version

Summary of OsREG435 (All List)

OrganismOryza sativa  
IDOsREG435  
SequenceACAGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1438  

Entry Sequences (1438 entries)

LocusGene modelSequenceDescription
Os01g0134500AK111908ACAGCCCASimilar to Delta-7-sterol-C5(6)-desaturase (EC 1.3.3.-) (Delta-7-C-5 sterol desaturase) (Delta7-sterol-C5-desaturase). 
AK112014ACAGCCCANONE 
Os01g0184000015-008-B06ACAGCCCAGNONE 
AK071130ACAGCCCAGNUC156 family protein. 
AK100604ACAGCCCAGNONE 
J075155H07ACAGCCCAGNONE 
J100047O19ACAGCCCAGNONE 
J100074A09ACAGCCCAGNONE 
Os01g0229900AK065381ACAGCCCATANONE 
AK065429ACAGCCCATASimilar to Shaggy-related protein kinase dzeta (EC 2.7.1.-) (ASK-dzeta). 
Os01g0303000009-016-A06ACAGCCCACGTGGCNONE 
009-084-B05ACAGCCCACGTGGCNONE 
009-100-E07ACAGCCCACGTGGCNONE 
009-133-B03ACAGCCCACGTGGCNONE 
AK058929ACAGCCCACGTGGCSimilar to CP12 (Fragment). 
AK066266ACAGCCCACGTGGCNONE 
AK102013ACAGCCCACGTGGCNONE 
J065001I21ACAGCCCACGTGGCNONE 
J065025D22ACAGCCCACGTGGCNONE 
J065098M18ACAGCCCACGTGGCNONE 
J065105O22ACAGCCCACGTGGCNONE 
J065121F07ACAGCCCACGTGGCNONE 
J065181F03ACAGCCCACGTGGCNONE 
J075020M03ACAGCCCACGTGGCNONE 
J075028O06ACAGCCCACGTGGCNONE 
J075032F15ACAGCCCACGTGGCNONE 
J075033H07ACAGCCCACGTGGCNONE 
J075062F22ACAGCCCACGTGGCNONE 
J075083P19ACAGCCCACGTGGCNONE 
J075097J16ACAGCCCACGTGGCNONE 
J075099A15ACAGCCCACGTGGCNONE 
J075104P03ACAGCCCACGTGGCNONE 
J075118K12ACAGCCCACGTGGCNONE 
J075125H01ACAGCCCACGTGGCNONE 
J075127K12ACAGCCCACGTGGCNONE 
J075128F24ACAGCCCACGTGGCNONE 
J075151P06ACAGCCCACGTGGCNONE 
J075169K22ACAGCCCACGTGGCNONE 
J075170K24ACAGCCCACGTGGCNONE 
J075182A01ACAGCCCACGTGGCNONE 
J075199H16ACAGCCCACGTGGCNONE 
J080010O12ACAGCCCACGTGGCNONE 
J080013A02ACAGCCCACGTGGCNONE 
J080013F09ACAGCCCACGTGGCNONE 
J080017C19ACAGCCCACGTGGCNONE 
J080017G05ACAGCCCACGTGGCNONE 
J080022L04ACAGCCCACGTGGCNONE 
J080025B17ACAGCCCACGTGGCNONE 
J080029A08ACAGCCCACGTGGCNONE 
J080037C12ACAGCCCACGTGGCNONE 
J080037L14ACAGCCCACGTGGCNONE 
J080037M24ACAGCCCACGTGGCNONE 
J080038M21ACAGCCCACGTGGCNONE 
J080039E06ACAGCCCACGTGGCNONE 
J080039I10ACAGCCCACGTGGCNONE 
J080042H01ACAGCCCACGTGGCNONE 
J080042L18ACAGCCCACGTGGCNONE 
J080042N21ACAGCCCACGTGGCNONE 
J080043E01ACAGCCCACGTGGCNONE 
J080044H05ACAGCCCACGTGGCNONE 
J080047H10ACAGCCCACGTGGCNONE 
J080050H03ACAGCCCACGTGGCNONE 
J080060N21ACAGCCCACGTGGCNONE 
J080061M09ACAGCCCACGTGGCNONE 
J080062D15ACAGCCCACGTGGCNONE 
J080062I18ACAGCCCACGTGGCNONE 
J080063G05ACAGCCCACGTGGCNONE 
J080063H16ACAGCCCACGTGGCNONE 
J080067G16ACAGCCCACGTGGCNONE 
J080067M07ACAGCCCACGTGGCNONE 
J080068M13ACAGCCCACGTGGCNONE 
J080069A19ACAGCCCACGTGGCNONE 
J080069G14ACAGCCCACGTGGCNONE 
J080070F04ACAGCCCACGTGGCNONE 
J080070K15ACAGCCCACGTGGCNONE 
J080072O20ACAGCCCACGTGGCNONE 
J080075L02ACAGCCCACGTGGCNONE 
J080077I10ACAGCCCACGTGGCNONE 
J080077P03ACAGCCCACGTGGCNONE 
J080078F14ACAGCCCACGTGGCNONE 
J080092H15ACAGCCCACGTGGCNONE 
J080097J15ACAGCCCACGTGGCNONE 
J080305C10ACAGCCCACGTGGCNONE 
Os01g0305900Os01g0305900ACAGCCCAAAASimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0324400AK102854ACAGCCCAGCCCACCAGGCCCACANONE 
AK111299ACAGCCCAGCCCACCAGGCCCACANONE 
J033032A11ACAGCCCAGCCCACCAGGCCCACANONE 
J033110L02ACAGCCCAGCCCACCAGGCCCACANONE 
Os01g0585400AK103584ACAGCCCAGConserved hypothetical protein. 
J033133B01ACAGCCCAGNONE 
Os01g0590300014-089-E04ACAGCCCACANONE 
AK063740ACAGCCCACAConserved hypothetical protein. 
Os01g0620100AK070122ACAGCCCAACTWD40-like domain containing protein. 
J023044A10ACAGCCCAACTNONE 
J033023C13ACAGCCCAACTNONE 
J033045E16ACAGCCCAACTNONE 
J033111H03ACAGCCCAACTNONE 
Os01g0626300016-070-G04AATTGGGCTGTNONE 
AK122071AATTGGGCTGTSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04AATTGGGCTGTNONE 
J033117J08AATTGGGCTGTNONE 
J065007O12AATTGGGCTGTNONE 
J065020K12AATTGGGCTGTNONE 
J065142D24AATTGGGCTGTNONE 
J065157K19AATTGGGCTGTNONE 
J080307H19AATTGGGCTGTNONE 
J080311D16AATTGGGCTGTNONE 
J080316C12AATTGGGCTGTNONE 
J080316E03AATTGGGCTGTNONE 
J100033K16AATTGGGCTGTNONE 
J100042J21AATTGGGCTGTNONE 
J100051E06AATTGGGCTGTNONE 
J100071E22AATTGGGCTGTNONE 
Os01g0678700AK111611AAATGGGCTGTDP protein. 
AY224529AAATGGGCTGTNONE 
Os01g0776700J065046N20ACAGCCCATCGConserved hypothetical protein. 
J100086L02ACAGCCCATCGNONE 
Os01g0847700AK103729GCCCATAATGGGCTGTSimilar to Aldose reductase. 
J033031B19GCCCATAATGGGCTGTNONE 
J065110K09GCCCATAATGGGCTGTNONE 
J065135H06GCCCATAATGGGCTGTNONE 
J075015H10GCCCATAATGGGCTGTNONE 
Os01g0853800006-033-H02ACAGCCCACAANONE 
006-037-A10ACAGCCCACAANONE 
006-038-F10ACAGCCCACAANONE 
006-054-E01ACAGCCCACAANONE 
006-067-E10ACAGCCCACAANONE 
012-015-G05ACAGCCCACAANONE 
AK069147ACAGCCCACAAC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK105929ACAGCCCACAANONE 
AK106144ACAGCCCACAANONE 
AK106186ACAGCCCACAANONE 
J023007P09ACAGCCCACAANONE 
J023007P10ACAGCCCACAANONE 
J065084L10ACAGCCCACAANONE 
J065179B10ACAGCCCACAANONE 
J065186D16ACAGCCCACAANONE 
J075040I08ACAGCCCACAANONE 
J075043K21ACAGCCCACAANONE 
J075051J08ACAGCCCACAANONE 
J075061D24ACAGCCCACAANONE 
J075095H04ACAGCCCACAANONE 
J075145J12ACAGCCCACAANONE 
J075148O18ACAGCCCACAANONE 
J075187J05ACAGCCCACAANONE 
J090042A20ACAGCCCACAANONE 
J100025K01ACAGCCCACAANONE 
Os01g0916300011-018-B12TGTGGGCTGTNONE 
AK063922TGTGGGCTGTSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
AK103107TGTGGGCTGTNONE 
AK121061TGTGGGCTGTNONE 
AK121997TGTGGGCTGTNONE 
J033118P14TGTGGGCTGTNONE 
J065002N16TGTGGGCTGTNONE 
J065079B04TGTGGGCTGTNONE 
J065102J07TGTGGGCTGTNONE 
J065128F16TGTGGGCTGTNONE 
J065184D11TGTGGGCTGTNONE 
J065186A07TGTGGGCTGTNONE 
J075115C07TGTGGGCTGTNONE 
J075147C04TGTGGGCTGTNONE 
Os01g0949700AK069037ACAGCCCATCCNONE 
J023004F17ACAGCCCATCCNONE 
J065063D04ACAGCCCATCCNONE 
J065196H02ACAGCCCATCCNONE 
J075198A05ACAGCCCATCCNONE 
Os02g0163600AK068043ACAGCCCAATAConserved hypothetical protein. 
J013131O20ACAGCCCAATANONE 
J065006E03ACAGCCCAATANONE 
Os02g0176400009-099-H11ACAGCCCAACCNONE 
AK062746ACAGCCCAACCProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0177500009-106-B06AAATGGGCTGTGGCCCATCGNONE 
AK062715AAATGGGCTGTGGCCCATCGSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
J065049F10AAATGGGCTGTGGCCCATCGNONE 
J065063L16AAATGGGCTGTGGCCCATCGNONE 
J065102P06AAATGGGCTGTGGCCCATCGNONE 
J065137A16AAATGGGCTGTGGCCCATCGNONE 
J065212M11AAATGGGCTGTGGCCCATCGNONE 
Os02g0208900003-126-D10ACAGCCCACGTNONE 
AK066171ACAGCCCACGTNONE 
AK070031ACAGCCCACGTNONE 
AK121183ACAGCCCACGTSimilar to ZIGA2 protein (Fragment). 
