version

Summary of OsREG437 (All List)

OrganismOryza sativa  
IDOsREG437  
SequenceACATGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1788  

Entry Sequences (1788 entries)

LocusGene modelSequenceDescription
Os01g0104800AK067602AAAAGCCCATGTSas10/Utp3 family protein. 
J013109E04AAAAGCCCATGTNONE 
J033057M05AAAAGCCCATGTNONE 
J043021M24AAAAGCCCATGTNONE 
J090014N05AAAAGCCCATGTNONE 
J090077H23AAAAGCCCATGTNONE 
J090084H08AAAAGCCCATGTNONE 
Os01g0139600AK073130CCCAGCCCATGTSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0157600AK106766GACAGGTGGGCCCATGTAnkyrin repeat containing protein. 
Os01g0203300015-045-F03ACATGGGCTTCNONE 
AK106329ACATGGGCTTCConserved hypothetical protein. 
Os01g0233500AB024986ACATGGGCTNONE 
AK063476ACATGGGCTCyclin. 
Os01g0513700AK058445ACATGGGCCGCNONE 
AK068877ACATGGGCCGCSybindin-like protein family protein. 
J023001F01ACATGGGCCGCNONE 
J065065I18ACATGGGCCGCNONE 
J065165A09ACATGGGCCGCNONE 
J065184N12ACATGGGCCGCNONE 
J065205M05ACATGGGCCGCNONE 
J075172I17ACATGGGCCGCNONE 
J090025O09ACATGGGCCGCNONE 
J100087H03ACATGGGCCGCNONE 
Os01g0574400AK072509ACATGGGCTSimilar to Cell division protein ftsH (EC 3.4.24.-). 
Os01g0745400AK107872AAAGCCCATGTGGGACCCACSec34-like protein family protein. 
Os01g0757700AK102734ACATGGGCConserved hypothetical protein. 
J033106B06ACATGGGCNONE 
J065025B07ACATGGGCNONE 
J065025B08ACATGGGCNONE 
J065033E12ACATGGGCNONE 
J065197B01ACATGGGCNONE 
Os01g0757800AK099226GCCCATGTNONE 
Os01g0784600AK067527ACATGGGCTAATGGGCCTAConserved hypothetical protein. 
Os01g0801000AK064082ACATGGGCCGGGCCGGANONE 
AK101426ACATGGGCCGGGCCGGASimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0848200AK069425AGCCCATGTSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AK101230AGCCCATGTNONE 
Os01g0862800AK071274GCCCATGTNo apical meristem (NAM) protein domain containing protein. 
Os01g0864100AK064616ACATGGGCConserved hypothetical protein. 
Os01g0936100AK101371ACATGGGCCAGASimilar to Protein kinase. 
Os01g0951800AK069239ACATGGGCTProtein prenyltransferase domain containing protein. 
Os01g0954400003-009-F12ACATGGGCTTTNONE 
012-080-B09ACATGGGCTTTNONE 
AK065709ACATGGGCTTTSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335ACATGGGCTTTNONE 
J013039J02ACATGGGCTTTNONE 
J033081E17ACATGGGCTTTNONE 
J075058B02ACATGGGCTTTNONE 
J075067K19ACATGGGCTTTNONE 
J075120E23ACATGGGCTTTNONE 
J075147I16ACATGGGCTTTNONE 
Os01g0958100AK058574CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
Os01g0962600009-104-A04GAGGCCCATGTNONE 
AK073846GAGGCCCATGTSimilar to 40S ribosomal protein S10-1. 
J033070I05GAGGCCCATGTNONE 
J065079N18GAGGCCCATGTNONE 
J065122H12GAGGCCCATGTNONE 
J065197O14GAGGCCCATGTNONE 
Os02g0109200AK108815CCACTGACACATGGGCCCTNONE 
J100030O18CCACTGACACATGGGCCCTNONE 
Os02g0119700AK108777ACATGGGCProtein prenyltransferase domain containing protein. 
Os02g0121200AK070123GAGGCCCATGTNONE 
AK121751GAGGCCCATGTProtein of unknown function DUF890 family protein. 
Os02g0135600AK069843TGCGGCCCAATTCAGCCCATGTConserved hypothetical protein. 
J023034H09TGCGGCCCAATTCAGCCCATGTNONE 
J033090D08TGCGGCCCAATTCAGCCCATGTNONE 
J100025N07TGCGGCCCAATTCAGCCCATGTNONE 
J100075G18TGCGGCCCAATTCAGCCCATGTNONE 
Os02g0135700AK100570ACATGGGCTGAATTGGGCCGCADNA polymerase V family protein. 
Os02g0169000AK101628TCGGCCCGGCCCATGTConserved hypothetical protein. 
Os02g0179100AK058557ACATGGGCTMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10ACATGGGCTNONE 
Os02g0189900012-074-E11CCTCGCCCATGTNONE 
AK063528CCTCGCCCATGTHepatocellular carcinoma-associated antigen 59 family protein. 
Os02g0198000AK067695AGCCCATGTProtein of unknown function DUF1677, Oryza sativa family protein. 
Os02g0205300006-050-H03ACATGGGCCGGCNONE 
011-057-B04ACATGGGCCGGCNONE 
AB033537ACATGGGCCGGCNONE 
AB052887ACATGGGCCGGCNONE 
AK061762ACATGGGCCGGCNONE 
AK102286ACATGGGCCGGCSimilar to TAT-binding protein homolog (Fragment). 
AK106217ACATGGGCCGGCNONE 
J013000E18ACATGGGCCGGCNONE 
J023030F11ACATGGGCCGGCNONE 
J033030E16ACATGGGCCGGCNONE 
J033061B21ACATGGGCCGGCNONE 
J033086D09ACATGGGCCGGCNONE 
J033089I16ACATGGGCCGGCNONE 
J033132G01ACATGGGCCGGCNONE 
J090003O15ACATGGGCCGGCNONE 
J090004A19ACATGGGCCGGCNONE 
J090054P05ACATGGGCCGGCNONE 
J090083M17ACATGGGCCGGCNONE 
J100039E08ACATGGGCCGGCNONE 
J100058D24ACATGGGCCGGCNONE 
J100066P09ACATGGGCCGGCNONE 
J100086K12ACATGGGCCGGCNONE 
J100088J15ACATGGGCCGGCNONE 
Os02g0241100Os02g0241100GAGGCCCATGTProtein kinase-like domain containing protein. 
Os02g0327500AK069802GCCCATGTProtein of unknown function DUF266, plant family protein. 
J065186I04GCCCATGTNONE 
Os02g0467700AK121672GAGGCCCATGTGlycosyltransferase 28, C-terminal domain containing protein. 
J033068B18GAGGCCCATGTNONE 
J080035D09GAGGCCCATGTNONE 
J080039E21GAGGCCCATGTNONE 
J080054N01GAGGCCCATGTNONE 
J080071C12GAGGCCCATGTNONE 
Os02g0504500AK062243GCCCATGTNONE 
Os02g0581300AK071553ACATGGGCTTRAM, LAG1 and CLN8 homology domain containing protein. 
J023105G15ACATGGGCTNONE 
J065044A01ACATGGGCTNONE 
J065089D11ACATGGGCTNONE 
J065098K16ACATGGGCTNONE 
J065119D04ACATGGGCTNONE 
J065190M10ACATGGGCTNONE 
J090029F16ACATGGGCTNONE 
J090040K10ACATGGGCTNONE 
J090058J09ACATGGGCTNONE 
J090080C19ACATGGGCTNONE 
Os02g0591800AK060611ACATGGGCTAGGCCCACTBrix domain containing protein. 
AK102534ACATGGGCTAGGCCCACTNONE 
J075057H08ACATGGGCTAGGCCCACTNONE 
J075179P18ACATGGGCTAGGCCCACTNONE 
J080011H01ACATGGGCTAGGCCCACTNONE 
J080018E14ACATGGGCTAGGCCCACTNONE 
J080026N17ACATGGGCTAGGCCCACTNONE 
J080047A13ACATGGGCTAGGCCCACTNONE 
J080049C17ACATGGGCTAGGCCCACTNONE 
J080050G07ACATGGGCTAGGCCCACTNONE 
J080064D10ACATGGGCTAGGCCCACTNONE 
J080080A03ACATGGGCTAGGCCCACTNONE 
J080080G20ACATGGGCTAGGCCCACTNONE 
J080080I03ACATGGGCTAGGCCCACTNONE 
J080081H12ACATGGGCTAGGCCCACTNONE 
J080090K07ACATGGGCTAGGCCCACTNONE 
J080092O06ACATGGGCTAGGCCCACTNONE 
J080096B07ACATGGGCTAGGCCCACTNONE 
J080097M08ACATGGGCTAGGCCCACTNONE 
Os02g0618250009-115-E10CCAAGCCCATGTNONE 
014-076-A03CCAAGCCCATGTNONE 
J065096D10CCAAGCCCATGTSimilar to H/ACA ribonucleoprotein complex subunit 3-like protein. 
J075045G01CCAAGCCCATGTNONE 
J075092J11CCAAGCCCATGTNONE 
J075134F02CCAAGCCCATGTNONE 
Os02g0637900AK110708GCTGGGCCATGGCCCATGTConserved hypothetical protein. 
J065038O03GCTGGGCCATGGCCCATGTNONE 
J065052A19GCTGGGCCATGGCCCATGTNONE 
J065052A20GCTGGGCCATGGCCCATGTNONE 
J065063D06GCTGGGCCATGGCCCATGTNONE 
J065069D12GCTGGGCCATGGCCCATGTNONE 
J065074H07GCTGGGCCATGGCCCATGTNONE 
J065174K17GCTGGGCCATGGCCCATGTNONE 
J065215M12GCTGGGCCATGGCCCATGTNONE 
J075007E12GCTGGGCCATGGCCCATGTNONE 
J075057K20GCTGGGCCATGGCCCATGTNONE 
J075119I10GCTGGGCCATGGCCCATGTNONE 
Os02g0638000AK103830ACATGGGCCGAGATCGGCCCAACTNONE 
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein. 
Os02g0767100011-054-E05ACATGGGCCTCNONE 
AK063351ACATGGGCCTCNONE 
AK103640ACATGGGCCTCConserved hypothetical protein. 
J090022G11ACATGGGCCTCNONE 
J090072L18ACATGGGCCTCNONE 
Os02g0769700AK111328ACATGGGCCGAProtein kinase-like domain containing protein. 
Os02g0823400AK105029AGCCCATGTSimilar to S-adenosyl-L-methionine: beta-alanine N-methyltransferase (Fragment). 
J033140N12AGCCCATGTNONE 
J075104C12AGCCCATGTNONE 
J075120E03AGCCCATGTNONE 
J075126M18AGCCCATGTNONE 
J075189P21AGCCCATGTNONE 
Os03g0120300AK066854ACATGGGCCGTGProtein of unknown function DUF1084 family protein. 
AK104882ACATGGGCCGTGNONE 
J013075C10ACATGGGCCGTGNONE 
J090012B18ACATGGGCCGTGNONE 
J090087J08ACATGGGCCGTGNONE 
Os03g0131200AB020502TGCGGCCCATGTNONE 
AK062174TGCGGCCCATGTNONE 
AK066378TGCGGCCCATGTSimilar to Catalase isozyme 2 (EC 1.11.1.6). 
