08GACACGTGGGGGNONE 
J100025N07GACACGTGGGGNONE 
J100025N07GACACGTGGGGGNONE 
J100075G18GACACGTGGGGNONE 
J100075G18GACACGTGGGGGNONE 
Os02g0135700AK100570CCCCACGTGTCDNA polymerase V family protein. 
AK100570CCCCCACGTGTCDNA polymerase V family protein. 
Os02g0178800016-033-C04ACACGTGGNONE 
AK060909ACACGTGGNONE 
J013070P03ACACGTGGNONE 
J023095E16ACACGTGGNONE 
J043027P11ACACGTGGNONE 
J043039N10ACACGTGGNONE 
J065050K08ACACGTGGNONE 
J065106C17ACACGTGGNONE 
J065121G18ACACGTGGNONE 
Os02g0186500AK068056CGCCACGTGTCCGACCCGCSimilar to Protein kinase-like protein. 
AK099031CGCCACGTGTCCGACCCGCNONE 
J013111A12CGCCACGTGTCCGACCCGCNONE 
J013127K13CGCCACGTGTCCGACCCGCNONE 
J013132O11CGCCACGTGTCCGACCCGCNONE 
J023056A11CGCCACGTGTCCGACCCGCNONE 
J023078M08CGCCACGTGTCCGACCCGCNONE 
J033081F07CGCCACGTGTCCGACCCGCNONE 
J090079E24CGCCACGTGTCCGACCCGCNONE 
J090097I02CGCCACGTGTCCGACCCGCNONE 
Os02g0192300Os02g0192300GACACGTGGGTCCCACZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0198200J075078L15GCCCCACGTGTCATCCACCCCCACGNONE 
J075097G10GCCCCACGTGTCATCCACCCCCACGNONE 
J075099N12GCCCCACGTGTCATCCACCCCCACGNONE 
J075142K24GCCCCACGTGTCATCCACCCCCACGNONE 
J075199K14GCCCCACGTGTCATCCACCCCCACGNONE 
Os02g0199800AK072970GCCACGTGTTGGGCSimilar to No pollen. 
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein. 
J043024M20GCGGCCCACGTGTCAGTGGNONE 
Os02g0266800AK070674ACACGTGGNONE 
L34551ACACGTGGTranscriptional activator protein. 
Os02g0274100AF442962ACACGTGGNONE 
AK073294ACACGTGGPeroxisomal fatty acid beta-oxidation multifunctional protein (MFP) [Includes: Enoyl-CoA hydratase (EC 4.2.1.17); 3-2-trans-enoyl-CoA isomerase (EC 5.3.3.8); 3-hydroxybutyryl-CoA epimerase (EC 5.1.2.3); 3-hydroxyacyl-CoA dehydrogenase (EC 1.1.1.35)]. 
J013020N17ACACGTGGNONE 
J013092A06ACACGTGGNONE 
J013111M11ACACGTGGNONE 
J023004L14ACACGTGGNONE 
J033034I11ACACGTGGNONE 
J033060L04ACACGTGGNONE 
J033082E18ACACGTGGNONE 
J043017D17ACACGTGGNONE 
J075064I16ACACGTGGNONE 
J075070D03ACACGTGGNONE 
Os02g0278700AK100333ACACGTGGSimilar to Kaurene synthase A (Fragment). 
Os02g0301800AK067818GACACGTGGNONE 
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein. 
Os02g0328300006-039-C09CCACGTGTNONE 
006-054-G10CCACGTGTNONE 
006-075-B09CCACGTGTNONE 
006-101-E09CCACGTGTNONE 
006-108-D11CCACGTGTNONE 
AK068505CCACGTGTPhenol hydroxylase reductase family protein. 
AK104780CCACGTGTNONE 
AK109330CCACGTGTNONE 
J013092B10CCACGTGTNONE 
J013128L11CCACGTGTNONE 
J013154E10CCACGTGTNONE 
Os02g0453300006-099-D03GGCCGTCCACGTGTCCNONE 
009-120-D02GGCCGTCCACGTGTCCNONE 
AK071220GGCCGTCCACGTGTCCNONE 
AK109380GGCCGTCCACGTGTCCConserved hypothetical protein. 
J023083M17GGCCGTCCACGTGTCCNONE 
Os02g0502500011-068-G11GCTGGGCCCACGTGTCNONE 
AK100111GCTGGGCCCACGTGTCNONE 
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein. 
J013074C19GCTGGGCCCACGTGTCNONE 
J013153K16GCTGGGCCCACGTGTCNONE 
J023078O21GCTGGGCCCACGTGTCNONE 
J033127M18GCTGGGCCCACGTGTCNONE 
J043038D17GCTGGGCCCACGTGTCNONE 
J065090L08GCTGGGCCCACGTGTCNONE 
J065110P16GCTGGGCCCACGTGTCNONE 
J065163C03GCTGGGCCCACGTGTCNONE 
J065213D23GCTGGGCCCACGTGTCNONE 
J090010M14GCTGGGCCCACGTGTCNONE 
J090016E02GCTGGGCCCACGTGTCNONE 
J090044J20GCTGGGCCCACGTGTCNONE 
J090091M16GCTGGGCCCACGTGTCNONE 
J090099I23GCTGGGCCCACGTGTCNONE 
Os02g0520800AK102815ACACGTGGCSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09ACACGTGGCNONE 
J100038E09ACACGTGGCNONE 
J100076G11ACACGTGGCNONE 
Os02g0527200009-022-A08ACACGTGGCCCCCCGCGNONE 
009-030-A06ACACGTGGCCCCCCGCGNONE 
009-034-F08ACACGTGGCCCCCCGCGNONE 
009-041-E08ACACGTGGCCCCCCGCGNONE 
009-048-H03ACACGTGGCCCCCCGCGNONE 
009-067-E04ACACGTGGCCCCCCGCGNONE 
009-081-E04ACACGTGGCCCCCCGCGNONE 
009-124-C06ACACGTGGCCCCCCGCGNONE 
009-154-A07ACACGTGGCCCCCCGCGNONE 
009-180-G04ACACGTGGCCCCCCGCGNONE 
009-180-H01ACACGTGGCCCCCCGCGNONE 
009-183-C03ACACGTGGCCCCCCGCGNONE 
009-198-E04ACACGTGGCCCCCCGCGNONE 
009-199-A12ACACGTGGCCCCCCGCGNONE 
AK058851ACACGTGGCCCCCCGCGConserved hypothetical protein. 
J075041O08ACACGTGGCCCCCCGCGNONE 
J075112L20ACACGTGGCCCCCCGCGNONE 
J075193M15ACACGTGGCCCCCCGCGNONE 
Os02g0530100AK058520ACACGTGGHeavy metal transport/detoxification protein domain containing protein. 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
Os02g0581800J065071F12AGCCCACACGTGGConserved hypothetical protein. 
Os02g0613200AK064869ACACGTGGGACCCACNONE 
AK065051ACACGTGGGACCCACNONE 
AK098853ACACGTGGGACCCACConserved hypothetical protein. 
AK098974ACACGTGGGACCCACNONE 
J013000H15ACACGTGGGACCCACNONE 
J013001I18ACACGTGGGACCCACNONE 
J013022I18ACACGTGGGACCCACNONE 
J013025D06ACACGTGGGACCCACNONE 
J013037H17ACACGTGGGACCCACNONE 
J013043F22ACACGTGGGACCCACNONE 
J013075E01ACACGTGGGACCCACNONE 
J013088D09ACACGTGGGACCCACNONE 
J013088E19ACACGTGGGACCCACNONE 
J013102O18ACACGTGGGACCCACNONE 
J013110C08ACACGTGGGACCCACNONE 
J013118C06ACACGTGGGACCCACNONE 
J013119F22ACACGTGGGACCCACNONE 
J013128K14ACACGTGGGACCCACNONE 
J013158C17ACACGTGGGACCCACNONE 
J023013P15ACACGTGGGACCCACNONE 
J023044L21ACACGTGGGACCCACNONE 
J033023I04ACACGTGGGACCCACNONE 
J033038I22ACACGTGGGACCCACNONE 
J033095M02ACACGTGGGACCCACNONE 
J043022F05ACACGTGGGACCCACNONE 
J080307N20ACACGTGGGACCCACNONE 
J080315C02ACACGTGGGACCCACNONE 
J080316A15ACACGTGGGACCCACNONE 
J080316G03ACACGTGGGACCCACNONE 
J090029E24ACACGTGGGACCCACNONE 
J090031H15ACACGTGGGACCCACNONE 
J090034F13ACACGTGGGACCCACNONE 
J090047G02ACACGTGGGACCCACNONE 
J090069M24ACACGTGGGACCCACNONE 
J100052E15ACACGTGGGACCCACNONE 
Os02g0617500AK106578CCACGTGTDEAD/DEAH box helicase, N-terminal domain containing protein. 
Os02g0649300014-043-A05CGCCACGTGTNONE 
014-043-A05GCCACGTGTCGNONE 
AK063685CGCCACGTGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
AK063685GCCACGTGTCGSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0717900AK069653GGACACGTGGCGMSF1 domain containing protein. 
J023031J12GGACACGTGGCGNONE 
J075195G22GGACACGTGGCGNONE 
J100088O11GGACACGTGGCGNONE 
Os02g0721800AK100043GCGGGCCCCACGTGTCCSimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0743500AK100319GGCCCCACGTGTCSimilar to EDR1. 
AK102767GGCCCCACGTGTCNONE 
Os02g0744700AF395537GACACGTGGGCCCCACACNONE 
AJ308110GACACGTGGGCCCCACACNONE 
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0752300AK072544CCCACCACGTGTCACTConserved hypothetical protein. 
J023132N16CCCACCACGTGTCACTNONE 
J033069F17CCCACCACGTGTCACTNONE 
Os02g0824400AK121390CGCCACGTGTCCConserved hypothetical protein. 
AK121390GCCACGTGTCCConserved hypothetical protein. 
J023128P21CGCCACGTGTCCNONE 
J023128P21GCCACGTGTCCNONE 
J053097O16CGCCACGTGTCCNONE 
J053097O16GCCACGTGTCCNONE 
J065012I02CGCCACGTGTCCNONE 
J065012I02GCCACGTGTCCNONE 
J065049C06CGCCACGTGTCCNONE 
J065049C06GCCACGTGTCCNONE 
J065051H02CGCCACGTGTCCNONE 
J065051H02GCCACGTGTCCNONE 
J065069A13CGCCACGTGTCCNONE 
J065069A13GCCACGTGTCCNONE 
J065082E04CGCCACGTGTCCNONE 
J065082E04GCCACGTGTCCNONE 
J065102N09CGCCACGTGTCCNONE 
J065102N09GCCACGTGTCCNONE 
J065157O10CGCCACGTGTCCNONE 
J065157O10GCCACGTGTCCNONE 
J065188N23CGCCACGTGTCCNONE 
J065188N23GCCACGTGTCCNONE 
J065190J11CGCCACGTGTCCNONE 
J065190J11GCCACGTGTCCNONE 
J065202M09CGCCACGTGTCCNONE 
J065202M09GCCACGTGTCCNONE 
Os02g0824500AK111296GGACACGTGGCSimilar to Remorin. 
AK111296GGACACGTGGCGSimilar to Remorin. 
J065048M11GGACACGTGGCNONE 
J065048M11GGACACGTGGCGNONE 
J065081F01GGACACGTGGCNONE 
J065081F01GGACACGTGGCGNONE 
Os02g0829100AB037145GCGGGCCCCACGTGTCNONE 
AJ278822GCGGGCCCCACGTGTCReplication protein A 30kDa. 
AK103235GCGGGCCCCACGTGTCNONE 
Os03g0106000011-049-C02CCACGTGTCNONE 
AK063343CCACGTGTCProtein of unknown function UPF0187 family protein. 
J065001I04CCACGTGTCNONE 
J065021G09CCACGTGTCNONE 
J065021I09CCACGTGTCNONE 
J100035C20CCACGTGTCNONE 
Os03g0116800012-097-D10GACACGTGGCNONE 
016-024-H10GACACGTGGCNONE 
AK066955GACACGTGGCConserved hypothetical protein. 
AK068678GACACGTGGCNONE 
AK104839GACACGTGGCNONE 
J013033G16GACACGTGGCNONE 
J013091C10GACACGTGGCNONE 
J013158H22GACACGTGGCNONE 
J023106K11GACACGTGGCNONE 
J065051O15GACACGTGGCNONE 
J065129G22GACACGTGGCNONE 
J075001K02GACACGTGGCNONE 
J075011O03GACACGTGGCNONE 
J075024K04GACACGTGGCNONE 
J075026E07GACACGTGGCNONE 
J075037O14GACACGTGGCNONE 
J075071D17GACACGTGGCNONE 
J075084M05GACACGTGGCNONE 
J075114B06GACACGTGGCNONE 
J075128C23GACACGTGGCNONE 
J075153A13GACACGTGGCNONE 
J075158A15GACACGTGGCNONE 
J075165P09GACACGTGGCNONE 
J075167M21GACACGTGGCNONE 
J075170F11GACACGTGGCNONE 
J075186F12GACACGTGGCNONE 
J075186L13GACACGTGGCNONE 
J075189A01GACACGTGGCNONE 
J075192D19GACACGTGGCNONE 
Os03g0154300J065112A07CCACGTGTCConserved hypothetical protein. 
J065192P15CCACGTGTCNONE 
Os03g0159400AK108557CCACGTGTProtein of unknown function DUF623, plant domain containing protein. 
Os03g0171900006-070-A01GCCCCCACGTGTCAGTGNONE 
AK061079GCCCCCACGTGTCAGTGNONE 
AK105642GCCCCCACGTGTCAGTGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0174200AK060616CCACGTGTNONE 
AK103762CCACGTGTConserved hypothetical protein. 
J033143G15CCACGTGTNONE 
J090025L02CCACGTGTNONE 
Os03g0192500AK068957ACACGTGGGGCProtein phosphatase 2C-like domain containing protein. 
AY603974ACACGTGGGGCNONE 
Os03g0219400AK100702CCACGTGTGlycoside hydrolase, family 20 protein. 