J013031N09ACAGCCCACGTNONE 
J013045O19ACAGCCCACGTNONE 
J023102A14ACAGCCCACGTNONE 
J023145E14ACAGCCCACGTNONE 
J033033E15ACAGCCCACGTNONE 
J033041H19ACAGCCCACGTNONE 
J033050E09ACAGCCCACGTNONE 
J065191H21ACAGCCCACGTNONE 
J065193C21ACAGCCCACGTNONE 
J075068F07ACAGCCCACGTNONE 
Os02g0220600AK103901GGCCCGTTACAGCCCAACANONE 
J013058O03GGCCCGTTACAGCCCAACANONE 
J013124E21GGCCCGTTACAGCCCAACANONE 
J023023L03GGCCCGTTACAGCCCAACANONE 
J023023L21GGCCCGTTACAGCCCAACANONE 
J023061N01GGCCCGTTACAGCCCAACANONE 
J023065O09GGCCCGTTACAGCCCAACANONE 
J023106J17GGCCCGTTACAGCCCAACANONE 
J023119N08GGCCCGTTACAGCCCAACANONE 
J033058A19GGCCCGTTACAGCCCAACANONE 
J033098O13GGCCCGTTACAGCCCAACANONE 
J033100M18GGCCCGTTACAGCCCAACANONE 
J033125A21GGCCCGTTACAGCCCAACANONE 
J033148C12GGCCCGTTACAGCCCAACANONE 
J043017F03GGCCCGTTACAGCCCAACANONE 
J043032J02GGCCCGTTACAGCCCAACANONE 
J053047N10GGCCCGTTACAGCCCAACANONE 
J053089P04GGCCCGTTACAGCCCAACANONE 
J065051K09GGCCCGTTACAGCCCAACANONE 
J065064H24GGCCCGTTACAGCCCAACANONE 
J090001L06GGCCCGTTACAGCCCAACANONE 
J090017C24GGCCCGTTACAGCCCAACANONE 
J090058G15GGCCCGTTACAGCCCAACANONE 
J090058H23GGCCCGTTACAGCCCAACANONE 
J090061G20GGCCCGTTACAGCCCAACANONE 
J090069N23GGCCCGTTACAGCCCAACANONE 
J090071A08GGCCCGTTACAGCCCAACANONE 
J090074A08GGCCCGTTACAGCCCAACANONE 
J090077B15GGCCCGTTACAGCCCAACANONE 
J090081K06GGCCCGTTACAGCCCAACANONE 
J090083I05GGCCCGTTACAGCCCAACANONE 
J090091O22GGCCCGTTACAGCCCAACANONE 
J090097L10GGCCCGTTACAGCCCAACANONE 
J100026B11GGCCCGTTACAGCCCAACANONE 
J100044M01GGCCCGTTACAGCCCAACANONE 
J100046F10GGCCCGTTACAGCCCAACANONE 
J100051K14GGCCCGTTACAGCCCAACANONE 
J100060D22GGCCCGTTACAGCCCAACANONE 
J100060H18GGCCCGTTACAGCCCAACANONE 
J100070I06GGCCCGTTACAGCCCAACANONE 
J100071C04GGCCCGTTACAGCCCAACANONE 
J100078M13GGCCCGTTACAGCCCAACANONE 
J100080E17GGCCCGTTACAGCCCAACANONE 
J100083I09GGCCCGTTACAGCCCAACANONE 
Os02g0321000AK121840ACAGCCCAACCTetratricopeptide-like helical domain containing protein. 
Os02g0496900AK059542ATATGGGCTGTConserved hypothetical protein. 
J053031E06ATATGGGCTGTNONE 
J065195E11ATATGGGCTGTNONE 
J090008P16ATATGGGCTGTNONE 
Os02g0510300AK067961CTGGGCTGTConserved hypothetical protein. 
AK104001CTGGGCTGTNONE 
J013123J20CTGGGCTGTNONE 
J065169H15CTGGGCTGTNONE 
Os02g0522000AK101294ATTTGGGCCTTGGGCTGTRetrotransposon gag protein family protein. 
Os02g0525400011-008-B01TAGGCCCACAGCCCAAACNONE 
AK065368TAGGCCCACAGCCCAAACSimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
J013021B13TAGGCCCACAGCCCAAACNONE 
J033046H10TAGGCCCACAGCCCAAACNONE 
Os02g0537900AK070310GGAGTGGGCTGTSimilar to Vacuolar-type H+-translocating inorganic pyrophosphatase (EC 3.6.1.1). 
Os02g0600100AK071215TCCGGCCCATGGGCTGTSimilar to 26S proteasome subunit RPN7. 
Os02g0651500AK066333ACAGCCCAACTNONE 
AK121865ACAGCCCAACTHypothetical protein. 
J090038J11ACAGCCCAACTNONE 
Os02g0658300AK073923ACAGCCCATTAConserved hypothetical protein. 
J065152M15ACAGCCCATTANONE 
Os02g0697200015-013-B10ACAGCCCACCACNONE 
AK059475ACAGCCCACCACNONE 
AK102993ACAGCCCACCACConserved hypothetical protein. 
J033079I18ACAGCCCACCACNONE 
J033082A14ACAGCCCACCACNONE 
J065047H08ACAGCCCACCACNONE 
J065131M14ACAGCCCACCACNONE 
Os02g0720600006-086-D09ATTTGGGCTGTNONE 
AK101967ATTTGGGCTGTPeptidase A1, pepsin family protein. 
AK105989ATTTGGGCTGTNONE 
J023073N17ATTTGGGCTGTNONE 
J033076I21ATTTGGGCTGTNONE 
J065057O13ATTTGGGCTGTNONE 
J065101I01ATTTGGGCTGTNONE 
J065102J23ATTTGGGCTGTNONE 
J065122L12ATTTGGGCTGTNONE 
J065132N22ATTTGGGCTGTNONE 
J065167A04ATTTGGGCTGTNONE 
J065168G11ATTTGGGCTGTNONE 
J065188C07ATTTGGGCTGTNONE 
J100018E15ATTTGGGCTGTNONE 
J100035L14ATTTGGGCTGTNONE 
J100041M01ATTTGGGCTGTNONE 
J100056J07ATTTGGGCTGTNONE 
J100065J09ATTTGGGCTGTNONE 
J100072E07ATTTGGGCTGTNONE 
J100081G12ATTTGGGCTGTNONE 
J100083G22ATTTGGGCTGTNONE 
J100085E19ATTTGGGCTGTNONE 
J100090P18ATTTGGGCTGTNONE 
Os02g0741500AK068867ACAGCCCACAARibbon-helix-helix domain containing protein. 
Os02g0756800013-074-D12ACAGCCCAAGNONE 
AK063605ACAGCCCAAGPhosphate-induced protein 1 conserved region family protein. 
J053100E11ACAGCCCAAGNONE 
J065045H15ACAGCCCAAGNONE 
J065099D22ACAGCCCAAGNONE 
J065142N08ACAGCCCAAGNONE 
Os02g0767500005-017-F10ACAGCCCAGATNONE 
AB016065ACAGCCCAGATNONE 
AK069611ACAGCCCAGATMitochondrial phosphate transporter. 
J013020K11ACAGCCCAGATNONE 
J013066I18ACAGCCCAGATNONE 
J023012D02ACAGCCCAGATNONE 
J023020J16ACAGCCCAGATNONE 
J023022H13ACAGCCCAGATNONE 
J023044N15ACAGCCCAGATNONE 
J023067E15ACAGCCCAGATNONE 
J023079C06ACAGCCCAGATNONE 
J023080B07ACAGCCCAGATNONE 
J023081G11ACAGCCCAGATNONE 
J023091H22ACAGCCCAGATNONE 
J023092J03ACAGCCCAGATNONE 
J023114D02ACAGCCCAGATNONE 
J023121J15ACAGCCCAGATNONE 
J023128G10ACAGCCCAGATNONE 
J023132B15ACAGCCCAGATNONE 
J023140G10ACAGCCCAGATNONE 
J023142B10ACAGCCCAGATNONE 
J033026C15ACAGCCCAGATNONE 
J033029F21ACAGCCCAGATNONE 
J033037I09ACAGCCCAGATNONE 
J033046D11ACAGCCCAGATNONE 
J033081L20ACAGCCCAGATNONE 
J033097J19ACAGCCCAGATNONE 
J033125D19ACAGCCCAGATNONE 
J033125I04ACAGCCCAGATNONE 
J033141M21ACAGCCCAGATNONE 
J033143K08ACAGCCCAGATNONE 
J053091N01ACAGCCCAGATNONE 
J065093C20ACAGCCCAGATNONE 
J065104K11ACAGCCCAGATNONE 
J065143L16ACAGCCCAGATNONE 
J065205I23ACAGCCCAGATNONE 
J090057C12ACAGCCCAGATNONE 
J090075P11ACAGCCCAGATNONE 
Os02g0811800011-036-F07ACAGCCCAATNONE 
AK063935ACAGCCCAATSimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44). 
AK119257ACAGCCCAATNONE 
J033022E13ACAGCCCAATNONE 
J033023F12ACAGCCCAATNONE 
J033028M20ACAGCCCAATNONE 
J033035L05ACAGCCCAATNONE 
J033043C20ACAGCCCAATNONE 
J033051O11ACAGCCCAATNONE 
J033071L10ACAGCCCAATNONE 
J033084E05ACAGCCCAATNONE 
J033101O21ACAGCCCAATNONE 
J033108A10ACAGCCCAATNONE 
J033115N15ACAGCCCAATNONE 
J033116N18ACAGCCCAATNONE 
J033117A11ACAGCCCAATNONE 
J033121C24ACAGCCCAATNONE 
J033131H15ACAGCCCAATNONE 
J033136O11ACAGCCCAATNONE 
J033138D20ACAGCCCAATNONE 
J033147C09ACAGCCCAATNONE 
J043036O15ACAGCCCAATNONE 
Os02g0812500AK106918ACAGCCCACACyclin-like F-box domain containing protein. 
