version

Summary of OsREG438 (All List)

OrganismOryza sativa  
IDOsREG438  
SequenceACCCCCCA  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1086  

Entry Sequences (1086 entries)

LocusGene modelSequenceDescription
Os01g0175100AK071289ACCCCCCACGKv1.4 voltage-gated K+ channel family protein. 
J023088B10ACCCCCCACGNONE 
J065122H15ACCCCCCACGNONE 
J065140B19ACCCCCCACGNONE 
J100031E12ACCCCCCACGNONE 
J100068J03ACCCCCCACGNONE 
J100083E12ACCCCCCACGNONE 
Os01g0198100AK119908ACCCCCCAConserved hypothetical protein. 
Os01g0273800AK109645ACCCCCCAFAD dependent oxidoreductase family protein. 
Os01g0514700AK069218ACCCCCCAProtein kinase domain containing protein. 
Os01g0610100006-029-C12ACCCCCCACGNONE 
006-050-D02ACCCCCCACGNONE 
006-099-A06ACCCCCCACGNONE 
009-029-G03ACCCCCCACGNONE 
009-158-F07ACCCCCCACGNONE 
AK059810ACCCCCCACGSimilar to Clone ZZZ51 mRNA sequence. 
AK104951ACCCCCCACGNONE 
J065067E14ACCCCCCACGNONE 
J065073H01ACCCCCCACGNONE 
J065094E10ACCCCCCACGNONE 
J075041P17ACCCCCCACGNONE 
J075051M22ACCCCCCACGNONE 
J075089J01ACCCCCCACGNONE 
J075119L21ACCCCCCACGNONE 
J075161I08ACCCCCCACGNONE 
J090072B22ACCCCCCACGNONE 
Os01g0693400015-096-D03ACCCCCCANONE 
J065109K09ACCCCCCATranscriptional factor B3 family protein. 
J075002K23ACCCCCCANONE 
J075083L02ACCCCCCANONE 
J075097P17ACCCCCCANONE 
J100025E16ACCCCCCANONE 
J100055O20ACCCCCCANONE 
J100068B21ACCCCCCANONE 
Os01g0732000009-052-G10ACCCCCCANONE 
AK062498ACCCCCCASimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J075040I23ACCCCCCANONE 
J075123E04ACCCCCCANONE 
J080305B10ACCCCCCANONE 
J080315B13ACCCCCCANONE 
J080318H03ACCCCCCANONE 
Os01g0736600009-105-F04ACCCCCCANONE 
014-035-D08ACCCCCCANONE 
AK099546ACCCCCCAZinc finger, RING-type domain containing protein. 
AK105189ACCCCCCANONE 
J065155B14ACCCCCCANONE 
J075007F01ACCCCCCANONE 
Os01g0737100AK108262ACCCCCCAConserved hypothetical protein. 
Os01g0744000AK101026ACCCCCCASimilar to Kinesin heavy chain (Fragment). 
Os01g0851300AK101770ACCCCCCAReticulon family protein. 
J033064I03ACCCCCCANONE 
J100058A05ACCCCCCANONE 
Os01g0864000AK106759ACCCCCCACACConserved hypothetical protein. 
J065124C16ACCCCCCACACNONE 
J065136J17ACCCCCCACACNONE 
J065171D20ACCCCCCACACNONE 
Os01g0867600AK102226ACCCCCCASimilar to UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). 
AK102226ACCCCCCASimilar to UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). 
Os01g0872700AK066633ACCCCCCANONE 
AK100381ACCCCCCAPutative 5-3 exonuclease domain containing protein. 
J013028K13ACCCCCCANONE 
J013038C19ACCCCCCANONE 
J023024P16ACCCCCCANONE 
J023074N21ACCCCCCANONE 
J023085E21ACCCCCCANONE 
J033034K14ACCCCCCANONE 
J033044N04ACCCCCCANONE 
J033052O10ACCCCCCANONE 
J033087J09ACCCCCCANONE 
J033129L17ACCCCCCANONE 
J033143O07ACCCCCCANONE 
J065014M22ACCCCCCANONE 
J065025H10ACCCCCCANONE 
J065051H21ACCCCCCANONE 
J065123E05ACCCCCCANONE 
J065181P03ACCCCCCANONE 
J100064B21ACCCCCCANONE 
Os01g0895500014-018-F04ACCCCCCANONE 
AK063649ACCCCCCARhomboid-like protein family protein. 
J065077H12ACCCCCCANONE 
J065116J18ACCCCCCANONE 
J075194C08ACCCCCCANONE 
Os01g0951800AK069239TGGGGGGTProtein prenyltransferase domain containing protein. 
AK069239TGGGGGGTProtein prenyltransferase domain containing protein. 
Os02g0137100015-082-A12ACCCCCCACTTGNONE 
016-013-D11ACCCCCCACTTGNONE 
AK073353ACCCCCCACTTGConserved hypothetical protein 1589, plant family protein. 
J013026D20ACCCCCCACTTGNONE 
J013111M05ACCCCCCACTTGNONE 
J023099B09ACCCCCCACTTGNONE 
J033025E21ACCCCCCACTTGNONE 
J033082H04ACCCCCCACTTGNONE 
J065110E11ACCCCCCACTTGNONE 
Os02g0137800AK060530ACCGGGCCCCACCCCCCAConserved hypothetical protein. 
AK101629ACCGGGCCCCACCCCCCANONE 
J065195A10ACCGGGCCCCACCCCCCANONE 
Os02g0138900J023136A12TGGGGGGTSodium/calcium exchanger membrane region domain containing protein. 
Os02g0156100AK058877ACCCCCCAConserved hypothetical protein. 
J065195O19ACCCCCCANONE 
J090049P12ACCCCCCANONE 
Os02g0208900003-126-D10ACCCCCCACGNONE 
AK066171ACCCCCCACGNONE 
AK070031ACCCCCCACGNONE 
AK121183ACCCCCCACGSimilar to ZIGA2 protein (Fragment). 
J013031N09ACCCCCCACGNONE 
J013045O19ACCCCCCACGNONE 
J023102A14ACCCCCCACGNONE 
J023145E14ACCCCCCACGNONE 
J033033E15ACCCCCCACGNONE 
J033041H19ACCCCCCACGNONE 
J033050E09ACCCCCCACGNONE 
J065191H21ACCCCCCACGNONE 
J065193C21ACCCCCCACGNONE 
J075068F07ACCCCCCACGNONE 
Os02g0219900004-018-E11CCGTGGGCCCCACCCCCCACACNONE 
AK060915CCGTGGGCCCCACCCCCCACACNONE 
AK099194CCGTGGGCCCCACCCCCCACACNONE 
AK104206CCGTGGGCCCCACCCCCCACACNONE 
AK104393CCGTGGGCCCCACCCCCCACACSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07CCGTGGGCCCCACCCCCCACACNONE 
Os02g0240100AK108037ACCCCCCASimilar to Peroxidase 2 (Fragment). 
J075002G05ACCCCCCANONE 
J100063O14ACCCCCCANONE 
Os02g0240300006-044-B12ACCCCCCANONE 
006-047-E01ACCCCCCANONE 
006-107-G10ACCCCCCANONE 
AK067000ACCCCCCASimilar to Class III peroxidase GvPx2b (Fragment). 