AY339372TGCGGCCCATGTNONE 
J013060B21TGCGGCCCATGTNONE 
J013149P20TGCGGCCCATGTNONE 
J023060E16TGCGGCCCATGTNONE 
J043004A19TGCGGCCCATGTNONE 
J053029N09TGCGGCCCATGTNONE 
J053072I10TGCGGCCCATGTNONE 
J065016G02TGCGGCCCATGTNONE 
J065022E22TGCGGCCCATGTNONE 
J065024K17TGCGGCCCATGTNONE 
J065035E10TGCGGCCCATGTNONE 
J065036D13TGCGGCCCATGTNONE 
J065041E06TGCGGCCCATGTNONE 
J065064H14TGCGGCCCATGTNONE 
J065067I06TGCGGCCCATGTNONE 
J065080C01TGCGGCCCATGTNONE 
J065086K23TGCGGCCCATGTNONE 
J065087L12TGCGGCCCATGTNONE 
J065090I05TGCGGCCCATGTNONE 
J065117E23TGCGGCCCATGTNONE 
J065120A10TGCGGCCCATGTNONE 
J065120L22TGCGGCCCATGTNONE 
J065123F02TGCGGCCCATGTNONE 
J065128G02TGCGGCCCATGTNONE 
J065142B04TGCGGCCCATGTNONE 
J065143K12TGCGGCCCATGTNONE 
J065148B18TGCGGCCCATGTNONE 
J065153C16TGCGGCCCATGTNONE 
J065163J11TGCGGCCCATGTNONE 
J065168L24TGCGGCCCATGTNONE 
J065181J11TGCGGCCCATGTNONE 
J065190F19TGCGGCCCATGTNONE 
J065209E24TGCGGCCCATGTNONE 
J065210G04TGCGGCCCATGTNONE 
J065217H17TGCGGCCCATGTNONE 
J065219I20TGCGGCCCATGTNONE 
J075001M13TGCGGCCCATGTNONE 
J075007B08TGCGGCCCATGTNONE 
J075009I01TGCGGCCCATGTNONE 
J075014C11TGCGGCCCATGTNONE 
J075014L02TGCGGCCCATGTNONE 
J075016E07TGCGGCCCATGTNONE 
J075017J02TGCGGCCCATGTNONE 
J075018F07TGCGGCCCATGTNONE 
J075018N07TGCGGCCCATGTNONE 
J075019B06TGCGGCCCATGTNONE 
J075024F21TGCGGCCCATGTNONE 
J075026B18TGCGGCCCATGTNONE 
J075026M12TGCGGCCCATGTNONE 
J075032B13TGCGGCCCATGTNONE 
J075033O09TGCGGCCCATGTNONE 
J075041A09TGCGGCCCATGTNONE 
J075045L13TGCGGCCCATGTNONE 
J075048N11TGCGGCCCATGTNONE 
J075052A14TGCGGCCCATGTNONE 
J075061B17TGCGGCCCATGTNONE 
J075061I05TGCGGCCCATGTNONE 
J075066I11TGCGGCCCATGTNONE 
J075066P09TGCGGCCCATGTNONE 
J075068F03TGCGGCCCATGTNONE 
J075068P22TGCGGCCCATGTNONE 
J075080I15TGCGGCCCATGTNONE 
J075081I07TGCGGCCCATGTNONE 
J075082K01TGCGGCCCATGTNONE 
J075083A18TGCGGCCCATGTNONE 
J075086O11TGCGGCCCATGTNONE 
J075087E02TGCGGCCCATGTNONE 
J075087M19TGCGGCCCATGTNONE 
J075088G23TGCGGCCCATGTNONE 
J075092K18TGCGGCCCATGTNONE 
J075095H15TGCGGCCCATGTNONE 
J075095K12TGCGGCCCATGTNONE 
J075096L06TGCGGCCCATGTNONE 
J075100H23TGCGGCCCATGTNONE 
J075100K01TGCGGCCCATGTNONE 
J075102K21TGCGGCCCATGTNONE 
J075104F24TGCGGCCCATGTNONE 
J075106C17TGCGGCCCATGTNONE 
J075106E06TGCGGCCCATGTNONE 
J075106M19TGCGGCCCATGTNONE 
J075106O12TGCGGCCCATGTNONE 
J075108I09TGCGGCCCATGTNONE 
J075111M06TGCGGCCCATGTNONE 
J075112E12TGCGGCCCATGTNONE 
J075114C04TGCGGCCCATGTNONE 
J075120A06TGCGGCCCATGTNONE 
J075120D14TGCGGCCCATGTNONE 
J075122P15TGCGGCCCATGTNONE 
J075123A11TGCGGCCCATGTNONE 
J075123L12TGCGGCCCATGTNONE 
J075127G14TGCGGCCCATGTNONE 
J075127H09TGCGGCCCATGTNONE 
J075128M04TGCGGCCCATGTNONE 
J075129J04TGCGGCCCATGTNONE 
J075130J01TGCGGCCCATGTNONE 
J075137N02TGCGGCCCATGTNONE 
J075137O14TGCGGCCCATGTNONE 
J075138H22TGCGGCCCATGTNONE 
J075139P16TGCGGCCCATGTNONE 
J075141G08TGCGGCCCATGTNONE 
J075142C17TGCGGCCCATGTNONE 
J075143B09TGCGGCCCATGTNONE 
J075156I11TGCGGCCCATGTNONE 
J075158M03TGCGGCCCATGTNONE 
J075166I21TGCGGCCCATGTNONE 
J075167C08TGCGGCCCATGTNONE 
J075170C12TGCGGCCCATGTNONE 
J075170F08TGCGGCCCATGTNONE 
J075170G04TGCGGCCCATGTNONE 
J075172N16TGCGGCCCATGTNONE 
J075172P13TGCGGCCCATGTNONE 
J075173G24TGCGGCCCATGTNONE 
J075175D01TGCGGCCCATGTNONE 
J075175K01TGCGGCCCATGTNONE 
J075181O04TGCGGCCCATGTNONE 
J075186A04TGCGGCCCATGTNONE 
J075190B08TGCGGCCCATGTNONE 
J075190M24TGCGGCCCATGTNONE 
J075193D18TGCGGCCCATGTNONE 
J075193H03TGCGGCCCATGTNONE 
J075195N18TGCGGCCCATGTNONE 
J080001N20TGCGGCCCATGTNONE 
J080006K17TGCGGCCCATGTNONE 
J080012I16TGCGGCCCATGTNONE 
J080013K20TGCGGCCCATGTNONE 
J080018N01TGCGGCCCATGTNONE 
J080041G15TGCGGCCCATGTNONE 
J080048L15TGCGGCCCATGTNONE 
J080049A21TGCGGCCCATGTNONE 
J080075G12TGCGGCCCATGTNONE 
J080076O09TGCGGCCCATGTNONE 
J080078P10TGCGGCCCATGTNONE 
J080084D10TGCGGCCCATGTNONE 
J090005N07TGCGGCCCATGTNONE 
Os03g0143400AK073999ACATGGGCCGCASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21ACATGGGCCGCANONE 
J033073C08ACATGGGCCGCANONE 
J033094C19ACATGGGCCGCANONE 
J065017L10ACATGGGCCGCANONE 
J065070H22ACATGGGCCGCANONE 
J065079M09ACATGGGCCGCANONE 
J065091N18ACATGGGCCGCANONE 
J065109N03ACATGGGCCGCANONE 
J065113F05ACATGGGCCGCANONE 
J065135D23ACATGGGCCGCANONE 
J065156L16ACATGGGCCGCANONE 
J065207O04ACATGGGCCGCANONE 
J065208F03ACATGGGCCGCANONE 
J090010M15ACATGGGCCGCANONE 
J090056J18ACATGGGCCGCANONE 
Os03g0179900AK121637GCCCATGTSimilar to Avr9/Cf-9 rapidly elicited protein 44 (Fragment). 
Os03g0196600Os03g0196600ACATGGGCSimilar to Chloroplast serine acetyltransferase. 
Os03g0219400AK100702ACATGGGCCGCGlycoside hydrolase, family 20 protein. 
AK100702ACATGGGCCGTCGlycoside hydrolase, family 20 protein. 
AK121985ACATGGGCCGCNONE 
AK121985ACATGGGCCGTCNONE 
J023114O06ACATGGGCCGCNONE 
J023114O06ACATGGGCCGTCNONE 
J100043M20ACATGGGCCGCNONE 
J100043M20ACATGGGCCGTCNONE 
Os03g0249900AK058379GAGGCCCATGTConserved hypothetical protein. 
Os03g0253100AK119618ACAGCCCATGTPhosphomevalonate kinase Erg8 family protein. 
J033052A14ACAGCCCATGTNONE 
Os03g0279700AK111338GCCCATGTSimilar to ZPT2-12. 
Os03g0282900006-088-H05ACAGCCCAAGAAGGCCCATGTNONE 
006-088-H05ACATGGGCTGATGGGCCGTGNONE 
AK061166ACAGCCCAAGAAGGCCCATGTNONE 
AK061166ACATGGGCTGATGGGCCGTGNONE 
AK102161ACAGCCCAAGAAGGCCCATGTConserved hypothetical protein. 
AK102161ACATGGGCTGATGGGCCGTGConserved hypothetical protein. 
AK104514ACAGCCCAAGAAGGCCCATGTNONE 
AK104514ACATGGGCTGATGGGCCGTGNONE 
Os03g0298800009-079-B10ACATGGGCTGTNONE 
AK103337ACATGGGCTGTSimilar to Spliceosomal protein. 
Os03g0302700006-099-F12AGCCCATGTNONE 
AK112010AGCCCATGTZinc finger, RING-type domain containing protein. 
AK121656AGCCCATGTNONE 
J075090A19AGCCCATGTNONE 
J075148M06AGCCCATGTNONE 
Os03g0324800AK059868ACATGGGCCATNONE 
AK071431ACATGGGCCATHypothetical protein. 
Os03g0343700AK060603ACATGGGCCAGABrix domain containing protein. 
AK102274ACATGGGCCAGANONE 
J033089C06ACATGGGCCAGANONE 
J090089A17ACATGGGCCAGANONE 
Os03g0352800009-030-G08ACATGGGCCGTANONE 
AK059673ACATGGGCCGTASimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17ACATGGGCCGTANONE 
J075050N19ACATGGGCCGTANONE 
J075104J18ACATGGGCCGTANONE 
J075142K05ACATGGGCCGTANONE 
J100050I19ACATGGGCCGTANONE 
J100057N04ACATGGGCCGTANONE 
Os03g0441000AK108726ACATGGGCTTranscription initiation factor TFIID component TAF4 domain containing protein. 
Os03g0566600011-071-A08ACATGGGCCATNONE 
AK063379ACATGGGCCATMethyltransferase FkbM domain containing protein. 
Os03g0578200003-117-B07ACATGGGCCCAATGGGCCCATGANONE 
009-175-C06ACATGGGCCCAATGGGCCCATGANONE 
009-179-H05ACATGGGCCCAATGGGCCCATGANONE 
013-078-G11ACATGGGCCCAATGGGCCCATGANONE 
AK062224ACATGGGCCCAATGGGCCCATGANONE 
AK120432ACATGGGCCCAATGGGCCCATGAConserved hypothetical protein. 
J013096L16ACATGGGCCCAATGGGCCCATGANONE 
J100042G12ACATGGGCCCAATGGGCCCATGANONE 
J100069F04ACATGGGCCCAATGGGCCCATGANONE 
J100073H14ACATGGGCCCAATGGGCCCATGANONE 
Os03g0606200009-030-E09CCCGGCCCATGTNONE 
009-076-H10CCCGGCCCATGTNONE 
009-122-H12CCCGGCCCATGTNONE 
009-153-F09CCCGGCCCATGTNONE 
AB055076CCCGGCCCATGTMitochondrial ATP synthase 6 KD subunit. 
AK072384CCCGGCCCATGTNONE 
AK107928CCCGGCCCATGTNONE 
J023078E13CCCGGCCCATGTNONE 
J053031N01CCCGGCCCATGTNONE 
J053046K19CCCGGCCCATGTNONE 
J053062P07CCCGGCCCATGTNONE 
J053091C23CCCGGCCCATGTNONE 
J053099N19CCCGGCCCATGTNONE 
J065005E06CCCGGCCCATGTNONE 
J065030N03CCCGGCCCATGTNONE 
J065138O21CCCGGCCCATGTNONE 
J065159K03CCCGGCCCATGTNONE 
J075030M08CCCGGCCCATGTNONE 
J080006E23CCCGGCCCATGTNONE 
J080010D10CCCGGCCCATGTNONE 
J080016N17CCCGGCCCATGTNONE 
J080024N09CCCGGCCCATGTNONE 
J080028E23CCCGGCCCATGTNONE 
J080035I11CCCGGCCCATGTNONE 
J080038D15CCCGGCCCATGTNONE 
J080040H08CCCGGCCCATGTNONE 
J080043L04CCCGGCCCATGTNONE 
J080047C06CCCGGCCCATGTNONE 
J080061G04CCCGGCCCATGTNONE 
J080066E10CCCGGCCCATGTNONE 
J080067P03CCCGGCCCATGTNONE 
J080082D07CCCGGCCCATGTNONE 
J080089M13CCCGGCCCATGTNONE 
J080094O09CCCGGCCCATGTNONE 
J080095C24CCCGGCCCATGTNONE 
J080309E21CCCGGCCCATGTNONE 
J090016G15CCCGGCCCATGTNONE 
J090031C20CCCGGCCCATGTNONE 
J090033A15CCCGGCCCATGTNONE 
J090037L07CCCGGCCCATGTNONE 
J090038I10CCCGGCCCATGTNONE 
J090072P19CCCGGCCCATGTNONE 
J100040J02CCCGGCCCATGTNONE 
J100047N05CCCGGCCCATGTNONE 
J100048M10CCCGGCCCATGTNONE 
J100076C02CCCGGCCCATGTNONE 
J100077G23CCCGGCCCATGTNONE 
J100080O08CCCGGCCCATGTNONE 
J100085C06CCCGGCCCATGTNONE 
J100085F16CCCGGCCCATGTNONE 
Os03g0609500Os03g0609500GCGGCCCATGTSimilar to LOB domain protein 39. 