AK121985CCACGTGTNONE 
J023114O06CCACGTGTNONE 
J100043M20CCACGTGTNONE 
Os03g0222600J065048C01CCACGTGTNONE 
J065117L06CCACGTGTNONE 
J065183E14CCACGTGTNONE 
J075074N18CCACGTGTNONE 
J075197B12CCACGTGTNONE 
J090049N05CCACGTGTNONE 
J100029D23CCACGTGTNONE 
J100068E06CCACGTGTNONE 
Os03g0262500AK071153CCCACGTGTNONE 
AK120384CCCACGTGTConserved hypothetical protein. 
J023078H24CCCACGTGTNONE 
Os03g0270000006-051-C05ACACGTGGNONE 
006-100-A03ACACGTGGNONE 
006-114-F11ACACGTGGNONE 
AK061579ACACGTGGNONE 
AK106069ACACGTGGProtein of unknown function DUF296 domain containing protein. 
J023102O16ACACGTGGNONE 
J065017C10ACACGTGGNONE 
J065059M01ACACGTGGNONE 
J065104I08ACACGTGGNONE 
J065120B10ACACGTGGNONE 
J065130K08ACACGTGGNONE 
J065140F09ACACGTGGNONE 
J065166E07ACACGTGGNONE 
Os03g0272300AK060183GCCACGTGTCNONE 
AK071865GCCACGTGTCZinc finger, RING-type domain containing protein. 
Os03g0295800006-107-F02ACACGTGGCNONE 
AK106050ACACGTGGCNONE 
Os03g0298300AK061180CCACGTGTCCProtein of unknown function DUF588 family protein. 
AK099089CCACGTGTCCNONE 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0308000016-023-H09CGACACGTGGGCCCAACANONE 
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CGACACGTGGGCCCAACANONE 
J023043K04CGACACGTGGGCCCAACANONE 
J023083I20CGACACGTGGGCCCAACANONE 
J033068F22CGACACGTGGGCCCAACANONE 
J033125P21CGACACGTGGGCCCAACANONE 
J065207A22CGACACGTGGGCCCAACANONE 
J100018D20CGACACGTGGGCCCAACANONE 
J100026L17CGACACGTGGGCCCAACANONE 
J100055D14CGACACGTGGGCCCAACANONE 
J100060P03CGACACGTGGGCCCAACANONE 
J100078A20CGACACGTGGGCCCAACANONE 
Os03g0322500009-014-F03GGACACGTGGCNONE 
009-076-G10GGACACGTGGCNONE 
009-100-C01GGACACGTGGCNONE 
009-106-F02GGACACGTGGCNONE 
009-123-H11GGACACGTGGCNONE 
009-158-C09GGACACGTGGCNONE 
009-172-D04GGACACGTGGCNONE 
009-179-C11GGACACGTGGCNONE 
009-188-B12GGACACGTGGCNONE 
009-194-D07GGACACGTGGCNONE 
AK103503GGACACGTGGCNONE 
AK121029GGACACGTGGCSimilar to 14 kDa zinc-binding protein (Protein kinase C inhibitor) (PKCI). 
J013066O21GGACACGTGGCNONE 
J023050G22GGACACGTGGCNONE 
J023103H15GGACACGTGGCNONE 
J033075B11GGACACGTGGCNONE 
J033091E24GGACACGTGGCNONE 
J033098N14GGACACGTGGCNONE 
J053089B02GGACACGTGGCNONE 
J065039M05GGACACGTGGCNONE 
J065210G05GGACACGTGGCNONE 
J090036P06GGACACGTGGCNONE 
J090040M04GGACACGTGGCNONE 
Os03g0331600009-025-C11GGTCCACGTGTGCCCAAAANONE 
AK063782GGTCCACGTGTGCCCAAAAConserved hypothetical protein. 
Os03g0333000AK109811GCCACGTGTConserved hypothetical protein. 
J065152D04GCCACGTGTNONE 
J090011B05GCCACGTGTNONE 
Os03g0333100AK101050ACACGTGGCProtein of unknown function DUF663 domain containing protein. 
Os03g0335300AK098846ACACGTGGACCACGCGTNONE 
AK098891ACACGTGGACCACGCGTNONE 
AK111509ACACGTGGACCACGCGTSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847ACACGTGGACCACGCGTNONE 
AK121413ACACGTGGACCACGCGTNONE 
Os03g0340500012-007-F10GGCCCCACGTGTCAGTGNONE 
AK099406GGCCCCACGTGTCAGTGNONE 
AK102158GGCCCCACGTGTCAGTGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13GGCCCCACGTGTCAGTGNONE 
J013063E02GGCCCCACGTGTCAGTGNONE 
J013063I02GGCCCCACGTGTCAGTGNONE 
J013157O07GGCCCCACGTGTCAGTGNONE 
J023131N05GGCCCCACGTGTCAGTGNONE 
J033033P05GGCCCCACGTGTCAGTGNONE 
J033040N16GGCCCCACGTGTCAGTGNONE 
J033044M19GGCCCCACGTGTCAGTGNONE 
J033086F24GGCCCCACGTGTCAGTGNONE 
J033097H01GGCCCCACGTGTCAGTGNONE 
J033106C22GGCCCCACGTGTCAGTGNONE 
J033128M13GGCCCCACGTGTCAGTGNONE 
J033133I15GGCCCCACGTGTCAGTGNONE 
J043027A21GGCCCCACGTGTCAGTGNONE 
J090028A09GGCCCCACGTGTCAGTGNONE 
J090053D06GGCCCCACGTGTCAGTGNONE 
J090083O17GGCCCCACGTGTCAGTGNONE 
J090099H10GGCCCCACGTGTCAGTGNONE 
J100036M05GGCCCCACGTGTCAGTGNONE 
Os03g0381500AK108125CGCCACGTGTConserved hypothetical protein. 
Os03g0412300AK071008ACACGTGGCHeavy metal transport/detoxification protein domain containing protein. 
J075120J12ACACGTGGCNONE 
J100068E17ACACGTGGCNONE 
Os03g0441000AK070997CCCACGTGTNONE 
J023077I17CCCACGTGTNONE 
Os03g0574900AK068853ACACGTGGSimilar to Potassium transporter 1 (OsHAK1). Splice isoform 2. 
Os03g0578500Os03g0578500CCCCACGTGTConserved hypothetical protein. 
Os03g0596800AK073603CCCACGTGTCAGTGConserved hypothetical protein. 
J033052N01CCCACGTGTCAGTGNONE 
Os03g0606200009-030-E09GACACGTGGNONE 
009-076-H10GACACGTGGNONE 
009-122-H12GACACGTGGNONE 
009-153-F09GACACGTGGNONE 
AB055076GACACGTGGMitochondrial ATP synthase 6 KD subunit. 
AK072384GACACGTGGNONE 
AK107928GACACGTGGNONE 
J023078E13GACACGTGGNONE 
J053031N01GACACGTGGNONE 
J053046K19GACACGTGGNONE 
J053062P07GACACGTGGNONE 
J053091C23GACACGTGGNONE 
J053099N19GACACGTGGNONE 
J065005E06GACACGTGGNONE 
J065030N03GACACGTGGNONE 
J065138O21GACACGTGGNONE 
J065159K03GACACGTGGNONE 
J075030M08GACACGTGGNONE 
J080006E23GACACGTGGNONE 
J080010D10GACACGTGGNONE 
J080016N17GACACGTGGNONE 
J080024N09GACACGTGGNONE 
J080028E23GACACGTGGNONE 
J080035I11GACACGTGGNONE 
J080038D15GACACGTGGNONE 
J080040H08GACACGTGGNONE 
J080043L04GACACGTGGNONE 
J080047C06GACACGTGGNONE 
J080061G04GACACGTGGNONE 
J080066E10GACACGTGGNONE 
J080067P03GACACGTGGNONE 
J080082D07GACACGTGGNONE 
J080089M13GACACGTGGNONE 
J080094O09GACACGTGGNONE 
J080095C24GACACGTGGNONE 
J080309E21GACACGTGGNONE 
J090016G15GACACGTGGNONE 
J090031C20GACACGTGGNONE 
J090033A15GACACGTGGNONE 
J090037L07GACACGTGGNONE 
J090038I10GACACGTGGNONE 
J090072P19GACACGTGGNONE 
J100040J02GACACGTGGNONE 
J100047N05GACACGTGGNONE 
J100048M10GACACGTGGNONE 
J100076C02GACACGTGGNONE 
J100077G23GACACGTGGNONE 
J100080O08GACACGTGGNONE 
J100085C06GACACGTGGNONE 
J100085F16GACACGTGGNONE 
Os03g0666500006-096-G10ACACGTGGNONE 
AK061203ACACGTGGSimilar to Ras-related protein RHA1. 
AK067459ACACGTGGNONE 
AK100036ACACGTGGNONE 
J065052B08ACACGTGGNONE 
J065075N17ACACGTGGNONE 
J065106A10ACACGTGGNONE 
J100065N16ACACGTGGNONE 
J100073A22ACACGTGGNONE 
J100084H04ACACGTGGNONE 
J100090P16ACACGTGGNONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0676400AK109228CCACGTGTVQ domain containing protein. 
Os03g0704200AK071176GACACGTGGGZinc finger, MYND-type domain containing protein. 
J023083O08GACACGTGGGNONE 
Os03g0712600015-008-G03ACACGTGGCNONE 
AK103705ACACGTGGCHypothetical protein. 
J033136N14ACACGTGGCNONE 
Os03g0747500AK108009CCACGTGTCCSeed maturation protein domain containing protein. 
AK108009CCCACGTGTSeed maturation protein domain containing protein. 
Os03g0764200Os03g0764200CCCACCACGTGTNONE 
Os03g0767800004-017-A08CCACGTGTCCNONE 
006-025-G11CCACGTGTCCNONE 
006-088-G04CCACGTGTCCNONE 
009-055-C02CCACGTGTCCNONE 
AF283006CCACGTGTCCNONE 
AK060000CCACGTGTCCNONE 
AK060906CCACGTGTCCNONE 
AK066036CCACGTGTCCCold acclimation WCOR413 family protein. 
J023026I12CCACGTGTCCNONE 
J023049J16CCACGTGTCCNONE 
J033037M10CCACGTGTCCNONE 
J033057D13CCACGTGTCCNONE 
J033105H16CCACGTGTCCNONE 
J033119G10CCACGTGTCCNONE 
J065023C15CCACGTGTCCNONE 
J065080D13CCACGTGTCCNONE 
J080003C23CCACGTGTCCNONE 
J080003P09CCACGTGTCCNONE 
J080004K04CCACGTGTCCNONE 
J080010M14CCACGTGTCCNONE 
J080011J21CCACGTGTCCNONE 
J080013J01CCACGTGTCCNONE 
J080015A16CCACGTGTCCNONE 
J080021F07CCACGTGTCCNONE 
J080023F18CCACGTGTCCNONE 
J080034D18CCACGTGTCCNONE 
J080034O19CCACGTGTCCNONE 
J080038J08CCACGTGTCCNONE 
J080039N10CCACGTGTCCNONE 
J080042P09CCACGTGTCCNONE 
J080043E10CCACGTGTCCNONE 
J080051M02CCACGTGTCCNONE 
J080051O17CCACGTGTCCNONE 
J080053B01CCACGTGTCCNONE 
J080056N01CCACGTGTCCNONE 
J080058J20CCACGTGTCCNONE 
J080061B11CCACGTGTCCNONE 
J080064B15CCACGTGTCCNONE 
J080064O18CCACGTGTCCNONE 
J080071A15CCACGTGTCCNONE 
J080071C13CCACGTGTCCNONE 
J080071F14CCACGTGTCCNONE 
J080071M21CCACGTGTCCNONE 
J080072A10CCACGTGTCCNONE 
J080075J05CCACGTGTCCNONE 
J080076A05CCACGTGTCCNONE 
J080078F05CCACGTGTCCNONE 
J080078K01CCACGTGTCCNONE 
J080081F11CCACGTGTCCNONE 
J080081K15CCACGTGTCCNONE 
J080084K03CCACGTGTCCNONE 
J080089F18CCACGTGTCCNONE 
J080095A21CCACGTGTCCNONE 
J100022L11CCACGTGTCCNONE 
J100029I01CCACGTGTCCNONE 
J100032I15CCACGTGTCCNONE 
J100062N24CCACGTGTCCNONE 
J100067E13CCACGTGTCCNONE 
J100075G02CCACGTGTCCNONE 
J100080L14CCACGTGTCCNONE 
Os03g0796000AK064912GACACGTGGSimilar to Ripening-associated protein (Fragment). 
AK106661GACACGTGGNONE 
J013000M11GACACGTGGNONE 
Os03g0798600AK121716GGCCGGGCCGGAACACGTGGGCCTASimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18GGCCGGGCCGGAACACGTGGGCCTANONE 
J033079G18GGCCGGGCCGGAACACGTGGGCCTANONE 
J043038B19GGCCGGGCCGGAACACGTGGGCCTANONE 
J065091E15GGCCGGGCCGGAACACGTGGGCCTANONE 
J065092P10GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189F18GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189L12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075021B11GGCCGGGCCGGAACACGTGGGCCTANONE 
J075022L15GGCCGGGCCGGAACACGTGGGCCTANONE 
J075046G12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075080H15GGCCGGGCCGGAACACGTGGGCCTANONE 
J090045H01GGCCGGGCCGGAACACGTGGGCCTANONE 
J090077H16GGCCGGGCCGGAACACGTGGGCCTANONE 
J090083D22GGCCGGGCCGGAACACGTGGGCCTANONE 
J100021D24GGCCGGGCCGGAACACGTGGGCCTANONE 
J100023G04GGCCGGGCCGGAACACGTGGGCCTANONE 
J100049J23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100075K23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100077G22GGCCGGGCCGGAACACGTGGGCCTANONE 
Os03g0799100AK058959ACACGTGGGCCCTNONE 
AK102772ACACGTGGGCCCTSimilar to WAVE-DAMPENED2. 
J023093D03ACACGTGGGCCCTNONE 
J033099D22ACACGTGGGCCCTNONE 
J090054G18ACACGTGGGCCCTNONE 
J100031H24ACACGTGGGCCCTNONE 
J100065H09ACACGTGGGCCCTNONE 
J100082G10ACACGTGGGCCCTNONE 
Os03g0807900006-056-G10GACACGTGGGGCCCGGCNONE 
AK060962GACACGTGGGGCCCGGCChaperonin-like RbcX family protein. 