Os02g0819700AK067374TGGATGGGCTGTATTGGGCCTCZinc finger, Zim17-type family protein. 
AK099160TGGATGGGCTGTATTGGGCCTCNONE 
J100086K17TGGATGGGCTGTATTGGGCCTCNONE 
Os02g0828200AK071199TGCGGCCCACAGCCCAATANONE 
Os03g0121300AK120047ACAGCCCANONE 
Os03g0122000AK101458ACAGCCCATAProtein kinase-like domain containing protein. 
J013035K10ACAGCCCATANONE 
J013050E10ACAGCCCATANONE 
J033040C13ACAGCCCATANONE 
Os03g0124300AK069148ACAGCCCAAACConserved hypothetical protein. 
AK106076ACAGCCCAAACNONE 
J023003G19ACAGCCCAAACNONE 
Os03g0130700015-052-H06TCATGGGCTGTNONE 
AK073872TCATGGGCTGTNONE 
AK100822TCATGGGCTGTNONE 
AK119886TCATGGGCTGTNONE 
J090060L05TCATGGGCTGTNONE 
J100059N01TCATGGGCTGTNONE 
Os03g0137500006-040-G01ACAGCCCACGTNONE 
015-054-G04ACAGCCCACGTNONE 
AK060148ACAGCCCACGTNONE 
AK073584ACAGCCCACGTNONE 
AK100231ACAGCCCACGTSimilar to VDAC3.1. 
J013146L24ACAGCCCACGTNONE 
J023022O09ACAGCCCACGTNONE 
J023049J19ACAGCCCACGTNONE 
J023133L05ACAGCCCACGTNONE 
J023143P12ACAGCCCACGTNONE 
J033040B12ACAGCCCACGTNONE 
J033050O14ACAGCCCACGTNONE 
J033066G05ACAGCCCACGTNONE 
J065007J18ACAGCCCACGTNONE 
J100067H13ACAGCCCACGTNONE 
Os03g0182800003-126-E06ACAGCCCATCCNONE 
AJ304840ACAGCCCATCCNONE 
AK073133ACAGCCCATCCNONE 
AY323478ACAGCCCATCCSimilar to Ethylene responsive element binding factor3 (OsERF3). 
J033023E13ACAGCCCATCCNONE 
J033028C22ACAGCCCATCCNONE 
J033042J03ACAGCCCATCCNONE 
J065022E13ACAGCCCATCCNONE 
J065208N24ACAGCCCATCCNONE 
J100034B17ACAGCCCATCCNONE 
J100035J21ACAGCCCATCCNONE 
J100039L16ACAGCCCATCCNONE 
J100040A02ACAGCCCATCCNONE 
J100051L11ACAGCCCATCCNONE 
J100064F07ACAGCCCATCCNONE 
J100070J12ACAGCCCATCCNONE 
Os03g0192500AK068957ACAGCCCAAGProtein phosphatase 2C-like domain containing protein. 
AY603974ACAGCCCAAGNONE 
Os03g0195800AF493792TGTGGGCTGTGGGCTGANONE 
AK103007TGTGGGCTGTGGGCTGASimilar to Sulfate transporter (Fragment). 
Os03g0198400AK059522GGTTGGGCTGTNONE 
AK103101GGTTGGGCTGTSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19GGTTGGGCTGTNONE 
J075036K08GGTTGGGCTGTNONE 
J075040J23GGTTGGGCTGTNONE 
J075041H18GGTTGGGCTGTNONE 
J075053H18GGTTGGGCTGTNONE 
J075055K15GGTTGGGCTGTNONE 
J075111K03GGTTGGGCTGTNONE 
J075125B22GGTTGGGCTGTNONE 
J075195L10GGTTGGGCTGTNONE 
Os03g0232800AK060669TGTGGGCTGTNONE 
AK072207TGTGGGCTGTLecithin:cholesterol acyltransferase family protein. 
AK121004TGTGGGCTGTNONE 
Os03g0239300AK066038ACAGCCCATATZinc finger, C2H2-type domain containing protein. 
AK068149ACAGCCCATATNONE 
AK071768ACAGCCCATATNONE 
J053027G22ACAGCCCATATNONE 
J075048G23ACAGCCCATATNONE 
J100060G19ACAGCCCATATNONE 
Os03g0253100AK119618ACAGCCCATGTPhosphomevalonate kinase Erg8 family protein. 
AK119618TAGGCCCACAGCCCACTTGPhosphomevalonate kinase Erg8 family protein. 
J033052A14ACAGCCCATGTNONE 
J033052A14TAGGCCCACAGCCCACTTGNONE 
Os03g0263900AK121215ACAGCCCACACGCalcium-binding EF-hand domain containing protein. 
J075115D02ACAGCCCACACGNONE 
J090095P20ACAGCCCACACGNONE 
Os03g0266900013-080-C12TATGGGCTACAGCCCACCCNONE 
014-010-A09TATGGGCTACAGCCCACCCNONE 
014-013-G10TATGGGCTACAGCCCACCCNONE 
014-019-D06TATGGGCTACAGCCCACCCNONE 
014-030-F08TATGGGCTACAGCCCACCCNONE 
014-039-C05TATGGGCTACAGCCCACCCNONE 
014-053-H08TATGGGCTACAGCCCACCCNONE 
014-089-F06TATGGGCTACAGCCCACCCNONE 
014-094-A05TATGGGCTACAGCCCACCCNONE 
014-098-C12TATGGGCTACAGCCCACCCNONE 
AK119243TATGGGCTACAGCCCACCCLow molecular mass heat shock protein Oshsp17.3. 
AK119717TATGGGCTACAGCCCACCCNONE 
D12635TATGGGCTACAGCCCACCCNONE 
M80186TATGGGCTACAGCCCACCCNONE 
Os03g0282900006-088-H05ACAGCCCAAGAAGGCCCATGTNONE 
AK061166ACAGCCCAAGAAGGCCCATGTNONE 
AK102161ACAGCCCAAGAAGGCCCATGTConserved hypothetical protein. 
AK104514ACAGCCCAAGAAGGCCCATGTNONE 
Os03g0297400AK060653ACAGCCCAACNONE 
AK061403ACAGCCCAACNONE 
AK101597ACAGCCCAACMalonyl CoA-acyl carrier protein transacylase family protein. 
Os03g0298800009-079-B10ACATGGGCTGTNONE 
AK103337ACATGGGCTGTSimilar to Spliceosomal protein. 
Os03g0343900009-077-C03ACAGCCCAAGGCCCAAGNONE 
AK105813ACAGCCCAAGGCCCAAGPhotosystem II protein PsbX family protein. 
J100059N03ACAGCCCAAGGCCCAAGNONE 
J100079C20ACAGCCCAAGGCCCAAGNONE 
Os03g0379500AK064760ACAGCCCASimilar to 40S ribosomal protein S9. 
J080024D11ACAGCCCANONE 
J080044J02ACAGCCCANONE 
J080050F01ACAGCCCANONE 
J080063D21ACAGCCCANONE 
J080063G04ACAGCCCANONE 
J080078E02ACAGCCCANONE 
Os03g0441000AK108726ACAGCCCAAGTranscription initiation factor TFIID component TAF4 domain containing protein. 
Os03g0567100AK109220CTCGCGCGCCGCGTGGGCTGTATGGGCCAGConserved hypothetical protein. 
Os03g0598200AK068322ACAGCCCATCANop14-like protein family protein. 
Os03g0622300AK107931AGCCCATGGGCTGTConserved hypothetical protein. 
J065184K14AGCCCATGGGCTGTNONE 
Os03g0626800015-067-B09GGGTGGGCTGTTCGTGGGCCTCNONE 
AK111916GGGTGGGCTGTTCGTGGGCCTCNONE 
AK112092GGGTGGGCTGTTCGTGGGCCTCCalcineurin B protein. 
J075016C21GGGTGGGCTGTTCGTGGGCCTCNONE 
Os03g0634000014-034-A03ACAGCCCATCTGGACCNONE 
AK063673ACAGCCCATCTGGACCSimilar to THA4. 
Os03g0647800003-103-H03ACAGCCCAACANONE 
006-104-G09ACAGCCCAACANONE 
AK070243ACAGCCCAACAConserved hypothetical protein. 
J100056F22ACAGCCCAACANONE 
Os03g0648400005-003-D07ACAGCCCATCTNONE 
006-048-C12ACAGCCCATCTNONE 
006-049-A03ACAGCCCATCTNONE 
011-008-F07ACAGCCCATCTNONE 
011-039-A07ACAGCCCATCTNONE 
011-044-D10ACAGCCCATCTNONE 
011-099-C01ACAGCCCATCTNONE 
012-051-B09ACAGCCCATCTNONE 
012-051-D08ACAGCCCATCTNONE 
012-056-G07ACAGCCCATCTNONE 
012-062-A01ACAGCCCATCTNONE 
012-079-C03ACAGCCCATCTNONE 
014-003-A06ACAGCCCATCTNONE 
015-010-D02ACAGCCCATCTNONE 
AK102263ACAGCCCATCTSimilar to DnaJ protein homolog (DNAJ-1). 
