version

Summary of OsREG439 (All List)

OrganismOryza sativa  
IDOsREG439  
SequenceACCCGCGC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1245  

Entry Sequences (1245 entries)

LocusGene modelSequenceDescription
Os01g0104400006-026-B08ACCCGCGCNONE 
006-030-C01ACCCGCGCNONE 
006-055-E02ACCCGCGCNONE 
006-061-B12ACCCGCGCNONE 
006-064-F06ACCCGCGCNONE 
006-078-G10ACCCGCGCNONE 
006-079-G09ACCCGCGCNONE 
006-080-B08ACCCGCGCNONE 
006-100-E07ACCCGCGCNONE 
006-110-E01ACCCGCGCNONE 
006-118-D10ACCCGCGCNONE 
006-120-C12ACCCGCGCNONE 
AK060132ACCCGCGCNONE 
AK071375ACCCGCGCRicin B-related lectin domain containing protein. 
AK104555ACCCGCGCNONE 
AK104820ACCCGCGCNONE 
J023121J21ACCCGCGCNONE 
Os01g0146600AK109179GCGCGGGTConserved hypothetical protein. 
Os01g0159600013-096-A02ACCCGCGCNONE 
013-096-A02ACCCGCGCNONE 
AK064055ACCCGCGCSmall hydrophilic plant seed protein family protein. 
AK064055ACCCGCGCSmall hydrophilic plant seed protein family protein. 
AK122153ACCCGCGCNONE 
AK122153ACCCGCGCNONE 
J033073N07ACCCGCGCNONE 
J033073N07ACCCGCGCNONE 
J033088A13ACCCGCGCNONE 
J033088A13ACCCGCGCNONE 
J033143J06ACCCGCGCNONE 
J033143J06ACCCGCGCNONE 
J053031D05ACCCGCGCNONE 
J053031D05ACCCGCGCNONE 
J053037K14ACCCGCGCNONE 
J053037K14ACCCGCGCNONE 
J053045E08ACCCGCGCNONE 
J053045E08ACCCGCGCNONE 
J053062D01ACCCGCGCNONE 
J053062D01ACCCGCGCNONE 
J053083H22ACCCGCGCNONE 
J053083H22ACCCGCGCNONE 
J053089G12ACCCGCGCNONE 
J053089G12ACCCGCGCNONE 
J053089G24ACCCGCGCNONE 
J053089G24ACCCGCGCNONE 
J053099O13ACCCGCGCNONE 
J053099O13ACCCGCGCNONE 
J065070H11ACCCGCGCNONE 
J065070H11ACCCGCGCNONE 
J075013L17ACCCGCGCNONE 
J075013L17ACCCGCGCNONE 
J075021L24ACCCGCGCNONE 
J075021L24ACCCGCGCNONE 
J075033B10ACCCGCGCNONE 
J075033B10ACCCGCGCNONE 
J075034G01ACCCGCGCNONE 
J075034G01ACCCGCGCNONE 
J075035A11ACCCGCGCNONE 
J075035A11ACCCGCGCNONE 
J075045F22ACCCGCGCNONE 
J075045F22ACCCGCGCNONE 
J075046N02ACCCGCGCNONE 
J075046N02ACCCGCGCNONE 
J075047K11ACCCGCGCNONE 
J075047K11ACCCGCGCNONE 
J075058N15ACCCGCGCNONE 
J075058N15ACCCGCGCNONE 
J075059E22ACCCGCGCNONE 
J075059E22ACCCGCGCNONE 
J075061G22ACCCGCGCNONE 
J075061G22ACCCGCGCNONE 
J075078E12ACCCGCGCNONE 
J075078E12ACCCGCGCNONE 
J075079B08ACCCGCGCNONE 
J075079B08ACCCGCGCNONE 
J075090K12ACCCGCGCNONE 
J075090K12ACCCGCGCNONE 
J075096P05ACCCGCGCNONE 
J075096P05ACCCGCGCNONE 
J075097G05ACCCGCGCNONE 
J075097G05ACCCGCGCNONE 
J075097O15ACCCGCGCNONE 
J075097O15ACCCGCGCNONE 
J075101J04ACCCGCGCNONE 
J075101J04ACCCGCGCNONE 
J075104K17ACCCGCGCNONE 
J075104K17ACCCGCGCNONE 
J075110F15ACCCGCGCNONE 
J075110F15ACCCGCGCNONE 
J075118D23ACCCGCGCNONE 
J075118D23ACCCGCGCNONE 
J075118E10ACCCGCGCNONE 
J075118E10ACCCGCGCNONE 