AK104645ACCCCCCANONE 
J013091I12ACCCCCCANONE 
J065023C19ACCCCCCANONE 
J065035P20ACCCCCCANONE 
J065059K23ACCCCCCANONE 
J065067P03ACCCCCCANONE 
J065097G05ACCCCCCANONE 
J065113E09ACCCCCCANONE 
J065120H13ACCCCCCANONE 
J065137M20ACCCCCCANONE 
J065158G15ACCCCCCANONE 
J065161A12ACCCCCCANONE 
J065175A01ACCCCCCANONE 
J065189B18ACCCCCCANONE 
J065198L19ACCCCCCANONE 
J075003E22ACCCCCCANONE 
J075021F10ACCCCCCANONE 
J075021J06ACCCCCCANONE 
J075030L15ACCCCCCANONE 
J075033E17ACCCCCCANONE 
J075037C14ACCCCCCANONE 
J075055G09ACCCCCCANONE 
J075069D12ACCCCCCANONE 
J075082K05ACCCCCCANONE 
J075108E07ACCCCCCANONE 
J075127F12ACCCCCCANONE 
J075147I15ACCCCCCANONE 
J075156P08ACCCCCCANONE 
J075166B03ACCCCCCANONE 
J075167E10ACCCCCCANONE 
Os02g0502500011-068-G11TGGGGGGTNONE 
AK100111TGGGGGGTNONE 
AK100315TGGGGGGTProtein kinase-like domain containing protein. 
J013074C19TGGGGGGTNONE 
J013153K16TGGGGGGTNONE 
J023078O21TGGGGGGTNONE 
J033127M18TGGGGGGTNONE 
J043038D17TGGGGGGTNONE 
J065090L08TGGGGGGTNONE 
J065110P16TGGGGGGTNONE 
J065163C03TGGGGGGTNONE 
J065213D23TGGGGGGTNONE 
J090010M14TGGGGGGTNONE 
J090016E02TGGGGGGTNONE 
J090044J20TGGGGGGTNONE 
J090091M16TGGGGGGTNONE 
J090099I23TGGGGGGTNONE 
Os02g0506600AK107967ACCCCCCAConserved hypothetical protein. 
J065142J01ACCCCCCANONE 
J100044B16ACCCCCCANONE 
J100079K18ACCCCCCANONE 
J100086M04ACCCCCCANONE 
Os02g0512400AK073461ACCCCCCASimilar to Glutaredoxin. 
J065073L11ACCCCCCANONE 
Os02g0672200AK112025TGGGGGGTNONE 
Os02g0709900AB110204ACCCCCCACGPrefoldin domain containing protein. 
AK109259ACCCCCCACGNONE 
J013093N22ACCCCCCACGNONE 
J033116F21ACCCCCCACGNONE 
Os02g0730300AK098897ACCCCCCACGCGTCCNONE 
AK111629ACCCCCCACGCGTCCSimilar to Potassium transporter HAK3p (Fragment). 
Os02g0730400AK101253ACCCCCCAConserved hypothetical protein. 
Os02g0777800AK066978ACCCCCCACACGCCTCSimilar to Avr9/Cf-9 induced kinase 1. 
Os02g0810500AK071602ACCCCCCARabGAP/TBC domain containing protein. 
J023043D17ACCCCCCANONE 
J023102D17ACCCCCCANONE 
Os02g0832600013-010-E02ACCCCCCANONE 
AK058645ACCCCCCAConserved hypothetical protein. 
AK072277ACCCCCCANONE 
AK100140ACCCCCCANONE 
J023002O20ACCCCCCANONE 
J023010P10ACCCCCCANONE 
J023019M07ACCCCCCANONE 
J023074F03ACCCCCCANONE 
J023087J05ACCCCCCANONE 
J033088K14ACCCCCCANONE 
J065031P06ACCCCCCANONE 
J075040C24ACCCCCCANONE 
J075047H12ACCCCCCANONE 
J075065F16ACCCCCCANONE 
J075074D03ACCCCCCANONE 
J075109G24ACCCCCCANONE 
J075124E09ACCCCCCANONE 
J075190M20ACCCCCCANONE 
J075195M23ACCCCCCANONE 
J100027H12ACCCCCCANONE 
J100029K12ACCCCCCANONE 
Os03g0100200009-022-G08TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-012-C04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-039-F04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein. 
AK104982TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J013039N23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J023131F13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065013G18TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065056M02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065197O22TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075055L17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075076F02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075085M06TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075104E21TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075123P09TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075125G07TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075138M13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075142J17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075152F05TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075191L23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J090074I04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
Os03g0121200013-060-B01ACCCCCCANONE 
AK060028ACCCCCCANONE 
AK073847ACCCCCCANONE 
AK103660ACCCCCCASimilar to Peroxidase 1. 
AK120013ACCCCCCANONE 
J023048M02ACCCCCCANONE 
J023052M11ACCCCCCANONE 
J023118A08ACCCCCCANONE 
J023135O08ACCCCCCANONE 
J033058P11ACCCCCCANONE 
J033135H09ACCCCCCANONE 
J033140I05ACCCCCCANONE 
J090015H12ACCCCCCANONE 
J090037M21ACCCCCCANONE 
Os03g0124900AK070284TGGGGGGTVirulence factor, pectin lyase fold family protein. 
J013052O13TGGGGGGTNONE 
J023048L01TGGGGGGTNONE 
J090085D12TGGGGGGTNONE 
Os03g0143700AK066360TGGGGGGTConserved hypothetical protein. 
J013066M09TGGGGGGTNONE 
J023087N24TGGGGGGTNONE 
Os03g0157300011-050-C09ACCCCCCANONE 
AK063160ACCCCCCANONE 
AK103362ACCCCCCAProtein of unknown function Cys-rich family protein. 
J013059E20ACCCCCCANONE 
J013157F18ACCCCCCANONE 
J033055M12ACCCCCCANONE 
J033058M02ACCCCCCANONE 
J033066C15ACCCCCCANONE 
J033095K18ACCCCCCANONE 
J033099M11ACCCCCCANONE 
J033126N07ACCCCCCANONE 
J033149O14ACCCCCCANONE 
J090015B11ACCCCCCANONE 
J090017C22ACCCCCCANONE 
J090018L20ACCCCCCANONE 
J090031I01ACCCCCCANONE 
Os03g0167000AK107307GCCCCCACACCCCCCAConserved hypothetical protein. 
J100070K07GCCCCCACACCCCCCANONE 
Os03g0261800AK060717GGTGTGTGTGTGGGGGGTNONE 
Os03g0281500AK100137ACCCCCCASimilar to Resistance protein candidate (Fragment). 
J013135N09ACCCCCCANONE 
J023003E18ACCCCCCANONE 
J023044J15ACCCCCCANONE 
J023067O20ACCCCCCANONE 
J033041I17ACCCCCCANONE 
J033131I17ACCCCCCANONE 
J065210G02ACCCCCCANONE 
J090067A14ACCCCCCANONE 
Os03g0300400AF395880ACCCCCCANONE 
AK121376ACCCCCCAPathogen-related protein (JIOsPR10). 
J013036K14ACCCCCCANONE 
J023019C05ACCCCCCANONE 
J023068B20ACCCCCCANONE 
J023074O20ACCCCCCANONE 
J023093P15ACCCCCCANONE 
J023119D19ACCCCCCANONE 
J023127E15ACCCCCCANONE 
J023143G09ACCCCCCANONE 
J033087E12ACCCCCCANONE 
J075191C11ACCCCCCANONE 
J100023P07ACCCCCCANONE 
J100032G15ACCCCCCANONE 
J100074L17ACCCCCCANONE 
Os03g0302800AK061293GCGGGCCCCACCCCCCAConserved hypothetical protein. 