AK103763ACAGCCCATCTNONE 
AK105028ACAGCCCATCTNONE 
AY224432ACAGCCCATCTNONE 
J013043H01ACAGCCCATCTNONE 
J013134K10ACAGCCCATCTNONE 
J023037D18ACAGCCCATCTNONE 
J023077K20ACAGCCCATCTNONE 
J023105M19ACAGCCCATCTNONE 
J023131M09ACAGCCCATCTNONE 
J033022F05ACAGCCCATCTNONE 
J033051J22ACAGCCCATCTNONE 
J033061D03ACAGCCCATCTNONE 
J033084H04ACAGCCCATCTNONE 
J033088M01ACAGCCCATCTNONE 
J033119H12ACAGCCCATCTNONE 
J033131C18ACAGCCCATCTNONE 
J043030C06ACAGCCCATCTNONE 
J080032A08ACAGCCCATCTNONE 
J090008C11ACAGCCCATCTNONE 
J090014D24ACAGCCCATCTNONE 
J090024C20ACAGCCCATCTNONE 
J090024H08ACAGCCCATCTNONE 
J090029F10ACAGCCCATCTNONE 
J090032K16ACAGCCCATCTNONE 
J090034L14ACAGCCCATCTNONE 
J090035C20ACAGCCCATCTNONE 
J090044H05ACAGCCCATCTNONE 
J090048M09ACAGCCCATCTNONE 
J090056I15ACAGCCCATCTNONE 
J090062B01ACAGCCCATCTNONE 
J090076F06ACAGCCCATCTNONE 
J090077A02ACAGCCCATCTNONE 
J090084E21ACAGCCCATCTNONE 
J090084J09ACAGCCCATCTNONE 
J090086G11ACAGCCCATCTNONE 
J090092C20ACAGCCCATCTNONE 
J100018G14ACAGCCCATCTNONE 
J100018I22ACAGCCCATCTNONE 
J100024N14ACAGCCCATCTNONE 
J100032K09ACAGCCCATCTNONE 
J100036F09ACAGCCCATCTNONE 
J100041M04ACAGCCCATCTNONE 
J100042H05ACAGCCCATCTNONE 
J100043P19ACAGCCCATCTNONE 
J100044B04ACAGCCCATCTNONE 
J100049L24ACAGCCCATCTNONE 
J100050M21ACAGCCCATCTNONE 
J100057F24ACAGCCCATCTNONE 
J100063I11ACAGCCCATCTNONE 
J100064J24ACAGCCCATCTNONE 
J100070B13ACAGCCCATCTNONE 
J100076A13ACAGCCCATCTNONE 
J100081C20ACAGCCCATCTNONE 
J100081L09ACAGCCCATCTNONE 
J100084G23ACAGCCCATCTNONE 
J100088H02ACAGCCCATCTNONE 
Os03g0685700AK066043CCGTGGGCTGTProtein prenyltransferase domain containing protein. 
J013048F08CCGTGGGCTGTNONE 
Os03g0763000AK120812GTTGGGCCGAACAGCCCASimilar to Casein kinase II alpha subunit. 
Os03g0786000AK061286ACAGCCCATTAConserved hypothetical protein. 
AK073187ACAGCCCATTANONE 
Os03g0797600006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
Os03g0801500AK122059ACAGCCCACAConserved hypothetical protein. 
J033115B08ACAGCCCACANONE 
J075092K04ACAGCCCACANONE 
J090005N01ACAGCCCACANONE 
Os03g0819900006-058-B05GGGCCAGACAGCCCACACNONE 
AK111912GGGCCAGACAGCCCACACNONE 
AK112029GGGCCAGACAGCCCACACSimilar to RAB8C. 
AY576526GGGCCAGACAGCCCACACNONE 
AY579410GGGCCAGACAGCCCACACNONE 
J075041G24GGGCCAGACAGCCCACACNONE 
J100070N08GGGCCAGACAGCCCACACNONE 
Os03g0822100AK101094TGCGGGCCTTGGGCTGTGGGCTGCSimilar to Transposase (Fragment). 
J033024N05TGCGGGCCTTGGGCTGTGGGCTGCNONE 
Os03g0833700011-060-A10GTGTGGGCCCACAGCCCAGCNONE 
AK121918GTGTGGGCCCACAGCCCAGCRNA 3'-terminal phosphate cyclase family protein. 
Os03g0854800J090007D13ACAGCCCACACNONE 
J090085N22ACAGCCCACACNONE 
Os03g0856200009-070-B07TTATGGGCTGTNONE 
009-135-H05TTATGGGCTGTNONE 
J100067D22TTATGGGCTGTNONE 
J100067L13TTATGGGCTGTNONE 
J100073I07TTATGGGCTGTNONE 
J100080D01TTATGGGCTGTNONE 
Os04g0196600AK121999ACAGCCCAAAProtein of unknown function DUF563 family protein. 
Os04g0390500AK066575ACAGCCCACGAANONE 
AK099908ACAGCCCACGAANONE 
AK100148ACAGCCCACGAANONE 
Os04g0428500AK109932CGCGTGGGCTGTCGGACGGConserved hypothetical protein. 
Os04g0440000AK073064AGGTGGGCTGTNONE 
AK101691AGGTGGGCTGTConserved hypothetical protein. 
AK102407AGGTGGGCTGTNONE 
Os04g0476000Os04g0476000ACAGCCCATTTetratricopeptide-like helical domain containing protein. 
Os04g0481800AK109152ACATGGGCTGTMembrane bound O-acyl transferase, MBOAT family protein. 
J065002K24ACATGGGCTGTNONE 
Os04g0496600AK065058TTTGGGCTGTConserved hypothetical protein. 
J013001J09TTTGGGCTGTNONE 
J013037C18TTTGGGCTGTNONE 
J013126H05TTTGGGCTGTNONE 
J090062G17TTTGGGCTGTNONE 
Os04g0513100AK067841GGGCTGGGCTGCGGTGGGCTGTSimilar to Beta-glucosidase. 
J075105F14GGGCTGGGCTGCGGTGGGCTGTNONE 
Os04g0531300016-006-E10ACAGCCCAAATNONE 
AK072647ACAGCCCAAATDihydrouridine synthase, DuS family protein. 
AK103911ACAGCCCAAATNONE 
J013038P22ACAGCCCAAATNONE 
J023130D01ACAGCCCAAATNONE 
J033150P13ACAGCCCAAATNONE 
J043026L14ACAGCCCAAATNONE 
J065049A08ACAGCCCAAATNONE 
J065215C17ACAGCCCAAATNONE 
Os04g0539000009-165-H09ACAGCCCAATANONE 
014-012-F10ACAGCCCAATANONE 
AK105343ACAGCCCAATALambda integrase-like, N-terminal domain containing protein. 
Os04g0574500AK110934ACAGCCCAATSimilar to Growth-regulating factor 3. 
J065101K11ACAGCCCAATNONE 
J065207F18ACAGCCCAATNONE 
Os04g0577500006-039-C03ACAGCCCAACNONE 
006-043-H01ACAGCCCAACNONE 
AK061538ACAGCCCAACNONE 
AK065648ACAGCCCAACTatD-related deoxyribonuclease family protein. 
AK104763ACAGCCCAACNONE 
J013035E21ACAGCCCAACNONE 
J013066M11ACAGCCCAACNONE 
J100026B02ACAGCCCAACNONE 
Os04g0589600011-100-F04TACTGGGCTGTNONE 
AK061833TACTGGGCTGTGlycosyl transferase, group 1 domain containing protein. 
AK098964TACTGGGCTGTNONE 
AK100053TACTGGGCTGTNONE 
Os04g0636900011-028-G03TTGTGGGCTGTTGGGCTNONE 
012-040-G03TTGTGGGCTGTTGGGCTNONE 
AK058405TTGTGGGCTGTTGGGCTNONE 
AK065789TTGTGGGCTGTTGGGCTNONE 
AK101408TTGTGGGCTGTTGGGCTNONE 
AK119286TTGTGGGCTGTTGGGCTNONE 
J013042J24TTGTGGGCTGTTGGGCTNONE 
J033037I12TTGTGGGCTGTTGGGCTNONE 
J043031B12TTGTGGGCTGTTGGGCTNONE 
J065152N10TTGTGGGCTGTTGGGCTNONE 
J090060K17TTGTGGGCTGTTGGGCTNONE 
J090083K14TTGTGGGCTGTTGGGCTNONE 
J100046O13TTGTGGGCTGTTGGGCTNONE 
J100066G22TTGTGGGCTGTTGGGCTNONE 
Os04g0661300AK070723ACAGCCCAACACGGCCCATGGConserved hypothetical protein. 
AK103942ACAGCCCAACACGGCCCATGGNONE 
Os05g0105300AK069395CCAGCCCACAGCCCAAAACAP-Gly domain containing protein. 
Os05g0106100009-186-E05TTTGGGCTGTNONE 
013-067-H01TTTGGGCTGTNONE 
AK063178TTTGGGCTGTSimilar to Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14) (V- ATPase 16 kDa proteolipid subunit) (Fragment). 
J065010J15TTTGGGCTGTNONE 
J065073M24TTTGGGCTGTNONE 
J065077A22TTTGGGCTGTNONE 
J065167I04TTTGGGCTGTNONE 
J075084F11TTTGGGCTGTNONE 
J075086M18TTTGGGCTGTNONE 
Os05g0128100009-051-B07ACAGCCCATTTNONE 
009-127-B08ACAGCCCATTTNONE 
009-144-H03ACAGCCCATTTNONE 
009-176-B05ACAGCCCATTTNONE 
AK108556ACAGCCCATTTNONE 
AK119308ACAGCCCATTTNONE 
AK120934ACAGCCCATTTConserved hypothetical protein. 
J023036J15ACAGCCCATTTNONE 
J065122L01ACAGCCCATTTNONE 
J075104P10ACAGCCCATTTNONE 
Os05g0330700009-032-H01ACAGCCCACCACNONE 
AK062425ACAGCCCACCACConserved hypothetical protein. 
Os05g0364300009-036-C07TTCGTGGGCTGTNONE 
AK062440TTCGTGGGCTGTConserved hypothetical protein. 
Os05g0378900AK103841ACAGCCCATCAConserved hypothetical protein. 
J033148I18ACAGCCCATCANONE 
J065085F12ACAGCCCATCANONE 
J075041H24ACAGCCCATCANONE 
J075180P06ACAGCCCATCANONE 
Os05g0427200AK070830ACAGCCCAACANONE 
AK106896ACAGCCCAACAGlycosyl transferase, family 31 protein. 
Os05g0430200J090095K16ACAGCCCATGNONE 
Os05g0436400003-014-B09TGTGGGCTGTNONE 
AK060776TGTGGGCTGTPeptidase A22, presenilin signal peptide family protein. 
Os05g0441500AK120434ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F13ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F15ACAGCCCAGGCCCACCTGTCAGNONE 
J065152G07ACAGCCCAGGCCCACCTGTCAGNONE 
Os05g0447000AK108280TGGTGGGCTGTSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0453500012-003-F05ACAGCCCAACNONE 
AK102175ACAGCCCAACConserved hypothetical protein. 
J033086K19ACAGCCCAACNONE 
Os05g0476100011-031-E09ACAGCCCACACACCNONE 
011-033-E05ACAGCCCACACACCNONE 
011-038-E02ACAGCCCACACACCNONE 
012-053-A09ACAGCCCACACACCNONE 
012-057-E02ACAGCCCACACACCNONE 
AK064010ACAGCCCACACACCProtein of unknown function DUF827, plant family protein. 