J075137K22ACCCGCGCNONE 
J075137K22ACCCGCGCNONE 
J075138P08ACCCGCGCNONE 
J075138P08ACCCGCGCNONE 
J075142E22ACCCGCGCNONE 
J075142E22ACCCGCGCNONE 
J075147K12ACCCGCGCNONE 
J075147K12ACCCGCGCNONE 
J075149D12ACCCGCGCNONE 
J075149D12ACCCGCGCNONE 
J075152A15ACCCGCGCNONE 
J075152A15ACCCGCGCNONE 
J075152H08ACCCGCGCNONE 
J075152H08ACCCGCGCNONE 
J075156C11ACCCGCGCNONE 
J075156C11ACCCGCGCNONE 
J075156H20ACCCGCGCNONE 
J075156H20ACCCGCGCNONE 
J075162I01ACCCGCGCNONE 
J075162I01ACCCGCGCNONE 
J075166H16ACCCGCGCNONE 
J075166H16ACCCGCGCNONE 
J075186F11ACCCGCGCNONE 
J075186F11ACCCGCGCNONE 
J075189F22ACCCGCGCNONE 
J075189F22ACCCGCGCNONE 
J075190E16ACCCGCGCNONE 
J075190E16ACCCGCGCNONE 
J075193O11ACCCGCGCNONE 
J075193O11ACCCGCGCNONE 
Os01g0179300AB118015GCGCGGGTNONE 
AK066179GCGCGGGTConserved hypothetical protein. 
J013027I24GCGCGGGTNONE 
J013057C04GCGCGGGTNONE 
J013114A12GCGCGGGTNONE 
J033044D13GCGCGGGTNONE 
J033088C17GCGCGGGTNONE 
J065079P13GCGCGGGTNONE 
J065097I15GCGCGGGTNONE 
J100025A19GCGCGGGTNONE 
J100027L07GCGCGGGTNONE 
J100035E12GCGCGGGTNONE 
J100076G01GCGCGGGTNONE 
Os01g0232400AK101990ACCCGCGCSimilar to VHS1 protein (Fragment). 
AK106519ACCCGCGCNONE 
Os01g0242500AK073692GCGCGGGTD-tyrosyl-tRNA(Tyr) deacylase family protein. 
J013075C06GCGCGGGTNONE 
J033060B05GCGCGGGTNONE 
Os01g0266400009-169-A06ACCCGCGCNONE 
AK121188ACCCGCGCConserved hypothetical protein. 
J023085H22ACCCGCGCNONE 
J080301K14ACCCGCGCNONE 
J080303B07ACCCGCGCNONE 
J080303H21ACCCGCGCNONE 
J080308F24ACCCGCGCNONE 
Os01g0306100AK111041ACCCGCGCPlant specific eukaryotic initiation factor 4B family protein. 
Os01g0341200AK068939ACCCGCGCConserved hypothetical protein. 
AK121837ACCCGCGCNONE 
J013170C22ACCCGCGCNONE 
J065132O03ACCCGCGCNONE 
J065137E24ACCCGCGCNONE 
Os01g0584900AK108522GCGCGGGTWRKY transcription factor 28-like (WRKY5) (WRKY transcription factor 77). 
AY341846GCGCGGGTNONE 
J065161G19GCGCGGGTNONE 
J065193D14GCGCGGGTNONE 
J065193L05GCGCGGGTNONE 
J065196K16GCGCGGGTNONE 
Os01g0588200006-052-E10ACCCGCGCCCACGCCCAGCCNONE 
AJ251563ACCCGCGCCCACGCCCAGCCNONE 
AK070745ACCCGCGCCCACGCCCAGCCVoltage-dependent anion channel. 
AK104055ACCCGCGCCCACGCCCAGCCNONE 
AK104419ACCCGCGCCCACGCCCAGCCNONE 
J023057A07ACCCGCGCCCACGCCCAGCCNONE 
J023068C08ACCCGCGCCCACGCCCAGCCNONE 
J023148E24ACCCGCGCCCACGCCCAGCCNONE 
J090045O22ACCCGCGCCCACGCCCAGCCNONE 
J090045P03ACCCGCGCCCACGCCCAGCCNONE 
J090050C18ACCCGCGCCCACGCCCAGCCNONE 
J100023F01ACCCGCGCCCACGCCCAGCCNONE 
J100051I18ACCCGCGCCCACGCCCAGCCNONE 
J100060P17ACCCGCGCCCACGCCCAGCCNONE 
Os01g0695200015-090-F01CCCACCCGCGCNONE 
AK064145CCCACCCGCGCProtein of unknown function DUF266, plant family protein. 