Os03g0308800AK066789ACCCCCCANONE 
AK068534ACCCCCCAProtein prenyltransferase domain containing protein. 
Os03g0398900AK107457ACCCCCCAConserved hypothetical protein. 
Os03g0625900AK101109ACCCCCCACCACWD40-like domain containing protein. 
Os03g0667100012-045-B01ACCCCCCACGTNONE 
AK065363ACCCCCCACGTBTB domain containing protein. 
AK065952ACCCCCCACGTNONE 
J013045I05ACCCCCCACGTNONE 
J013129F20ACCCCCCACGTNONE 
Os03g0758500016-015-D02ACCCCCCANONE 
AK059403ACCCCCCANONE 
AK102002ACCCCCCAPlastocyanin-like domain containing protein. 
J033079N03ACCCCCCANONE 
J065012M05ACCCCCCANONE 
J065045H19ACCCCCCANONE 
J065050J08ACCCCCCANONE 
J075189D02ACCCCCCANONE 
J090018L03ACCCCCCANONE 
J100043O22ACCCCCCANONE 
J100088G17ACCCCCCANONE 
Os03g0797000AK073440TGGGGGGTSimilar to Indole synthase. 
Os03g0825300AK072216ACCCCCCACCCCACACACGCCACNONE 
AK102693ACCCCCCACCCCACACACGCCACNONE 
AK105593ACCCCCCACCCCACACACGCCACProtein kinase-like domain containing protein. 
BT014687ACCCCCCACCCCACACACGCCACNONE 
Os03g0857500AK072880ACCCCCCAGGCCCProtein of unknown function DUF303, acetylesterase putative domain containing protein. 
Os04g0405500011-007-D12ACCCCCCACGTGNONE 
AK063263ACCCCCCACGTGConserved hypothetical protein. 
J065166G19ACCCCCCACGTGNONE 
J075180M09ACCCCCCACGTGNONE 
Os04g0412300AK110902ACCCCCCANONE 
AK121151ACCCCCCAGlycoside hydrolase, family 17 protein. 
J013126I01ACCCCCCANONE 
J023078I08ACCCCCCANONE 
J090006M17ACCCCCCANONE 
J090060D03ACCCCCCANONE 
J090063F12ACCCCCCANONE 
J100040E06ACCCCCCANONE 
J100057F18ACCCCCCANONE 
J100058B19ACCCCCCANONE 
J100058C20ACCCCCCANONE 
J100067G08ACCCCCCANONE 
J100082C09ACCCCCCANONE 
J100086D14ACCCCCCANONE 
Os04g0445200009-034-A06ACCCCCCACGNONE 
AK062427ACCCCCCACGProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720ACCCCCCACGNONE 
J065022E20ACCCCCCACGNONE 
J065062D16ACCCCCCACGNONE 
J065081I02ACCCCCCACGNONE 
J065087C10ACCCCCCACGNONE 
J065116N16ACCCCCCACGNONE 
J065132F10ACCCCCCACGNONE 
J065140F18ACCCCCCACGNONE 
J065143M22ACCCCCCACGNONE 
J065158K17ACCCCCCACGNONE 
J065162D07ACCCCCCACGNONE 
J065207H19ACCCCCCACGNONE 
J075155B20ACCCCCCACGNONE 
J075167E24ACCCCCCACGNONE 
J075178B19ACCCCCCACGNONE 
J080301D22ACCCCCCACGNONE 
J080301J15ACCCCCCACGNONE 
J080308J02ACCCCCCACGNONE 
Os04g0462400J100043O17ACCCCCCAAmino acid/polyamine transporter II family protein. 
Os04g0648900006-069-H01ACCCCCCANONE 
012-095-D01ACCCCCCANONE 
015-088-E07ACCCCCCANONE 
AK061095ACCCCCCASimilar to Dehydration responsive element binding protein 2F (DREB2F protein). 
AK099333ACCCCCCANONE 
J100056E16ACCCCCCANONE 
Os04g0652400AK072809ACCCCCCASimilar to Sulphate transporter protein. 
AK104831ACCCCCCANONE 
AK107225ACCCCCCANONE 
Os04g0688300006-061-B01TGGGGGGTNONE 
013-018-H08TGGGGGGTNONE 
013-066-D06TGGGGGGTNONE 
AK065090TGGGGGGTHaem peroxidase, plant/fungal/bacterial family protein. 
AK104928TGGGGGGTNONE 
J013001L22TGGGGGGTNONE 
J023120H12TGGGGGGTNONE 
J065002B04TGGGGGGTNONE 
J065039G09TGGGGGGTNONE 
J065042E02TGGGGGGTNONE 
J065079L02TGGGGGGTNONE 
J065186D12TGGGGGGTNONE 
J065198I02TGGGGGGTNONE 
J075103M02TGGGGGGTNONE 
J075129A09TGGGGGGTNONE 
Os05g0102500009-183-E08TGGGGGGTNONE 
AK063894TGGGGGGTNONE 
AK073341TGGGGGGTConserved hypothetical protein. 
J023022C11TGGGGGGTNONE 
J065095B14TGGGGGGTNONE 
J065130O12TGGGGGGTNONE 
J065142P07TGGGGGGTNONE 
J065155L18TGGGGGGTNONE 
Os05g0136400AK101387ACCCCCCAConserved hypothetical protein. 
J033036G05ACCCCCCANONE 
J033084O20ACCCCCCANONE 
J043039L07ACCCCCCANONE 
J065210B03ACCCCCCANONE 
J075016A14ACCCCCCANONE 
J075153I24ACCCCCCANONE 
J075156N22ACCCCCCANONE 
J075159J21ACCCCCCANONE 
J075169L09ACCCCCCANONE 
J075194A11ACCCCCCANONE 
J080004A02ACCCCCCANONE 
J080006I10ACCCCCCANONE 
J080010B06ACCCCCCANONE 
J080010G07ACCCCCCANONE 
J080013F18ACCCCCCANONE 
J080020O18ACCCCCCANONE 
J080023B07ACCCCCCANONE 
J080024F01ACCCCCCANONE 
J080027H06ACCCCCCANONE 
J080029I23ACCCCCCANONE 
J080031C17ACCCCCCANONE 
J080036J03ACCCCCCANONE 
J080040L10ACCCCCCANONE 
J080048D16ACCCCCCANONE 
J080049C04ACCCCCCANONE 
J080054E19ACCCCCCANONE 
J080067J03ACCCCCCANONE 
J080068C12ACCCCCCANONE 
J080079M15ACCCCCCANONE 
J080081C12ACCCCCCANONE 
J080083I23ACCCCCCANONE 
J080094D17ACCCCCCANONE 
J080096M16ACCCCCCANONE 
J100073D13ACCCCCCANONE 
Os05g0151400AK065647TGGGGGGTNONE 
J013038D10TGGGGGGTNONE 
J013043M24TGGGGGGTNONE 
J013051E20TGGGGGGTNONE 
J013135C04TGGGGGGTNONE 
J033031A16TGGGGGGTNONE 
J033034L20TGGGGGGTNONE 
J033092C09TGGGGGGTNONE 
J033099A18TGGGGGGTNONE 
J033114D01TGGGGGGTNONE 
J033118P03TGGGGGGTNONE 
J033132H04TGGGGGGTNONE 
J090015B18TGGGGGGTNONE 
J090015E02TGGGGGGTNONE 
J090016B08TGGGGGGTNONE 
Os05g0296800AK108441ACCCCCCACACHypothetical protein. 