AK102615ACAGCCCACACACCNONE 
J033057J03ACAGCCCACACACCNONE 
J033099E14ACAGCCCACACACCNONE 
Os05g0480700AK100850ACAGCCCACASimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11ACAGCCCACANONE 
Os05g0494700Os05g0494700ACAGCCCAAGNONE 
Os05g0521500AK066030TATTGGGCTGTPeptidase S16, lon N-terminal domain containing protein. 
Os05g0531700AK110982GGTTGGGCTGTConserved hypothetical protein. 
Os05g0553000015-052-H09ACAGCCCAAAANONE 
AK061681ACAGCCCAAAAATP synthase beta chain, mitochondrial precursor (EC 3.6.3.14). 
AK071143ACAGCCCAAAANONE 
J013068H04ACAGCCCAAAANONE 
J013124C06ACAGCCCAAAANONE 
J033127N11ACAGCCCAAAANONE 
J100056O04ACAGCCCAAAANONE 
Os05g0574500006-021-A08ATTGGGCTGTNONE 
006-049-A11ATTGGGCTGTNONE 
006-086-F03ATTGGGCTGTNONE 
009-051-F06ATTGGGCTGTNONE 
AB015287ATTGGGCTGTNONE 
AB015972ATTGGGCTGTNONE 
AK061714ATTGGGCTGTNONE 
AK098889ATTGGGCTGTNONE 
AK121699ATTGGGCTGTSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATTGGGCTGTNONE 
J013072D17ATTGGGCTGTNONE 
J023028M04ATTGGGCTGTNONE 
J023031F01ATTGGGCTGTNONE 
J023114L22ATTGGGCTGTNONE 
J033058L12ATTGGGCTGTNONE 
J033073D17ATTGGGCTGTNONE 
J043031D08ATTGGGCTGTNONE 
J043036G01ATTGGGCTGTNONE 
J065144O04ATTGGGCTGTNONE 
J065181O08ATTGGGCTGTNONE 
J080066B20ATTGGGCTGTNONE 
Os06g0116900009-176-D04GGGTGGGCTGTNONE 
AK063112GGGTGGGCTGTConserved hypothetical protein. 
Os06g0134900AK103205GGATGGGCTGTGTTGGGCCAAGCCCAGConserved hypothetical protein. 
J033122E01GGATGGGCTGTGTTGGGCCAAGCCCAGNONE 
Os06g0135000J075008J15CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075166F23CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075185F03CTGGGCTTGGCCCAACACAGCCCATCCNONE 
Os06g0135340J065061D17ACAGCCCAAACNONE 
J065159A10ACAGCCCAAACConserved hypothetical protein. 
Os06g0136900AK107405ACAGCCCAGCCCAGGGCCCGCProtein of unknown function DUF296 domain containing protein. 
Os06g0137500AK072896ACAGCCCATGGGCBrix domain containing protein. 
AK121945ACAGCCCATGGGCNONE 
Os06g0147600AK107817ACGTGGGCTGTConserved hypothetical protein. 
Os06g0157800AK121504TATTGGGCCGATTTGGGCTGTSimilar to CG7224 (Fragment). 
J033022L20TATTGGGCCGATTTGGGCTGTNONE 
J075033D09TATTGGGCCGATTTGGGCTGTNONE 
Os06g0192500AK067746TTTCGGCCCATACAGCCCATCAATP-dependent helicase, DEAH-box family protein. 
J065023K06TTTCGGCCCATACAGCCCATCANONE 
J100063P08TTTCGGCCCATACAGCCCATCANONE 
J100065N03TTTCGGCCCATACAGCCCATCANONE 
Os06g0192800AK070038ACAGCCCAAAASimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
J065057C13ACAGCCCAAAANONE 
J100067A03ACAGCCCAAAANONE 
Os06g0199500AK060939ACAGCCCAATANONE 
AK064613ACAGCCCAATASimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138ACAGCCCAATANONE 
Os06g0219600AK060429CAACGGCCCACAGCCCACGGSimilar to Poly(A)-binding protein II-like. 
AK099019CAACGGCCCACAGCCCACGGNONE 
J013118A14CAACGGCCCACAGCCCACGGNONE 
Os06g0309000AK121021AAGGCCCAGACAGCCCAACZinc finger, FYVE/PHD-type domain containing protein. 
Os06g0343500AK106646ACAGCCCAConserved hypothetical protein. 
Os06g0494400AK067594ACAGCCCATCCMulti antimicrobial extrusion protein MatE family protein. 
Os06g0600100AK065619ACAGCCCATCASimilar to TAT-binding protein homolog (Fragment). 
Os06g0638700AK108500ACAGCCCATGTPutative cyclase family protein. 
Os06g0667600AK058606ACAGCCCANONE 
AK071621ACAGCCCASimilar to Glycine decarboxylase complex H-protein. 
J023101D03ACAGCCCANONE 
J033095E17ACAGCCCANONE 
J065020B16ACAGCCCANONE 
Os06g0681000009-105-G11AGATGGGCTGTNONE 
AK062780AGATGGGCTGTConserved hypothetical protein. 
J100021E01AGATGGGCTGTNONE 
Os06g0694500AK067484CCATGGGCTGTATGGGCTTTTSimilar to Nitrogen fixation like protein. 
AK103983CCATGGGCTGTATGGGCTTTTNONE 
Os06g0702800009-039-E05ACAGCCCATAANONE 
AK073948ACAGCCCATAAHypothetical protein. 
J023108K23ACAGCCCATAANONE 
J033072H04ACAGCCCATAANONE 
J065008G05ACAGCCCATAANONE 
J065128J12ACAGCCCATAANONE 
J065131A01ACAGCCCATAANONE 
J065173B12ACAGCCCATAANONE 
Os07g0115200AK111404ACAGCCCACAConserved hypothetical protein. 
Os07g0147600AK099551ACAGCCCACGCNONE 
AK102834ACAGCCCACGCProtein kinase-like domain containing protein. 
J090004P22ACAGCCCACGCNONE 
J090040K07ACAGCCCACGCNONE 
J090044I03ACAGCCCACGCNONE 
J090060I04ACAGCCCACGCNONE 
J090063O16ACAGCCCACGCNONE 
J090072C03ACAGCCCACGCNONE 
J090072E05ACAGCCCACGCNONE 
J090091P08ACAGCCCACGCNONE 
J090099P14ACAGCCCACGCNONE 
Os07g0171100AF272978CGTGTGGGCTGTNONE 
AK062132CGTGTGGGCTGTNONE 
AK066475CGTGTGGGCTGTTetratricopeptide-like helical domain containing protein. 
J013068C23CGTGTGGGCTGTNONE 
Os07g0181000AK066918ACAGCCCAAATNONE 
AK070512ACAGCCCAAATSimilar to Pyruvate kinase isozyme A, chloroplast precursor (EC 2.7.1.40). 
Os07g0479200005-017-H08ACAGCCCAAANONE 
AK058326ACAGCCCAAASimilar to SL15-like (Fragment). 
J013092A08ACAGCCCAAANONE 
J033139E04ACAGCCCAAANONE 
J043016M16ACAGCCCAAANONE 
J053050O18ACAGCCCAAANONE 
J053098B03ACAGCCCAAANONE 
J065068G10ACAGCCCAAANONE 
J065091I17ACAGCCCAAANONE 
J065109A03ACAGCCCAAANONE 
J065168B17ACAGCCCAAANONE 
J065177A05ACAGCCCAAANONE 
J065180J01ACAGCCCAAANONE 
J075006F13ACAGCCCAAANONE 
J075022J03ACAGCCCAAANONE 
J075024N09ACAGCCCAAANONE 
J075114B12ACAGCCCAAANONE 
J080023M06ACAGCCCAAANONE 
J080081N24ACAGCCCAAANONE 
J090060N07ACAGCCCAAANONE 
Os07g0481100003-130-F04ACAGCCCATGTNONE 
AK062302ACAGCCCATGTProtein of unknown function DUF315 domain containing protein. 
J090048K21ACAGCCCATGTNONE 
Os07g0486000AK069343ACAGCCCACTCCSimilar to MSH4. 
Os07g0490300AK068288GCGGCCCACAGCCCAACCSimilar to Preproacrosin. 
J013149P03GCGGCCCACAGCCCAACCNONE 
J065039L14GCGGCCCACAGCCCAACCNONE 
J100024A06GCGGCCCACAGCCCAACCNONE 
Os07g0490400AK067941GGTTGGGCTGTGGGCCGCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22GGTTGGGCTGTGGGCCGCNONE 
Os07g0603100AK101352GCGGGCCCACACAGCCCACCACNuclear transport factor 2 domain containing protein. 
J023077E09GCGGGCCCACACAGCCCACCACNONE 
J023081N15GCGGGCCCACACAGCCCACCACNONE 
J033022N22GCGGGCCCACACAGCCCACCACNONE 
J033024M18GCGGGCCCACACAGCCCACCACNONE 
J033034P09GCGGGCCCACACAGCCCACCACNONE 
J033046A06GCGGGCCCACACAGCCCACCACNONE 
J033051K01GCGGGCCCACACAGCCCACCACNONE 
J033081P09GCGGGCCCACACAGCCCACCACNONE 
J033091B17GCGGGCCCACACAGCCCACCACNONE 
J033092K23GCGGGCCCACACAGCCCACCACNONE 
J033132J09GCGGGCCCACACAGCCCACCACNONE 
J033144A14GCGGGCCCACACAGCCCACCACNONE 
J033145A14GCGGGCCCACACAGCCCACCACNONE 
J043021B20GCGGGCCCACACAGCCCACCACNONE 
J053024D23GCGGGCCCACACAGCCCACCACNONE 
J065212J10GCGGGCCCACACAGCCCACCACNONE 
J090055M05GCGGGCCCACACAGCCCACCACNONE 
J090065E14GCGGGCCCACACAGCCCACCACNONE 
J090092J06GCGGGCCCACACAGCCCACCACNONE 
Os07g0649200AK072510AGATGGGCTGTConserved hypothetical protein. 
Os07g0688100AK101635ACAGCCCATCTProtein prenyltransferase domain containing protein. 