AK070287GACACGTGGGGCCCGGCNONE 
J023049O16GACACGTGGGGCCCGGCNONE 
J100025I21GACACGTGGGGCCCGGCNONE 
J100035K21GACACGTGGGGCCCGGCNONE 
Os03g0815900013-097-G08CGACACGTGGCGNONE 
AK065258CGACACGTGGCGNONE 
AK119756CGACACGTGGCGSimilar to DNA-directed RNA polymerase. 
J013002J17CGACACGTGGCGNONE 
J013074A12CGACACGTGGCGNONE 
J023045C17CGACACGTGGCGNONE 
J033050E21CGACACGTGGCGNONE 
J053094P05CGACACGTGGCGNONE 
J090038F11CGACACGTGGCGNONE 
J090072J01CGACACGTGGCGNONE 
J100026H07CGACACGTGGCGNONE 
J100040O06CGACACGTGGCGNONE 
J100083D07CGACACGTGGCGNONE 
Os03g0832200AK070712CCCACGTGTSimilar to Calcium-binding protein precursor (Calreticulin). 
Os03g0835600AK101677CGACACGTGGAcyl-coA-binding protein, ACBP family protein. 
Os03g0837300AK111243GCCACGTGTCGNONE 
AK121140GCCACGTGTCGNicotinate phosphoribosyltransferase and related family protein. 
AY214337GCCACGTGTCGNONE 
J023077G12GCCACGTGTCGNONE 
J023078M10GCCACGTGTCGNONE 
J033031B10GCCACGTGTCGNONE 
J033067L18GCCACGTGTCGNONE 
J043005P09GCCACGTGTCGNONE 
J090013J15GCCACGTGTCGNONE 
J090042E10GCCACGTGTCGNONE 
J090045A20GCCACGTGTCGNONE 
J100022H02GCCACGTGTCGNONE 
Os03g0843700AK070364ACACGTGGGCCTAFAR1 domain containing protein. 
J013146A20ACACGTGGGCCTANONE 
J023050I08ACACGTGGGCCTANONE 
J033058E14ACACGTGGGCCTANONE 
J033111G20ACACGTGGGCCTANONE 
J033141H24ACACGTGGGCCTANONE 
J065021K13ACACGTGGGCCTANONE 
J065082M21ACACGTGGGCCTANONE 
J075106L22ACACGTGGGCCTANONE 
J075150L05ACACGTGGGCCTANONE 
J075172H24ACACGTGGGCCTANONE 
J075199F06ACACGTGGGCCTANONE 
Os04g0173800AK103206ACACGTGGLectin precursor (Agglutinin). 
J033122E14ACACGTGGNONE 
J075001E08ACACGTGGNONE 
J075005H05ACACGTGGNONE 
J075006A12ACACGTGGNONE 
J075026O21ACACGTGGNONE 
J075040I24ACACGTGGNONE 
J075060N11ACACGTGGNONE 
J075069A22ACACGTGGNONE 
J075070A15ACACGTGGNONE 
J075074K06ACACGTGGNONE 
J075078E13ACACGTGGNONE 
J075085O15ACACGTGGNONE 
J075088A22ACACGTGGNONE 
J075094E22ACACGTGGNONE 
J075095E06ACACGTGGNONE 
J075120L07ACACGTGGNONE 
J075138I15ACACGTGGNONE 
J075140I20ACACGTGGNONE 
J075140N11ACACGTGGNONE 
J075142I18ACACGTGGNONE 
J075147F23ACACGTGGNONE 
J075147J18ACACGTGGNONE 
J075155H18ACACGTGGNONE 
J075156J22ACACGTGGNONE 
J075157J02ACACGTGGNONE 
J075167L04ACACGTGGNONE 
J075170H22ACACGTGGNONE 
J075172G01ACACGTGGNONE 
J075180L07ACACGTGGNONE 
J075182B03ACACGTGGNONE 
J075194C19ACACGTGGNONE 
J100063D16ACACGTGGNONE 
M24504ACACGTGGNONE 
Os04g0244800009-066-G06GCCCACGTGTCNONE 
011-024-D02GCCCACGTGTCNONE 
AK121488GCCCACGTGTCHeavy metal transport/detoxification protein domain containing protein. 
J023095P14GCCCACGTGTCNONE 
J023150J09GCCCACGTGTCNONE 
J053097G24GCCCACGTGTCNONE 
J065001K24GCCCACGTGTCNONE 
J065009O13GCCCACGTGTCNONE 
J065076M12GCCCACGTGTCNONE 
J065081I15GCCCACGTGTCNONE 
J065105E10GCCCACGTGTCNONE 
J065106G04GCCCACGTGTCNONE 
J065123I12GCCCACGTGTCNONE 
J065137H16GCCCACGTGTCNONE 
J065151I11GCCCACGTGTCNONE 
J065164H06GCCCACGTGTCNONE 
J065173J07GCCCACGTGTCNONE 
J065196F02GCCCACGTGTCNONE 
J065198I17GCCCACGTGTCNONE 
J065206I11GCCCACGTGTCNONE 
J065216J02GCCCACGTGTCNONE 
J075076D10GCCCACGTGTCNONE 
J075098F06GCCCACGTGTCNONE 
J075115A20GCCCACGTGTCNONE 
J075184H05GCCCACGTGTCNONE 
J075193E17GCCCACGTGTCNONE 
J090014L09GCCCACGTGTCNONE 
J090015H16GCCCACGTGTCNONE 
J090024M04GCCCACGTGTCNONE 
J090062K08GCCCACGTGTCNONE 
J090082I08GCCCACGTGTCNONE 
Os04g0389800AK109628CCCCACGTGTSimilar to Acetohydroxyacid synthase. 
Os04g0390700AK107261CGCCACGTGTCCGlucose/ribitol dehydrogenase family protein. 
AK107261GGACACGTGGGlucose/ribitol dehydrogenase family protein. 
Os04g0428900009-068-A06ACACGTGGGNONE 
AK061355ACACGTGGGSimilar to CSN8. 
AK099153ACACGTGGGNONE 
AY336991ACACGTGGGNONE 
J023069F08ACACGTGGGNONE 
J065112H12ACACGTGGGNONE 
J075022F23ACACGTGGGNONE 
J090045D23ACACGTGGGNONE 
J090067E18ACACGTGGGNONE 
J090099H14ACACGTGGGNONE 
Os04g0453200AK121306CCACGTGTSimilar to Monosaccharide transporter 1. 
J023111J01CCACGTGTNONE 
Os04g0479300AK106088AGCCCACGTGTConserved hypothetical protein. 
Os04g0503500AK099404CGACACGTGGLeucine-rich repeat, cysteine-containing subtype containing protein. 
AK101695CGACACGTGGNONE 
Os04g0591300009-006-D05CGCCACGTGTCNONE 
AK105120CGCCACGTGTCConserved hypothetical protein. 
Os04g0602800AK100925GACACGTGGGSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0616900013-094-A06CCCACGTGTCNONE 
013-099-B07CCCACGTGTCNONE 
015-083-G11CCCACGTGTCNONE 
AK066343CCCACGTGTCConserved hypothetical protein. 
AK104906CCCACGTGTCNONE 
J013066L21CCCACGTGTCNONE 
J023091I07CCCACGTGTCNONE 
J065056B15CCCACGTGTCNONE 
J065148E09CCCACGTGTCNONE 
J065162P19CCCACGTGTCNONE 
J065185N03CCCACGTGTCNONE 
J065198D13CCCACGTGTCNONE 
J090055O20CCCACGTGTCNONE 
J090067F24CCCACGTGTCNONE 
Os04g0652900AK071125ACACGTGGCPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
AK071125GCCACGTGTCGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03ACACGTGGCNONE 
J023082K03GCCACGTGTCGNONE 
J075142E01ACACGTGGCNONE 
J075142E01GCCACGTGTCGNONE 
Os04g0687900009-068-D03CCACTGACACGTGGGNONE 
015-097-H12CCACTGACACGTGGGNONE 
AK062547CCACTGACACGTGGGNONE 
AK066910CCACTGACACGTGGGNONE 
AK098928CCACTGACACGTGGGSimilar to T24D18.17 protein (Tubby-like protein TULP8). 
AK104333CCACTGACACGTGGGNONE 
J013023N16CCACTGACACGTGGGNONE 
J013031I07CCACTGACACGTGGGNONE 
J013063L06CCACTGACACGTGGGNONE 
J013091C11CCACTGACACGTGGGNONE 
J013123M06CCACTGACACGTGGGNONE 
J013126D14CCACTGACACGTGGGNONE 
J023023E09CCACTGACACGTGGGNONE 
J023039C19CCACTGACACGTGGGNONE 
J023068D23CCACTGACACGTGGGNONE 
J023080C21CCACTGACACGTGGGNONE 
J033092J17CCACTGACACGTGGGNONE 
J033112P12CCACTGACACGTGGGNONE 
J033135O08CCACTGACACGTGGGNONE 
J053023C13CCACTGACACGTGGGNONE 
J065030O05CCACTGACACGTGGGNONE 
J065065P07CCACTGACACGTGGGNONE 
J065190O06CCACTGACACGTGGGNONE 
J090011M19CCACTGACACGTGGGNONE 
J090061F08CCACTGACACGTGGGNONE 
J090064H09CCACTGACACGTGGGNONE 
J090064P11CCACTGACACGTGGGNONE 
Os05g0134200AK067074CGCCACGTGTCCSimilar to Protein phosphatase-2C. 
Os05g0154900009-168-F11CCACGTGTNONE 
AK070869CCACGTGTConserved hypothetical protein. 
Os05g0163700AK071561CCACTGACACGTGGGTCCCACCACSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0171900012-005-F08CCCACGTGTCNONE 
012-048-G09CCCACGTGTCNONE 
013-046-A07CCCACGTGTCNONE 
013-050-D10CCCACGTGTCNONE 
014-003-G04CCCACGTGTCNONE 
014-008-G10CCCACGTGTCNONE 
014-011-E07CCCACGTGTCNONE 
014-011-F11CCCACGTGTCNONE 
014-019-C02CCCACGTGTCNONE 
014-037-G03CCCACGTGTCNONE 
014-043-G06CCCACGTGTCNONE 
014-045-A05CCCACGTGTCNONE 
014-047-C07CCCACGTGTCNONE 
014-052-F03CCCACGTGTCNONE 
014-088-G07CCCACGTGTCNONE 
014-090-B11CCCACGTGTCNONE 
015-010-A06CCCACGTGTCNONE 
015-013-B11CCCACGTGTCNONE 
015-026-A04CCCACGTGTCNONE 
015-041-G01CCCACGTGTCNONE 
015-046-D06CCCACGTGTCNONE 
015-050-B07CCCACGTGTCNONE 
015-053-C03CCCACGTGTCNONE 
015-056-C04CCCACGTGTCNONE 
015-057-B04CCCACGTGTCNONE 
015-075-C12CCCACGTGTCNONE 
015-079-F04CCCACGTGTCNONE 
016-025-F02CCCACGTGTCNONE 
016-030-B10CCCACGTGTCNONE 
016-034-B03CCCACGTGTCNONE 
016-034-E04CCCACGTGTCNONE 
016-035-B07CCCACGTGTCNONE 
016-035-D10CCCACGTGTCNONE 
016-039-C06CCCACGTGTCNONE 
016-042-D01CCCACGTGTCNONE 
016-043-C02CCCACGTGTCNONE 
016-044-B01CCCACGTGTCNONE 
016-045-G06CCCACGTGTCNONE 
016-049-G07CCCACGTGTCNONE 
016-052-C10CCCACGTGTCNONE 
016-070-D03CCCACGTGTCNONE 
016-077-H10CCCACGTGTCNONE 
016-082-F02CCCACGTGTCNONE 
016-087-D04CCCACGTGTCNONE 
016-093-B05CCCACGTGTCNONE 
016-093-F06CCCACGTGTCNONE 
AK069814CCCACGTGTCGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
AK106348CCCACGTGTCNONE 
AK119584CCCACGTGTCNONE 
AK119669CCCACGTGTCNONE 
J013074J12CCCACGTGTCNONE 
J023031G07CCCACGTGTCNONE 
J023072P16CCCACGTGTCNONE 
J023105N07CCCACGTGTCNONE 
J053023E11CCCACGTGTCNONE 
J053025H06CCCACGTGTCNONE 
J053029G08CCCACGTGTCNONE 
J053051L10CCCACGTGTCNONE 
J065011P09CCCACGTGTCNONE 
J065022O05CCCACGTGTCNONE 
J065071D04CCCACGTGTCNONE 
J065100B07CCCACGTGTCNONE 
J065104O10CCCACGTGTCNONE 
J065154H19CCCACGTGTCNONE 
J065183D19CCCACGTGTCNONE 
J065185I07CCCACGTGTCNONE 
J065205O17CCCACGTGTCNONE 
J075022N11CCCACGTGTCNONE 
J100033M17CCCACGTGTCNONE 
Os05g0176700009-076-A09CGCCACGTGTCCNONE 
009-147-H06CGCCACGTGTCCNONE 
009-161-C02CGCCACGTGTCCNONE 
AK071729CGCCACGTGTCCConserved hypothetical protein. 
J023110H11CGCCACGTGTCCNONE 
J075092I23CGCCACGTGTCCNONE 
J100038P12CGCCACGTGTCCNONE 
J100039J21CGCCACGTGTCCNONE 
J100039M13CGCCACGTGTCCNONE 
J100084A22CGCCACGTGTCCNONE 
Os05g0188100009-011-G07AGTGACACGTGGCNONE 
009-015-G06AGTGACACGTGGCNONE 
009-021-B03AGTGACACGTGGCNONE 
009-024-A09AGTGACACGTGGCNONE 
009-025-A03AGTGACACGTGGCNONE 
009-028-G03AGTGACACGTGGCNONE 
009-029-G10AGTGACACGTGGCNONE 
009-034-G12AGTGACACGTGGCNONE 
009-039-D05AGTGACACGTGGCNONE 
009-055-F08AGTGACACGTGGCNONE 
009-064-B05AGTGACACGTGGCNONE 
009-066-H12AGTGACACGTGGCNONE 
009-077-B10AGTGACACGTGGCNONE 
009-102-B06AGTGACACGTGGCNONE 
009-113-F04AGTGACACGTGGCNONE 
009-114-F04AGTGACACGTGGCConserved hypothetical protein. 