Os03g0646300AK069229GTGGCCCATGTSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0670700009-028-B03GCGGCCCATGTNONE 
009-036-H12GCGGCCCATGTNONE 
009-053-H05GCGGCCCATGTNONE 
009-126-B02GCGGCCCATGTNONE 
009-135-D07GCGGCCCATGTNONE 
009-148-A03GCGGCCCATGTNONE 
009-148-A12GCGGCCCATGTNONE 
009-152-B02GCGGCCCATGTNONE 
009-153-B06GCGGCCCATGTNONE 
009-166-G05GCGGCCCATGTNONE 
009-181-A09GCGGCCCATGTNONE 
011-061-D07GCGGCCCATGTNONE 
012-043-C04GCGGCCCATGTNONE 
013-001-A02GCGGCCCATGTNONE 
013-004-F05GCGGCCCATGTNONE 
013-008-C08GCGGCCCATGTNONE 
013-015-B09GCGGCCCATGTNONE 
013-016-G05GCGGCCCATGTNONE 
013-023-A06GCGGCCCATGTNONE 
013-023-B06GCGGCCCATGTNONE 
013-032-F09GCGGCCCATGTNONE 
013-059-C07GCGGCCCATGTNONE 
013-071-E09GCGGCCCATGTNONE 
013-073-D06GCGGCCCATGTNONE 
013-077-C02GCGGCCCATGTNONE 
013-078-B12GCGGCCCATGTNONE 
013-093-A01GCGGCCCATGTNONE 
014-002-B12GCGGCCCATGTNONE 
014-003-E08GCGGCCCATGTNONE 
014-004-D06GCGGCCCATGTNONE 
014-007-C11GCGGCCCATGTNONE 
014-007-G10GCGGCCCATGTNONE 
014-019-C04GCGGCCCATGTNONE 
014-021-F05GCGGCCCATGTNONE 
014-024-G06GCGGCCCATGTNONE 
014-027-C07GCGGCCCATGTNONE 
014-027-D03GCGGCCCATGTNONE 
014-029-E07GCGGCCCATGTNONE 
014-031-B04GCGGCCCATGTNONE 
014-033-B05GCGGCCCATGTNONE 
014-033-C03GCGGCCCATGTNONE 
014-033-C12GCGGCCCATGTNONE 
014-036-F01GCGGCCCATGTNONE 
014-037-C04GCGGCCCATGTNONE 
014-040-H02GCGGCCCATGTNONE 
014-045-H04GCGGCCCATGTNONE 
014-045-H06GCGGCCCATGTNONE 
014-052-A08GCGGCCCATGTNONE 
014-076-G01GCGGCCCATGTNONE 
014-083-F04GCGGCCCATGTNONE 
014-086-E01GCGGCCCATGTNONE 
014-091-D02GCGGCCCATGTNONE 
014-091-F05GCGGCCCATGTNONE 
014-093-E10GCGGCCCATGTNONE 
014-100-C10GCGGCCCATGTNONE 
015-011-H02GCGGCCCATGTNONE 
015-073-B03GCGGCCCATGTNONE 
AF010579GCGGCCCATGTNONE 
AK059164GCGGCCCATGTSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GCGGCCCATGTNONE 
AK119238GCGGCCCATGTNONE 
AK119242GCGGCCCATGTNONE 
J023037K17GCGGCCCATGTNONE 
J033136F11GCGGCCCATGTNONE 
J065008C13GCGGCCCATGTNONE 
J065032K18GCGGCCCATGTNONE 
J065043N10GCGGCCCATGTNONE 
J065045E06GCGGCCCATGTNONE 
J065046P21GCGGCCCATGTNONE 
J065048J17GCGGCCCATGTNONE 
J065053I23GCGGCCCATGTNONE 
J065053P03GCGGCCCATGTNONE 
J065054C13GCGGCCCATGTNONE 
J065058I17GCGGCCCATGTNONE 
J065061I12GCGGCCCATGTNONE 
J065062E09GCGGCCCATGTNONE 
J065063P04GCGGCCCATGTNONE 
J065068J07GCGGCCCATGTNONE 
J065076D02GCGGCCCATGTNONE 
J065083O07GCGGCCCATGTNONE 
J065090J02GCGGCCCATGTNONE 
J065093N08GCGGCCCATGTNONE 
J065097F02GCGGCCCATGTNONE 
J065112H17GCGGCCCATGTNONE 
J065121B01GCGGCCCATGTNONE 
J065124F12GCGGCCCATGTNONE 
J065130L03GCGGCCCATGTNONE 
J065131K05GCGGCCCATGTNONE 
J065132C06GCGGCCCATGTNONE 
J065135J18GCGGCCCATGTNONE 
J065138J22GCGGCCCATGTNONE 
J065140G21GCGGCCCATGTNONE 
J065161B19GCGGCCCATGTNONE 
J065162F22GCGGCCCATGTNONE 
J065162M09GCGGCCCATGTNONE 
J065163D03GCGGCCCATGTNONE 
J065163O21GCGGCCCATGTNONE 
J065165H11GCGGCCCATGTNONE 
J065165O16GCGGCCCATGTNONE 
J065167N06GCGGCCCATGTNONE 
J065168I08GCGGCCCATGTNONE 
J065170A14GCGGCCCATGTNONE 
J065170L03GCGGCCCATGTNONE 
J065171C08GCGGCCCATGTNONE 
J065173G11GCGGCCCATGTNONE 
J065173M09GCGGCCCATGTNONE 
J065176P07GCGGCCCATGTNONE 
J065178K24GCGGCCCATGTNONE 
J065185O12GCGGCCCATGTNONE 
J065191E02GCGGCCCATGTNONE 
J065204H10GCGGCCCATGTNONE 
J075033C23GCGGCCCATGTNONE 
J075041M21GCGGCCCATGTNONE 
J075043F13GCGGCCCATGTNONE 
J075044D02GCGGCCCATGTNONE 
J075044J15GCGGCCCATGTNONE 
J075048L07GCGGCCCATGTNONE 
J075054G12GCGGCCCATGTNONE 
J075055J10GCGGCCCATGTNONE 
J075059F09GCGGCCCATGTNONE 
J075066M23GCGGCCCATGTNONE 
J075071O09GCGGCCCATGTNONE 
J075085G23GCGGCCCATGTNONE 
J075086B21GCGGCCCATGTNONE 
J075087L18GCGGCCCATGTNONE 
J075087L21GCGGCCCATGTNONE 
J075087N14GCGGCCCATGTNONE 
J075088O13GCGGCCCATGTNONE 
J075089B06GCGGCCCATGTNONE 
J075089E20GCGGCCCATGTNONE 
J075090J01GCGGCCCATGTNONE 
J075090L05GCGGCCCATGTNONE 
J075091G05GCGGCCCATGTNONE 
J075091N06GCGGCCCATGTNONE 
J075093G08GCGGCCCATGTNONE 
J075094C13GCGGCCCATGTNONE 
J075095K01GCGGCCCATGTNONE 
J075096C02GCGGCCCATGTNONE 
J075097L16GCGGCCCATGTNONE 
J075097O10GCGGCCCATGTNONE 
J075098H24GCGGCCCATGTNONE 
J075099H02GCGGCCCATGTNONE 
J075099J11GCGGCCCATGTNONE 
J075099L08GCGGCCCATGTNONE 
J075109I11GCGGCCCATGTNONE 
J075114F03GCGGCCCATGTNONE 
J075121G07GCGGCCCATGTNONE 
J075122D23GCGGCCCATGTNONE 
J075132O07GCGGCCCATGTNONE 
J075141L21GCGGCCCATGTNONE 
J075142I08GCGGCCCATGTNONE 
J075145A06GCGGCCCATGTNONE 
J075147J15GCGGCCCATGTNONE 
J075150B09GCGGCCCATGTNONE 
J075151E07GCGGCCCATGTNONE 
J075161M16GCGGCCCATGTNONE 
J075190I16GCGGCCCATGTNONE 
J075192L05GCGGCCCATGTNONE 
J075192O03GCGGCCCATGTNONE 
J075192O08GCGGCCCATGTNONE 
J075193L12GCGGCCCATGTNONE 
J080001M24GCGGCCCATGTNONE 
J080004E20GCGGCCCATGTNONE 
J080005K15GCGGCCCATGTNONE 
J080005L05GCGGCCCATGTNONE 
J080014P20GCGGCCCATGTNONE 
J080029D12GCGGCCCATGTNONE 
J080030H09GCGGCCCATGTNONE 
J080039G05GCGGCCCATGTNONE 
J080040E18GCGGCCCATGTNONE 
J080041B02GCGGCCCATGTNONE 
J080041E06GCGGCCCATGTNONE 
J080041G05GCGGCCCATGTNONE 
J080041G24GCGGCCCATGTNONE 
J080041H07GCGGCCCATGTNONE 
J080041K03GCGGCCCATGTNONE 
J080047G01GCGGCCCATGTNONE 
J080052E07GCGGCCCATGTNONE 
J080053B15GCGGCCCATGTNONE 
J080053N01GCGGCCCATGTNONE 
J080054I01GCGGCCCATGTNONE 
J080054N02GCGGCCCATGTNONE 
J080063P03GCGGCCCATGTNONE 
J080064E13GCGGCCCATGTNONE 
J080064G13GCGGCCCATGTNONE 
J080065F02GCGGCCCATGTNONE 
J080065G03GCGGCCCATGTNONE 
J080065K17GCGGCCCATGTNONE 
J080067D06GCGGCCCATGTNONE 
J080067H23GCGGCCCATGTNONE 
J080067M15GCGGCCCATGTNONE 
J080068B20GCGGCCCATGTNONE 
J080068G24GCGGCCCATGTNONE 
J080072K19GCGGCCCATGTNONE 
J080076I24GCGGCCCATGTNONE 
J080092F05GCGGCCCATGTNONE 
J080092K14GCGGCCCATGTNONE 
J080092N22GCGGCCCATGTNONE 
J080093K02GCGGCCCATGTNONE 
J080094C08GCGGCCCATGTNONE 
J080094E09GCGGCCCATGTNONE 
J080094E20GCGGCCCATGTNONE 
J080094G08GCGGCCCATGTNONE 
J080094H18GCGGCCCATGTNONE 
J080094P22GCGGCCCATGTNONE 
J080095J23GCGGCCCATGTNONE 
J080096F14GCGGCCCATGTNONE 
J080097A21GCGGCCCATGTNONE 
J080097I07GCGGCCCATGTNONE 
J080097J02GCGGCCCATGTNONE 
J080097K01GCGGCCCATGTNONE 
J080097K03GCGGCCCATGTNONE 
J080305H18GCGGCCCATGTNONE 
J080306G01GCGGCCCATGTNONE 
J080306O08GCGGCCCATGTNONE 
J080311I01GCGGCCCATGTNONE 
J080315N24GCGGCCCATGTNONE 
J090003K21GCGGCCCATGTNONE 
J090008C20GCGGCCCATGTNONE 
J090008K19GCGGCCCATGTNONE 
J090008P13GCGGCCCATGTNONE 
J090015H22GCGGCCCATGTNONE 
J090016M01GCGGCCCATGTNONE 
J090018E13GCGGCCCATGTNONE 
J090018G03GCGGCCCATGTNONE 
J090018L17GCGGCCCATGTNONE 
J090019H11GCGGCCCATGTNONE 
J090021B19GCGGCCCATGTNONE 
J090021K02GCGGCCCATGTNONE 
J090023H15GCGGCCCATGTNONE 
J090034E03GCGGCCCATGTNONE 
J090045D16GCGGCCCATGTNONE 
J090045I06GCGGCCCATGTNONE 
J090047L09GCGGCCCATGTNONE 
J090048B05GCGGCCCATGTNONE 
J090048D11GCGGCCCATGTNONE 
J090048N11GCGGCCCATGTNONE 
J090050F20GCGGCCCATGTNONE 
J090052M20GCGGCCCATGTNONE 
J090083H03GCGGCCCATGTNONE 
J090084C12GCGGCCCATGTNONE 
J090095B05GCGGCCCATGTNONE 
J090095M18GCGGCCCATGTNONE 
J100024I22GCGGCCCATGTNONE 
J100024J12GCGGCCCATGTNONE 
J100024J22GCGGCCCATGTNONE 
J100025F07GCGGCCCATGTNONE 
J100026B13GCGGCCCATGTNONE 
J100027N03GCGGCCCATGTNONE 