J033055B02ACAGCCCATCTNONE 
J090013O08ACAGCCCATCTNONE 
J090074A17ACAGCCCATCTNONE 
Os07g0690300012-048-A07ACAGCCCACANONE 
AK099674ACAGCCCACAChromatin SPT2 family protein. 
J013028F12ACAGCCCACANONE 
J013069F21ACAGCCCACANONE 
J013104E17ACAGCCCACANONE 
J013153M16ACAGCCCACANONE 
J023012L09ACAGCCCACANONE 
J023069A08ACAGCCCACANONE 
J023132L23ACAGCCCACANONE 
J033120P19ACAGCCCACANONE 
J065173J03ACAGCCCACANONE 
J075008H06ACAGCCCACANONE 
J075043J15ACAGCCCACANONE 
J075147I12ACAGCCCACANONE 
J090041G07ACAGCCCACANONE 
Os07g0691200AK060763ATATGGGCTGTNONE 
Os08g0100500006-093-G03ACAGCCCATTNONE 
AK109496ACAGCCCATTNONE 
J013097K15ACAGCCCATTNONE 
J023027K12ACAGCCCATTNONE 
J033046J03ACAGCCCATTNONE 
J075012A04ACAGCCCATTNONE 
J075056N17ACAGCCCATTNONE 
J075104O11ACAGCCCATTNONE 
J075177A17ACAGCCCATTNONE 
J090012E07ACAGCCCATTNONE 
J090054H18ACAGCCCATTNONE 
J090061K07ACAGCCCATTNONE 
Os08g0128000AK069322ACAGCCCAAGNONE 
AK103896ACAGCCCAAGGalactose oxidase, central domain containing protein. 
J023013D19ACAGCCCAAGNONE 
J023013I07ACAGCCCAAGNONE 
J023037F21ACAGCCCAAGNONE 
J023106B02ACAGCCCAAGNONE 
J023134E22ACAGCCCAAGNONE 
J033027F15ACAGCCCAAGNONE 
J033150H12ACAGCCCAAGNONE 
J090088A10ACAGCCCAAGNONE 
Os08g0139100006-027-E12ACAGCCCATAANONE 
006-089-E06ACAGCCCATAANONE 
006-113-G02ACAGCCCATAANONE 
AK061429ACAGCCCATAANONE 
AK099590ACAGCCCATAASimilar to DAG protein, chloroplast precursor. 
AK104727ACAGCCCATAANONE 
J013043H11ACAGCCCATAANONE 
J013049N13ACAGCCCATAANONE 
J065079F01ACAGCCCATAANONE 
J065122N24ACAGCCCATAANONE 
J065142J24ACAGCCCATAANONE 
J065193N03ACAGCCCATAANONE 
J075041I21ACAGCCCATAANONE 
J075145E04ACAGCCCATAANONE 
Os08g0156900AJ605583ACAGCCCATCANONE 
AK073344ACAGCCCATCASpo11/DNA topoisomerase VI, subunit A family protein. 
AK106397ACAGCCCATCANONE 
Os08g0195400006-057-E04ACAGCCCAGTANONE 
006-057-E04TGTTGGGCTGTNONE 
006-060-B10ACAGCCCAGTANONE 
006-060-B10TGTTGGGCTGTNONE 
AK070464ACAGCCCAGTAConserved hypothetical protein. 
AK070464TGTTGGGCTGTConserved hypothetical protein. 
AK104389ACAGCCCAGTANONE 
AK104389TGTTGGGCTGTNONE 
AK106140ACAGCCCAGTANONE 
AK106140TGTTGGGCTGTNONE 
J023013G08ACAGCCCAGTANONE 
J023013G08TGTTGGGCTGTNONE 
J023054K19ACAGCCCAGTANONE 
J023054K19TGTTGGGCTGTNONE 
J023089D18ACAGCCCAGTANONE 
J023089D18TGTTGGGCTGTNONE 
J023092K05ACAGCCCAGTANONE 
J023092K05TGTTGGGCTGTNONE 
J033025A08ACAGCCCAGTANONE 
J033025A08TGTTGGGCTGTNONE 
J033067P12ACAGCCCAGTANONE 
J033067P12TGTTGGGCTGTNONE 
J033098A10ACAGCCCAGTANONE 
J033098A10TGTTGGGCTGTNONE 
J065219L04ACAGCCCAGTANONE 
J065219L04TGTTGGGCTGTNONE 
J090021P06ACAGCCCAGTANONE 
J090021P06TGTTGGGCTGTNONE 
J090062M05ACAGCCCAGTANONE 
J090062M05TGTTGGGCTGTNONE 
J090079F15ACAGCCCAGTANONE 
J090079F15TGTTGGGCTGTNONE 
J100041H19ACAGCCCAGTANONE 
J100041H19TGTTGGGCTGTNONE 
Os08g0230000014-096-F01ACAGCCCATTNONE 
AK067127ACAGCCCATTConserved hypothetical protein. 
J013096C05ACAGCCCATTNONE 
J100032D12ACAGCCCATTNONE 
Os08g0237000003-111-F01ACAGCCCACAANONE 
006-022-H07ACAGCCCACAANONE 
006-028-G01ACAGCCCACAANONE 
006-032-D10ACAGCCCACAANONE 
006-039-F08ACAGCCCACAANONE 
006-039-H01ACAGCCCACAANONE 
006-051-E01ACAGCCCACAANONE 
006-053-E11ACAGCCCACAANONE 
006-055-E09ACAGCCCACAANONE 
006-061-H02ACAGCCCACAANONE 
006-062-G07ACAGCCCACAANONE 
006-074-D07ACAGCCCACAANONE 
006-074-F11ACAGCCCACAANONE 
006-076-F03ACAGCCCACAANONE 
006-080-G01ACAGCCCACAANONE 
006-081-A03ACAGCCCACAANONE 
006-084-F05ACAGCCCACAANONE 
006-085-B08ACAGCCCACAANONE 
006-089-C03ACAGCCCACAANONE 
006-090-B12ACAGCCCACAANONE 
006-092-D04ACAGCCCACAANONE 
006-095-E05ACAGCCCACAANONE 
006-100-C12ACAGCCCACAANONE 
006-109-C03ACAGCCCACAANONE 
006-114-E09ACAGCCCACAANONE 
009-033-G02ACAGCCCACAANONE 
009-189-F09ACAGCCCACAANONE 
009-200-A08ACAGCCCACAANONE 
009-200-D07ACAGCCCACAANONE 
AB110604ACAGCCCACAAXyloglucan endotransglycosylase/hydrolase protein 8 precursor (EC 2.4.1.207) (End-xyloglucan transferase) (OsXTH8) (OsXRT5). 
AK060654ACAGCCCACAANONE 
AK104451ACAGCCCACAANONE 
Os08g0260600AK108529ACAGCCCAAAACD9/CD37/CD63 antigen family protein. 
Os08g0327700AK107930ACAGCCCAGLate embryogenesis abundant (LEA) group 1 family protein. 
Os08g0366000AK061683TTTGGGCTGTNONE 
J075038P08TTTGGGCTGTNONE 
J075078A19TTTGGGCTGTNONE 
J075116L15TTTGGGCTGTNONE 
J075117E22TTTGGGCTGTNONE 
J075118D04TTTGGGCTGTNONE 
J075139A08TTTGGGCTGTNONE 
J075175J19TTTGGGCTGTNONE 
J075197N24TTTGGGCTGTNONE 
Os08g0379000AK105647ACAGCCCATCCProtein prenyltransferase domain containing protein. 
Os08g0387050J043038F21GAAGCCCAGCCGAGCCGGCCCACAGCCCAGCCConserved hypothetical protein. 
Os08g0430600009-181-E04ACAGCCCAATTNONE 
AK060045ACAGCCCAATTConserved hypothetical protein. 
AK068922ACAGCCCAATTNONE 
J013170B19ACAGCCCAATTNONE 
J065076C03ACAGCCCAATTNONE 
J065218G16ACAGCCCAATTNONE 
J090045N10ACAGCCCAATTNONE 
J100028O03ACAGCCCAATTNONE 
Os08g0471800AK105281CTGGGCTGTRemorin, C-terminal region domain containing protein. 
Os08g0471900015-099-E10ACAGCCCAACAAGGCCCATCGNONE 
AK069434ACAGCCCAACAAGGCCCATCGZinc finger, ZPR1-type domain containing protein. 
Os08g0492100AK060178AAATGGGCTGTATTTGGGCCAANONE 
AK071053AAATGGGCTGTATTTGGGCCAAParaneoplastic encephalomyelitis antigen family protein. 
AK100101AAATGGGCTGTATTTGGGCCAANONE 
J023004I20AAATGGGCTGTATTTGGGCCAANONE 
J023067D13AAATGGGCTGTATTTGGGCCAANONE 
J033028G05AAATGGGCTGTATTTGGGCCAANONE 
J033060L15AAATGGGCTGTATTTGGGCCAANONE 
J033103N12AAATGGGCTGTATTTGGGCCAANONE 
J033125B19AAATGGGCTGTATTTGGGCCAANONE 
J065132A12AAATGGGCTGTATTTGGGCCAANONE 
J065161F02AAATGGGCTGTATTTGGGCCAANONE 
J065162L05AAATGGGCTGTATTTGGGCCAANONE 
J090093I18AAATGGGCTGTATTTGGGCCAANONE 
J100061I05AAATGGGCTGTATTTGGGCCAANONE 
J100081G13AAATGGGCTGTATTTGGGCCAANONE 
Os08g0496400AK110964ACAGCCCATTAConserved hypothetical protein. 
Os08g0532800AK061214GGCTGGGCTCTGGGCTGTPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
AK061387GGCTGGGCTCTGGGCTGTNONE 
AK067802GGCTGGGCTCTGGGCTGTNONE 
AK104251GGCTGGGCTCTGGGCTGTNONE 
Os09g0100800AK072386TGTTGGGCTGTConserved hypothetical protein. 
J023081P06TGTTGGGCTGTNONE 
J090027B17TGTTGGGCTGTNONE 
Os09g0287500006-102-A02CCAGCCCAGTAACAGCCCAATNONE 
AK059944CCAGCCCAGTAACAGCCCAATProtein of unknown function DUF565 family protein. 