009-131-G06AGTGACACGTGGCNONE 
009-137-H11AGTGACACGTGGCNONE 
009-172-H10AGTGACACGTGGCNONE 
009-176-D08AGTGACACGTGGCNONE 
009-182-A01AGTGACACGTGGCNONE 
009-183-A04AGTGACACGTGGCNONE 
009-183-G03AGTGACACGTGGCNONE 
009-185-B10AGTGACACGTGGCNONE 
009-192-F10AGTGACACGTGGCNONE 
009-196-G01AGTGACACGTGGCNONE 
011-005-A09AGTGACACGTGGCNONE 
013-031-B12AGTGACACGTGGCNONE 
013-031-F12AGTGACACGTGGCNONE 
013-032-A08AGTGACACGTGGCNONE 
013-069-H06AGTGACACGTGGCNONE 
013-089-C10AGTGACACGTGGCNONE 
J065123I11AGTGACACGTGGCNONE 
J065124F15AGTGACACGTGGCNONE 
J065155D05AGTGACACGTGGCNONE 
J065181J22AGTGACACGTGGCNONE 
J065185B07AGTGACACGTGGCNONE 
J065186J11AGTGACACGTGGCNONE 
J075183H21AGTGACACGTGGCNONE 
J080003P06AGTGACACGTGGCNONE 
J080068G17AGTGACACGTGGCNONE 
J080069J05AGTGACACGTGGCNONE 
J080080D03AGTGACACGTGGCNONE 
J080080K22AGTGACACGTGGCNONE 
J080090D12AGTGACACGTGGCNONE 
J080092I03AGTGACACGTGGCNONE 
J100039B06AGTGACACGTGGCNONE 
J100047N15AGTGACACGTGGCNONE 
Os05g0195200015-031-H09CCACGTGTCCNONE 
015-031-H09GCCCCCACGTGTCNONE 
015-070-C11CCACGTGTCCNONE 
015-070-C11GCCCCCACGTGTCNONE 
016-063-C11CCACGTGTCCNONE 
016-063-C11GCCCCCACGTGTCNONE 
AK106392CCACGTGTCCZinc finger, CCCH-type domain containing protein. 
AK106392GCCCCCACGTGTCZinc finger, CCCH-type domain containing protein. 
J033051N05CCACGTGTCCNONE 
J033051N05GCCCCCACGTGTCNONE 
J065118P05CCACGTGTCCNONE 
J065118P05GCCCCCACGTGTCNONE 
J100071H15CCACGTGTCCNONE 
J100071H15GCCCCCACGTGTCNONE 
J100078J22CCACGTGTCCNONE 
J100078J22GCCCCCACGTGTCNONE 
Os05g0295800AK070232ACACGTGGGTCCSimilar to Glyoxalase I (EC 4.4.1.5). 
J023043J03ACACGTGGGTCCNONE 
Os05g0357200014-046-H09CCACTGACACGTGGACCNONE 
AK064069CCACTGACACGTGGACCNONE 
AK072064CCACTGACACGTGGACCMitochondrial substrate carrier family protein. 
J065038M01CCACTGACACGTGGACCNONE 
J065121C16CCACTGACACGTGGACCNONE 
J075173E09CCACTGACACGTGGACCNONE 
J080307A20CCACTGACACGTGGACCNONE 
J090046B19CCACTGACACGTGGACCNONE 
J100033N12CCACTGACACGTGGACCNONE 
J100036G01CCACTGACACGTGGACCNONE 
J100057B19CCACTGACACGTGGACCNONE 
Os05g0372400AK068781GGACACGTGGGTCCCACLipase, class 3 family protein. 
Os05g0373300Os05g0373300GACACGTGGGGCCSimilar to BONZAI1. 
Os05g0380900AK067214GCCCACGTGTSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2). 
AK099962GCCCACGTGTNONE 
J065083M07GCCCACGTGTNONE 
Os05g0395300AK066212CCACGTGTCGProtein of unknown function DUF21 domain containing protein. 
Os05g0411300014-098-D05ACGTGGGCCCCACGTGTCNONE 
015-093-F04ACGTGGGCCCCACGTGTCNONE 
AK071931ACGTGGGCCCCACGTGTCConserved hypothetical protein. 
AK073142ACGTGGGCCCCACGTGTCNONE 
Os05g0490200016-097-B03CGCCACGTGTCCNONE 
AK101147CGCCACGTGTCCProtein of unknown function DUF1692 domain containing protein. 
AK105601CGCCACGTGTCCNONE 
J033026P06CGCCACGTGTCCNONE 
Os05g0514300AK061747GGCCCCACGTGTCSimilar to Tubby-like protein 3. 
AK098851GGCCCCACGTGTCNONE 
Os05g0521700AK070182GCCACGTGTCConserved hypothetical protein. 
J013170O04GCCACGTGTCNONE 
J023045H17GCCACGTGTCNONE 
Os05g0542200AK071306CCACGTGTEpoxide hydrolase family protein. 
AK071703CCACGTGTNONE 
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein. 
Os05g0549100AK072422CCCACGTGTCSimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os05g0566800AK065748GGACACGTGGCold acclimation protein COR413-TM1. 
AY181210GGACACGTGGNONE 
Os05g0568600009-024-B09CGCCACGTGTCGNONE 
AK063781CGCCACGTGTCGProtein of unknown function DUF1645 family protein. 
J080049H14CGCCACGTGTCGNONE 
J080062M08CGCCACGTGTCGNONE 
J080064I07CGCCACGTGTCGNONE 
J080068A12CGCCACGTGTCGNONE 
J080086J10CGCCACGTGTCGNONE 
Os05g0586600AB096011CCACGTGTCACTPlastid sigma factor SIG5. 
AB096071CCACGTGTCACTNONE 
AK105697CCACGTGTCACTNONE 
Os05g0592800AK067627CGCGTCGCCACGTGTCCACGCCSimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2). 
AK070388CGCGTCGCCACGTGTCCACGCCNONE 
AK104323CGCGTCGCCACGTGTCCACGCCNONE 
Os06g0129000Os06g0129000GACACGTGGGCCCTConserved hypothetical protein. 
Os06g0130800014-002-A12CGCCACGTGTNONE 
AK069863CGCCACGTGTHistone H5 family protein. 
J023037L12CGCCACGTGTNONE 
J065013F22CGCCACGTGTNONE 
J065021C09CGCCACGTGTNONE 
J065065E23CGCCACGTGTNONE 
J065066L24CGCCACGTGTNONE 
J065093N06CGCCACGTGTNONE 
J065135B12CGCCACGTGTNONE 
J065142J19CGCCACGTGTNONE 
J065163M21CGCCACGTGTNONE 
J065167K01CGCCACGTGTNONE 
J065178F24CGCCACGTGTNONE 
J065179A22CGCCACGTGTNONE 
J065196O19CGCCACGTGTNONE 
J075041I03CGCCACGTGTNONE 
J075071E18CGCCACGTGTNONE 
J075071F17CGCCACGTGTNONE 
J075125K04CGCCACGTGTNONE 
J075141I12CGCCACGTGTNONE 
J075142M02CGCCACGTGTNONE 
J075150G22CGCCACGTGTNONE 
J075151J04CGCCACGTGTNONE 
J075195A03CGCCACGTGTNONE 
J080023G18CGCCACGTGTNONE 
J080076P03CGCCACGTGTNONE 
J090051F21CGCCACGTGTNONE 
J090082L05CGCCACGTGTNONE 
U74296CGCCACGTGTNONE 
Os06g0136300AK109132ACACGTGGConserved hypothetical protein. 
Os06g0199300J065045H01GGCCCCACGTGTCCNONE 
J075177C22GGCCCCACGTGTCCNONE 
J080068H06GGCCCCACGTGTCCNONE 
J090048F01GGCCCCACGTGTCCNONE 
J100066F17GGCCCCACGTGTCCNONE 
Os06g0291600AK100261GACACGTGGCSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment). 
AK100261GACACGTGGGCCACSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment). 
J023063D14GACACGTGGCNONE 
J023063D14GACACGTGGGCCACNONE 
J090041B12GACACGTGGCNONE 
J090041B12GACACGTGGGCCACNONE 
Os06g0360600004-004-E05CCACGTGTNONE 
AK059997CCACGTGTNONE 
Os06g0574200Os06g0574200ACACGTGGUspA domain containing protein. 
Os06g0589500AK073322CACTGACACGTGGGCCCACGGConserved hypothetical protein. 
J033030G15CACTGACACGTGGGCCCACGGNONE 
J033148N18CACTGACACGTGGGCCCACGGNONE 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0678200AK059456CCCCCACGCCGGCCCCACGTGTCNONE 
AK071299CCCCCACGCCGGCCCCACGTGTCSimilar to Geranyl diphosphate synthase. 
Os06g0688100AK063450CGCCACGTGTCNONE 
AK101144CGCCACGTGTCRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0697600015-012-D01CACTGACACGTGGATCCGACGNONE 
J033024G16CACTGACACGTGGATCCGACGAAA ATPase domain containing protein. 
Os06g0716700AB037681CGCCACGTGTCCGGCCCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385CGCCACGTGTCCGGCCCNONE 
AK102478CGCCACGTGTCCGGCCCNONE 
J013030D18CGCCACGTGTCCGGCCCNONE 
J090091L06CGCCACGTGTCCGGCCCNONE 
Os07g0102100AK066544GACACGTGGNONE 
AK099800GACACGTGGSimilar to Potassium transporter 1 (OsHAK1). Splice isoform 2. 
Os07g0124100014-015-G11ACACGTGGCGNONE 
014-015-G11GTTGGGCCCACGTGTNONE 
AJ276693ACACGTGGCGPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AJ276693GTTGGGCCCACGTGTPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647ACACGTGGCGNONE 
AK063647GTTGGGCCCACGTGTNONE 
Os07g0143000AK067910CCACGTGTAldo/keto reductase family protein. 
Os07g0152800AK065458CCCCACGTGTConserved hypothetical protein. 
AK065458TACTGGGCCCACGTGTConserved hypothetical protein. 
J013022G05CCCCACGTGTNONE 
J013022G05TACTGGGCCCACGTGTNONE 
J013023D18CCCCACGTGTNONE 
J013023D18TACTGGGCCCACGTGTNONE 
J013048J16CCCCACGTGTNONE 
J013048J16TACTGGGCCCACGTGTNONE 
J013055I03CCCCACGTGTNONE 
J013055I03TACTGGGCCCACGTGTNONE 
J013057F12CCCCACGTGTNONE 
J013057F12TACTGGGCCCACGTGTNONE 
J023109A22CCCCACGTGTNONE 
J023109A22TACTGGGCCCACGTGTNONE 
J023148E09CCCCACGTGTNONE 
J023148E09TACTGGGCCCACGTGTNONE 
J033069G17CCCCACGTGTNONE 
J033069G17TACTGGGCCCACGTGTNONE 
J033092I18CCCCACGTGTNONE 
J033092I18TACTGGGCCCACGTGTNONE 
J033093C02CCCCACGTGTNONE 
J033093C02TACTGGGCCCACGTGTNONE 
J033141M17CCCCACGTGTNONE 
J033141M17TACTGGGCCCACGTGTNONE 
J043016M18CCCCACGTGTNONE 
J043016M18TACTGGGCCCACGTGTNONE 
J090016D12CCCCACGTGTNONE 
J090016D12TACTGGGCCCACGTGTNONE 
J090071B10CCCCACGTGTNONE 
J090071B10TACTGGGCCCACGTGTNONE 
J090098K07CCCCACGTGTNONE 
J090098K07TACTGGGCCCACGTGTNONE 
J100035K14CCCCACGTGTNONE 
J100035K14TACTGGGCCCACGTGTNONE 
Os07g0154900009-142-E09GGGGCCCACGTGGGCCCCACGTGTCNONE 
AK062969GGGGCCCACGTGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0166800006-038-C11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
012-080-F02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
AK070524CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCRad6 (Ubiquitin carrier protein). 
AK121382CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023022D19CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023055G02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023073E02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023125B08CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023127H21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033052G01CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033067F13CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065046L14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065178D11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065205N17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075006K17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075051D20CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075109L04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090024K15CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090025N04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090049N09CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090070N12CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090078O21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090083L07CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100063K16CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100083D14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
Os07g0176200AK062003CCACGTGTNONE 
J013048O08CCACGTGTNONE 
J013093K05CCACGTGTNONE 
J023075A11CCACGTGTNONE 
J033022L15CCACGTGTNONE 
J033123I21CCACGTGTNONE 
J065152L07CCACGTGTNONE 
J065195F21CCACGTGTNONE 
J090008P11CCACGTGTNONE 
J090011C01CCACGTGTNONE 
J090019H19CCACGTGTNONE 
J090043M15CCACGTGTNONE 
J100060I19CCACGTGTNONE 
J100072B03CCACGTGTNONE 
Os07g0179400015-011-G09CCACGTGTNONE 
AK073022CCACGTGTCytidyltransferase-related domain containing protein. 
J023149P22CCACGTGTNONE 
Os07g0209100AK120944GCCACGTGTCSimilar to Seed imbibition protein (Fragment). 
Os07g0241500AK107239CACGTCACCGACACGTGGGGCCCACCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J065065I20CACGTCACCGACACGTGGGGCCCACCCNONE 
J065158P15CACGTCACCGACACGTGGGGCCCACCCNONE 
J065167J16CACGTCACCGACACGTGGGGCCCACCCNONE 
J065183I01CACGTCACCGACACGTGGGGCCCACCCNONE 
J065187L18CACGTCACCGACACGTGGGGCCCACCCNONE 
J065205J10CACGTCACCGACACGTGGGGCCCACCCNONE 
Os07g0406800AK064087CGCCACGTGTNONE 
AK101812CGCCACGTGTEukaryotic-type DNA primase, large subunit family protein. 
Os07g0407350J065005B03ACACGTGGCGTGNONE 
J065058G23ACACGTGGCGTGNONE 
J065144A11ACACGTGGCGTGNONE 
J065175J02ACACGTGGCGTGConserved hypothetical protein. 
Os07g0459200AK066819CTCCCCCACGTGTCNONE 
AK102099CTCCCCCACGTGTCSimilar to Possible kinase. 
Os07g0467200009-103-G05ACACGTGGNONE 
009-109-G02ACACGTGGNONE 
AK070358ACACGTGGSimilar to Clone ZZD536 mRNA sequence. 
J100026N23ACACGTGGNONE 
J100038B09ACACGTGGNONE 
Os07g0474300AK108961CGCCACGTGTCCGGGCCCCConserved hypothetical protein. 