J100029F14GCGGCCCATGTNONE 
J100029L20GCGGCCCATGTNONE 
J100032C22GCGGCCCATGTNONE 
J100032I08GCGGCCCATGTNONE 
J100032O05GCGGCCCATGTNONE 
J100033J24GCGGCCCATGTNONE 
J100033L12GCGGCCCATGTNONE 
J100034K06GCGGCCCATGTNONE 
J100037D09GCGGCCCATGTNONE 
J100038H02GCGGCCCATGTNONE 
J100039A12GCGGCCCATGTNONE 
J100039N12GCGGCCCATGTNONE 
J100039O21GCGGCCCATGTNONE 
J100040K05GCGGCCCATGTNONE 
J100042A02GCGGCCCATGTNONE 
J100042A17GCGGCCCATGTNONE 
J100043C15GCGGCCCATGTNONE 
J100044A17GCGGCCCATGTNONE 
J100044E18GCGGCCCATGTNONE 
J100044I11GCGGCCCATGTNONE 
J100044J15GCGGCCCATGTNONE 
J100045E23GCGGCCCATGTNONE 
J100049B18GCGGCCCATGTNONE 
J100050G04GCGGCCCATGTNONE 
J100051D06GCGGCCCATGTNONE 
J100051H20GCGGCCCATGTNONE 
J100052J01GCGGCCCATGTNONE 
J100052K07GCGGCCCATGTNONE 
J100055I01GCGGCCCATGTNONE 
J100057D02GCGGCCCATGTNONE 
J100059G14GCGGCCCATGTNONE 
J100059G21GCGGCCCATGTNONE 
J100059H03GCGGCCCATGTNONE 
J100059H15GCGGCCCATGTNONE 
J100063E13GCGGCCCATGTNONE 
J100063M02GCGGCCCATGTNONE 
J100064B17GCGGCCCATGTNONE 
J100064F11GCGGCCCATGTNONE 
J100066G12GCGGCCCATGTNONE 
J100066H09GCGGCCCATGTNONE 
J100068B12GCGGCCCATGTNONE 
J100068L16GCGGCCCATGTNONE 
J100068M23GCGGCCCATGTNONE 
J100069A02GCGGCCCATGTNONE 
J100069D07GCGGCCCATGTNONE 
J100069M13GCGGCCCATGTNONE 
J100070C07GCGGCCCATGTNONE 
J100070J11GCGGCCCATGTNONE 
J100070L20GCGGCCCATGTNONE 
J100071H10GCGGCCCATGTNONE 
J100072L14GCGGCCCATGTNONE 
J100072N12GCGGCCCATGTNONE 
J100073A21GCGGCCCATGTNONE 
J100074K17GCGGCCCATGTNONE 
J100074M04GCGGCCCATGTNONE 
J100075F11GCGGCCCATGTNONE 
J100076E23GCGGCCCATGTNONE 
J100076G03GCGGCCCATGTNONE 
J100077K01GCGGCCCATGTNONE 
J100077N23GCGGCCCATGTNONE 
J100079H17GCGGCCCATGTNONE 
J100081N01GCGGCCCATGTNONE 
J100082E04GCGGCCCATGTNONE 
J100082K11GCGGCCCATGTNONE 
J100085H23GCGGCCCATGTNONE 
J100086O18GCGGCCCATGTNONE 
J100087F21GCGGCCCATGTNONE 
J100088E02GCGGCCCATGTNONE 
J100088F08GCGGCCCATGTNONE 
J100088G24GCGGCCCATGTNONE 
J100088K20GCGGCCCATGTNONE 
J100089B19GCGGCCCATGTNONE 
J100089K22GCGGCCCATGTNONE 
J100089N22GCGGCCCATGTNONE 
J100089O17GCGGCCCATGTNONE 
J100090N05GCGGCCCATGTNONE 
Os03g0754800AK101584ACATGGGCCGGAMitochondrial substrate carrier family protein. 
J080305A09ACATGGGCCGGANONE 
J080310E24ACATGGGCCGGANONE 
J080310O12ACATGGGCCGGANONE 
J080311N04ACATGGGCCGGANONE 
J080313N20ACATGGGCCGGANONE 
J080317H24ACATGGGCCGGANONE 
Os03g0776900AK107941TATTGGGCCACATGGGCCTCSimilar to DNAJ protein-like. 
J053100E14TATTGGGCCACATGGGCCTCNONE 
J075111A12TATTGGGCCACATGGGCCTCNONE 
Os03g0785500AK067718ACATGGGCCCAAACProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0797000AK073440ACATGGGCTTCSimilar to Indole synthase. 
Os03g0844600AK059168ACATGGGCLipolytic enzyme, G-D-S-L family protein. 
Os03g0851900AK102145ACATGGGCCGAAAFG1-like ATPase family protein. 
J033086B08ACATGGGCCGAANONE 
Os03g0853800006-064-F07CTGGCCCATATCGGCCCATGTNONE 
006-069-B11CTGGCCCATATCGGCCCATGTNONE 
006-104-B10CTGGCCCATATCGGCCCATGTNONE 
AK059849CTGGCCCATATCGGCCCATGTNONE 
AK102872CTGGCCCATATCGGCCCATGTNONE 
AK120043CTGGCCCATATCGGCCCATGTProtein of unknown function DUF1301 family protein. 
J033112B07CTGGCCCATATCGGCCCATGTNONE 
J053059J20CTGGCCCATATCGGCCCATGTNONE 
J065155F15CTGGCCCATATCGGCCCATGTNONE 
Os04g0111250J065075K03ACATGGGCConserved hypothetical protein. 
Os04g0304200AB018443ACATGGGCTTTNONE 
AK067128ACATGGGCTTTSimilar to Nonphototropic hypocotyl protein 1 (EC 2.7.1.37) (Phototropin). 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0481800AK109152ACATGGGCTGTMembrane bound O-acyl transferase, MBOAT family protein. 
J065002K24ACATGGGCTGTNONE 
Os04g0502300009-116-F02TGCGGCCCATGTNONE 
009-130-H06TGCGGCCCATGTNONE 
AK120520TGCGGCCCATGTSimilar to 40S ribosomal protein S11. 
J013124K01TGCGGCCCATGTNONE 
J023102F03TGCGGCCCATGTNONE 
J033094F17TGCGGCCCATGTNONE 
J053054C22TGCGGCCCATGTNONE 
J065024N13TGCGGCCCATGTNONE 
J065083J18TGCGGCCCATGTNONE 
J065132O14TGCGGCCCATGTNONE 
J065156M09TGCGGCCCATGTNONE 
J065176N15TGCGGCCCATGTNONE 
J065208H08TGCGGCCCATGTNONE 
J075054B03TGCGGCCCATGTNONE 
J090053E20TGCGGCCCATGTNONE 
J100075B09TGCGGCCCATGTNONE 
J100089H12TGCGGCCCATGTNONE 
Os04g0506800006-044-G02ACATGGGCTNONE 
AK070719ACATGGGCTGlycosyl transferase, family 29 protein. 
AK104647ACATGGGCTNONE 
AK104762ACATGGGCTNONE 
J013096J11ACATGGGCTNONE 
J023058L14ACATGGGCTNONE 
J065057C09ACATGGGCTNONE 
J065101H18ACATGGGCTNONE 
J065107F03ACATGGGCTNONE 
J065154O19ACATGGGCTNONE 
J065179I09ACATGGGCTNONE 
J065189E21ACATGGGCTNONE 
Os04g0521900009-067-H03GCCCATGTNONE 
AK105173GCCCATGTConserved hypothetical protein. 
Os04g0551300AK103502TAGGCCCATGTSimilar to Growth regulator like protein. 
Os04g0553800AK068076ACATGGGCNONE 
J013159F02ACATGGGCNONE 
Os04g0573900AK101618GGATGGGCCAAGCCCATGTSimilar to Cytochrome P450-like protein. 
AK103182GGATGGGCCAAGCCCATGTNONE 
AK119612GGATGGGCCAAGCCCATGTNONE 
AK120901GGATGGGCCAAGCCCATGTNONE 
Os04g0577000AK073711ACATGGGCTGAUbiquitin fusion degradation protein UFD1 family protein. 
AK119957ACATGGGCTGANONE 
J013127H04ACATGGGCTGANONE 
J033035G06ACATGGGCTGANONE 
J033061G23ACATGGGCTGANONE 
J033127L07ACATGGGCTGANONE 
J065015F17ACATGGGCTGANONE 
J065062G08ACATGGGCTGANONE 
J065132M07ACATGGGCTGANONE 
J065155C12ACATGGGCTGANONE 
J075055I08ACATGGGCTGANONE 
J075140D07ACATGGGCTGANONE 
J090055B21ACATGGGCTGANONE 
J100031D23ACATGGGCTGANONE 
Os04g0610500006-115-C07ATATGGGCTGCAGCCCATGTNONE 
AK066289ATATGGGCTGCAGCCCATGTPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817ATATGGGCTGCAGCCCATGTNONE 
J013096N09ATATGGGCTGCAGCCCATGTNONE 
J023054I11ATATGGGCTGCAGCCCATGTNONE 
J023121P20ATATGGGCTGCAGCCCATGTNONE 
J053039O20ATATGGGCTGCAGCCCATGTNONE 
J053071L20ATATGGGCTGCAGCCCATGTNONE 
J053088H23ATATGGGCTGCAGCCCATGTNONE 
J053096J03ATATGGGCTGCAGCCCATGTNONE 
Os04g0613000AK069804ACATGGGCSimilar to Zinc transporter ZIP1 (Fragment). 
AY323915ACATGGGCNONE 
Os04g0635700009-079-G03AAGGCCCATGTNONE 
AK062025AAGGCCCATGTRibbon-helix-helix domain containing protein. 
AK098916AAGGCCCATGTNONE 
J013002J07AAGGCCCATGTNONE 
J013109L20AAGGCCCATGTNONE 
J023055C07AAGGCCCATGTNONE 
J065036K04AAGGCCCATGTNONE 
J065164G12AAGGCCCATGTNONE 
Os04g0650500AK066690ACATGGGCCGGTConserved hypothetical protein. 
AK104273ACATGGGCCGGTNONE 
Os04g0660600009-113-A11ACATGGGCCCACTTGNONE 
AK120899ACATGGGCCCACTTGATPase, V0 complex, subunit H family protein. 
J023030J05ACATGGGCCCACTTGNONE 
J065068M07ACATGGGCCCACTTGNONE 
J065120G22ACATGGGCCCACTTGNONE 
J065168J18ACATGGGCCCACTTGNONE 
J065211M10ACATGGGCCCACTTGNONE 
J075175E21ACATGGGCCCACTTGNONE 
J090021C06ACATGGGCCCACTTGNONE 
J090032P15ACATGGGCCCACTTGNONE 
J090082E05ACATGGGCCCACTTGNONE 
J100090O11ACATGGGCCCACTTGNONE 
Os04g0663200006-074-D02GCCCATGTNONE 
AK105958GCCCATGTZinc finger, CCCH-type domain containing protein. 
AK111925GCCCATGTNONE 
Os04g0676100Os04g0676100TCTGGGCCTACATGGGCCAGGCCGAAASimilar to Thioredoxin X, chloroplast precursor. 
Os04g0687300AK060617ACATGGGCCAGAHeat shock protein DnaJ, N-terminal domain containing protein. 
J065072M04ACATGGGCCAGANONE 
Os05g0103100AK103317GGGGCCCATGTTranslocon-associated beta family protein. 