AK108511ACCCCCCACACNONE 
Os05g0358500AK060575ACCCCCCANONE 
AK100777ACCCCCCAProtein phosphatase 2C-like domain containing protein. 
Os05g0391500AK119412ACCCCCCACCACSimilar to Endo-beta-mannosidase. 
Os05g0399100004-005-F03ACCCCCCANONE 
009-087-E06ACCCCCCANONE 
AK060876ACCCCCCANONE 
J013045L10ACCCCCCANONE 
J065010F04ACCCCCCANONE 
J065211L20ACCCCCCANONE 
J090068A12ACCCCCCANONE 
J090098N18ACCCCCCANONE 
Os05g0408300AK068553ACCCCCCAConserved hypothetical protein. 
Os05g0423400AK100233ACCCCCCASimilar to PISTILLATA-like MADS box protein. 
J075063D08ACCCCCCANONE 
J075077H10ACCCCCCANONE 
J075118P06ACCCCCCANONE 
J075126P19ACCCCCCANONE 
J075162O13ACCCCCCANONE 
J075180L03ACCCCCCANONE 
J075187L07ACCCCCCANONE 
L37527ACCCCCCANONE 
Os05g0437500AK102974TGGGGGGTYip1 domain containing protein. 
Os05g0463800AB095439ACCCCCCACGCGNONE 
AK100811ACCCCCCACGCGSimilar to CCAAT-binding transcription factor-like protein (Fragment). 
AY224530ACCCCCCACGCGNONE 
J023075E18ACCCCCCACGCGNONE 
J023121O11ACCCCCCACGCGNONE 
Os05g0539400AK068572TGGGGGGTGlycoside hydrolase, family 35 protein. 
J013063P08TGGGGGGTNONE 
J013110N24TGGGGGGTNONE 
J013156K22TGGGGGGTNONE 
J043038A08TGGGGGGTNONE 
J090004K18TGGGGGGTNONE 
J090085F03TGGGGGGTNONE 
Os06g0101300013-080-G09TGGGGGGTNONE 
015-006-A01TGGGGGGTNONE 
015-044-F09TGGGGGGTNONE 
AK109515TGGGGGGTZinc finger, RING-type domain containing protein. 
AK121897TGGGGGGTNONE 
J033084O06TGGGGGGTNONE 
J033105E24TGGGGGGTNONE 
J033126H24TGGGGGGTNONE 
J065001F05TGGGGGGTNONE 
J065002H03TGGGGGGTNONE 
J065026B12TGGGGGGTNONE 
J065093E11TGGGGGGTNONE 
J065122E04TGGGGGGTNONE 
J065164O07TGGGGGGTNONE 
J065182M16TGGGGGGTNONE 
J065217N11TGGGGGGTNONE 
J090002P22TGGGGGGTNONE 
Os06g0106100009-197-E09TGGGGGGTNONE 
AK111784TGGGGGGTCwf15/Cwc15 cell cycle control protein family protein. 
AK112060TGGGGGGTNONE 
Os06g0143700AK067270ACCCCCCASimilar to Sulfate transporter 2. 
J013098O05ACCCCCCANONE 
J065017H17ACCCCCCANONE 
Os06g0179700AK065602ACCCCCCASimilar to DNA-binding protein phosphatase 2C. 
Os06g0206100AK099498TGGGGGGTNONE 
AK121282TGGGGGGTSimilar to Gb protein. 
Os06g0275600AK103853ACCCCCCASimilar to TA1 protein (Fragment). 
J013124M09ACCCCCCANONE 
J023037A16ACCCCCCANONE 
J023082E23ACCCCCCANONE 
J033148M07ACCCCCCANONE 
J065019C20ACCCCCCANONE 
J065035G16ACCCCCCANONE 
J065064K09ACCCCCCANONE 
J065138N11ACCCCCCANONE 
J065219O07ACCCCCCANONE 
J090040A03ACCCCCCANONE 
Os06g0318700011-077-A09ACCCCCCANONE 
AK120250ACCCCCCAZinc finger, CCCH-type domain containing protein. 
J013045F22ACCCCCCANONE 
J013072K20ACCCCCCANONE 
J023055N20ACCCCCCANONE 
J023079E05ACCCCCCANONE 
J023079G09ACCCCCCANONE 
J023085P14ACCCCCCANONE 
J043005L18ACCCCCCANONE 
J053088F13ACCCCCCANONE 
J090098H13ACCCCCCANONE 
Os06g0647100009-005-F12ACCCCCCANONE 
009-113-D11ACCCCCCANONE 
009-132-D09ACCCCCCANONE 
009-147-G06ACCCCCCANONE 
AK066837ACCCCCCASimilar to 50S ribosomal protein L35, chloroplast precursor (CL35). 
J065073M03ACCCCCCANONE 
Os06g0717400AK072887GTGTGGGGGGTPseudouridine synthase, Rlu family protein. 
Os07g0190900012-063-F11TGGGGGGTNONE 
AK073533TGGGGGGTSMAD/FHA domain containing protein. 
J013110O09TGGGGGGTNONE 
J033041I12TGGGGGGTNONE 
J033046D05TGGGGGGTNONE 
J033101K24TGGGGGGTNONE 
J090009F10TGGGGGGTNONE 
J090095B17TGGGGGGTNONE 
Os07g0191000AK071379ACCCCCCAInositol monophosphatase family protein. 
AK103440ACCCCCCANONE 
Os07g0200900006-062-F11ACCCCCCANONE 
006-071-A04ACCCCCCANONE 
AK061082ACCCCCCAConserved hypothetical protein. 
Os07g0205900AK070209ACCCCCCAArmadillo-like helical domain containing protein. 
Os07g0419500J065210A06ACCCCCCACCCGNONE 
Os07g0476900005-002-A06ACCCCCCANONE 
009-022-G02ACCCCCCANONE 
AK066045ACCCCCCAThioredoxin domain 2 containing protein. 
J013049P20ACCCCCCANONE 
J065118O13ACCCCCCANONE 
J065214C17ACCCCCCANONE 
J075041K14ACCCCCCANONE 
J075083O08ACCCCCCANONE 
J075088E04ACCCCCCANONE 
J080014I10ACCCCCCANONE 
J080024C01ACCCCCCANONE 
J080044A03ACCCCCCANONE 
J080072L22ACCCCCCANONE 
J080077D21ACCCCCCANONE 
Os07g0499800AK120716ACCCCCCACCACZinc finger, RING-type domain containing protein. 
Os07g0506700AK073959ACCCCCCAWD40-like domain containing protein. 
Os07g0569100013-067-E02ACCCCCCANONE 
013-081-C06ACCCCCCANONE 
014-030-G06ACCCCCCANONE 
014-034-H09ACCCCCCANONE 
AK120160ACCCCCCARemorin, C-terminal region domain containing protein. 
J090034F20ACCCCCCANONE 
Os07g0636100AK068356ACCCCCCAProtein of unknown function DUF573 family protein. 