J065163N10CCCACCCGCGCNONE 
J100051F21CCCACCCGCGCNONE 
Os01g0705200011-075-B10CGACCCGCGCNONE 
014-056-F05CGACCCGCGCNONE 
014-072-F08CGACCCGCGCNONE 
014-082-E10CGACCCGCGCNONE 
014-085-E10CGACCCGCGCNONE 
AK064074CGACCCGCGCLate embryogenesis abundant protein repeat containing protein. 
AK073837CGACCCGCGCNONE 
D26536CGACCCGCGCNONE 
J033070H10CGACCCGCGCNONE 
J065138A19CGACCCGCGCNONE 
J065140A10CGACCCGCGCNONE 
Os01g0757200AB092485GGGACCCGCGCNONE 
AK060666GGGACCCGCGCNONE 
AK060714GGGACCCGCGCNONE 
AK099350GGGACCCGCGCNONE 
AK101713GGGACCCGCGCSimilar to GA 2-oxidase 4. 
Os01g0764000006-021-G03ACCCGCGCGAGNONE 
006-025-C07ACCCGCGCGAGNONE 
006-029-G11ACCCGCGCGAGNONE 
006-030-C04ACCCGCGCGAGNONE 
006-035-E05ACCCGCGCGAGNONE 
006-037-G01ACCCGCGCGAGNONE 
006-038-C01ACCCGCGCGAGNONE 
006-039-G05ACCCGCGCGAGNONE 
006-042-E11ACCCGCGCGAGNONE 
006-044-H04ACCCGCGCGAGNONE 
006-045-A10ACCCGCGCGAGNONE 
006-045-C05ACCCGCGCGAGNONE 
006-047-A11ACCCGCGCGAGNONE 
006-048-H10ACCCGCGCGAGNONE 
006-050-C01ACCCGCGCGAGNONE 
006-050-H11ACCCGCGCGAGNONE 
006-051-G10ACCCGCGCGAGNONE 
006-051-G11ACCCGCGCGAGNONE 
006-056-B04ACCCGCGCGAGNONE 
006-063-F04ACCCGCGCGAGNONE 
006-063-H12ACCCGCGCGAGNONE 
006-065-G09ACCCGCGCGAGNONE 
006-067-F11ACCCGCGCGAGNONE 
006-073-D10ACCCGCGCGAGNONE 
006-074-G09ACCCGCGCGAGNONE 
006-075-D04ACCCGCGCGAGNONE 
006-077-C10ACCCGCGCGAGNONE 
006-082-A10ACCCGCGCGAGNONE 
006-084-C12ACCCGCGCGAGNONE 
006-085-F05ACCCGCGCGAGNONE 
006-087-H12ACCCGCGCGAGNONE 
006-092-E10ACCCGCGCGAGNONE 
006-094-C06ACCCGCGCGAGNONE 
006-096-G11ACCCGCGCGAGNONE 
006-097-H11ACCCGCGCGAGNONE 
006-101-A07ACCCGCGCGAGNONE 
006-101-G08ACCCGCGCGAGNONE 
006-110-E08ACCCGCGCGAGNONE 
006-111-D04ACCCGCGCGAGNONE 
006-116-H04ACCCGCGCGAGNONE 
AK058894ACCCGCGCGAGNONE 
AK059818ACCCGCGCGAGSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142ACCCGCGCGAGNONE 
J013119N15ACCCGCGCGAGNONE 
J013123P15ACCCGCGCGAGNONE 
J023055F24ACCCGCGCGAGNONE 
J023125K17ACCCGCGCGAGNONE 
J053050A20ACCCGCGCGAGNONE 
J053056P10ACCCGCGCGAGNONE 
J053074D19ACCCGCGCGAGNONE 
J053078A14ACCCGCGCGAGNONE 
J053086P10ACCCGCGCGAGNONE 
J053094N23ACCCGCGCGAGNONE 
J053095M23ACCCGCGCGAGNONE 
J065006D02ACCCGCGCGAGNONE 
J065030A17ACCCGCGCGAGNONE 
J065030K04ACCCGCGCGAGNONE 
J065035L12ACCCGCGCGAGNONE 
J065046E12ACCCGCGCGAGNONE 