Os07g0486500AK063998CGGGCCCACGTGTCGRho GTPase activation protein domain containing protein. 
AK068175CGGGCCCACGTGTCGNONE 
J013130L24CGGGCCCACGTGTCGNONE 
J013156J03CGGGCCCACGTGTCGNONE 
J033031L21CGGGCCCACGTGTCGNONE 
J043001A20CGGGCCCACGTGTCGNONE 
J043007B17CGGGCCCACGTGTCGNONE 
J043017M19CGGGCCCACGTGTCGNONE 
J043024H09CGGGCCCACGTGTCGNONE 
J043030B12CGGGCCCACGTGTCGNONE 
J065177C18CGGGCCCACGTGTCGNONE 
J075004K10CGGGCCCACGTGTCGNONE 
J075004K12CGGGCCCACGTGTCGNONE 
J075088G07CGGGCCCACGTGTCGNONE 
J075107M02CGGGCCCACGTGTCGNONE 
J075126G01CGGGCCCACGTGTCGNONE 
J075185J08CGGGCCCACGTGTCGNONE 
J100034E04CGGGCCCACGTGTCGNONE 
J100038G12CGGGCCCACGTGTCGNONE 
Os07g0529600006-066-F05GACACGTGGNONE 
009-049-D10GACACGTGGNONE 
009-180-A06GACACGTGGNONE 
013-001-E04GACACGTGGNONE 
013-011-G03GACACGTGGNONE 
013-015-D04GACACGTGGNONE 
013-016-B02GACACGTGGNONE 
013-021-B11GACACGTGGNONE 
013-021-F07GACACGTGGNONE 
013-022-B02GACACGTGGNONE 
013-029-D10GACACGTGGNONE 
013-029-E04GACACGTGGNONE 
013-032-A07GACACGTGGNONE 
013-035-D07GACACGTGGNONE 
013-036-B03GACACGTGGNONE 
013-036-B10GACACGTGGNONE 
013-037-F08GACACGTGGNONE 
013-040-B02GACACGTGGNONE 
013-040-B10GACACGTGGNONE 
013-041-D07GACACGTGGNONE 
013-044-H10GACACGTGGNONE 
013-046-C06GACACGTGGNONE 
013-047-E03GACACGTGGNONE 
013-051-E06GACACGTGGNONE 
013-055-B07GACACGTGGNONE 
013-055-H04GACACGTGGNONE 
013-057-G06GACACGTGGNONE 
013-060-E04GACACGTGGNONE 
013-062-C07GACACGTGGNONE 
013-064-B11GACACGTGGNONE 
013-065-A09GACACGTGGNONE 
013-065-H03GACACGTGGNONE 
013-066-C07GACACGTGGNONE 
013-069-B03GACACGTGGNONE 
013-070-B08GACACGTGGNONE 
013-074-A03GACACGTGGNONE 
013-082-B08GACACGTGGNONE 
013-083-C10GACACGTGGNONE 
013-088-H12GACACGTGGNONE 
013-089-A10GACACGTGGNONE 
013-089-H06GACACGTGGNONE 
013-091-B09GACACGTGGNONE 
013-095-D09GACACGTGGNONE 
013-099-D03GACACGTGGNONE 
014-008-H04GACACGTGGNONE 
014-015-D12GACACGTGGNONE 
014-017-H12GACACGTGGNONE 
014-040-C05GACACGTGGNONE 
014-045-D07GACACGTGGNONE 
014-053-B03GACACGTGGNONE 
014-073-B05GACACGTGGNONE 
014-098-F10GACACGTGGNONE 
AB110170GACACGTGGNONE 
AK064916GACACGTGGNONE 
AK099918GACACGTGGSimilar to Thiazole biosynthetic enzyme 1-1, chloroplast precursor. 
J013000M17GACACGTGGNONE 
J013039J16GACACGTGGNONE 
J013055B12GACACGTGGNONE 
J013059A13GACACGTGGNONE 
J013060H05GACACGTGGNONE 
J013067A05GACACGTGGNONE 
J013071H11GACACGTGGNONE 
J013075I24GACACGTGGNONE 
J013102B09GACACGTGGNONE 
J013123E11GACACGTGGNONE 
J013123I22GACACGTGGNONE 
J013123L17GACACGTGGNONE 
J013156A11GACACGTGGNONE 
J013158K17GACACGTGGNONE 
J013160E19GACACGTGGNONE 
J023022F22GACACGTGGNONE 
J023045D15GACACGTGGNONE 
J023063E21GACACGTGGNONE 
J023078H19GACACGTGGNONE 
J023107E18GACACGTGGNONE 
J023107O16GACACGTGGNONE 
J023108B07GACACGTGGNONE 
J023113M14GACACGTGGNONE 
J023122K02GACACGTGGNONE 
J023134I12GACACGTGGNONE 
J033024O07GACACGTGGNONE 
J033045E09GACACGTGGNONE 
J033050O12GACACGTGGNONE 
J033052B16GACACGTGGNONE 
J033052F10GACACGTGGNONE 
J033052L07GACACGTGGNONE 
J033055D16GACACGTGGNONE 
J033093C13GACACGTGGNONE 
J033107I04GACACGTGGNONE 
J033122D23GACACGTGGNONE 
J043029H01GACACGTGGNONE 
J053043E04GACACGTGGNONE 
J053059G17GACACGTGGNONE 
J053069L11GACACGTGGNONE 
J053095I18GACACGTGGNONE 
J065035I11GACACGTGGNONE 
J065087P10GACACGTGGNONE 
J065124B14GACACGTGGNONE 
J065198E12GACACGTGGNONE 
J065210N22GACACGTGGNONE 
J065210P16GACACGTGGNONE 
J080309H11GACACGTGGNONE 
J080316C05GACACGTGGNONE 
J090039D18GACACGTGGNONE 
J090053F06GACACGTGGNONE 
J090084D01GACACGTGGNONE 
J090085K24GACACGTGGNONE 
J090096C10GACACGTGGNONE 
J090097N18GACACGTGGNONE 
J100045M09GACACGTGGNONE 
Os07g0557400AK065096CCACGTGTDelayed-early response protein/equilibrative nucleoside transporter family protein. 
J013001M14CCACGTGTNONE 
J075044F13CCACGTGTNONE 
J075107I08CCACGTGTNONE 
Os07g0558400003-103-C02CCACGTGTCNONE 
003-115-G05CCACGTGTCNONE 
006-025-B09CCACGTGTCNONE 
006-025-G10CCACGTGTCNONE 
006-027-E03CCACGTGTCNONE 
006-036-C06CCACGTGTCNONE 
006-045-B10CCACGTGTCNONE 
006-051-H11CCACGTGTCNONE 
006-053-H03CCACGTGTCNONE 
006-057-B09CCACGTGTCNONE 
006-062-C10CCACGTGTCNONE 
006-075-B12CCACGTGTCNONE 
006-079-F01CCACGTGTCNONE 
006-082-D08CCACGTGTCNONE 
006-087-F04CCACGTGTCNONE 
006-089-E09CCACGTGTCNONE 
006-090-C04CCACGTGTCNONE 
006-091-H05CCACGTGTCNONE 
006-093-E02CCACGTGTCNONE 
006-093-E06CCACGTGTCNONE 
006-093-H05CCACGTGTCNONE 
006-095-C05CCACGTGTCNONE 
006-097-B04CCACGTGTCNONE 
006-097-C07CCACGTGTCNONE 
006-097-D02CCACGTGTCNONE 
006-097-H10CCACGTGTCNONE 
006-098-C05CCACGTGTCNONE 
006-099-H09CCACGTGTCNONE 
006-104-B06CCACGTGTCNONE 
006-105-B11CCACGTGTCNONE 
006-106-E12CCACGTGTCNONE 
006-107-B06CCACGTGTCNONE 
006-109-A09CCACGTGTCNONE 
006-112-D05CCACGTGTCNONE 
006-118-C12CCACGTGTCNONE 
006-118-E10CCACGTGTCNONE 
006-120-D05CCACGTGTCNONE 
006-120-E08CCACGTGTCNONE 
009-055-D12CCACGTGTCNONE 
009-108-E05CCACGTGTCNONE 
009-125-H05CCACGTGTCNONE 
009-150-A07CCACGTGTCNONE 
009-198-C07CCACGTGTCNONE 
AF058796CCACGTGTCNONE 
AK058293CCACGTGTCNONE 
AK098992CCACGTGTCNONE 
AK103924CCACGTGTCNONE 
AK104309CCACGTGTCNONE 
AK104619CCACGTGTCNONE 
AK119534CCACGTGTCSimilar to Chlorophyll a/b-binding protein CP29 precursor. 
J013098H13CCACGTGTCNONE 
J043039O11CCACGTGTCNONE 
J065176D03CCACGTGTCNONE 
J075022K10CCACGTGTCNONE 
J075065A02CCACGTGTCNONE 
J075077D23CCACGTGTCNONE 
J075088P15CCACGTGTCNONE 
J075125D24CCACGTGTCNONE 
J075125H11CCACGTGTCNONE 
J075192H21CCACGTGTCNONE 
J090080H18CCACGTGTCNONE 
Os07g0558500AK064914GGACACGTGGCGInositol phosphatase-like protein. 
AY224446GGACACGTGGCGNONE 
J013000M13GGACACGTGGCGNONE 
Os07g0615900AK066317ACACGTGGCZinc finger, GATA-type domain containing protein. 
AK073803ACACGTGGCNONE 
J013026A07ACACGTGGCNONE 
J013064I12ACACGTGGCNONE 
J033068D01ACACGTGGCNONE 
J033074A10ACACGTGGCNONE 
J033129C06ACACGTGGCNONE 
J100035K20ACACGTGGCNONE 
J100044G13ACACGTGGCNONE 
J100050K01ACACGTGGCNONE 
J100069P20ACACGTGGCNONE 
J100071O09ACACGTGGCNONE 
J100086K01ACACGTGGCNONE 
J100089G11ACACGTGGCNONE 
Os07g0623600AK063642TGCGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0633400AK071894CGCCACGTGTIQ calmodulin-binding region domain containing protein. 
Os07g0659500AK073537GACACGTGGGCCCCACCNon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0679300AK065079GCCACGTGTNONE 
AK099229GCCACGTGTSimilar to Alpha-galactosidase precursor (EC 3.2.1.22) (Melibiase) (Alpha-D- galactoside galactohydrolase). 
J013033F05GCCACGTGTNONE 
J013049N18GCCACGTGTNONE 
J013071C14GCCACGTGTNONE 
J013088P15GCCACGTGTNONE 
J013092D24GCCACGTGTNONE 
J013093O14GCCACGTGTNONE 
J023095E17GCCACGTGTNONE 
J043005E21GCCACGTGTNONE 
J043015E06GCCACGTGTNONE 
J043027P22GCCACGTGTNONE 
J065038B15GCCACGTGTNONE 
J065073M21GCCACGTGTNONE 
J065165P06GCCACGTGTNONE 
J065198I06GCCACGTGTNONE 
J075007E08GCCACGTGTNONE 
J075038I07GCCACGTGTNONE 
J075130L20GCCACGTGTNONE 
J090057G17GCCACGTGTNONE 
J100029K23GCCACGTGTNONE 
J100086O16GCCACGTGTNONE 
J100087M02GCCACGTGTNONE 
Os07g0695100AB189039GGACACGTGGGNONE 
AB189042GGACACGTGGGNONE 
AK059514GGACACGTGGGNONE 
AK066112GGACACGTGGGCheY-like domain containing protein. 
J013051N02GGACACGTGGGNONE 
J013127M02GGACACGTGGGNONE 
J023007I05GGACACGTGGGNONE 
Os08g0122700AK111089GGACGGACCCACGTGTCConserved hypothetical protein. 
Os08g0128200AK120428CACGCCACGTGTCCConserved hypothetical protein. 
Os08g0167800J065081J23ACACGTGGTerpenoid cylases/protein prenyltransferase alpha-alpha toroid domain containing protein. 
J065143E14ACACGTGGNONE 
J065165C22ACACGTGGNONE 
J075082K17ACACGTGGNONE 
J075131I20ACACGTGGNONE 
J075157K22ACACGTGGNONE 
J075171E13ACACGTGGNONE 
Os08g0183900J043001P15CCACGTGTNONE 
J065080M03CCACGTGTNONE 
J065215I09CCACGTGTNAD-dependent epimerase/dehydratase family protein. 
Os08g0191900AK067587GCCCACACGTGGCProtein prenyltransferase domain containing protein. 
AK099016GCCCACACGTGGCNONE 
J013032I08GCCCACACGTGGCNONE 
J013050I24GCCCACACGTGGCNONE 
J013128E05GCCCACACGTGGCNONE 
Os08g0192800AK059490CGCCACGTGTCGNONE 
AK101678CGCCACGTGTCGNONE 
AK120613CGCCACGTGTCGBromodomain containing protein. 
J080039B22CGCCACGTGTCGNONE 
J080039I23CGCCACGTGTCGNONE 
J080074D19CGCCACGTGTCGNONE 
J080086N13CGCCACGTGTCGNONE 
Os08g0238200006-021-D04GCCACGTGTNONE 
006-049-C01GCCACGTGTNONE 
006-062-D11GCCACGTGTNONE 
006-078-D06GCCACGTGTNONE 
006-115-G09GCCACGTGTNONE 
009-166-B07GCCACGTGTNONE 
AK067264GCCACGTGTDienelactone hydrolase domain containing protein. 
AK104922GCCACGTGTNONE 
Os08g0249000AK109938CCACGTGTCCZinc finger, B-box domain containing protein. 
Os08g0282400AK100935CCACGTGTSimilar to Alpha-SNAP (Fragment). 
Os08g0290500004-010-C07GGCCGTCCACGTGTCCNONE 
009-111-A08GGCCGTCCACGTGTCCNONE 
011-046-F10GGCCGTCCACGTGTCCNONE 
AK066894GGCCGTCCACGTGTCCNONE 
AK067122GGCCGTCCACGTGTCCNONE 
AK102868GGCCGTCCACGTGTCCSimilar to AF-10 protein. 
J013089O21GGCCGTCCACGTGTCCNONE 
J033072D17GGCCGTCCACGTGTCCNONE 
J033095M14GGCCGTCCACGTGTCCNONE 
J033111N23GGCCGTCCACGTGTCCNONE 
J043024M17GGCCGTCCACGTGTCCNONE 
J065176I24GGCCGTCCACGTGTCCNONE 
J090035C05GGCCGTCCACGTGTCCNONE 
Os08g0360100AK066365ACACGTGGGTCCCACCRS1/YhbY domain containing protein. 