J013146D06ACCCCCCANONE 
J090026A02ACCCCCCANONE 
J090027P04ACCCCCCANONE 
J100022D11ACCCCCCANONE 
J100058K05ACCCCCCANONE 
Os07g0661400006-083-E05GGCCCCACCCCCCANONE 
006-084-B12GGCCCCACCCCCCANONE 
006-096-B03GGCCCCACCCCCCANONE 
009-013-C12GGCCCCACCCCCCANONE 
009-017-C10GGCCCCACCCCCCANONE 
009-027-A02GGCCCCACCCCCCANONE 
009-035-A06GGCCCCACCCCCCANONE 
009-047-H11GGCCCCACCCCCCANONE 
009-050-B11GGCCCCACCCCCCANONE 
009-051-C02GGCCCCACCCCCCANONE 
009-089-G06GGCCCCACCCCCCANONE 
009-091-C05GGCCCCACCCCCCANONE 
009-095-B11GGCCCCACCCCCCANONE 
009-151-C01GGCCCCACCCCCCANONE 
009-154-F06GGCCCCACCCCCCANONE 
009-169-F02GGCCCCACCCCCCANONE 
009-171-G01GGCCCCACCCCCCANONE 
009-179-F07GGCCCCACCCCCCANONE 
013-018-H06GGCCCCACCCCCCANONE 
013-024-E05GGCCCCACCCCCCANONE 
013-038-F09GGCCCCACCCCCCANONE 
013-099-F06GGCCCCACCCCCCANONE 
014-042-E09GGCCCCACCCCCCANONE 
014-086-C02GGCCCCACCCCCCANONE 
014-093-B08GGCCCCACCCCCCANONE 
015-039-G11GGCCCCACCCCCCANONE 
016-036-E05GGCCCCACCCCCCANONE 
AK068814GGCCCCACCCCCCANONE 
AK102682GGCCCCACCCCCCANONE 
AK105973GGCCCCACCCCCCANONE 
AK107202GGCCCCACCCCCCAConserved hypothetical protein. 
J053035N21GGCCCCACCCCCCANONE 
J053099D11GGCCCCACCCCCCANONE 
J065023B18GGCCCCACCCCCCANONE 
J065031M15GGCCCCACCCCCCANONE 
J065035G23GGCCCCACCCCCCANONE 
J065060M18GGCCCCACCCCCCANONE 
J065073J18GGCCCCACCCCCCANONE 
J065103E20GGCCCCACCCCCCANONE 
J065105N19GGCCCCACCCCCCANONE 
J065137A08GGCCCCACCCCCCANONE 
J065152K09GGCCCCACCCCCCANONE 
J065156M12GGCCCCACCCCCCANONE 
J065162G23GGCCCCACCCCCCANONE 
J065162L13GGCCCCACCCCCCANONE 
J065163H16GGCCCCACCCCCCANONE 
J065165E06GGCCCCACCCCCCANONE 
J065171J04GGCCCCACCCCCCANONE 
J065180L23GGCCCCACCCCCCANONE 
J065183K23GGCCCCACCCCCCANONE 
J065186H13GGCCCCACCCCCCANONE 
J065195D10GGCCCCACCCCCCANONE 
J065209G11GGCCCCACCCCCCANONE 
J075006J08GGCCCCACCCCCCANONE 
J075112O07GGCCCCACCCCCCANONE 
J080301H14GGCCCCACCCCCCANONE 
J100058C17GGCCCCACCCCCCANONE 
J100077I23GGCCCCACCCCCCANONE 
J100080I24GGCCCCACCCCCCANONE 
Os08g0151300AK111808ACCCCCCAMyb, DNA-binding domain containing protein. 
AK112117ACCCCCCANONE 
Os08g0267800AK101465ACCCCCCACyclin-like F-box domain containing protein. 
Os08g0461800012-071-E12ACCCCCCACGNONE 
AK066516ACCCCCCACGNONE 
AK067364ACCCCCCACGConserved hypothetical protein. 
AK098966ACCCCCCACGNONE 
Os08g0463500AK058457ACCCCCCAZinc finger, C2H2-type domain containing protein. 
Os08g0469600009-080-H09ACCCCCCANONE 
AK062647ACCCCCCAConserved hypothetical protein. 
Os08g0493100AK108678ACCCCCCANONE 
AK121365ACCCCCCACyclin-like F-box domain containing protein. 
Os08g0510300AK072472ACCCCCCAK+ potassium transporter family protein. 
J023020L12ACCCCCCANONE 
J023112D01ACCCCCCANONE 
J023113B06ACCCCCCANONE 
J023119J10ACCCCCCANONE 
Os08g0519600012-027-B02ACCCCCCANONE 
AK072374ACCCCCCANONE 
AK105273ACCCCCCAProtein of unknown function DUF1666 family protein. 
Os09g0251800006-100-E12ACCCCCCANONE 
AK061218ACCCCCCAC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010ACCCCCCANONE 
J065048A02ACCCCCCANONE 
J065073P10ACCCCCCANONE 
J065075B09ACCCCCCANONE 
J065112B05ACCCCCCANONE 
J090014H10ACCCCCCANONE 
Os09g0369500013-023-F11ACCCCCCANONE 
AK105322ACCCCCCANONE 
AK105479ACCCCCCAConserved hypothetical protein. 
Os09g0402100009-119-F11ACCCCCCANONE 
009-166-C09ACCCCCCANONE 
AK068506ACCCCCCAPF1 protein. 
J065130I01ACCCCCCANONE 
L24390ACCCCCCANONE 
Os09g0415700AK102287ACCCCCCAProtein of unknown function DUF248, methyltransferase putative family protein. 
J013095G13ACCCCCCANONE 
J013128E08ACCCCCCANONE 
J023072N21ACCCCCCANONE 
J023083D13ACCCCCCANONE 
J023090E24ACCCCCCANONE 
J023097A14ACCCCCCANONE 
J023122E02ACCCCCCANONE 
J023130H06ACCCCCCANONE 
J033052I04ACCCCCCANONE 
J033071G04ACCCCCCANONE 
J033089J21ACCCCCCANONE 
J033090L16ACCCCCCANONE 
J033100P19ACCCCCCANONE 
J033102C11ACCCCCCANONE 
J033124H23ACCCCCCANONE 
J033129E23ACCCCCCANONE 
J043003I16ACCCCCCANONE 
J090029J24ACCCCCCANONE 
J090033P05ACCCCCCANONE 
J090068G20ACCCCCCANONE 
J090094K13ACCCCCCANONE 
Os09g0516600AK070780ACCCCCCANONE 
AK103563ACCCCCCANONE 
AY054407ACCCCCCAGlyoxalase II. 
J013058P06ACCCCCCANONE 
J013093G04ACCCCCCANONE 
J023007G05ACCCCCCANONE 
J023091A08ACCCCCCANONE 
J023136K23ACCCCCCANONE 
J023138D20ACCCCCCANONE 
J033022N20ACCCCCCANONE 
J033065N15ACCCCCCANONE 
J033109L23ACCCCCCANONE 
J053073C08ACCCCCCANONE 
J075094J24ACCCCCCANONE 
J075106P21ACCCCCCANONE 
Os09g0532000AK105810ACCCCCCACCGCACCACGCGTNONE 
AY850134ACCCCCCACCGCACCACGCGTConserved hypothetical protein. 
J065022C05ACCCCCCACCGCACCACGCGTNONE 
J065054B06ACCCCCCACCGCACCACGCGTNONE 
J065072C03ACCCCCCACCGCACCACGCGTNONE 
J065121O09ACCCCCCACCGCACCACGCGTNONE 
J065163P22ACCCCCCACCGCACCACGCGTNONE 
J065192G01ACCCCCCACCGCACCACGCGTNONE 
J065194H12ACCCCCCACCGCACCACGCGTNONE 
Os11g0473000AK060156ACCCCCCANONE 
AK065994ACCCCCCASimilar to ER lumen protein retaining receptor (HDEL receptor) (PGP169-12). 