J065065H19ACCCGCGCGAGNONE 
J065073C01ACCCGCGCGAGNONE 
J065105F01ACCCGCGCGAGNONE 
J065131N16ACCCGCGCGAGNONE 
J065144O13ACCCGCGCGAGNONE 
J065160E12ACCCGCGCGAGNONE 
J065160K02ACCCGCGCGAGNONE 
J065163F09ACCCGCGCGAGNONE 
J065165E18ACCCGCGCGAGNONE 
J065174E04ACCCGCGCGAGNONE 
J065175O08ACCCGCGCGAGNONE 
J065191N24ACCCGCGCGAGNONE 
J065193D19ACCCGCGCGAGNONE 
J065198D04ACCCGCGCGAGNONE 
J065200G09ACCCGCGCGAGNONE 
J075016L06ACCCGCGCGAGNONE 
J075017J11ACCCGCGCGAGNONE 
J075019L08ACCCGCGCGAGNONE 
J075028M08ACCCGCGCGAGNONE 
J075029K05ACCCGCGCGAGNONE 
J075039K04ACCCGCGCGAGNONE 
J075047J22ACCCGCGCGAGNONE 
J075079H13ACCCGCGCGAGNONE 
J075095K14ACCCGCGCGAGNONE 
J075111D21ACCCGCGCGAGNONE 
J075131A19ACCCGCGCGAGNONE 
J075147G20ACCCGCGCGAGNONE 
J075158F11ACCCGCGCGAGNONE 
J075166N10ACCCGCGCGAGNONE 
J075196G09ACCCGCGCGAGNONE 
J075198I24ACCCGCGCGAGNONE 
J090001L08ACCCGCGCGAGNONE 
J090026G07ACCCGCGCGAGNONE 
J090050M15ACCCGCGCGAGNONE 
J090071A01ACCCGCGCGAGNONE 
J090072P16ACCCGCGCGAGNONE 
J090078D22ACCCGCGCGAGNONE 
J090089C18ACCCGCGCGAGNONE 
J100019B07ACCCGCGCGAGNONE 
J100019H15ACCCGCGCGAGNONE 
J100019P09ACCCGCGCGAGNONE 
J100023A16ACCCGCGCGAGNONE 
J100023B09ACCCGCGCGAGNONE 
J100026O18ACCCGCGCGAGNONE 
J100027E09ACCCGCGCGAGNONE 
J100028F22ACCCGCGCGAGNONE 
J100029P05ACCCGCGCGAGNONE 
J100031M19ACCCGCGCGAGNONE 
J100032A11ACCCGCGCGAGNONE 
J100036G19ACCCGCGCGAGNONE 
J100038E22ACCCGCGCGAGNONE 
J100040A12ACCCGCGCGAGNONE 
J100040L02ACCCGCGCGAGNONE 
J100043O13ACCCGCGCGAGNONE 
J100045E20ACCCGCGCGAGNONE 
J100046H18ACCCGCGCGAGNONE 
J100047E08ACCCGCGCGAGNONE 
J100050E08ACCCGCGCGAGNONE 
J100050P14ACCCGCGCGAGNONE 
J100051G10ACCCGCGCGAGNONE 
J100052L12ACCCGCGCGAGNONE 
J100056G24ACCCGCGCGAGNONE 
J100066B15ACCCGCGCGAGNONE 
J100068O15ACCCGCGCGAGNONE 
J100070J16ACCCGCGCGAGNONE 
J100074I22ACCCGCGCGAGNONE 
J100075M12ACCCGCGCGAGNONE 
J100077M09ACCCGCGCGAGNONE 
J100077O14ACCCGCGCGAGNONE 
J100079J08ACCCGCGCGAGNONE 
J100080I16ACCCGCGCGAGNONE 
Os01g0767100AK109493CACGTGTCACCCGCGCSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0823100AK070463GCGCGGGTAlpha-expansin OsEXPA2. 
J065162I18GCGCGGGTNONE 
J090038D18GCGCGGGTNONE 
U30477GCGCGGGTNONE 
Os01g0830000012-056-G03GCCCACCCGCGCNONE 
015-092-H05GCCCACCCGCGCNONE 
AK121100GCCCACCCGCGCSimilar to Plastid sufB (Fragment). 