Os08g0398000AK101910CACTGACACGTGGGCCCCACAABC transporter related domain containing protein. 
Os08g0398700AK120068ACACGTGGCGPeptidase M1, membrane alanine aminopeptidase family protein. 
Os08g0425100AK069134CCACGTGTCCDynamin family protein. 
AK072791CCACGTGTCCNONE 
Os08g0425800009-168-F06GCCACGTGTCAGTGGNONE 
AK061339GCCACGTGTCAGTGGConserved hypothetical protein. 
AK101198GCCACGTGTCAGTGGNONE 
J033030L06GCCACGTGTCAGTGGNONE 
J100036D08GCCACGTGTCAGTGGNONE 
J100052I22GCCACGTGTCAGTGGNONE 
Os08g0440500AK058761ACACGTGGMIR domain containing protein. 
Os08g0473650J065031A07AATTGGGCCCACGTGTCHypothetical protein. 
J065129E01AATTGGGCCCACGTGTCNONE 
J065134I05AATTGGGCCCACGTGTCNONE 
J065212K13AATTGGGCCCACGTGTCNONE 
J065217M14AATTGGGCCCACGTGTCNONE 
Os08g0481500J065054C23CCACGTGTCCConserved hypothetical protein. 
J065218E06CCACGTGTCCNONE 
Os08g0519600012-027-B02GACACGTGGGNONE 
AK072374GACACGTGGGNONE 
AK105273GACACGTGGGProtein of unknown function DUF1666 family protein. 
Os08g0521600AK108208CGCCACGTGTCCSimilar to Dehydration responsive element binding protein 2C (DREB2C protein). 
AK108208GGACACGTGGCSimilar to Dehydration responsive element binding protein 2C (DREB2C protein). 
Os08g0531900AY177701CGACACGTGGSimilar to MADS box transcription factor-like protein (MADS-box protein AGL72). 
J090094F15CGACACGTGGNONE 
Os08g0532300009-122-A05CGACACGTGGCNONE 
009-129-H05CGACACGTGGCNONE 
AB011262CGACACGTGGCNONE 
AK065141CGACACGTGGCNONE 
AK119730CGACACGTGGCSimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14CGACACGTGGCNONE 
J013042K23CGACACGTGGCNONE 
J023057J08CGACACGTGGCNONE 
J023057N10CGACACGTGGCNONE 
J023113C21CGACACGTGGCNONE 
J053054E03CGACACGTGGCNONE 
J053062B07CGACACGTGGCNONE 
J053075O17CGACACGTGGCNONE 
J053075P09CGACACGTGGCNONE 
J065024H05CGACACGTGGCNONE 
J065049F22CGACACGTGGCNONE 
J065063L03CGACACGTGGCNONE 
J065102O07CGACACGTGGCNONE 
J065104M12CGACACGTGGCNONE 
J065119E04CGACACGTGGCNONE 
J065153E10CGACACGTGGCNONE 
J065168M24CGACACGTGGCNONE 
J065173I10CGACACGTGGCNONE 
J065181L04CGACACGTGGCNONE 
J065184I18CGACACGTGGCNONE 
J065203M15CGACACGTGGCNONE 
J075004C21CGACACGTGGCNONE 
J075047B11CGACACGTGGCNONE 
J075055F18CGACACGTGGCNONE 
J075065G09CGACACGTGGCNONE 
J075094O14CGACACGTGGCNONE 
J075143C22CGACACGTGGCNONE 
J075153K18CGACACGTGGCNONE 
J075164N10CGACACGTGGCNONE 
J075197C11CGACACGTGGCNONE 
J080001A01CGACACGTGGCNONE 
J080003B11CGACACGTGGCNONE 
J080006G17CGACACGTGGCNONE 
J080007J06CGACACGTGGCNONE 
J080010H12CGACACGTGGCNONE 
J080014I01CGACACGTGGCNONE 
J080015C16CGACACGTGGCNONE 
J080016P19CGACACGTGGCNONE 
J080020G24CGACACGTGGCNONE 
J080021E12CGACACGTGGCNONE 
J080023I11CGACACGTGGCNONE 
J080024H24CGACACGTGGCNONE 
J080025G18CGACACGTGGCNONE 
J080028H08CGACACGTGGCNONE 
J080030G08CGACACGTGGCNONE 
J080031H20CGACACGTGGCNONE 
J080034C20CGACACGTGGCNONE 
J080040H13CGACACGTGGCNONE 
J080044M04CGACACGTGGCNONE 
J080047D02CGACACGTGGCNONE 
J080049D17CGACACGTGGCNONE 
J080049J17CGACACGTGGCNONE 
J080050A05CGACACGTGGCNONE 
J080051C11CGACACGTGGCNONE 
J080051K06CGACACGTGGCNONE 
J080053A07CGACACGTGGCNONE 
J080053I08CGACACGTGGCNONE 
J080056L12CGACACGTGGCNONE 
J080061I19CGACACGTGGCNONE 
J080075G09CGACACGTGGCNONE 
J080078C23CGACACGTGGCNONE 
J080080I21CGACACGTGGCNONE 
J080084F04CGACACGTGGCNONE 
J080085K16CGACACGTGGCNONE 
J080097A12CGACACGTGGCNONE 
J080097N01CGACACGTGGCNONE 
J090027L10CGACACGTGGCNONE 
J100034N17CGACACGTGGCNONE 
Os08g0532400AK101608GCCACGTGTCGSimilar to AT.I.24-7 protein. 
Os08g0541400003-128-C08AGTGACACGTGGACCNONE 
AK068255AGTGACACGTGGACCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
AK104009AGTGACACGTGGACCNONE 
J013129J12AGTGACACGTGGACCNONE 
J013149F15AGTGACACGTGGACCNONE 
J065187N18AGTGACACGTGGACCNONE 
Os08g0558200AK069761CCCACGTGTGlutathione S-transferase, N-terminal domain containing protein. 
J013041N12CCCACGTGTNONE 
J013093H08CCCACGTGTNONE 
J023020B17CCCACGTGTNONE 
J023028D17CCCACGTGTNONE 
J023039B10CCCACGTGTNONE 
J065045O11CCCACGTGTNONE 
J065206N10CCCACGTGTNONE 
J075032G11CCCACGTGTNONE 
J075037C22CCCACGTGTNONE 
J075074J23CCCACGTGTNONE 
J090023A08CCCACGTGTNONE 
J090028N16CCCACGTGTNONE 
J100081G01CCCACGTGTNONE 
Os09g0243200AK107718ACACGTGGCGZinc finger, RING-type domain containing protein. 
Os09g0296800AK066997CGCCACGTGTCCGTCCCACCChlorophyll A-B binding protein family protein. 
Os09g0380600014-022-G08ACACGTGGNONE 
AK063655ACACGTGGConserved hypothetical protein. 
Os09g0412900014-003-F10GACACGTGGGTCCCACNONE 
AK102254GACACGTGGGTCCCACProtein prenyltransferase domain containing protein. 
AK102867GACACGTGGGTCCCACNONE 
J033088H22GACACGTGGGTCCCACNONE 
Os09g0456900AK073236GCCACGTGTNucleic acid-binding, OB-fold domain containing protein. 
Os09g0465500AK109671ACACGTGGCCGTCCConserved hypothetical protein. 
AK109671GACACGTGGConserved hypothetical protein. 
Os09g0482740006-098-F12GTCCGTCCACGTGTNONE 
AK061852GTCCGTCCACGTGTProtein of unknown function DUF1664 family protein. 
J013032I17GTCCGTCCACGTGTNONE 
J013119L22GTCCGTCCACGTGTNONE 
J065114C06GTCCGTCCACGTGTNONE 
J090059O06GTCCGTCCACGTGTNONE 
J090062K09GTCCGTCCACGTGTNONE 
J100031O03GTCCGTCCACGTGTNONE 
J100038P06GTCCGTCCACGTGTNONE 
J100051M18GTCCGTCCACGTGTNONE 
J100075H20GTCCGTCCACGTGTNONE 
J100077O11GTCCGTCCACGTGTNONE 
Os09g0525600012-072-G03ACACGTGGNONE 
AK063524ACACGTGGNONE 
AK103370ACACGTGGUBA-like domain containing protein. 
J065039M02ACACGTGGNONE 
J065040J02ACACGTGGNONE 
J065101G01ACACGTGGNONE 
J065110D08ACACGTGGNONE 
J065144H13ACACGTGGNONE 
J065169K22ACACGTGGNONE 
J065180A05ACACGTGGNONE 
J065218G22ACACGTGGNONE 
Os09g0553200003-101-F12CGCCACGTGTCCNONE 
003-125-E09CGCCACGTGTCCNONE 
011-031-H12CGCCACGTGTCCNONE 
012-033-A01CGCCACGTGTCCNONE 
015-046-H04CGCCACGTGTCCNONE 
015-056-F04CGCCACGTGTCCNONE 
016-029-H06CGCCACGTGTCCNONE 
016-080-D05CGCCACGTGTCCNONE 
AB062606CGCCACGTGTCCNONE 
AK065780CGCCACGTGTCCSimilar to UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) (UDP-glucose pyrophosphorylase) (UDPGP) (UGPase). 
AK103930CGCCACGTGTCCNONE 
AK104344CGCCACGTGTCCNONE 
AK119197CGCCACGTGTCCNONE 
AK119232CGCCACGTGTCCNONE 
J013039M01CGCCACGTGTCCNONE 
J013043M01CGCCACGTGTCCNONE 
J013064F03CGCCACGTGTCCNONE 
J013066K19CGCCACGTGTCCNONE 
J013092G12CGCCACGTGTCCNONE 
J013123P09CGCCACGTGTCCNONE 
J013155F01CGCCACGTGTCCNONE 
J013158J12CGCCACGTGTCCNONE 
J013159H14CGCCACGTGTCCNONE 
J013169C10CGCCACGTGTCCNONE 
J013170L23CGCCACGTGTCCNONE 
J023010J18CGCCACGTGTCCNONE 
J023019E23CGCCACGTGTCCNONE 
J023045B14CGCCACGTGTCCNONE 
J023082K24CGCCACGTGTCCNONE 
J023086G04CGCCACGTGTCCNONE 
J023090N09CGCCACGTGTCCNONE 
J023113C08CGCCACGTGTCCNONE 
J023125H18CGCCACGTGTCCNONE 
J033034M08CGCCACGTGTCCNONE 
J033035K03CGCCACGTGTCCNONE 
J033039D15CGCCACGTGTCCNONE 
J033045P18CGCCACGTGTCCNONE 
J033058P08CGCCACGTGTCCNONE 
J033061D16CGCCACGTGTCCNONE 
J033070F14CGCCACGTGTCCNONE 
J033086F23CGCCACGTGTCCNONE 
J033095C05CGCCACGTGTCCNONE 
J033114H22CGCCACGTGTCCNONE 
J033133M20CGCCACGTGTCCNONE 
J043026G01CGCCACGTGTCCNONE 
J043037F17CGCCACGTGTCCNONE 
J065120K17CGCCACGTGTCCNONE 
J065123O07CGCCACGTGTCCNONE 
J080305H06CGCCACGTGTCCNONE 
J090001F11CGCCACGTGTCCNONE 
J090020C17CGCCACGTGTCCNONE 
J090043A19CGCCACGTGTCCNONE 
J090051J17CGCCACGTGTCCNONE 
J090068K06CGCCACGTGTCCNONE 
J090075P19CGCCACGTGTCCNONE 
J100036G10CGCCACGTGTCCNONE 
J100084F02CGCCACGTGTCCNONE 
Os09g0565400AK067821GACACGTGGLipoprotein, type 6 family protein. 
Os11g0106700006-055-F11CCACGTGTGGCCCATCCNONE 
006-099-D08CCACGTGTGGCCCATCCNONE 
009-155-A12CCACGTGTGGCCCATCCNONE 
AF519570CCACGTGTGGCCCATCCNONE 
AK059354CCACGTGTGGCCCATCCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0118200AK105536GTGGGACCCACGTGTCGHypothetical protein. 
Os11g0131900AK065240CCCACGTGTSimilar to Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II. 
Os11g0159000AK065738CCACTGACACGTGGGTCCCACConserved hypothetical protein. 
Os11g0180000006-025-E11CGCCACGTGTCGNONE 
006-044-A07CGCCACGTGTCGNONE 
AK060077CGCCACGTGTCGPlant disease resistance response protein family protein. 
Os11g0181700006-062-E12AGCCGTCCACGTGTCNONE 
006-072-B05AGCCGTCCACGTGTCNONE 
006-118-G08AGCCGTCCACGTGTCNONE 
009-068-A10AGCCGTCCACGTGTCNONE 
AK062546AGCCGTCCACGTGTCSimilar to Short-chain dehydrogenase Tic32. 
AK065928AGCCGTCCACGTGTCNONE 
Os11g0229100AK105557TGGGACCCACGTGTConserved hypothetical protein. 
Os11g0244800AK103215GTGGGCCCCACGTGTCSimilar to Alfin-1. 
J065009E13GTGGGCCCCACGTGTCNONE 
J065027D16GTGGGCCCCACGTGTCNONE 
J065085B06GTGGGCCCCACGTGTCNONE 
J065180O17GTGGGCCCCACGTGTCNONE 
J090010C16GTGGGCCCCACGTGTCNONE 
J090039K20GTGGGCCCCACGTGTCNONE 
Os11g0291500AK108558ACACGTGGCGTGSimilar to Beta-D-xylosidase. 
Os11g0297300AK070171GACACGTGGCSimilar to Beta-D-xylosidase. 
Os11g0417700J075031P16CGACACGTGGCConserved hypothetical protein. 
J075034C16CGACACGTGGCNONE 
J075034J22CGACACGTGGCNONE 
J075042C07CGACACGTGGCNONE 
J075046O07CGACACGTGGCNONE 
J075062O13CGACACGTGGCNONE 
J075091G08CGACACGTGGCNONE 
J075135H20CGACACGTGGCNONE 
J075172B13CGACACGTGGCNONE 
J075179G14CGACACGTGGCNONE 
Os11g0501000AK109615CGCCACGTGTCConserved hypothetical protein. 