AK104759ACCCCCCANONE 
Os11g0479300AK099761ACCCCCCARabGAP/TBC domain containing protein. 
Os11g0586300AK072257TGTGGGCCCCACACCCCCCACGConserved hypothetical protein. 
Os12g0230600AK072568CTGGCCCACCACCCCCCAProtein of unknown function DUF1685 family protein. 
Os12g0235800AK058994TGGGGGGTNONE 
J023081B09TGGGGGGTNONE 
J033061B15TGGGGGGTNONE 
J033124C22TGGGGGGTNONE 
J043024C15TGGGGGGTNONE 
J090082N21TGGGGGGTNONE 
Os12g0278800003-004-E01TGGGGGGTNONE 
AK111498TGGGGGGTNONE 
AK111962TGGGGGGTNONE 
AK121774TGGGGGGTSimilar to Zinc finger CCCH type domain containing protein ZFN-like 1. Splice isoform 3. 
J013000H23TGGGGGGTNONE 
J033034P15TGGGGGGTNONE 
J033064D07TGGGGGGTNONE 
J033089C02TGGGGGGTNONE 
J033092M18TGGGGGGTNONE 
J033097M16TGGGGGGTNONE 
J043001K06TGGGGGGTNONE 
J090083L17TGGGGGGTNONE 
J100090M02TGGGGGGTNONE 
Os12g0511300015-003-D12CACGTGGCACCCCCCANONE 
AK064077CACGTGGCACCCCCCANONE 
AK109892CACGTGGCACCCCCCANONE 
AK121419CACGTGGCACCCCCCAConserved hypothetical protein. 
J065020L21CACGTGGCACCCCCCANONE 
J065033D11CACGTGGCACCCCCCANONE 
J065038K03CACGTGGCACCCCCCANONE 
J065043A18CACGTGGCACCCCCCANONE 
J065056F02CACGTGGCACCCCCCANONE 
J065071M10CACGTGGCACCCCCCANONE 
J065158M05CACGTGGCACCCCCCANONE 
J065161E23CACGTGGCACCCCCCANONE 
J065202O07CACGTGGCACCCCCCANONE 
J065208N21CACGTGGCACCCCCCANONE 
J100069C18CACGTGGCACCCCCCANONE 
J100088H18CACGTGGCACCCCCCANONE 
J100090B10CACGTGGCACCCCCCANONE 
Os12g0532600AK066369ACCCCCCAHypothetical protein. 
J013059K17ACCCCCCANONE 
J065082J04ACCCCCCANONE 
J065158C15ACCCCCCANONE 
J090017A09ACCCCCCANONE 
Os12g0547500AK065586ACCCCCCACACGCalponin-like actin-binding domain containing protein. 
Os12g0554800AK105676TGGGGGGTSimilar to Polygalacturonase-like protein. 
Os12g0605800AK121511ACCCCCCATCCGACGSimilar to 3-methylcrotonyl CoA carboxylase biotin-containing subunit (Fragment). 
Os12g0616200006-055-C11TGGATGGGGGGTNONE 
006-077-F07TGGATGGGGGGTNONE 
006-095-B06TGGATGGGGGGTNONE 
006-117-E04TGGATGGGGGGTNONE 
AK059735TGGATGGGGGGTHUELLENLOS-like protein. 
AK098937TGGATGGGGGGTNONE 
AK104805TGGATGGGGGGTNONE 
J013036H15TGGATGGGGGGTNONE 
J033052K05TGGATGGGGGGTNONE 
J033105K08TGGATGGGGGGTNONE 
J090075C15TGGATGGGGGGTNONE 
J100045O09TGGATGGGGGGTNONE 
Os12g0632000AF010580ACCCCCCACCGTCGGATNONE 
AJ002893ACCCCCCACCGTCGGATSimilar to Glycine-rich RNA-binding protein 1 (Fragment). 
J065001J09ACCCCCCACCGTCGGATNONE 
J065002D04ACCCCCCACCGTCGGATNONE 
J065041I19ACCCCCCACCGTCGGATNONE 
J065051I02ACCCCCCACCGTCGGATNONE 
J065054G12ACCCCCCACCGTCGGATNONE 
J065061A03ACCCCCCACCGTCGGATNONE 
J065061B03ACCCCCCACCGTCGGATNONE 
J065062D24ACCCCCCACCGTCGGATNONE 
J065079O14ACCCCCCACCGTCGGATNONE 
J065083P21ACCCCCCACCGTCGGATNONE 
J065098H21ACCCCCCACCGTCGGATNONE 
J065101F01ACCCCCCACCGTCGGATNONE 
J065102M05ACCCCCCACCGTCGGATNONE 
J065121E24ACCCCCCACCGTCGGATNONE 
J065138P03ACCCCCCACCGTCGGATNONE 
J065161B22ACCCCCCACCGTCGGATNONE 
J065163E13ACCCCCCACCGTCGGATNONE 
J065165D14ACCCCCCACCGTCGGATNONE 
J065169J17ACCCCCCACCGTCGGATNONE 
J065191B15ACCCCCCACCGTCGGATNONE 
J065197C23ACCCCCCACCGTCGGATNONE 
J075002C02ACCCCCCACCGTCGGATNONE 
J075003D03ACCCCCCACCGTCGGATNONE 
J075003M01ACCCCCCACCGTCGGATNONE 
J075011J11ACCCCCCACCGTCGGATNONE 
J075013I09ACCCCCCACCGTCGGATNONE 
J075013P21ACCCCCCACCGTCGGATNONE 
J075020D15ACCCCCCACCGTCGGATNONE 
J075020L10ACCCCCCACCGTCGGATNONE 
J075025P14ACCCCCCACCGTCGGATNONE 
J075031G13ACCCCCCACCGTCGGATNONE 
J075044J01ACCCCCCACCGTCGGATNONE 
J075048K03ACCCCCCACCGTCGGATNONE 
J075081H02ACCCCCCACCGTCGGATNONE 
J075081M24ACCCCCCACCGTCGGATNONE 
J075093H13ACCCCCCACCGTCGGATNONE 
J075096I02ACCCCCCACCGTCGGATNONE 
J075096K17ACCCCCCACCGTCGGATNONE 
J075097I08ACCCCCCACCGTCGGATNONE 
J075097L19ACCCCCCACCGTCGGATNONE 
J075098K03ACCCCCCACCGTCGGATNONE 
J075099L15ACCCCCCACCGTCGGATNONE 
J075118E23ACCCCCCACCGTCGGATNONE 
J075118H23ACCCCCCACCGTCGGATNONE 
J075118J24ACCCCCCACCGTCGGATNONE 
J075127N03ACCCCCCACCGTCGGATNONE 
J075142H14ACCCCCCACCGTCGGATNONE 
J075146D17ACCCCCCACCGTCGGATNONE 
J075156K21ACCCCCCACCGTCGGATNONE 
J080016A22ACCCCCCACCGTCGGATNONE 
J080016B03ACCCCCCACCGTCGGATNONE 
J080040H01ACCCCCCACCGTCGGATNONE 
J080068A22ACCCCCCACCGTCGGATNONE 
J080068G23ACCCCCCACCGTCGGATNONE 