Os09g0298500009-037-H05CTGGGCTGTNONE 
015-032-F11CTGGGCTGTNONE 
AK062446CTGGGCTGTNONE 
AK064311CTGGGCTGTZinc finger, RING-type domain containing protein. 
Os09g0329800AK069775TTTTGGGCCTAACAGCCCATATConserved hypothetical protein. 
Os09g0329900Os09g0329900TTTTGGGCCTAACAGCCCATATNONE 
Os09g0388400AK069644CTTGGGCTGTCof protein family protein. 
J023147A17CTTGGGCTGTNONE 
Os09g0433650J075094M19ACAGCCCAGTobacco mosaic virus coat protein family protein. 
Os09g0458100AK109625CTGGGCTGTXyloglucan fucosyltransferase family protein. 
Os09g0458400AK070055ACTGACAGCCCAGCCCATTAConserved hypothetical protein. 
AK120321ACTGACAGCCCAGCCCATTANONE 
J065064N11ACTGACAGCCCAGCCCATTANONE 
J065083J06ACTGACAGCCCAGCCCATTANONE 
J065121D24ACTGACAGCCCAGCCCATTANONE 
J065156I22ACTGACAGCCCAGCCCATTANONE 
J065163J24ACTGACAGCCCAGCCCATTANONE 
J075001I02ACTGACAGCCCAGCCCATTANONE 
J090088O06ACTGACAGCCCAGCCCATTANONE 
Os09g0462300J065097M23TGTTGGGCTGTEsterase/lipase/thioesterase domain containing protein. 
J065161K12TGTTGGGCTGTNONE 
Os09g0530700AK058211ACAGCCCAATTConserved hypothetical protein. 
AK100759ACAGCCCAATTNONE 
J065039L02ACAGCCCAATTNONE 
J065043O03ACAGCCCAATTNONE 
J065070M16ACAGCCCAATTNONE 
Os09g0532600J013002F02ACAGCCCATATNONE 
Os09g0535000AK058712CTTGGGCTGTSimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488CTTGGGCTGTNONE 
AK069832CTTGGGCTGTNONE 
J100065D20CTTGGGCTGTNONE 
Os09g0535500AK108282ACAGCCCAAACSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
Os09g0568000AK068829ACAGCCCAAGNONE 
Os09g0571400AK103109ACAGCCCAACACyclophilin 1. 
J023011A12ACAGCCCAACANONE 
J033119A20ACAGCCCAACANONE 
J053034N16ACAGCCCAACANONE 
J053045N23ACAGCCCAACANONE 
J053052J12ACAGCCCAACANONE 
J053052K04ACAGCCCAACANONE 
J053099M15ACAGCCCAACANONE 
J065071H23ACAGCCCAACANONE 
J065131B16ACAGCCCAACANONE 
J075003F19ACAGCCCAACANONE 
J075116F02ACAGCCCAACANONE 
J075126G05ACAGCCCAACANONE 
J075145E09ACAGCCCAACANONE 
J075149O22ACAGCCCAACANONE 
J075163A09ACAGCCCAACANONE 
J075194A09ACAGCCCAACANONE 
L29471ACAGCCCAACANONE 
Os11g0107700AK073061ACAGCCCACAProtein kinase-like domain containing protein. 
AK109643ACAGCCCACANONE 
Os11g0139500AK121845TCGTGGGCTGTATATGGGCTGANONE 
Os11g0145400009-117-C07ACAGCCCATCASimilar to Ubiquitin-like protein 5. 
009-189-E08ACAGCCCATCANONE 
J023127F18ACAGCCCATCANONE 
J065071G10ACAGCCCATCANONE 
J065118J21ACAGCCCATCANONE 
J065184P05ACAGCCCATCANONE 
J080301B06ACAGCCCATCANONE 
J080303C06ACAGCCCATCANONE 
J080304F18ACAGCCCATCANONE 
J080308D02ACAGCCCATCANONE 
J080309H09ACAGCCCATCANONE 
J080311O09ACAGCCCATCANONE 
J080311O15ACAGCCCATCANONE 
J080312N11ACAGCCCATCANONE 
J080313G04ACAGCCCATCANONE 
J080313I06ACAGCCCATCANONE 
J100077F22ACAGCCCATCANONE 
Os11g0267000006-024-H12ACAGCCCACCANONE 
006-039-A12ACAGCCCACCANONE 
006-039-B09ACAGCCCACCANONE 
006-044-F05ACAGCCCACCANONE 
006-069-C12ACAGCCCACCANONE 
006-098-E01ACAGCCCACCANONE 
006-099-H05ACAGCCCACCANONE 
006-103-B11ACAGCCCACCANONE 
006-107-A02ACAGCCCACCANONE 
006-109-C12ACAGCCCACCANONE 
009-123-C09ACAGCCCACCANONE 
AK060022ACAGCCCACCANONE 
AK061014ACAGCCCACCAGUN4-like domain containing protein. 
AK100815ACAGCCCACCANONE 
AK104559ACAGCCCACCANONE 
J023122C05ACAGCCCACCANONE 
Os11g0306300006-102-D09GCTGGGCTGTNONE 
AK109384GCTGGGCTGTSimilar to Herbicide safener binding protein. 
Os11g0423200AK111297ACAGCCCATGGHypothetical protein. 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os11g0602300AK103473ACAGCCCACCACSimilar to HVA22-like protein a (AtHVA22a). 
J033075N24ACAGCCCACCACNONE 
Os11g0634200AK066700CCATGGGCTGTConserved hypothetical protein. 
J013073J21CCATGGGCTGTNONE 
Os11g0657200AK059959ACAGCCCATTT2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07AAATGGGCTGTNONE 
AK062752AAATGGGCTGTSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0703900011-004-D05ACAGCCCAAAANONE 
011-014-C03ACAGCCCAAAANONE 
011-016-C01ACAGCCCAAAANONE 
011-017-B04ACAGCCCAAAANONE 
011-017-E09ACAGCCCAAAANONE 
011-019-E12ACAGCCCAAAANONE 
011-021-H12ACAGCCCAAAANONE 
011-025-H02ACAGCCCAAAANONE 
011-027-B09ACAGCCCAAAANONE 
011-039-G07ACAGCCCAAAANONE 
011-044-G07ACAGCCCAAAANONE 
011-046-F11ACAGCCCAAAANONE 
011-070-F02ACAGCCCAAAANONE 
011-071-A07ACAGCCCAAAANONE 
011-082-A03ACAGCCCAAAANONE 
011-086-B09ACAGCCCAAAANONE 
011-092-C04ACAGCCCAAAANONE 
012-006-F02ACAGCCCAAAANONE 
012-011-G08ACAGCCCAAAANONE 
012-026-C06ACAGCCCAAAANONE 
012-026-G06ACAGCCCAAAANONE 
012-028-E05ACAGCCCAAAANONE 
012-040-A05ACAGCCCAAAANONE 
012-045-C01ACAGCCCAAAANONE 
012-046-A10ACAGCCCAAAANONE 
012-047-H09ACAGCCCAAAANONE 
012-059-A12ACAGCCCAAAANONE 
012-072-D06ACAGCCCAAAANONE 
012-073-D05ACAGCCCAAAANONE 
012-076-D08ACAGCCCAAAANONE 
012-079-G05ACAGCCCAAAANONE 
012-080-A04ACAGCCCAAAANONE 
012-080-E01ACAGCCCAAAANONE 
012-083-C03ACAGCCCAAAANONE 
012-083-G06ACAGCCCAAAANONE 
012-086-G02ACAGCCCAAAANONE 
012-091-A07ACAGCCCAAAANONE 
012-094-G10ACAGCCCAAAANONE 
012-098-A07ACAGCCCAAAANONE 
012-100-G04ACAGCCCAAAANONE 
015-001-A11ACAGCCCAAAANONE 
015-033-E01ACAGCCCAAAANONE 
015-047-F12ACAGCCCAAAANONE 
015-054-E05ACAGCCCAAAANONE 
015-063-H02ACAGCCCAAAANONE 
015-075-E10ACAGCCCAAAANONE 
015-086-F05ACAGCCCAAAANONE 
016-031-A08ACAGCCCAAAANONE 
016-053-A03ACAGCCCAAAANONE 
016-054-C09ACAGCCCAAAANONE 
016-079-C08ACAGCCCAAAANONE 
AK065431ACAGCCCAAAAHeat shock protein 70. 