Os11g0525200011-005-B12ACACGTGGNONE 
012-006-A10ACACGTGGNONE 
012-093-G03ACACGTGGNONE 
014-088-E05ACACGTGGNONE 
015-100-F08ACACGTGGNONE 
AB025047ACACGTGGNONE 
AK060487ACACGTGGNONE 
AK121491ACACGTGGSimilar to Cytochrome P450 51 (EC 1.14.13.70) (CYPLI) (P450-LIA1) (Obtusifoliol 14-alpha demethylase) (Fragment). 
J013130H02ACACGTGGNONE 
J013158G17ACACGTGGNONE 
J023063C20ACACGTGGNONE 
J023079N18ACACGTGGNONE 
J023082P17ACACGTGGNONE 
J023086I09ACACGTGGNONE 
J023112D17ACACGTGGNONE 
J023121B06ACACGTGGNONE 
J023122G16ACACGTGGNONE 
J023147J07ACACGTGGNONE 
J023150P16ACACGTGGNONE 
J033076I22ACACGTGGNONE 
J033129I15ACACGTGGNONE 
J075155F06ACACGTGGNONE 
J075163E02ACACGTGGNONE 
J075168H23ACACGTGGNONE 
J100022M11ACACGTGGNONE 
Os11g0533400014-020-B08CGCCACGTGTCNONE 
AK063652CGCCACGTGTCConserved hypothetical protein. 
Os11g0536900J100027G18CCACGTGTConserved hypothetical protein. 
J100027G18GCCACGTGTCCConserved hypothetical protein. 
J100073G12CCACGTGTNONE 
J100073G12GCCACGTGTCCNONE 
Os11g0615700AB026561ACACGTGGGCCCGCANONE 
AK059521ACACGTGGGCCCGCANONE 
AK103487ACACGTGGGCCCGCAProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14ACACGTGGGCCCGCANONE 
J065044A11ACACGTGGGCCCGCANONE 
J065090I02ACACGTGGGCCCGCANONE 
J065104I09ACACGTGGGCCCGCANONE 
J065187J10ACACGTGGGCCCGCANONE 
J075024E07ACACGTGGGCCCGCANONE 
J075025O13ACACGTGGGCCCGCANONE 
J090062N12ACACGTGGGCCCGCANONE 
J090087G06ACACGTGGGCCCGCANONE 
J090098K11ACACGTGGGCCCGCANONE 
Os11g0648000AK066444GACACGTGGSimilar to Na+/H+ antiporter. 
AK072026GACACGTGGNONE 
Os11g0707000003-106-C01CGCCACGTGTNONE 
003-130-G06CGCCACGTGTNONE 
005-012-E05CGCCACGTGTNONE 
006-021-F04CGCCACGTGTNONE 
006-031-E07CGCCACGTGTNONE 
006-035-C03CGCCACGTGTNONE 
006-038-D10CGCCACGTGTNONE 
006-043-A10CGCCACGTGTNONE 
006-043-G08CGCCACGTGTNONE 
006-046-C03CGCCACGTGTNONE 
006-055-G09CGCCACGTGTNONE 
006-085-A03CGCCACGTGTNONE 
006-118-E05CGCCACGTGTNONE 
AB034698CGCCACGTGTNONE 
AB034748CGCCACGTGTNONE 
AB110180CGCCACGTGTNONE 
AK060841CGCCACGTGTNONE 
AK060847CGCCACGTGTNONE 
AK064986CGCCACGTGTNONE 
AK104332CGCCACGTGTSimilar to Ribulose-bisphosphate carboxylase activase (EC 6.3.4.-) (Fragments). 
AK119513CGCCACGTGTNONE 
J013001C24CGCCACGTGTNONE 
J013024I02CGCCACGTGTNONE 
J013044O11CGCCACGTGTNONE 
J013048O10CGCCACGTGTNONE 
J013051A08CGCCACGTGTNONE 
J013055H23CGCCACGTGTNONE 
J013070N15CGCCACGTGTNONE 
J013074C16CGCCACGTGTNONE 
J013096P16CGCCACGTGTNONE 
J013109A14CGCCACGTGTNONE 
J013112C07CGCCACGTGTNONE 
J013112N16CGCCACGTGTNONE 
J013123B03CGCCACGTGTNONE 
J013128G01CGCCACGTGTNONE 
J013132L17CGCCACGTGTNONE 
J013158I17CGCCACGTGTNONE 
J013159L01CGCCACGTGTNONE 
J023001H04CGCCACGTGTNONE 
J023004L05CGCCACGTGTNONE 
J023013G12CGCCACGTGTNONE 
J023020K06CGCCACGTGTNONE 
J023031J19CGCCACGTGTNONE 
J023034A05CGCCACGTGTNONE 
J023034E21CGCCACGTGTNONE 
J023041M12CGCCACGTGTNONE 
J023041P06CGCCACGTGTNONE 
J023044C04CGCCACGTGTNONE 
J023047H01CGCCACGTGTNONE 
J023048D08CGCCACGTGTNONE 
J023052H08CGCCACGTGTNONE 
J023054D24CGCCACGTGTNONE 
J023063G11CGCCACGTGTNONE 
J023068O21CGCCACGTGTNONE 
J023074C13CGCCACGTGTNONE 
J023078O06CGCCACGTGTNONE 
J023089K10CGCCACGTGTNONE 
J023100O05CGCCACGTGTNONE 
J023107N16CGCCACGTGTNONE 
J023120L08CGCCACGTGTNONE 
J023123N23CGCCACGTGTNONE 
J023127M10CGCCACGTGTNONE 
J023128C22CGCCACGTGTNONE 
J023129C04CGCCACGTGTNONE 
J023146H08CGCCACGTGTNONE 
J053063N05CGCCACGTGTNONE 
J053066F02CGCCACGTGTNONE 
J053066N18CGCCACGTGTNONE 
J053076G01CGCCACGTGTNONE 
J065012O05CGCCACGTGTNONE 
J065035L06CGCCACGTGTNONE 
J065037M01CGCCACGTGTNONE 
J065045N23CGCCACGTGTNONE 
J065058F09CGCCACGTGTNONE 
J065072E14CGCCACGTGTNONE 
J065073I20CGCCACGTGTNONE 
J065076B05CGCCACGTGTNONE 
J065093B09CGCCACGTGTNONE 
J065117A22CGCCACGTGTNONE 
J065149J21CGCCACGTGTNONE 
J065155M04CGCCACGTGTNONE 
J065161J21CGCCACGTGTNONE 
J065163H19CGCCACGTGTNONE 
J065192A15CGCCACGTGTNONE 
J065211L18CGCCACGTGTNONE 
J075001K13CGCCACGTGTNONE 
J075002J24CGCCACGTGTNONE 
J075004N18CGCCACGTGTNONE 
J075025H21CGCCACGTGTNONE 
J075028F20CGCCACGTGTNONE 
J075039F23CGCCACGTGTNONE 
J075043M08CGCCACGTGTNONE 
J075057D02CGCCACGTGTNONE 
J075059I01CGCCACGTGTNONE 
J075069P10CGCCACGTGTNONE 
J075073D08CGCCACGTGTNONE 
J075084I17CGCCACGTGTNONE 
J075089I04CGCCACGTGTNONE 
J075093O18CGCCACGTGTNONE 
J075097N13CGCCACGTGTNONE 
J075114B02CGCCACGTGTNONE 
J075123E10CGCCACGTGTNONE 
J075128C19CGCCACGTGTNONE 
J075135F05CGCCACGTGTNONE 
J075136A04CGCCACGTGTNONE 
J075141B05CGCCACGTGTNONE 
J075169H18CGCCACGTGTNONE 
J075183L14CGCCACGTGTNONE 
J075191N03CGCCACGTGTNONE 
J080001C11CGCCACGTGTNONE 
J080004F18CGCCACGTGTNONE 
J080004H21CGCCACGTGTNONE 
J080004O09CGCCACGTGTNONE 
J080005J02CGCCACGTGTNONE 
J080006I03CGCCACGTGTNONE 
J080006J17CGCCACGTGTNONE 
J080009I09CGCCACGTGTNONE 
J080010I06CGCCACGTGTNONE 
J080011A17CGCCACGTGTNONE 
J080014N22CGCCACGTGTNONE 
J080016E24CGCCACGTGTNONE 
J080016P08CGCCACGTGTNONE 
J080017G22CGCCACGTGTNONE 
J080017P09CGCCACGTGTNONE 
J080018D23CGCCACGTGTNONE 
J080018E15CGCCACGTGTNONE 
J080020K04CGCCACGTGTNONE 
J080024P09CGCCACGTGTNONE 
J080025G15CGCCACGTGTNONE 
J080025N11CGCCACGTGTNONE 
J080026H10CGCCACGTGTNONE 
J080026N06CGCCACGTGTNONE 
J080027C07CGCCACGTGTNONE 
J080027M21CGCCACGTGTNONE 
J080028I03CGCCACGTGTNONE 
J080028K11CGCCACGTGTNONE 
J080029B19CGCCACGTGTNONE 
J080029G14CGCCACGTGTNONE 
J080029G20CGCCACGTGTNONE 
J080030A16CGCCACGTGTNONE 
J080031C05CGCCACGTGTNONE 
J080033M16CGCCACGTGTNONE 
J080034C24CGCCACGTGTNONE 
J080034F11CGCCACGTGTNONE 
J080036B03CGCCACGTGTNONE 
J080036C14CGCCACGTGTNONE 
J080037C01CGCCACGTGTNONE 
J080038M20CGCCACGTGTNONE 
J080039K03CGCCACGTGTNONE 
J080040M24CGCCACGTGTNONE 
J080040P19CGCCACGTGTNONE 
J080042L24CGCCACGTGTNONE 
J080042O06CGCCACGTGTNONE 
J080043A22CGCCACGTGTNONE 
J080043N19CGCCACGTGTNONE 
J080044A18CGCCACGTGTNONE 
J080044P14CGCCACGTGTNONE 
J080045K12CGCCACGTGTNONE 
J080045N16CGCCACGTGTNONE 
J080047A16CGCCACGTGTNONE 
J080047B09CGCCACGTGTNONE 
J080047E08CGCCACGTGTNONE 
J080047G06CGCCACGTGTNONE 
J080048H04CGCCACGTGTNONE 
J080049B17CGCCACGTGTNONE 
J080049D05CGCCACGTGTNONE 
J080049G23CGCCACGTGTNONE 
J080050D03CGCCACGTGTNONE 
J080050J24CGCCACGTGTNONE 
J080050O20CGCCACGTGTNONE 
J080052E24CGCCACGTGTNONE 
J080052K11CGCCACGTGTNONE 
J080053B04CGCCACGTGTNONE 
J080053D20CGCCACGTGTNONE 
J080053E16CGCCACGTGTNONE 
J080054H20CGCCACGTGTNONE 
J080054H22CGCCACGTGTNONE 
J080054N24CGCCACGTGTNONE 
J080055H08CGCCACGTGTNONE 
J080056H08CGCCACGTGTNONE 
J080056H12CGCCACGTGTNONE 
J080057N11CGCCACGTGTNONE 
J080058D08CGCCACGTGTNONE 
J080058D21CGCCACGTGTNONE 
J080058E10CGCCACGTGTNONE 
J080060J10CGCCACGTGTNONE 
J080061O04CGCCACGTGTNONE 
J080065M18CGCCACGTGTNONE 
J080066D15CGCCACGTGTNONE 
J080067E22CGCCACGTGTNONE 
J080067N20CGCCACGTGTNONE 
J080068F02CGCCACGTGTNONE 
J080069G20CGCCACGTGTNONE 
J080069O13CGCCACGTGTNONE 
J080070I20CGCCACGTGTNONE 
J080071H11CGCCACGTGTNONE 
J080071H17CGCCACGTGTNONE 
J080071O18CGCCACGTGTNONE 
J080077G14CGCCACGTGTNONE 
J080077H17CGCCACGTGTNONE 
J080078B18CGCCACGTGTNONE 
J080078D24CGCCACGTGTNONE 
J080079H02CGCCACGTGTNONE 
J080079J02CGCCACGTGTNONE 
J080081O20CGCCACGTGTNONE 
J080082E02CGCCACGTGTNONE 
J080082N12CGCCACGTGTNONE 
J080084E18CGCCACGTGTNONE 
J080085P08CGCCACGTGTNONE 
J080086B21CGCCACGTGTNONE 
J080086L10CGCCACGTGTNONE 
J080086L18CGCCACGTGTNONE 
J080087D12CGCCACGTGTNONE 
J080087E24CGCCACGTGTNONE 
J080087G12CGCCACGTGTNONE 
J080088J22CGCCACGTGTNONE 
J080090C18CGCCACGTGTNONE 
J080090L02CGCCACGTGTNONE 
J080092N05CGCCACGTGTNONE 
J080092P20CGCCACGTGTNONE 
J080094D15CGCCACGTGTNONE 
J080095A11CGCCACGTGTNONE 
J080095K13CGCCACGTGTNONE 
J080096L16CGCCACGTGTNONE 
J080097F16CGCCACGTGTNONE 
J080305J21CGCCACGTGTNONE 
J080308I22CGCCACGTGTNONE 
J080310E21CGCCACGTGTNONE 
J080310G09CGCCACGTGTNONE 
J090032M14CGCCACGTGTNONE 
J090045I12CGCCACGTGTNONE 
J090076M15CGCCACGTGTNONE 
J090088C17CGCCACGTGTNONE 
J090094B06CGCCACGTGTNONE 
U74321CGCCACGTGTNONE 
Os12g0102100J013134H02GCCACGTGTAlcohol dehydrogenase superfamily, zinc-containing protein. 
Os12g0106000AF370029CCACGTGTGGCCCATCCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
AF519571CCACGTGTGGCCCATCCNONE 
AK102242CCACGTGTGGCCCATCCNONE 
AY324879CCACGTGTGGCCCATCCNONE 
J053063M21CCACGTGTGGCCCATCCNONE 
J090080A16CCACGTGTGGCCCATCCNONE 
Os12g0156400012-065-D02ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK072086ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK099278ACAGCCCACACGTGGCCGTGGGCCCCDcp1-like decapping family protein. 
J013063H09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023125D09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023149G21ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033064E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033093C07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033107E06ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J075172A11ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090009E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090023F13ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090071N18ACAGCCCACACGTGGCCGTGGGCCCCNONE 
Os12g0242500J065129F10AGTGACACGTGGGCCTCNONE 
J065129F10CGCCACGTGTNONE 
J090032G12AGTGACACGTGGGCCTCConserved hypothetical protein. 