J033125H15GGGGCCCATGTNONE 
J065021L01GGGGCCCATGTNONE 
J065029M01GGGGCCCATGTNONE 
J065089F17GGGGCCCATGTNONE 
J065112N04GGGGCCCATGTNONE 
J065163L03GGGGCCCATGTNONE 
J065175B04GGGGCCCATGTNONE 
J065192E02GGGGCCCATGTNONE 
J075046C20GGGGCCCATGTNONE 
J075192A01GGGGCCCATGTNONE 
J100018H13GGGGCCCATGTNONE 
J100067K20GGGGCCCATGTNONE 
J100080N03GGGGCCCATGTNONE 
Os05g0121800AK101222GCCCATGTConserved hypothetical protein. 
J033031D02GCCCATGTNONE 
J065078F10GCCCATGTNONE 
J065151J16GCCCATGTNONE 
J065151K04GCCCATGTNONE 
J090057E18GCCCATGTNONE 
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein. 
Os05g0153400AK108071TAGGCCCAACACGGCCCATGTProtein prenyltransferase domain containing protein. 
Os05g0176600009-151-A09ACATGGGCCGCNONE 
AK071760ACATGGGCCGCConserved hypothetical protein. 
J023110C14ACATGGGCCGCNONE 
J065116G18ACATGGGCCGCNONE 
J065131I04ACATGGGCCGCNONE 
J065163H12ACATGGGCCGCNONE 
J075088L08ACATGGGCCGCNONE 
J075165F17ACATGGGCCGCNONE 
Os05g0267100009-106-H07ACATGGGCTTGNONE 
009-177-H02ACATGGGCTTGNONE 
AK062790ACATGGGCTTGNONE 
AK065811ACATGGGCTTGNONE 
J013026N17ACATGGGCTTGNONE 
J013039F07ACATGGGCTTGNONE 
Os05g0348100006-028-F04ATCGGACGGCCCATGTAGCCCAACTNONE 
009-036-C03ATCGGACGGCCCATGTAGCCCAACTNONE 
009-040-H02ATCGGACGGCCCATGTAGCCCAACTNONE 
009-173-H12ATCGGACGGCCCATGTAGCCCAACTNONE 
AK061434ATCGGACGGCCCATGTAGCCCAACTConserved hypothetical protein. 
J065137N04ATCGGACGGCCCATGTAGCCCAACTNONE 
J065164C10ATCGGACGGCCCATGTAGCCCAACTNONE 
J065210H22ATCGGACGGCCCATGTAGCCCAACTNONE 
Os05g0447000AK108280AATTGGGCTTTTAGCCCATGTSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0488900AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase. 
AK073699TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
AK105459TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080009C06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080021N09TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080041K24TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080058H15TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080064P06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080077B16TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
Os05g0526800016-054-G05ACATGGGCCATNONE 
AK066551ACATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013074J04ACATGGGCCATNONE 
J013095M02ACATGGGCCATNONE 
J065195O21ACATGGGCCATNONE 
Os05g0541900009-130-F05ACATGGGCCAANONE 
009-200-E07ACATGGGCCAANONE 
013-057-G09ACATGGGCCAANONE 
Os05g0558900AK101679ACATGGGCTGGSimilar to Frsb-prov protein. 
J013028M08ACATGGGCTGGNONE 
J013074E16ACATGGGCTGGNONE 
J013096L01ACATGGGCTGGNONE 
J023085M19ACATGGGCTGGNONE 
J033058I10ACATGGGCTGGNONE 
J033091D18ACATGGGCTGGNONE 
J033111H13ACATGGGCTGGNONE 
J033114C18ACATGGGCTGGNONE 
Os05g0559900AK067197ACATGGGCCGTCtRNA-binding arm domain containing protein. 
J013074C15ACATGGGCCGTCNONE 
J013098O16ACATGGGCCGTCNONE 
J033030M01ACATGGGCCGTCNONE 
J090058H12ACATGGGCCGTCNONE 
J090075M06ACATGGGCCGTCNONE 
Os05g0577900016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
Os06g0116400006-082-G06ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK058327ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK105979ACATGGGCTCGGCCCAAGCCACGTCHigh-affinity nickel-transporter family protein. 
J065083I24ACATGGGCTCGGCCCAAGCCACGTCNONE 
J100072O18ACATGGGCTCGGCCCAAGCCACGTCNONE 
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein. 
Os06g0130000AK064427TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK070084TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK119321TATTGGGCTCAGCCCATGAGCCCATGTSimilar to Tobacco mosaic virus helicase domain-binding protein (Fragment). 
Os06g0178900011-082-D06GAGGCCCATGTNONE 
AK066933GAGGCCCATGTVacuolar H+-pyrophosphatase (EC 3.6.1.1) (Ovp2). 
D45384GAGGCCCATGTNONE 
J013025O19GAGGCCCATGTNONE 
J013067J23GAGGCCCATGTNONE 
J013119G12GAGGCCCATGTNONE 
J013119I17GAGGCCCATGTNONE 
J013132B18GAGGCCCATGTNONE 
J023108D14GAGGCCCATGTNONE 
J033034C17GAGGCCCATGTNONE 
J033088E10GAGGCCCATGTNONE 
J065013C19GAGGCCCATGTNONE 
J065047E17GAGGCCCATGTNONE 
J090004E24GAGGCCCATGTNONE 
J090008I11GAGGCCCATGTNONE 
J090011F12GAGGCCCATGTNONE 
J090014D19GAGGCCCATGTNONE 
J090030B11GAGGCCCATGTNONE 
J090038J24GAGGCCCATGTNONE 
J090045I05GAGGCCCATGTNONE 
J090046C11GAGGCCCATGTNONE 
J090046F19GAGGCCCATGTNONE 
J090048G03GAGGCCCATGTNONE 
J090050A14GAGGCCCATGTNONE 
J090051B15GAGGCCCATGTNONE 
J090052E04GAGGCCCATGTNONE 
J090052L10GAGGCCCATGTNONE 
J090071O13GAGGCCCATGTNONE 
J090075F03GAGGCCCATGTNONE 
J090080I15GAGGCCCATGTNONE 
J090088B04GAGGCCCATGTNONE 
J100029D12GAGGCCCATGTNONE 
J100032D14GAGGCCCATGTNONE 
J100037J15GAGGCCCATGTNONE 
J100045D01GAGGCCCATGTNONE 
J100045K04GAGGCCCATGTNONE 
J100053M07GAGGCCCATGTNONE 
J100056F04GAGGCCCATGTNONE 
J100056L21GAGGCCCATGTNONE 
J100073N11GAGGCCCATGTNONE 
J100076O13GAGGCCCATGTNONE 
Os06g0287700AK067966AGGGCCCATGTSimilar to NBS-LRR disease resistance protein homologue (Fragment). 
J013122I17AGGGCCCATGTNONE 
J065038I02AGGGCCCATGTNONE 
J065214J02AGGGCCCATGTNONE 
Os06g0306600006-117-A07ACATGGGCCGTANONE 
AK070763ACATGGGCCGTAEsterase/lipase/thioesterase domain containing protein. 
AK099262ACATGGGCCGTANONE 
AK106075ACATGGGCCGTANONE 
Os06g0316100011-089-C01ACATGGGCCGGGCCCAGGNONE 
015-030-D11ACATGGGCCGGGCCCAGGNONE 
015-044-H10ACATGGGCCGGGCCCAGGNONE 
AK105260ACATGGGCCGGGCCCAGGConserved hypothetical protein. 
AK119646ACATGGGCCGGGCCCAGGNONE 
Os06g0325500011-037-D06AAAGCCCATGTNONE 
011-093-G07AAAGCCCATGTNONE 
AK063974AAAGCCCATGTProtein of unknown function DUF89 family protein. 
AK099286AAAGCCCATGTNONE 
J065124G18AAAGCCCATGTNONE 
J065160K08AAAGCCCATGTNONE 
J065207O08AAAGCCCATGTNONE 
J075011D18AAAGCCCATGTNONE 
J075012D02AAAGCCCATGTNONE 
J075090F13AAAGCCCATGTNONE 
J075164A04AAAGCCCATGTNONE 
J075198I19AAAGCCCATGTNONE 
Os06g0512700J065058D18ACATGGGCSimilar to Thionin Osthi1. 
J065167L19ACATGGGCNONE 
Os06g0513943J065129L04ACATGGGCNONE 
J065158H12ACATGGGCSimilar to Ligatoxin B. 
J065174L04ACATGGGCNONE 
J065191G13ACATGGGCNONE 
Os06g0514800AB072337ACATGGGCThionin Osthi1. 
J065070N22ACATGGGCNONE 
J065108B16ACATGGGCNONE 
J065200G24ACATGGGCNONE 
J065210M14ACATGGGCNONE 
Os06g0638700AK108500ACAGCCCATGTPutative cyclase family protein. 
Os06g0666800AK103209CCAAGCCCACATGGGCCAANONE 
AK107710CCAAGCCCACATGGGCCAAConserved hypothetical protein. 
Os06g0667600AK058606ACATGGGCCTANONE 
AK071621ACATGGGCCTASimilar to Glycine decarboxylase complex H-protein. 
J023101D03ACATGGGCCTANONE 
J033095E17ACATGGGCCTANONE 
J065020B16ACATGGGCCTANONE 
Os06g0673500J100018J12GACGGCCCATGTNONE 
J100072F13GACGGCCCATGTSimilar to Ubiquitin. 
Os06g0682800011-092-E01ACATGGGCCTGANONE 
011-092-E01GCCGGGCCACATGGGCCGGANONE 
AK064816ACATGGGCCTGAZinc finger, CCCH-type domain containing protein. 
AK064816GCCGGGCCACATGGGCCGGAZinc finger, CCCH-type domain containing protein. 
J013000E13ACATGGGCCTGANONE 
J013000E13GCCGGGCCACATGGGCCGGANONE 
J013035J22ACATGGGCCTGANONE 
J013035J22GCCGGGCCACATGGGCCGGANONE 
J013045M06ACATGGGCCTGANONE 
J013045M06GCCGGGCCACATGGGCCGGANONE 
J013120A07ACATGGGCCTGANONE 
J013120A07GCCGGGCCACATGGGCCGGANONE 
J033144H15ACATGGGCCTGANONE 
J033144H15GCCGGGCCACATGGGCCGGANONE 
J033145H15ACATGGGCCTGANONE 
J033145H15GCCGGGCCACATGGGCCGGANONE 
J033145N16ACATGGGCCTGANONE 
J033145N16GCCGGGCCACATGGGCCGGANONE 
J090019J02ACATGGGCCTGANONE 
J090019J02GCCGGGCCACATGGGCCGGANONE 
Os06g0701400013-010-G06ACATGGGCTTTTCATGGGCCAGANONE 
AK121229ACATGGGCTTTTCATGGGCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16ACATGGGCTTTTCATGGGCCAGANONE 
J033023L12ACATGGGCTTTTCATGGGCCAGANONE 
J065043I07ACATGGGCTTTTCATGGGCCAGANONE 
J065049E09ACATGGGCTTTTCATGGGCCAGANONE 
J065054I05ACATGGGCTTTTCATGGGCCAGANONE 
J065072H13ACATGGGCTTTTCATGGGCCAGANONE 
J065073L10ACATGGGCTTTTCATGGGCCAGANONE 
J065079P09ACATGGGCTTTTCATGGGCCAGANONE 
J065112I06ACATGGGCTTTTCATGGGCCAGANONE 
J065167C03ACATGGGCTTTTCATGGGCCAGANONE 
J065167I03ACATGGGCTTTTCATGGGCCAGANONE 
J065176P13ACATGGGCTTTTCATGGGCCAGANONE 
J065205M07ACATGGGCTTTTCATGGGCCAGANONE 
J075018E13ACATGGGCTTTTCATGGGCCAGANONE 
J075021E04ACATGGGCTTTTCATGGGCCAGANONE 
J075038F13ACATGGGCTTTTCATGGGCCAGANONE 
J075051E05ACATGGGCTTTTCATGGGCCAGANONE 
J075067C10ACATGGGCTTTTCATGGGCCAGANONE 
J075079A12ACATGGGCTTTTCATGGGCCAGANONE 
J075084A13ACATGGGCTTTTCATGGGCCAGANONE 
J075103E20ACATGGGCTTTTCATGGGCCAGANONE 
J075116E09ACATGGGCTTTTCATGGGCCAGANONE 
J075118F15ACATGGGCTTTTCATGGGCCAGANONE 
J075121I15ACATGGGCTTTTCATGGGCCAGANONE 
J075129B01ACATGGGCTTTTCATGGGCCAGANONE 
J075138A22ACATGGGCTTTTCATGGGCCAGANONE 
J075159B22ACATGGGCTTTTCATGGGCCAGANONE 
J075165I11ACATGGGCTTTTCATGGGCCAGANONE 
J075186E09ACATGGGCTTTTCATGGGCCAGANONE 
J075190J09ACATGGGCTTTTCATGGGCCAGANONE 
J075191I07ACATGGGCTTTTCATGGGCCAGANONE 
J080301C05ACATGGGCTTTTCATGGGCCAGANONE 
J080302L02ACATGGGCTTTTCATGGGCCAGANONE 
J100035C19ACATGGGCTTTTCATGGGCCAGANONE 
J100059P06ACATGGGCTTTTCATGGGCCAGANONE 
Os06g0702800009-039-E05ACATGGGCCAGNONE 
009-039-E05ACATGGGCCAGGCCCAAATNONE 
AK073948ACATGGGCCAGHypothetical protein. 