J080071M07ACCCCCCACCGTCGGATNONE 
J080072C22ACCCCCCACCGTCGGATNONE 
J080092L23ACCCCCCACCGTCGGATNONE 
J080094M23ACCCCCCACCGTCGGATNONE 
J080094P05ACCCCCCACCGTCGGATNONE 
J080304H19ACCCCCCACCGTCGGATNONE 
J090045K01ACCCCCCACCGTCGGATNONE 
J090051E23ACCCCCCACCGTCGGATNONE 
J090084I02ACCCCCCACCGTCGGATNONE 
J100024B13ACCCCCCACCGTCGGATNONE 
J100024H16ACCCCCCACCGTCGGATNONE 
J100025F08ACCCCCCACCGTCGGATNONE 
J100026C20ACCCCCCACCGTCGGATNONE 
J100026J20ACCCCCCACCGTCGGATNONE 
J100026J24ACCCCCCACCGTCGGATNONE 
J100026K14ACCCCCCACCGTCGGATNONE 
J100026M15ACCCCCCACCGTCGGATNONE 
J100027A21ACCCCCCACCGTCGGATNONE 
J100027C08ACCCCCCACCGTCGGATNONE 
J100027D04ACCCCCCACCGTCGGATNONE 
J100027F17ACCCCCCACCGTCGGATNONE 
J100027G08ACCCCCCACCGTCGGATNONE 
J100027H22ACCCCCCACCGTCGGATNONE 
J100027N15ACCCCCCACCGTCGGATNONE 
J100028F01ACCCCCCACCGTCGGATNONE 
J100028J11ACCCCCCACCGTCGGATNONE 
J100029B19ACCCCCCACCGTCGGATNONE 
J100029C17ACCCCCCACCGTCGGATNONE 
J100029K13ACCCCCCACCGTCGGATNONE 
J100029N17ACCCCCCACCGTCGGATNONE 
J100030A16ACCCCCCACCGTCGGATNONE 
J100030F13ACCCCCCACCGTCGGATNONE 
J100030M17ACCCCCCACCGTCGGATNONE 
J100030N04ACCCCCCACCGTCGGATNONE 
J100030N09ACCCCCCACCGTCGGATNONE 
J100031F16ACCCCCCACCGTCGGATNONE 
J100031I07ACCCCCCACCGTCGGATNONE 
J100031K06ACCCCCCACCGTCGGATNONE 
J100031K09ACCCCCCACCGTCGGATNONE 
J100032E01ACCCCCCACCGTCGGATNONE 
J100032F13ACCCCCCACCGTCGGATNONE 
J100032I20ACCCCCCACCGTCGGATNONE 
J100032N21ACCCCCCACCGTCGGATNONE 
J100032O06ACCCCCCACCGTCGGATNONE 
J100033E08ACCCCCCACCGTCGGATNONE 
J100033M19ACCCCCCACCGTCGGATNONE 
J100033M22ACCCCCCACCGTCGGATNONE 
J100034B22ACCCCCCACCGTCGGATNONE 
J100034H08ACCCCCCACCGTCGGATNONE 
J100034K22ACCCCCCACCGTCGGATNONE 
J100034N04ACCCCCCACCGTCGGATNONE 
J100034P17ACCCCCCACCGTCGGATNONE 
J100035K22ACCCCCCACCGTCGGATNONE 
J100035L11ACCCCCCACCGTCGGATNONE 
J100035N24ACCCCCCACCGTCGGATNONE 
J100036L18ACCCCCCACCGTCGGATNONE 
J100037B01ACCCCCCACCGTCGGATNONE 
J100037F04ACCCCCCACCGTCGGATNONE 
J100037H23ACCCCCCACCGTCGGATNONE 
J100037L18ACCCCCCACCGTCGGATNONE 
J100038B05ACCCCCCACCGTCGGATNONE 
J100038F13ACCCCCCACCGTCGGATNONE 
J100038K04ACCCCCCACCGTCGGATNONE 
J100039G20ACCCCCCACCGTCGGATNONE 
J100040G09ACCCCCCACCGTCGGATNONE 
J100041A11ACCCCCCACCGTCGGATNONE 
J100041B22ACCCCCCACCGTCGGATNONE 
J100041K06ACCCCCCACCGTCGGATNONE 
J100041O09ACCCCCCACCGTCGGATNONE 
J100042A20ACCCCCCACCGTCGGATNONE 
J100042C07ACCCCCCACCGTCGGATNONE 
J100042I02ACCCCCCACCGTCGGATNONE 
J100042K03ACCCCCCACCGTCGGATNONE 
J100043C18ACCCCCCACCGTCGGATNONE 
J100043D20ACCCCCCACCGTCGGATNONE 
J100043F08ACCCCCCACCGTCGGATNONE 
J100043G23ACCCCCCACCGTCGGATNONE 
J100043H22ACCCCCCACCGTCGGATNONE 
J100043I23ACCCCCCACCGTCGGATNONE 
J100043K11ACCCCCCACCGTCGGATNONE 
J100043P03ACCCCCCACCGTCGGATNONE 
J100044C01ACCCCCCACCGTCGGATNONE 
J100044F02ACCCCCCACCGTCGGATNONE 
J100044L10ACCCCCCACCGTCGGATNONE 
J100045A13ACCCCCCACCGTCGGATNONE 
J100045D16ACCCCCCACCGTCGGATNONE 
J100045D23ACCCCCCACCGTCGGATNONE 
J100045F09ACCCCCCACCGTCGGATNONE 
J100045H22ACCCCCCACCGTCGGATNONE 
J100045O07ACCCCCCACCGTCGGATNONE 
J100046J15ACCCCCCACCGTCGGATNONE 
J100046K14ACCCCCCACCGTCGGATNONE 
J100046L15ACCCCCCACCGTCGGATNONE 
J100047L23ACCCCCCACCGTCGGATNONE 
J100047P05ACCCCCCACCGTCGGATNONE 
J100048A20ACCCCCCACCGTCGGATNONE 
J100048C22ACCCCCCACCGTCGGATNONE 
J100048G17ACCCCCCACCGTCGGATNONE 
J100048J20ACCCCCCACCGTCGGATNONE 
J100048K18ACCCCCCACCGTCGGATNONE 
J100048L22ACCCCCCACCGTCGGATNONE 
J100048O22ACCCCCCACCGTCGGATNONE 
J100049F18ACCCCCCACCGTCGGATNONE 
J100049M03ACCCCCCACCGTCGGATNONE 
J100050C20ACCCCCCACCGTCGGATNONE 
J100050G14ACCCCCCACCGTCGGATNONE 
J100050O10ACCCCCCACCGTCGGATNONE 
J100051E09ACCCCCCACCGTCGGATNONE 
J100051F20ACCCCCCACCGTCGGATNONE 
J100051I22ACCCCCCACCGTCGGATNONE 
J100051J11ACCCCCCACCGTCGGATNONE 
J100051J17ACCCCCCACCGTCGGATNONE 
J100052A04ACCCCCCACCGTCGGATNONE 
J100052E01ACCCCCCACCGTCGGATNONE 
J100052E13ACCCCCCACCGTCGGATNONE 
J100054A10ACCCCCCACCGTCGGATNONE 
J100054B08ACCCCCCACCGTCGGATNONE 
J100054B12ACCCCCCACCGTCGGATNONE 
J100054F05ACCCCCCACCGTCGGATNONE 
J100054I16ACCCCCCACCGTCGGATNONE 
J100054L18ACCCCCCACCGTCGGATNONE 
J100055A03ACCCCCCACCGTCGGATNONE 
J100055K11ACCCCCCACCGTCGGATNONE 
J100056I06ACCCCCCACCGTCGGATNONE 