J090032G12CGCCACGTGTConserved hypothetical protein. 
Os12g0285600AK069104CGACACGTGGGCCATOxysterol-binding protein family protein. 
Os12g0291100013-021-D10CGACACGTGGCNONE 
013-038-B12CGACACGTGGCNONE 
AK068555CGACACGTGGCSimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
AY445627CGACACGTGGCNONE 
D00644CGACACGTGGCNONE 
J013156H12CGACACGTGGCNONE 
J023122F15CGACACGTGGCNONE 
J065001F13CGACACGTGGCNONE 
J065001O16CGACACGTGGCNONE 
J065006D15CGACACGTGGCNONE 
J065008I17CGACACGTGGCNONE 
J065008N22CGACACGTGGCNONE 
J065010K05CGACACGTGGCNONE 
J065015G11CGACACGTGGCNONE 
J065019H21CGACACGTGGCNONE 
J065020N17CGACACGTGGCNONE 
J065024O18CGACACGTGGCNONE 
J065025A04CGACACGTGGCNONE 
J065026I06CGACACGTGGCNONE 
J065028C06CGACACGTGGCNONE 
J065029C01CGACACGTGGCNONE 
J065029C06CGACACGTGGCNONE 
J065029D16CGACACGTGGCNONE 
J065029E02CGACACGTGGCNONE 
J065030P11CGACACGTGGCNONE 
J065032M13CGACACGTGGCNONE 
J065034C06CGACACGTGGCNONE 
J065037H24CGACACGTGGCNONE 
J065037O14CGACACGTGGCNONE 
J065038A12CGACACGTGGCNONE 
J065043A05CGACACGTGGCNONE 
J065046C06CGACACGTGGCNONE 
J065046D22CGACACGTGGCNONE 
J065048C14CGACACGTGGCNONE 
J065048D24CGACACGTGGCNONE 
J065049F19CGACACGTGGCNONE 
J065050C04CGACACGTGGCNONE 
J065052J16CGACACGTGGCNONE 
J065055E07CGACACGTGGCNONE 
J065055I04CGACACGTGGCNONE 
J065060L04CGACACGTGGCNONE 
J065062I15CGACACGTGGCNONE 
J065062J11CGACACGTGGCNONE 
J065065I12CGACACGTGGCNONE 
J065068C24CGACACGTGGCNONE 
J065069M04CGACACGTGGCNONE 
J065071J22CGACACGTGGCNONE 
J065076A12CGACACGTGGCNONE 
J065076C24CGACACGTGGCNONE 
J065076F09CGACACGTGGCNONE 
J065076F16CGACACGTGGCNONE 
J065077O06CGACACGTGGCNONE 
J065081E14CGACACGTGGCNONE 
J065082K22CGACACGTGGCNONE 
J065082L04CGACACGTGGCNONE 
J065085B02CGACACGTGGCNONE 
J065089C21CGACACGTGGCNONE 
J065092L07CGACACGTGGCNONE 
J065093G08CGACACGTGGCNONE 
J065093I19CGACACGTGGCNONE 
J065093K24CGACACGTGGCNONE 
J065093N04CGACACGTGGCNONE 
J065094I09CGACACGTGGCNONE 
J065094N19CGACACGTGGCNONE 
J065095J17CGACACGTGGCNONE 
J065095N24CGACACGTGGCNONE 
J065096B17CGACACGTGGCNONE 
J065096C02CGACACGTGGCNONE 
J065097P18CGACACGTGGCNONE 
J065099E07CGACACGTGGCNONE 
J065103D23CGACACGTGGCNONE 
J065104F04CGACACGTGGCNONE 
J065104L17CGACACGTGGCNONE 
J065111L14CGACACGTGGCNONE 
J065112K11CGACACGTGGCNONE 
J065115P09CGACACGTGGCNONE 
J065123A02CGACACGTGGCNONE 
J065127P14CGACACGTGGCNONE 
J065137E16CGACACGTGGCNONE 
J065138H20CGACACGTGGCNONE 
J065138J11CGACACGTGGCNONE 
J065141K23CGACACGTGGCNONE 
J065141L14CGACACGTGGCNONE 
J065143P04CGACACGTGGCNONE 
J065146N12CGACACGTGGCNONE 
J065147F21CGACACGTGGCNONE 
J065147N15CGACACGTGGCNONE 
J065154L06CGACACGTGGCNONE 
J065156C09CGACACGTGGCNONE 
J065156J18CGACACGTGGCNONE 
J065157C19CGACACGTGGCNONE 
J065159H23CGACACGTGGCNONE 
J065159M08CGACACGTGGCNONE 
J065163B19CGACACGTGGCNONE 
J065164K14CGACACGTGGCNONE 
J065166K07CGACACGTGGCNONE 
J065166O07CGACACGTGGCNONE 
J065168A18CGACACGTGGCNONE 
J065170B18CGACACGTGGCNONE 
J065170D18CGACACGTGGCNONE 
J065173E05CGACACGTGGCNONE 
J065174L23CGACACGTGGCNONE 
J065177F08CGACACGTGGCNONE 
J065177I05CGACACGTGGCNONE 
J065178P20CGACACGTGGCNONE 
J065181G24CGACACGTGGCNONE 
J065182A07CGACACGTGGCNONE 
J065183D24CGACACGTGGCNONE 
J065184K10CGACACGTGGCNONE 
J065185F09CGACACGTGGCNONE 
J065185P10CGACACGTGGCNONE 
J065186J16CGACACGTGGCNONE 
J065188K23CGACACGTGGCNONE 
J065190E22CGACACGTGGCNONE 
J065191D06CGACACGTGGCNONE 
J065193C05CGACACGTGGCNONE 
J065193N13CGACACGTGGCNONE 
J065194B15CGACACGTGGCNONE 
J065199C03CGACACGTGGCNONE 
J065200P19CGACACGTGGCNONE 
J065202O18CGACACGTGGCNONE 
J065203F16CGACACGTGGCNONE 
J065204A15CGACACGTGGCNONE 
J065206P13CGACACGTGGCNONE 
J065207P12CGACACGTGGCNONE 
J065210J24CGACACGTGGCNONE 
J065211K01CGACACGTGGCNONE 
J065213O21CGACACGTGGCNONE 
J065215L18CGACACGTGGCNONE 
J065216N22CGACACGTGGCNONE 
J065219A16CGACACGTGGCNONE 
J065219C24CGACACGTGGCNONE 
J075012P04CGACACGTGGCNONE 
J075013K19CGACACGTGGCNONE 
J075028N24CGACACGTGGCNONE 
J075028P16CGACACGTGGCNONE 
J075032H22CGACACGTGGCNONE 
J075032J18CGACACGTGGCNONE 
J075042O14CGACACGTGGCNONE 
J075047A04CGACACGTGGCNONE 
J075053A16CGACACGTGGCNONE 
J075064C23CGACACGTGGCNONE 
J075072H11CGACACGTGGCNONE 
J075073C03CGACACGTGGCNONE 
J075081G11CGACACGTGGCNONE 
J075093H04CGACACGTGGCNONE 
J075095A11CGACACGTGGCNONE 
J075095C13CGACACGTGGCNONE 
J075100D18CGACACGTGGCNONE 
J075101P08CGACACGTGGCNONE 
J075114G11CGACACGTGGCNONE 
J075118D19CGACACGTGGCNONE 
J075122K13CGACACGTGGCNONE 
J075125G22CGACACGTGGCNONE 
J075129E22CGACACGTGGCNONE 
J075129I07CGACACGTGGCNONE 
J075132C12CGACACGTGGCNONE 
J075135E24CGACACGTGGCNONE 
J075136I06CGACACGTGGCNONE 
J075136O07CGACACGTGGCNONE 
J075138I07CGACACGTGGCNONE 
J075142G08CGACACGTGGCNONE 
J075147J22CGACACGTGGCNONE 
J075150H20CGACACGTGGCNONE 
J075151A15CGACACGTGGCNONE 
J075151G24CGACACGTGGCNONE 
J075151J20CGACACGTGGCNONE 
J075156N21CGACACGTGGCNONE 
J075158O12CGACACGTGGCNONE 
J075161E05CGACACGTGGCNONE 
J075166F17CGACACGTGGCNONE 
J075169M10CGACACGTGGCNONE 
J075174K15CGACACGTGGCNONE 
J075179F17CGACACGTGGCNONE 
J075185G15CGACACGTGGCNONE 
J075188P12CGACACGTGGCNONE 
J075191P15CGACACGTGGCNONE 
J075192A13CGACACGTGGCNONE 
J075197E23CGACACGTGGCNONE 
J075197M02CGACACGTGGCNONE 
J075198M16CGACACGTGGCNONE 
J080020B11CGACACGTGGCNONE 
J080021M20CGACACGTGGCNONE 
J080066K02CGACACGTGGCNONE 
J080301F01CGACACGTGGCNONE 
J080301G19CGACACGTGGCNONE 
J080305G02CGACACGTGGCNONE 
J080306N09CGACACGTGGCNONE 
J080309D21CGACACGTGGCNONE 
J080309I02CGACACGTGGCNONE 
J080313J11CGACACGTGGCNONE 
J080313P09CGACACGTGGCNONE 
J080315B10CGACACGTGGCNONE 
J080315O13CGACACGTGGCNONE 
J080316G02CGACACGTGGCNONE 
J080317F03CGACACGTGGCNONE 
J080318D17CGACACGTGGCNONE 
J080319C10CGACACGTGGCNONE 
J090017E03CGACACGTGGCNONE 
J090034N22CGACACGTGGCNONE 
J090042G07CGACACGTGGCNONE 
J090062P21CGACACGTGGCNONE 
J090082D08CGACACGTGGCNONE 
J090096M13CGACACGTGGCNONE 
J100086J22CGACACGTGGCNONE 
Os12g0460800J023003J21CACTGACACGTGGGCCACNONE 
Os12g0478100013-036-F11GCCACGTGTCCNONE 
AK063578GCCACGTGTCCGRAM domain containing protein. 
Os12g0532600AK066369ACACGTGGGGHypothetical protein. 
J013059K17ACACGTGGGGNONE 
J065082J04ACACGTGGGGNONE 
J065158C15ACACGTGGGGNONE 
J090017A09ACACGTGGGGNONE 
Os12g0535400004-008-H02GGCCGTCCACGTGTCCNONE 
AK065318GGCCGTCCACGTGTCCHypothetical protein. 
J013002P10GGCCGTCCACGTGTCCNONE 
Os12g0541900AK069047CCACGTGTRapid ALkalinization Factor family protein. 
AK071210CCACGTGTNONE 
Os12g0548300009-148-D10ACACGTGGCNONE 
AK058388ACACGTGGCNONE 
Os12g0553200J013072P20GACACGTGGCNONE 
J033024I06GACACGTGGCNONE 
Os12g0554400AK072345GACACGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os12g0560300AK060332CCCGGGCCCACGTGTCSimilar to NTGB2 (Fragment). 
AK099125CCCGGGCCCACGTGTCNONE 
AK099149CCCGGGCCCACGTGTCNONE 
J023044P12CCCGGGCCCACGTGTCNONE 
J023063C05CCCGGGCCCACGTGTCNONE 
J043006H11CCCGGGCCCACGTGTCNONE 
J065055C21CCCGGGCCCACGTGTCNONE 
J065104A14CCCGGGCCCACGTGTCNONE 
J075156I06CCCGGGCCCACGTGTCNONE 
J090083J19CCCGGGCCCACGTGTCNONE 
J100069A17CCCGGGCCCACGTGTCNONE 
Os12g0569500AK066624GCCACGTGTThaumatin, pathogenesis-related family protein. 
J065041B03GCCACGTGTNONE 
J065046P11GCCACGTGTNONE 
J075140J11GCCACGTGTNONE 
Os12g0578500AK065485ACACGTGGGCGlycosyl transferase, family 8 protein. 
J043027D21ACACGTGGGCNONE 
J075120F12ACACGTGGGCNONE 
J080010J21ACACGTGGGCNONE 
J080015L10ACACGTGGGCNONE 
J080016C19ACACGTGGGCNONE 
J080016F10ACACGTGGGCNONE 
J080022A12ACACGTGGGCNONE 
J080024B10ACACGTGGGCNONE 
J080025C16ACACGTGGGCNONE 
J080026B03ACACGTGGGCNONE 
J080028B11ACACGTGGGCNONE 
J080028M19ACACGTGGGCNONE 
J080030I02ACACGTGGGCNONE 
J080032F18ACACGTGGGCNONE 
J080038O16ACACGTGGGCNONE 
J080040D01ACACGTGGGCNONE 
J080043H19ACACGTGGGCNONE 
J080045N21ACACGTGGGCNONE 
J080046H14ACACGTGGGCNONE 
J080053B20ACACGTGGGCNONE 
J080053P14ACACGTGGGCNONE 
J080056L15ACACGTGGGCNONE 
J080057F14ACACGTGGGCNONE 
J080060C10ACACGTGGGCNONE 
J080061D20ACACGTGGGCNONE 
J080061J12ACACGTGGGCNONE 
J080062F17ACACGTGGGCNONE 
J080065M15ACACGTGGGCNONE 
J080066N15ACACGTGGGCNONE 
J080069K21ACACGTGGGCNONE 
J080070L14ACACGTGGGCNONE 
J080072L05ACACGTGGGCNONE 
J080072L16ACACGTGGGCNONE 
J080075D08ACACGTGGGCNONE 
J080075I19ACACGTGGGCNONE 
J080076M24ACACGTGGGCNONE 
J080077M11ACACGTGGGCNONE 
J080078O10ACACGTGGGCNONE 
J080081K24ACACGTGGGCNONE 
J080082J02ACACGTGGGCNONE 
J080083N20ACACGTGGGCNONE 
J080085M09ACACGTGGGCNONE 
J080093K05ACACGTGGGCNONE 
J080094J19ACACGTGGGCNONE 
J080095E06ACACGTGGGCNONE 
J080096B04ACACGTGGGCNONE 
J080096H08ACACGTGGGCNONE 
J090034I21ACACGTGGGCNONE 
J090045J19ACACGTGGGCNONE 
J090065F20ACACGTGGGCNONE 
J100077M24ACACGTGGGCNONE 
Os12g0586600AK066259GACACGTGGGTCCSimilar to Plasma membrane Ca2+-ATPase. 
AK100436GACACGTGGGTCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.