AK073948ACATGGGCCAGGCCCAAATHypothetical protein. 
J023108K23ACATGGGCCAGNONE 
J023108K23ACATGGGCCAGGCCCAAATNONE 
J033072H04ACATGGGCCAGNONE 
J033072H04ACATGGGCCAGGCCCAAATNONE 
J065008G05ACATGGGCCAGNONE 
J065008G05ACATGGGCCAGGCCCAAATNONE 
J065128J12ACATGGGCCAGNONE 
J065128J12ACATGGGCCAGGCCCAAATNONE 
J065131A01ACATGGGCCAGNONE 
J065131A01ACATGGGCCAGGCCCAAATNONE 
J065173B12ACATGGGCCAGNONE 
J065173B12ACATGGGCCAGGCCCAAATNONE 
Os06g0709300AK108588ACATGGGCCCACCCFAR1 domain containing protein. 
Os06g0712900AK106648ACATGGGCCGGADihydrouridine synthase, DuS family protein. 
J075055M19ACATGGGCCGGANONE 
J075122I03ACATGGGCCGGANONE 
Os07g0102200AK121572ACATGGGCConserved hypothetical protein. 
Os07g0114550J090025L18AACGGCCCATGTHypothetical protein. 
Os07g0150200009-152-C07AGATGGGCCGGCCCATGTNONE 
AK058680AGATGGGCCGGCCCATGTNONE 
AK121635AGATGGGCCGGCCCATGTSimilar to 40S ribosomal protein S12-1. 
J033051C16AGATGGGCCGGCCCATGTNONE 
J033123H15AGATGGGCCGGCCCATGTNONE 
J065093I01AGATGGGCCGGCCCATGTNONE 
J065197C05AGATGGGCCGGCCCATGTNONE 
J075037B11AGATGGGCCGGCCCATGTNONE 
J075114B08AGATGGGCCGGCCCATGTNONE 
J075123N01AGATGGGCCGGCCCATGTNONE 
J075129O04AGATGGGCCGGCCCATGTNONE 
J075160H17AGATGGGCCGGCCCATGTNONE 
J075166H17AGATGGGCCGGCCCATGTNONE 
J080310F11AGATGGGCCGGCCCATGTNONE 
J080315P11AGATGGGCCGGCCCATGTNONE 
J090025A22AGATGGGCCGGCCCATGTNONE 
Os07g0155200006-036-E03AATTGGGCCCATGTNONE 
006-036-E04AATTGGGCCCATGTNONE 
AK061006AATTGGGCCCATGTProtein of unknown function DUF150 family protein. 
AK104606AATTGGGCCCATGTNONE 
Os07g0418100Os07g0418100GTATGGGCCCATGTProtein of unknown function DUF889, eukaryote family protein. 
Os07g0481100003-130-F04ACAGCCCATGTNONE 
AK062302ACAGCCCATGTProtein of unknown function DUF315 domain containing protein. 
J090048K21ACAGCCCATGTNONE 
Os07g0499900AK109745ACATGGGCCAAGTTGGGCCACCyclin-like F-box domain containing protein. 
Os07g0516200AK061373ACATGGGCTTCSimilar to Endoribonuclease, L-PSP family. 
Os07g0517000016-009-C04ACATGGGCNONE 
AK064167ACATGGGCDEAD/DEAH box helicase domain containing protein. 
J065168N16ACATGGGCNONE 
Os07g0531600015-098-E11ACATGGGCCGANONE 
015-098-E11CCGAGCCGGCCCATGTNONE 
AK067845ACATGGGCCGAPhospholipid/glycerol acyltransferase domain containing protein. 
AK067845CCGAGCCGGCCCATGTPhospholipid/glycerol acyltransferase domain containing protein. 
J013124G01ACATGGGCCGANONE 
J013124G01CCGAGCCGGCCCATGTNONE 
J065008E15ACATGGGCCGANONE 
J065008E15CCGAGCCGGCCCATGTNONE 
J065052K14ACATGGGCCGANONE 
J065052K14CCGAGCCGGCCCATGTNONE 
J065052L13ACATGGGCCGANONE 
J065052L13CCGAGCCGGCCCATGTNONE 
J065058M02ACATGGGCCGANONE 
J065058M02CCGAGCCGGCCCATGTNONE 
J065069M10ACATGGGCCGANONE 
J065069M10CCGAGCCGGCCCATGTNONE 
J065135A14ACATGGGCCGANONE 
J065135A14CCGAGCCGGCCCATGTNONE 
J065168O18ACATGGGCCGANONE 
J065168O18CCGAGCCGGCCCATGTNONE 
J075070D14ACATGGGCCGANONE 
J075070D14CCGAGCCGGCCCATGTNONE 
J075169B16ACATGGGCCGANONE 
J075169B16CCGAGCCGGCCCATGTNONE 
Os07g0558000AK069272ACATGGGCTTANONE 
AK101867ACATGGGCTTAABC-1 domain containing protein. 
Os07g0583000009-007-G05ACATGGGCNONE 
009-190-E05ACATGGGCNONE 
AK121047ACATGGGCRibosome associated membrane RAMP4 family protein. 
J023055F01ACATGGGCNONE 
J023102M16ACATGGGCNONE 
J065014E08ACATGGGCNONE 
J065022K10ACATGGGCNONE 
J065022L10ACATGGGCNONE 
J065108H15ACATGGGCNONE 
J065142D09ACATGGGCNONE 
J065209L19ACATGGGCNONE 
J075063E11ACATGGGCNONE 
J075072D09ACATGGGCNONE 
J075095G11ACATGGGCNONE 
J075112K10ACATGGGCNONE 
J075128I05ACATGGGCNONE 
J075130O07ACATGGGCNONE 
J075137F12ACATGGGCNONE 
J075139O19ACATGGGCNONE 
J075173L21ACATGGGCNONE 
J075194I22ACATGGGCNONE 
J090062I16ACATGGGCNONE 
J100055L14ACATGGGCNONE 
J100058G14ACATGGGCNONE 
J100058H12ACATGGGCNONE 
J100067L21ACATGGGCNONE 
Os07g0626300AK100052CCATGGGCCACGGCCCATGTConserved hypothetical protein. 
Os07g0638300AK101401ACATGGGCCGCNONE 
AK102982ACATGGGCCGCSimilar to 1-Cys peroxiredoxin. 
AY336994ACATGGGCCGCNONE 
D63917ACATGGGCCGCNONE 
J033044N01ACATGGGCCGCNONE 
J033055M23ACATGGGCCGCNONE 
J033057E19ACATGGGCCGCNONE 
J033114I23ACATGGGCCGCNONE 
J033115O22ACATGGGCCGCNONE 
J033120C03ACATGGGCCGCNONE 
J033121H24ACATGGGCCGCNONE 
J043034H13ACATGGGCCGCNONE 
J065029D17ACATGGGCCGCNONE 
J065058P20ACATGGGCCGCNONE 
J065062L08ACATGGGCCGCNONE 
J065082B12ACATGGGCCGCNONE 
J065131K01ACATGGGCCGCNONE 
J065181F09ACATGGGCCGCNONE 
J065200F11ACATGGGCCGCNONE 
J075003I12ACATGGGCCGCNONE 
J075006B18ACATGGGCCGCNONE 
J075013E13ACATGGGCCGCNONE 
J075013I03ACATGGGCCGCNONE 
J075017J08ACATGGGCCGCNONE 
J075019J19ACATGGGCCGCNONE 
J075030G22ACATGGGCCGCNONE 
J075037E04ACATGGGCCGCNONE 
J075048L18ACATGGGCCGCNONE 
J075056A08ACATGGGCCGCNONE 
J075059G05ACATGGGCCGCNONE 
J075062J04ACATGGGCCGCNONE 
J075070F14ACATGGGCCGCNONE 
J075072N23ACATGGGCCGCNONE 
J075085J23ACATGGGCCGCNONE 
J075091L01ACATGGGCCGCNONE 
J075094B10ACATGGGCCGCNONE 
J075098M05ACATGGGCCGCNONE 
J075106B18ACATGGGCCGCNONE 
J075116K24ACATGGGCCGCNONE 
J075136C06ACATGGGCCGCNONE 
J075137I15ACATGGGCCGCNONE 
J075140K14ACATGGGCCGCNONE 
J075147H07ACATGGGCCGCNONE 
J075167I19ACATGGGCCGCNONE 
J075182O03ACATGGGCCGCNONE 
J075188G23ACATGGGCCGCNONE 
J075194C06ACATGGGCCGCNONE 
Os07g0641400009-078-A04TTGGCCCATGTCCAGCCCATCGNONE 
AK062634TTGGCCCATGTCCAGCCCATCGHypothetical protein. 
Os08g0110200AK068841ACATGGGCCATSimilar to Fertility restorer. 
J090071I18ACATGGGCCATNONE 
Os08g0110400AK100025AGTGACACATGGGCCCCACCCCACGCGProtein of unknown function DUF266, plant family protein. 
Os08g0118900AK109749TCGGCCCATGTAdenylate kinase family protein. 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J013149L10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075027H17ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075060F10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
Os08g0127700012-086-F03TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK059350TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK099242TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
J033027J18TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065012F22TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065046N17TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065197B02TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100018P04TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100052C14TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100083A12TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
Os08g0156900AJ605583AAAGCCCATGTNONE 
AK073344AAAGCCCATGTSpo11/DNA topoisomerase VI, subunit A family protein. 
AK106397AAAGCCCATGTNONE 
Os08g0158900AK067062ACATGGGCCGGAGTP1/OBG domain containing protein. 
J013089F04ACATGGGCCGGANONE 
J013092D16ACATGGGCCGGANONE 
J033120K14ACATGGGCCGGANONE 
J033133F24ACATGGGCCGGANONE 
J033145A10ACATGGGCCGGANONE 
J033145A11ACATGGGCCGGANONE 
J053048H24ACATGGGCCGGANONE 
J053075H10ACATGGGCCGGANONE 
Os08g0159000AK073617TCCGGCCCATGTNONE 
AK103973TCCGGCCCATGTSimilar to DnaJ homolog subfamily C member 1. 
J023130H14TCCGGCCCATGTNONE 
J033051J11TCCGGCCCATGTNONE 
J065101C10TCCGGCCCATGTNONE 
J065168B04TCCGGCCCATGTNONE 
J065184E22TCCGGCCCATGTNONE 
J080021D11TCCGGCCCATGTNONE 
J080025H10TCCGGCCCATGTNONE 
J080026N19TCCGGCCCATGTNONE 
J080034A12TCCGGCCCATGTNONE 
J080040L02TCCGGCCCATGTNONE 
J080042H19TCCGGCCCATGTNONE 
J080047B05TCCGGCCCATGTNONE 
J080047E09TCCGGCCCATGTNONE 
J080047I01TCCGGCCCATGTNONE 
J080052H19TCCGGCCCATGTNONE 
J080062K13TCCGGCCCATGTNONE 
J080063A22TCCGGCCCATGTNONE 
J080068G18TCCGGCCCATGTNONE 
J080068N19TCCGGCCCATGTNONE 
J080076G08TCCGGCCCATGTNONE 
J080077H13TCCGGCCCATGTNONE 
J080077K06TCCGGCCCATGTNONE 
J080093D15TCCGGCCCATGTNONE 
J080094D21TCCGGCCCATGTNONE 
J080097A20TCCGGCCCATGTNONE 
J080097E21TCCGGCCCATGTNONE 
J080097N17TCCGGCCCATGTNONE 
J100071K18TCCGGCCCATGTNONE 
J100072F09TCCGGCCCATGTNONE 
Os08g0191900AK067587CGTGTGGGGCCCATGTGGGGCCCATTProtein prenyltransferase domain containing protein. 