J100056I16ACCCCCCACCGTCGGATNONE 
J100056M20ACCCCCCACCGTCGGATNONE 
J100057D04ACCCCCCACCGTCGGATNONE 
J100057E15ACCCCCCACCGTCGGATNONE 
J100057G07ACCCCCCACCGTCGGATNONE 
J100057H22ACCCCCCACCGTCGGATNONE 
J100058H07ACCCCCCACCGTCGGATNONE 
J100058M11ACCCCCCACCGTCGGATNONE 
J100058M20ACCCCCCACCGTCGGATNONE 
J100058N04ACCCCCCACCGTCGGATNONE 
J100058N16ACCCCCCACCGTCGGATNONE 
J100058O11ACCCCCCACCGTCGGATNONE 
J100059A20ACCCCCCACCGTCGGATNONE 
J100059E05ACCCCCCACCGTCGGATNONE 
J100059K17ACCCCCCACCGTCGGATNONE 
J100059M07ACCCCCCACCGTCGGATNONE 
J100060A07ACCCCCCACCGTCGGATNONE 
J100060G24ACCCCCCACCGTCGGATNONE 
J100060I15ACCCCCCACCGTCGGATNONE 
J100060M15ACCCCCCACCGTCGGATNONE 
J100060M20ACCCCCCACCGTCGGATNONE 
J100060N23ACCCCCCACCGTCGGATNONE 
J100061H20ACCCCCCACCGTCGGATNONE 
J100062C04ACCCCCCACCGTCGGATNONE 
J100062C22ACCCCCCACCGTCGGATNONE 
J100062F20ACCCCCCACCGTCGGATNONE 
J100062G08ACCCCCCACCGTCGGATNONE 
J100062H17ACCCCCCACCGTCGGATNONE 
J100062I05ACCCCCCACCGTCGGATNONE 
J100062L21ACCCCCCACCGTCGGATNONE 
J100062O04ACCCCCCACCGTCGGATNONE 
J100063B10ACCCCCCACCGTCGGATNONE 
J100063C01ACCCCCCACCGTCGGATNONE 
J100063D11ACCCCCCACCGTCGGATNONE 
J100064B18ACCCCCCACCGTCGGATNONE 
J100064G01ACCCCCCACCGTCGGATNONE 
J100064K07ACCCCCCACCGTCGGATNONE 
J100064L09ACCCCCCACCGTCGGATNONE 
J100064M13ACCCCCCACCGTCGGATNONE 
J100064O10ACCCCCCACCGTCGGATNONE 
J100065J24ACCCCCCACCGTCGGATNONE 
J100065N15ACCCCCCACCGTCGGATNONE 
J100066E13ACCCCCCACCGTCGGATNONE 
J100066G16ACCCCCCACCGTCGGATNONE 
J100066J03ACCCCCCACCGTCGGATNONE 
J100066K06ACCCCCCACCGTCGGATNONE 
J100066P15ACCCCCCACCGTCGGATNONE 
J100067D12ACCCCCCACCGTCGGATNONE 
J100067G04ACCCCCCACCGTCGGATNONE 
J100067G18ACCCCCCACCGTCGGATNONE 
J100067I18ACCCCCCACCGTCGGATNONE 
J100067K04ACCCCCCACCGTCGGATNONE 
J100068C21ACCCCCCACCGTCGGATNONE 
J100068D08ACCCCCCACCGTCGGATNONE 
J100068G17ACCCCCCACCGTCGGATNONE 
J100068H09ACCCCCCACCGTCGGATNONE 
J100069F05ACCCCCCACCGTCGGATNONE 
J100069I20ACCCCCCACCGTCGGATNONE 
J100069J05ACCCCCCACCGTCGGATNONE 
J100070D16ACCCCCCACCGTCGGATNONE 
J100070I09ACCCCCCACCGTCGGATNONE 
J100070K06ACCCCCCACCGTCGGATNONE 
J100071G09ACCCCCCACCGTCGGATNONE 
J100071H20ACCCCCCACCGTCGGATNONE 
J100071K07ACCCCCCACCGTCGGATNONE 
J100071L03ACCCCCCACCGTCGGATNONE 
J100071L13ACCCCCCACCGTCGGATNONE 
J100072A11ACCCCCCACCGTCGGATNONE 
J100072C19ACCCCCCACCGTCGGATNONE 
J100072E13ACCCCCCACCGTCGGATNONE 
J100072E16ACCCCCCACCGTCGGATNONE 
J100072M06ACCCCCCACCGTCGGATNONE 
J100072O10ACCCCCCACCGTCGGATNONE 
J100073E05ACCCCCCACCGTCGGATNONE 
J100073L14ACCCCCCACCGTCGGATNONE 
J100073N05ACCCCCCACCGTCGGATNONE 
J100074I04ACCCCCCACCGTCGGATNONE 
J100074K21ACCCCCCACCGTCGGATNONE 
J100074L22ACCCCCCACCGTCGGATNONE 
J100074N07ACCCCCCACCGTCGGATNONE 
J100075F18ACCCCCCACCGTCGGATNONE 
J100075H14ACCCCCCACCGTCGGATNONE 
J100075I03ACCCCCCACCGTCGGATNONE 
J100075K02ACCCCCCACCGTCGGATNONE 
J100075K11ACCCCCCACCGTCGGATNONE 
J100075K16ACCCCCCACCGTCGGATNONE 
J100075N08ACCCCCCACCGTCGGATNONE 
J100076A03ACCCCCCACCGTCGGATNONE 
J100076C05ACCCCCCACCGTCGGATNONE 
J100076I24ACCCCCCACCGTCGGATNONE 
J100077H07ACCCCCCACCGTCGGATNONE 
J100077P09ACCCCCCACCGTCGGATNONE 
J100078C15ACCCCCCACCGTCGGATNONE 
J100078J15ACCCCCCACCGTCGGATNONE 
J100078K02ACCCCCCACCGTCGGATNONE 
J100078K23ACCCCCCACCGTCGGATNONE 
J100078M11ACCCCCCACCGTCGGATNONE 
J100079E21ACCCCCCACCGTCGGATNONE 
J100079F03ACCCCCCACCGTCGGATNONE 
J100079K13ACCCCCCACCGTCGGATNONE 
J100081L17ACCCCCCACCGTCGGATNONE 
J100081P09ACCCCCCACCGTCGGATNONE 
J100082D14ACCCCCCACCGTCGGATNONE 
J100083E07ACCCCCCACCGTCGGATNONE 
J100083H07ACCCCCCACCGTCGGATNONE 
J100084B12ACCCCCCACCGTCGGATNONE 
J100084C20ACCCCCCACCGTCGGATNONE 
J100084D21ACCCCCCACCGTCGGATNONE 
J100084L21ACCCCCCACCGTCGGATNONE 
J100085I10ACCCCCCACCGTCGGATNONE 
J100085L22ACCCCCCACCGTCGGATNONE 
J100085M20ACCCCCCACCGTCGGATNONE 
J100086G15ACCCCCCACCGTCGGATNONE 
J100086N03ACCCCCCACCGTCGGATNONE 
J100087E11ACCCCCCACCGTCGGATNONE 
J100087I01ACCCCCCACCGTCGGATNONE 
J100088C17ACCCCCCACCGTCGGATNONE 
J100088N20ACCCCCCACCGTCGGATNONE 
J100089I18ACCCCCCACCGTCGGATNONE 
J100089M13ACCCCCCACCGTCGGATNONE 
J100090E17ACCCCCCACCGTCGGATNONE 
J100090J19ACCCCCCACCGTCGGATNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.