AK119255ACAGCCCAAAANONE 
J013021C12ACAGCCCAAAANONE 
J013021C17ACAGCCCAAAANONE 
J023027B08ACAGCCCAAAANONE 
J023078A21ACAGCCCAAAANONE 
J023097M06ACAGCCCAAAANONE 
J023100O04ACAGCCCAAAANONE 
J023107B17ACAGCCCAAAANONE 
J023108L24ACAGCCCAAAANONE 
J023109L05ACAGCCCAAAANONE 
J033022M22ACAGCCCAAAANONE 
J033023K21ACAGCCCAAAANONE 
J033031L11ACAGCCCAAAANONE 
J033034H10ACAGCCCAAAANONE 
J033037B16ACAGCCCAAAANONE 
J033037F16ACAGCCCAAAANONE 
J033037H07ACAGCCCAAAANONE 
J033046E22ACAGCCCAAAANONE 
J033050N12ACAGCCCAAAANONE 
J033064F10ACAGCCCAAAANONE 
J033064N10ACAGCCCAAAANONE 
J033066O09ACAGCCCAAAANONE 
J033068H01ACAGCCCAAAANONE 
J033068J07ACAGCCCAAAANONE 
J033070B10ACAGCCCAAAANONE 
J033070G13ACAGCCCAAAANONE 
J033073O13ACAGCCCAAAANONE 
J033075B07ACAGCCCAAAANONE 
J033079L15ACAGCCCAAAANONE 
J033081J06ACAGCCCAAAANONE 
J033086G13ACAGCCCAAAANONE 
J033086N07ACAGCCCAAAANONE 
J033086O05ACAGCCCAAAANONE 
J033091A15ACAGCCCAAAANONE 
J033091D05ACAGCCCAAAANONE 
J033094C12ACAGCCCAAAANONE 
J033099P03ACAGCCCAAAANONE 
J033107L09ACAGCCCAAAANONE 
J033108D16ACAGCCCAAAANONE 
J033109E12ACAGCCCAAAANONE 
J033109K14ACAGCCCAAAANONE 
J033112P22ACAGCCCAAAANONE 
J033116F12ACAGCCCAAAANONE 
J033116K01ACAGCCCAAAANONE 
J033118F19ACAGCCCAAAANONE 
J033121J10ACAGCCCAAAANONE 
J033126H04ACAGCCCAAAANONE 
J033131G17ACAGCCCAAAANONE 
J033131L05ACAGCCCAAAANONE 
J033136A08ACAGCCCAAAANONE 
J033136H22ACAGCCCAAAANONE 
J033143F01ACAGCCCAAAANONE 
J065040M10ACAGCCCAAAANONE 
J065046F17ACAGCCCAAAANONE 
J065048G20ACAGCCCAAAANONE 
J065071N06ACAGCCCAAAANONE 
J065084I24ACAGCCCAAAANONE 
J065171B01ACAGCCCAAAANONE 
J065191J21ACAGCCCAAAANONE 
J065199I20ACAGCCCAAAANONE 
J075076C02ACAGCCCAAAANONE 
J090002P12ACAGCCCAAAANONE 
J090003A11ACAGCCCAAAANONE 
J090003H11ACAGCCCAAAANONE 
J090009M22ACAGCCCAAAANONE 
J090009O11ACAGCCCAAAANONE 
J090014N09ACAGCCCAAAANONE 
J090015A18ACAGCCCAAAANONE 
J090016E16ACAGCCCAAAANONE 
J090016I07ACAGCCCAAAANONE 
J090017O07ACAGCCCAAAANONE 
J090019E10ACAGCCCAAAANONE 
J090020D24ACAGCCCAAAANONE 
J090021M16ACAGCCCAAAANONE 
J090022F13ACAGCCCAAAANONE 
J090023H03ACAGCCCAAAANONE 
J090024E15ACAGCCCAAAANONE 
J090024G19ACAGCCCAAAANONE 
J090026J19ACAGCCCAAAANONE 
J090030E20ACAGCCCAAAANONE 
J090030I15ACAGCCCAAAANONE 
J090032F04ACAGCCCAAAANONE 
J090033N22ACAGCCCAAAANONE 
J090033O19ACAGCCCAAAANONE 
J090036F08ACAGCCCAAAANONE 
J090039A13ACAGCCCAAAANONE 
J090042N07ACAGCCCAAAANONE 
J090043C15ACAGCCCAAAANONE 
J090043N09ACAGCCCAAAANONE 
J090053J10ACAGCCCAAAANONE 
J090054F14ACAGCCCAAAANONE 
J090057N12ACAGCCCAAAANONE 
J090061P13ACAGCCCAAAANONE 
J090062F17ACAGCCCAAAANONE 
J090065H15ACAGCCCAAAANONE 
J090067P11ACAGCCCAAAANONE 
J090068M09ACAGCCCAAAANONE 
J090069E24ACAGCCCAAAANONE 
J090069K16ACAGCCCAAAANONE 
J090070N07ACAGCCCAAAANONE 
J090072M09ACAGCCCAAAANONE 
J090075I24ACAGCCCAAAANONE 
J090075M04ACAGCCCAAAANONE 
J090077D24ACAGCCCAAAANONE 
J090080M17ACAGCCCAAAANONE 
J090080O14ACAGCCCAAAANONE 
J090081C12ACAGCCCAAAANONE 
J090084N21ACAGCCCAAAANONE 
J090084O21ACAGCCCAAAANONE 
J090087J18ACAGCCCAAAANONE 
J090092L17ACAGCCCAAAANONE 
J090097A08ACAGCCCAAAANONE 
J100017E24ACAGCCCAAAANONE 
J100018K11ACAGCCCAAAANONE 
J100019A16ACAGCCCAAAANONE 
J100023I23ACAGCCCAAAANONE 
J100024D07ACAGCCCAAAANONE 
J100025H12ACAGCCCAAAANONE 
J100027K19ACAGCCCAAAANONE 
J100028C23ACAGCCCAAAANONE 
J100029A14ACAGCCCAAAANONE 
J100029O19ACAGCCCAAAANONE 
J100030I09ACAGCCCAAAANONE 
J100030J16ACAGCCCAAAANONE 
J100031C01ACAGCCCAAAANONE 
J100031N06ACAGCCCAAAANONE 
J100033H04ACAGCCCAAAANONE 
J100034L20ACAGCCCAAAANONE 
J100036K13ACAGCCCAAAANONE 
J100039M02ACAGCCCAAAANONE 
J100040J01ACAGCCCAAAANONE 
J100042O21ACAGCCCAAAANONE 
J100042P20ACAGCCCAAAANONE 
J100047K22ACAGCCCAAAANONE 
J100049B16ACAGCCCAAAANONE 
J100052M10ACAGCCCAAAANONE 
J100053B05ACAGCCCAAAANONE 
J100053B20ACAGCCCAAAANONE 
J100055I11ACAGCCCAAAANONE 
J100056A13ACAGCCCAAAANONE 
J100057C08ACAGCCCAAAANONE 
J100057N11ACAGCCCAAAANONE 
J100057P07ACAGCCCAAAANONE 
J100059E16ACAGCCCAAAANONE 
J100063N14ACAGCCCAAAANONE 
J100069H01ACAGCCCAAAANONE 
J100071C17ACAGCCCAAAANONE 
J100071K09ACAGCCCAAAANONE 
J100077D07ACAGCCCAAAANONE 
J100078P22ACAGCCCAAAANONE 
J100080F11ACAGCCCAAAANONE 
J100081L07ACAGCCCAAAANONE 
J100083B10ACAGCCCAAAANONE 
J100083K17ACAGCCCAAAANONE 
J100085B22ACAGCCCAAAANONE 
J100085L21ACAGCCCAAAANONE 
J100086B11ACAGCCCAAAANONE 
J100087E06ACAGCCCAAAANONE 
J100087P07ACAGCCCAAAANONE 
J100089H24ACAGCCCAAAANONE 
Os12g0131300J090086B06CTTGGGCTGTHypothetical protein. 
Os12g0156400012-065-D02ACAGCCCACACGTGGCCGTGGGCCCCNONE 
012-065-D02ACAGCCCAGNONE 
AK072086ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK072086ACAGCCCAGNONE 
AK099278ACAGCCCACACGTGGCCGTGGGCCCCDcp1-like decapping family protein. 
AK099278ACAGCCCAGDcp1-like decapping family protein. 
J013063H09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J013063H09ACAGCCCAGNONE 
J023125D09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023125D09ACAGCCCAGNONE 
J023149G21ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023149G21ACAGCCCAGNONE 
J033064E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033064E07ACAGCCCAGNONE 
J033093C07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033093C07ACAGCCCAGNONE 
J033107E06ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033107E06ACAGCCCAGNONE 
J075172A11ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J075172A11ACAGCCCAGNONE 
J090009E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090009E07ACAGCCCAGNONE 
J090023F13ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090023F13ACAGCCCAGNONE 
J090071N18ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090071N18ACAGCCCAGNONE 
Os12g0179700AK068305GCCCATCACAGCCCACCCNONE 
AK120612GCCCATCACAGCCCACCCNONE 
J013146K12GCCCATCACAGCCCACCCNONE 
J023131C17GCCCATCACAGCCCACCCNONE 
J033079I11GCCCATCACAGCCCACCCNONE 
J033125D20GCCCATCACAGCCCACCCNONE 
J090048O13GCCCATCACAGCCCACCCNONE 
J100076M12GCCCATCACAGCCCACCCNONE 
J100079L09GCCCATCACAGCCCACCCNONE 
Os12g0287200009-067-B11ACAGCCCAACTNONE 
009-130-F06ACAGCCCAACTNONE 
009-185-H10ACAGCCCAACTNONE 
AF338343ACAGCCCAACTNONE 
AK063847ACAGCCCAACTSimilar to Mago nashi protein. 
AK121477ACAGCCCAACTNONE 
J023149H05ACAGCCCAACTNONE 
J065019G18ACAGCCCAACTNONE 
J065049J18ACAGCCCAACTNONE 
J065143C22ACAGCCCAACTNONE 
J075130D23ACAGCCCAACTNONE 
J090014I22ACAGCCCAACTNONE 
J090018A06ACAGCCCAACTNONE 
J090053H11ACAGCCCAACTNONE 
J090080N13ACAGCCCAACTNONE 
J100019H19ACAGCCCAACTNONE 
Os12g0477050J065069B06ATTGGGCTGTNONE 
J065105I23ATTGGGCTGTNONE 
J065203F03ATTGGGCTGTNONE 
J075019C20ATTGGGCTGTConserved hypothetical protein. 
J075164G13ATTGGGCTGTNONE 
J075187H10ATTGGGCTGTNONE 
Os12g0488800015-085-F11AAATGGGCTGTNONE 
AK064347AAATGGGCTGTRNA polymerase II, RPB4 domain containing protein. 
J033065H11AAATGGGCTGTNONE 
J033145P10AAATGGGCTGTNONE 
J065137L04AAATGGGCTGTNONE 
J065171P08AAATGGGCTGTNONE 
Os12g0556100J065083C21ACAGCCCATAADrought induced 19 family protein. 
J065124M18ACAGCCCATAANONE 
J100032P22ACAGCCCATAANONE 
J100048N01ACAGCCCATAANONE 
Os12g0590900J100033M15ACAGCCCAATConserved hypothetical protein. 
J100042H14ACAGCCCAATNONE 
J100059P17ACAGCCCAATNONE 
J100062H13ACAGCCCAATNONE 
Os12g0596000AK073530ACAGCCCACGTSimilar to Lipoyltransferase (EC 2.3.1.-) (Lipoyl-[acyl-carrier protein]-protein- N-lipoyltransferase) (Lipoate-protein ligase B). 
AK101541ACAGCCCACGTNONE 
Os12g0609800AK101303ACAGCCCATCACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01ACAGCCCATCANONE 
J033033K21ACAGCCCATCANONE 
J033082L13ACAGCCCATCANONE 
J043034M20ACAGCCCATCANONE 
J065137J24ACAGCCCATCANONE 
J065141A11ACAGCCCATCANONE 
J065217H09ACAGCCCATCANONE 
Os12g0610950J075157D04ACAGCCCAAGHypothetical protein. 
Os12g0630600J100033A04ACAGCCCAAAConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.