AK099016CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013032I08CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013050I24CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013128E05CGTGTGGGGCCCATGTGGGGCCCATTNONE 
Os08g0260600AK108529CCCAGCCCATGCCCATGTCD9/CD37/CD63 antigen family protein. 
Os08g0346400003-103-D08ACATGGGCTTTTNONE 
009-135-G12ACATGGGCTTTTNONE 
AK059644ACATGGGCTTTTNONE 
AK062928ACATGGGCTTTTNONE 
AK103873ACATGGGCTTTTSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
J033149L11ACATGGGCTTTTNONE 
J065137E08ACATGGGCTTTTNONE 
J065194M22ACATGGGCTTTTNONE 
J075083O16ACATGGGCTTTTNONE 
Os08g0435800AK121712ACATGGGCTGGSimilar to Lipoate protein ligase-like protein. 
J065121P15ACATGGGCTGGNONE 
Os08g0439900AK110628TGTGGGGCCCATGTGGGTCCCACMitochondrial glycoprotein family protein. 
J065118D13TGTGGGGCCCATGTGGGTCCCACNONE 
Os08g0450800AK102479GAGGCCCATGTPhosphatidylinositol-4-phosphate 5-kinase family protein. 
Os08g0461300AK065651GTGGCCCATGTCyclin-like F-box domain containing protein. 
Os08g0558000J080005K14ACATGGGCCACNONE 
Os09g0115400AK067816GGACACGTGCACGGCCCATGTNONE 
AK101706GGACACGTGCACGGCCCATGTSimilar to Poly(A)-binding protein. 
Os09g0115500006-023-A12CGATGGGCCCATGTNONE 
006-023-A12GCCCATGTNONE 
006-042-G01CGATGGGCCCATGTNONE 
006-042-G01GCCCATGTNONE 
AK061717CGATGGGCCCATGTCBS domain containing protein. 
AK061717GCCCATGTCBS domain containing protein. 
AK065986CGATGGGCCCATGTNONE 
AK065986GCCCATGTNONE 
J013043C13CGATGGGCCCATGTNONE 
J013043C13GCCCATGTNONE 
J013111D13CGATGGGCCCATGTNONE 
J013111D13GCCCATGTNONE 
J023114K12CGATGGGCCCATGTNONE 
J023114K12GCCCATGTNONE 
J065102N18CGATGGGCCCATGTNONE 
J065102N18GCCCATGTNONE 
Os09g0269900AK064489GCCCATGTConserved hypothetical protein. 
Os09g0332100009-067-H06ACATGGGCCGCNONE 
009-092-B11ACATGGGCCGCNONE 
009-094-D10ACATGGGCCGCNONE 
009-095-C09ACATGGGCCGCNONE 
009-147-F07ACATGGGCCGCNONE 
AK069759ACATGGGCCGCConserved hypothetical protein. 
J080092G16ACATGGGCCGCNONE 
J090053I07ACATGGGCCGCNONE 
Os09g0363700AK103667ACATGGGCCTCConserved hypothetical protein. 
J075001L14ACATGGGCCTCNONE 
J075049M23ACATGGGCCTCNONE 
J075051I04ACATGGGCCTCNONE 
J075073L04ACATGGGCCTCNONE 
J075077E03ACATGGGCCTCNONE 
J075083J11ACATGGGCCTCNONE 
J075094J22ACATGGGCCTCNONE 
J075112E08ACATGGGCCTCNONE 
J075137J23ACATGGGCCTCNONE 
J075192E02ACATGGGCCTCNONE 
J100039K04ACATGGGCCTCNONE 
Os09g0385300AK073247GTGGCCCATGTHypothetical protein. 
AK120455GTGGCCCATGTNONE 
J013104G23GTGGCCCATGTNONE 
J023110A14GTGGCCCATGTNONE 
J033143F07GTGGCCCATGTNONE 
J065036P14GTGGCCCATGTNONE 
J065041I11GTGGCCCATGTNONE 
J065103K11GTGGCCCATGTNONE 
J065138M15GTGGCCCATGTNONE 
J065138P09GTGGCCCATGTNONE 
J065141J20GTGGCCCATGTNONE 
J075063J16GTGGCCCATGTNONE 
J075063K19GTGGCCCATGTNONE 
J075085H08GTGGCCCATGTNONE 
J075093C12GTGGCCCATGTNONE 
J075127N08GTGGCCCATGTNONE 
J075134E09GTGGCCCATGTNONE 
J075166D06GTGGCCCATGTNONE 
J075168K24GTGGCCCATGTNONE 
J075197G05GTGGCCCATGTNONE 
J080034J24GTGGCCCATGTNONE 
Os09g0395400AK109221ATGGCCCATGTGGCCCAAGConserved hypothetical protein. 
J075009I06ATGGCCCATGTGGCCCAAGNONE 
Os09g0419500016-067-D11TTGGCCCATGTNONE 
AK064394TTGGCCCATGTZinc finger, RING-type domain containing protein. 
AK073786TTGGCCCATGTNONE 
J033067G01TTGGCCCATGTNONE 
Os09g0459800AK060764ACATGGGCCGAANONE 
AK100324ACATGGGCCGAASimilar to ARP protein. 
AK102736ACATGGGCCGAANONE 
Os09g0464000AK060777ACATGGGCCCACGANONE 
AK069530ACATGGGCCCACGASimilar to Carbonate dehydratase-like protein. 
Os09g0478400AK107794ACATGGGCConserved hypothetical protein. 
J065082F04ACATGGGCNONE 
Os09g0532600J013002F02TTTGGGCCAAGCCCATGTNONE 
Os09g0532800J065167K16CCAAGCCCATGTProtein prenyltransferase domain containing protein. 
Os09g0549700J053039F06TAATGGGCTTTCGGCCCATGTNONE 
J065089F23TAATGGGCTTTCGGCCCATGTRibosomal protein L18P/L5E family protein. 
J065090G14TAATGGGCTTTCGGCCCATGTNONE 
J065093M17TAATGGGCTTTCGGCCCATGTNONE 
J065096L23TAATGGGCTTTCGGCCCATGTNONE 
J065152A18TAATGGGCTTTCGGCCCATGTNONE 
J065155H12TAATGGGCTTTCGGCCCATGTNONE 
Os09g0560600AK070937ACATGGGCCCCACACProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
J013112M13ACATGGGCCCCACACNONE 
J013151P14ACATGGGCCCCACACNONE 
J023022E01ACATGGGCCCCACACNONE 
J023068C02ACATGGGCCCCACACNONE 
J023107O13ACATGGGCCCCACACNONE 
Os09g0563800AK068364ACATGGGCCTTConserved hypothetical protein. 
J075156H12ACATGGGCCTTNONE 
Os09g0569400AK063384GCCCGGCCCATGTBeta-lactamase-like domain containing protein. 
AK070608GCCCGGCCCATGTNONE 
Os11g0100100009-122-C12ACATGGGCTGGGCTSimilar to Gamma-aminobutyric acid receptor-associated protein-like 2 (GABA(A) receptor-associated protein-like 2) (Ganglioside expression factor 2) (GEF-2) (General protein transport factor p16) (MAP1 light chain 3 related protein). 
Os11g0130300AK059597ACATGGGCCTTGNse1 non-SMC component of SMC5-6 complex family protein. 
AK101224ACATGGGCCTTGNONE 
J033031D09ACATGGGCCTTGNONE 
J033135B02ACATGGGCCTTGNONE 
J100021A17ACATGGGCCTTGNONE 
J100066G09ACATGGGCCTTGNONE 
Os11g0146700AK065900AGCCCATGTNONE 
AK072412AGCCCATGTRED-like, C-terminal family protein. 
Os11g0147800005-013-G01GCCCATGTNONE 
006-022-F04GCCCATGTNONE 
006-029-E06GCCCATGTNONE 
006-036-H09GCCCATGTNONE 
006-043-F11GCCCATGTNONE 
006-045-G11GCCCATGTNONE 
006-062-C07GCCCATGTNONE 
006-062-G04GCCCATGTNONE 
006-063-C01GCCCATGTNONE 
006-065-A03GCCCATGTNONE 
006-074-E02GCCCATGTNONE 
006-076-H11GCCCATGTNONE 
006-078-E12GCCCATGTNONE 
006-098-A12GCCCATGTNONE 
006-103-B01GCCCATGTNONE 
006-107-C01GCCCATGTNONE 
006-111-D09GCCCATGTNONE 
006-113-H09GCCCATGTNONE 
006-118-D07GCCCATGTNONE 
006-120-B04GCCCATGTNONE 
009-064-G07GCCCATGTNONE 
009-200-A06GCCCATGTNONE 
AK071762GCCCATGTNONE 
AK102998GCCCATGTNONE 
AK104445GCCCATGTNONE 
AK105169GCCCATGTNONE 
AK119185GCCCATGTSimilar to Wali7 protein (Fragment). 
Os11g0148600AK100066ACATGGGCCGAGConserved hypothetical protein. 
AK102442ACATGGGCCGAGNONE 
J065167F17ACATGGGCCGAGNONE 
Os11g0175500015-087-F02TCAGGCCCATGAAAGCCCATGTNONE 
AK064320TCAGGCCCATGAAAGCCCATGTZinc finger, RING-type domain containing protein. 
AK101592TCAGGCCCATGAAAGCCCATGTNONE 
Os11g0543100AK108274ACATGGGCTTTTConserved hypothetical protein. 
Os11g0629200AK065196ACATGGGCCAASimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os11g0682600J090026G08TGTGGGGCCCATGTGGGCTConserved hypothetical protein. 
J090037N19TGTGGGGCCCATGTGGGCTNONE 
J090061M21TGTGGGGCCCATGTGGGCTNONE 
Os11g0703900011-004-D05CTCGGCCCATGTNONE 
011-014-C03CTCGGCCCATGTNONE 
011-016-C01CTCGGCCCATGTNONE 
011-017-B04CTCGGCCCATGTNONE 
011-017-E09CTCGGCCCATGTNONE 
011-019-E12CTCGGCCCATGTNONE 
011-021-H12CTCGGCCCATGTNONE 
011-025-H02CTCGGCCCATGTNONE 
011-027-B09CTCGGCCCATGTNONE 
011-039-G07CTCGGCCCATGTNONE 
011-044-G07CTCGGCCCATGTNONE 
011-046-F11CTCGGCCCATGTNONE 
011-070-F02CTCGGCCCATGTNONE 
011-071-A07CTCGGCCCATGTNONE 
011-082-A03CTCGGCCCATGTNONE 
011-086-B09CTCGGCCCATGTNONE 
011-092-C04CTCGGCCCATGTNONE 
012-006-F02CTCGGCCCATGTNONE 
012-011-G08CTCGGCCCATGTNONE 
012-026-C06CTCGGCCCATGTNONE 
012-026-G06CTCGGCCCATGTNONE 
012-028-E05CTCGGCCCATGTNONE 
012-040-A05CTCGGCCCATGTNONE 
012-045-C01CTCGGCCCATGTNONE 
012-046-A10CTCGGCCCATGTNONE 
012-047-H09CTCGGCCCATGTNONE 
012-059-A12CTCGGCCCATGTNONE 
012-072-D06CTCGGCCCATGTNONE 
012-073-D05CTCGGCCCATGTNONE 
012-076-D08CTCGGCCCATGTNONE 
012-079-G05CTCGGCCCATGTNONE 
012-080-A04CTCGGCCCATGTNONE 
012-080-E01CTCGGCCCATGTNONE 
012-083-C03CTCGGCCCATGTNONE 
012-083-G06CTCGGCCCATGTNONE 
012-086-G02CTCGGCCCATGTNONE 
012-091-A07CTCGGCCCATGTNONE 
012-094-G10CTCGGCCCATGTNONE 
012-098-A07CTCGGCCCATGTNONE 
012-100-G04CTCGGCCCATGTNONE 
015-001-A11CTCGGCCCATGTNONE 
015-033-E01CTCGGCCCATGTNONE 
015-047-F12CTCGGCCCATGTNONE 
015-054-E05CTCGGCCCATGTNONE 
015-063-H02CTCGGCCCATGTNONE 
015-075-E10CTCGGCCCATGTNONE 
015-086-F05CTCGGCCCATGTNONE 
016-031-A08CTCGGCCCATGTNONE 
016-053-A03CTCGGCCCATGTNONE 
016-054-C09CTCGGCCCATGTNONE 
016-079-C08CTCGGCCCATGTNONE 
AK065431CTCGGCCCATGTHeat shock protein 70. 