J023069G03GCCCACCCGCGCNONE 
J090047G13GCCCACCCGCGCNONE 
J090059K22GCCCACCCGCGCNONE 
Os01g0830100AK069755GCGCGGGTGGGCPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0863300014-030-D08ACCCGCGCNONE 
AK111571ACCCGCGCSimilar to MCB2 protein. 
J013071A13ACCCGCGCNONE 
J075060E09ACCCGCGCNONE 
J075138C14ACCCGCGCNONE 
J075150M17ACCCGCGCNONE 
Os01g0896200AK105622ACCCGCGCConserved hypothetical protein. 
Os01g0906425J065161F19GCGCGGGTConserved hypothetical protein. 
J080030J06GCGCGGGTNONE 
J080062E23GCGCGGGTNONE 
J080080G14GCGCGGGTNONE 
Os01g0934000AK060679CCCCACACCCGCGCNONE 
AK072525CCCCACACCCGCGCWD40-like domain containing protein. 
J065097G12CCCCACACCCGCGCNONE 
Os01g0939200AK110814ACCCGCGCConserved hypothetical protein. 
AK110814CGACCCGCGCConserved hypothetical protein. 
Os02g0125300006-047-E06GCCCCCACGCGCGGGTNONE 
006-088-F09GCCCCCACGCGCGGGTNONE 
006-106-F10GCCCCCACGCGCGGGTNONE 
AB025926GCCCCCACGCGCGGGTNONE 
AK061564GCCCCCACGCGCGGGTNONE 
AK061953GCCCCCACGCGCGGGTNONE 
AK101060GCCCCCACGCGCGGGTBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21GCCCCCACGCGCGGGTNONE 
J023097A08GCCCCCACGCGCGGGTNONE 
J023133F03GCCCCCACGCGCGGGTNONE 
J033022C21GCCCCCACGCGCGGGTNONE 
J033073C21GCCCCCACGCGCGGGTNONE 
J033116O09GCCCCCACGCGCGGGTNONE 
J033120E01GCCCCCACGCGCGGGTNONE 
J065088M19GCCCCCACGCGCGGGTNONE 
J065135O04GCCCCCACGCGCGGGTNONE 
J080304J03GCCCCCACGCGCGGGTNONE 
J090001K14GCCCCCACGCGCGGGTNONE 
J090038D04GCCCCCACGCGCGGGTNONE 
J090045G09GCCCCCACGCGCGGGTNONE 
J090076E12GCCCCCACGCGCGGGTNONE 
J090077D21GCCCCCACGCGCGGGTNONE 
J100018J19GCCCCCACGCGCGGGTNONE 
J100029M12GCCCCCACGCGCGGGTNONE 
J100049D07GCCCCCACGCGCGGGTNONE 
J100067G21GCCCCCACGCGCGGGTNONE 
J100090D05GCCCCCACGCGCGGGTNONE 
Os02g0195500AK062207GCGCGGGTNONE 
Os02g0220600AK061944ACCCGCGCElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK104946ACCCGCGCNONE 
D89802ACCCGCGCNONE 
J013042L22ACCCGCGCNONE 
J013056A14ACCCGCGCNONE 
J013120G13ACCCGCGCNONE 
J013155K19ACCCGCGCNONE 
J023002B10ACCCGCGCNONE 
J023080J19ACCCGCGCNONE 
J023081C08ACCCGCGCNONE 
J023090H05ACCCGCGCNONE 
J023091M07ACCCGCGCNONE 
J023115F09ACCCGCGCNONE 
J033025I23ACCCGCGCNONE 
J033026G12ACCCGCGCNONE 
J033035E15ACCCGCGCNONE 
J033040N13ACCCGCGCNONE 
J033046C17ACCCGCGCNONE 
J033069F02ACCCGCGCNONE 
J033071B16ACCCGCGCNONE 
J033071N22ACCCGCGCNONE 
J033088J02ACCCGCGCNONE 
J033092N24ACCCGCGCNONE 
J033093I09ACCCGCGCNONE 
J033126G06ACCCGCGCNONE 
J043003G15ACCCGCGCNONE 
J043010M11ACCCGCGCNONE 
J043024O20ACCCGCGCNONE 
J065092N03ACCCGCGCNONE 
J080004D17ACCCGCGCNONE 
J080010L09ACCCGCGCNONE 
J080021I11ACCCGCGCNONE 
J080022L01ACCCGCGCNONE 
J080029B01ACCCGCGCNONE 
J080032D11ACCCGCGCNONE 
J080039B11ACCCGCGCNONE 
J080040K17ACCCGCGCNONE 
J080041B21ACCCGCGCNONE 
J080052L24ACCCGCGCNONE 
J080054M12ACCCGCGCNONE 
J080057B15ACCCGCGCNONE 
J080078G15ACCCGCGCNONE 
J080078H06ACCCGCGCNONE 
J080079M03ACCCGCGCNONE 
J080088H16ACCCGCGCNONE 
J080093C11ACCCGCGCNONE 
J080095K09ACCCGCGCNONE 
J080095O20ACCCGCGCNONE 
J090009J19ACCCGCGCNONE 
J090040D04ACCCGCGCNONE 
J090052E14ACCCGCGCNONE 
J090063B14ACCCGCGCNONE 
J090071K04ACCCGCGCNONE 
J090075E12ACCCGCGCNONE 
J090087A06ACCCGCGCNONE 
J090094P03ACCCGCGCNONE 
J090098M14ACCCGCGCNONE 
Os02g0539200AK108494ACCCGCGCU box domain containing protein. 