AK119255CTCGGCCCATGTNONE 
J013021C12CTCGGCCCATGTNONE 
J013021C17CTCGGCCCATGTNONE 
J023027B08CTCGGCCCATGTNONE 
J023078A21CTCGGCCCATGTNONE 
J023097M06CTCGGCCCATGTNONE 
J023100O04CTCGGCCCATGTNONE 
J023107B17CTCGGCCCATGTNONE 
J023108L24CTCGGCCCATGTNONE 
J023109L05CTCGGCCCATGTNONE 
J033022M22CTCGGCCCATGTNONE 
J033023K21CTCGGCCCATGTNONE 
J033031L11CTCGGCCCATGTNONE 
J033034H10CTCGGCCCATGTNONE 
J033037B16CTCGGCCCATGTNONE 
J033037F16CTCGGCCCATGTNONE 
J033037H07CTCGGCCCATGTNONE 
J033046E22CTCGGCCCATGTNONE 
J033050N12CTCGGCCCATGTNONE 
J033064F10CTCGGCCCATGTNONE 
J033064N10CTCGGCCCATGTNONE 
J033066O09CTCGGCCCATGTNONE 
J033068H01CTCGGCCCATGTNONE 
J033068J07CTCGGCCCATGTNONE 
J033070B10CTCGGCCCATGTNONE 
J033070G13CTCGGCCCATGTNONE 
J033073O13CTCGGCCCATGTNONE 
J033075B07CTCGGCCCATGTNONE 
J033079L15CTCGGCCCATGTNONE 
J033081J06CTCGGCCCATGTNONE 
J033086G13CTCGGCCCATGTNONE 
J033086N07CTCGGCCCATGTNONE 
J033086O05CTCGGCCCATGTNONE 
J033091A15CTCGGCCCATGTNONE 
J033091D05CTCGGCCCATGTNONE 
J033094C12CTCGGCCCATGTNONE 
J033099P03CTCGGCCCATGTNONE 
J033107L09CTCGGCCCATGTNONE 
J033108D16CTCGGCCCATGTNONE 
J033109E12CTCGGCCCATGTNONE 
J033109K14CTCGGCCCATGTNONE 
J033112P22CTCGGCCCATGTNONE 
J033116F12CTCGGCCCATGTNONE 
J033116K01CTCGGCCCATGTNONE 
J033118F19CTCGGCCCATGTNONE 
J033121J10CTCGGCCCATGTNONE 
J033126H04CTCGGCCCATGTNONE 
J033131G17CTCGGCCCATGTNONE 
J033131L05CTCGGCCCATGTNONE 
J033136A08CTCGGCCCATGTNONE 
J033136H22CTCGGCCCATGTNONE 
J033143F01CTCGGCCCATGTNONE 
J065040M10CTCGGCCCATGTNONE 
J065046F17CTCGGCCCATGTNONE 
J065048G20CTCGGCCCATGTNONE 
J065071N06CTCGGCCCATGTNONE 
J065084I24CTCGGCCCATGTNONE 
J065171B01CTCGGCCCATGTNONE 
J065191J21CTCGGCCCATGTNONE 
J065199I20CTCGGCCCATGTNONE 
J075076C02CTCGGCCCATGTNONE 
J090002P12CTCGGCCCATGTNONE 
J090003A11CTCGGCCCATGTNONE 
J090003H11CTCGGCCCATGTNONE 
J090009M22CTCGGCCCATGTNONE 
J090009O11CTCGGCCCATGTNONE 
J090014N09CTCGGCCCATGTNONE 
J090015A18CTCGGCCCATGTNONE 
J090016E16CTCGGCCCATGTNONE 
J090016I07CTCGGCCCATGTNONE 
J090017O07CTCGGCCCATGTNONE 
J090019E10CTCGGCCCATGTNONE 
J090020D24CTCGGCCCATGTNONE 
J090021M16CTCGGCCCATGTNONE 
J090022F13CTCGGCCCATGTNONE 
J090023H03CTCGGCCCATGTNONE 
J090024E15CTCGGCCCATGTNONE 
J090024G19CTCGGCCCATGTNONE 
J090026J19CTCGGCCCATGTNONE 
J090030E20CTCGGCCCATGTNONE 
J090030I15CTCGGCCCATGTNONE 
J090032F04CTCGGCCCATGTNONE 
J090033N22CTCGGCCCATGTNONE 
J090033O19CTCGGCCCATGTNONE 
J090036F08CTCGGCCCATGTNONE 
J090039A13CTCGGCCCATGTNONE 
J090042N07CTCGGCCCATGTNONE 
J090043C15CTCGGCCCATGTNONE 
J090043N09CTCGGCCCATGTNONE 
J090053J10CTCGGCCCATGTNONE 
J090054F14CTCGGCCCATGTNONE 
J090057N12CTCGGCCCATGTNONE 
J090061P13CTCGGCCCATGTNONE 
J090062F17CTCGGCCCATGTNONE 
J090065H15CTCGGCCCATGTNONE 
J090067P11CTCGGCCCATGTNONE 
J090068M09CTCGGCCCATGTNONE 
J090069E24CTCGGCCCATGTNONE 
J090069K16CTCGGCCCATGTNONE 
J090070N07CTCGGCCCATGTNONE 
J090072M09CTCGGCCCATGTNONE 
J090075I24CTCGGCCCATGTNONE 
J090075M04CTCGGCCCATGTNONE 
J090077D24CTCGGCCCATGTNONE 
J090080M17CTCGGCCCATGTNONE 
J090080O14CTCGGCCCATGTNONE 
J090081C12CTCGGCCCATGTNONE 
J090084N21CTCGGCCCATGTNONE 
J090084O21CTCGGCCCATGTNONE 
J090087J18CTCGGCCCATGTNONE 
J090092L17CTCGGCCCATGTNONE 
J090097A08CTCGGCCCATGTNONE 
J100017E24CTCGGCCCATGTNONE 
J100018K11CTCGGCCCATGTNONE 
J100019A16CTCGGCCCATGTNONE 
J100023I23CTCGGCCCATGTNONE 
J100024D07CTCGGCCCATGTNONE 
J100025H12CTCGGCCCATGTNONE 
J100027K19CTCGGCCCATGTNONE 
J100028C23CTCGGCCCATGTNONE 
J100029A14CTCGGCCCATGTNONE 
J100029O19CTCGGCCCATGTNONE 
J100030I09CTCGGCCCATGTNONE 
J100030J16CTCGGCCCATGTNONE 
J100031C01CTCGGCCCATGTNONE 
J100031N06CTCGGCCCATGTNONE 
J100033H04CTCGGCCCATGTNONE 
J100034L20CTCGGCCCATGTNONE 
J100036K13CTCGGCCCATGTNONE 
J100039M02CTCGGCCCATGTNONE 
J100040J01CTCGGCCCATGTNONE 
J100042O21CTCGGCCCATGTNONE 
J100042P20CTCGGCCCATGTNONE 
J100047K22CTCGGCCCATGTNONE 
J100049B16CTCGGCCCATGTNONE 
J100052M10CTCGGCCCATGTNONE 
J100053B05CTCGGCCCATGTNONE 
J100053B20CTCGGCCCATGTNONE 
J100055I11CTCGGCCCATGTNONE 
J100056A13CTCGGCCCATGTNONE 
J100057C08CTCGGCCCATGTNONE 
J100057N11CTCGGCCCATGTNONE 
J100057P07CTCGGCCCATGTNONE 
J100059E16CTCGGCCCATGTNONE 
J100063N14CTCGGCCCATGTNONE 
J100069H01CTCGGCCCATGTNONE 
J100071C17CTCGGCCCATGTNONE 
J100071K09CTCGGCCCATGTNONE 
J100077D07CTCGGCCCATGTNONE 
J100078P22CTCGGCCCATGTNONE 
J100080F11CTCGGCCCATGTNONE 
J100081L07CTCGGCCCATGTNONE 
J100083B10CTCGGCCCATGTNONE 
J100083K17CTCGGCCCATGTNONE 
J100085B22CTCGGCCCATGTNONE 
J100085L21CTCGGCCCATGTNONE 
J100086B11CTCGGCCCATGTNONE 
J100087E06CTCGGCCCATGTNONE 
J100087P07CTCGGCCCATGTNONE 
J100089H24CTCGGCCCATGTNONE 
Os12g0100050Os12g0100050ACATGGGCTGGGCTGGGCTGGGCTLight chain 3 (LC3) family protein. 
Os12g0100100006-036-G03AGCCCAGCCCAGCCCAGCCCATGTNONE 
AK061492AGCCCAGCCCAGCCCAGCCCATGTSimilar to ALY protein. 
AK068452AGCCCAGCCCAGCCCAGCCCATGTNONE 
J013153E18AGCCCAGCCCAGCCCAGCCCATGTNONE 
J033140D06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065046A19AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065061F08AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065101I03AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065158B05AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065162H06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065195I23AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065218E07AGCCCAGCCCAGCCCAGCCCATGTNONE 
Os12g0102100J013134H02ACATGGGCAlcohol dehydrogenase superfamily, zinc-containing protein. 
Os12g0120000011-024-E09ACATGGGCCGAAANONE 
AK105399ACATGGGCCGAAAProtein of unknown function DUF936, plant family protein. 
Os12g0124700AK073156TGCGGCCCATGTCDC45-like protein family protein. 
J090013O22TGCGGCCCATGTNONE 
Os12g0132300AK111834GCCCATGTSimilar to Calmodulin (CaM). 
AK119956GCCCATGTNONE 
Os12g0133600AK103096GAGGCCCATGTConserved hypothetical protein. 
J033118M03GAGGCCCATGTNONE 
Os12g0146300J065162K17TGTTGGGCTTTACATGGGCCGAGHypothetical protein. 
Os12g0223300006-037-D03GCGGCCCATGTNONE 
AJ429043GCGGCCCATGTNONE 
AK060133GCGGCCCATGTSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK073017GCGGCCCATGTNONE 
J065085K05GCGGCCCATGTNONE 
J075053C01GCGGCCCATGTNONE 
J075055O06GCGGCCCATGTNONE 
J075073B01GCGGCCCATGTNONE 
J075089M07GCGGCCCATGTNONE 
J075095E16GCGGCCCATGTNONE 
J075112O19GCGGCCCATGTNONE 
J075143A11GCGGCCCATGTNONE 
J075173D24GCGGCCCATGTNONE 
J075199G18GCGGCCCATGTNONE 
J090030N06GCGGCCCATGTNONE 
J100052H12GCGGCCCATGTNONE 
J100079F09GCGGCCCATGTNONE 
Os12g0270300AK070311GCCCATGTDisease resistance protein family protein. 
AK103036GCCCATGTNONE 
Os12g0299700AK071145ACATGGGCCACConserved hypothetical protein. 
J023082N05ACATGGGCCACNONE 
Os12g0405700AK061920ACATGGGCCCACCCSimilar to Wound-induced basic protein. 
AK120436ACATGGGCCCACCCNONE 
Os12g0572400016-084-F04ACATGGGCCTCNONE 
016-084-F04GAGGCCCATGTNONE 
AK065531ACATGGGCCTCSimilar to SC35-like splicing factor SCL30, 30 kD. 
AK065531GAGGCCCATGTSimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03ACATGGGCCTCNONE 
J013025H03GAGGCCCATGTNONE 
J013034H02ACATGGGCCTCNONE 
J013034H02GAGGCCCATGTNONE 
J033117N05ACATGGGCCTCNONE 
J033117N05GAGGCCCATGTNONE 
J065027L09ACATGGGCCTCNONE 
J065027L09GAGGCCCATGTNONE 
J065037D09ACATGGGCCTCNONE 
J065037D09GAGGCCCATGTNONE 
J065197I09ACATGGGCCTCNONE 
J065197I09GAGGCCCATGTNONE 
J090045C01ACATGGGCCTCNONE 
J090045C01GAGGCCCATGTNONE 
J100031E11ACATGGGCCTCNONE 
J100031E11GAGGCCCATGTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.