Os02g0562300AK073250CGACCCGCGCCalmodulin binding protein-like family protein. 
Os02g0610500AK058536GCGCGGGTCGGACGGSimilar to CONSTANS-like protein CO9 (Fragment). 
AK100097GCGCGGGTCGGACGGNONE 
J090016D17GCGCGGGTCGGACGGNONE 
J090077O10GCGCGGGTCGGACGGNONE 
J090097J09GCGCGGGTCGGACGGNONE 
J100054K15GCGCGGGTCGGACGGNONE 
J100066N13GCGCGGGTCGGACGGNONE 
J100072H14GCGCGGGTCGGACGGNONE 
Os02g0622400005-010-C04GCGCGGGTNONE 
AK061679GCGCGGGTConserved hypothetical protein. 
J013058H01GCGCGGGTNONE 
J013095D07GCGCGGGTNONE 
J023054G05GCGCGGGTNONE 
J023093A17GCGCGGGTNONE 
J023146P16GCGCGGGTNONE 
J033089D16GCGCGGGTNONE 
J033099G12GCGCGGGTNONE 
J033131N10GCGCGGGTNONE 
J053073J04GCGCGGGTNONE 
J053074P03GCGCGGGTNONE 
J053075M06GCGCGGGTNONE 
J053088K13GCGCGGGTNONE 
J090039F18GCGCGGGTNONE 
J090045M03GCGCGGGTNONE 
Os02g0743800AK064134ACCCGCGCCS domain containing protein. 
AK111254ACCCGCGCNONE 
Os02g0753000AK121015CTCGCGCGGGTSimilar to Trehalose-6-phosphate phosphatase. 
Os02g0824500AK111296ACCCGCGCSimilar to Remorin. 
J065048M11ACCCGCGCNONE 
J065081F01ACCCGCGCNONE 
Os03g0128300AK064718ACCCGCGCConserved hypothetical protein. 
Os03g0157400AK066035ACCCGCGCABC transporter related domain containing protein. 
AK066035CTCGCGCGGGTABC transporter related domain containing protein. 
Os03g0194600009-115-B11CCCCACACGCGCGGGTNONE 
AK062839CCCCACACGCGCGGGTDOMON related domain containing protein. 
Os03g0206600AK058618GCGCGGGTProtein of unknown function DUF588 family protein. 
Os03g0245200003-116-E09ACCCGCGCNONE 
AK062288ACCCGCGCProtein of unknown function DUF1210 family protein. 
J075022G03ACCCGCGCNONE 
J075088C24ACCCGCGCNONE 
J075110L07ACCCGCGCNONE 
J075112K01ACCCGCGCNONE 
J075131F24ACCCGCGCNONE 
J075149D10ACCCGCGCNONE 
Os03g0266700AK072831ACCCGCGCSrc homology-3 domain containing protein. 
Os03g0270000006-051-C05ACCCGCGCNONE 
006-100-A03ACCCGCGCNONE 
006-114-F11ACCCGCGCNONE 
AK061579ACCCGCGCNONE 
AK106069ACCCGCGCProtein of unknown function DUF296 domain containing protein. 
J023102O16ACCCGCGCNONE 
J065017C10ACCCGCGCNONE 
J065059M01ACCCGCGCNONE 
J065104I08ACCCGCGCNONE 
J065120B10ACCCGCGCNONE 
J065130K08ACCCGCGCNONE 
J065140F09ACCCGCGCNONE 
J065166E07ACCCGCGCNONE 
Os03g0275900AK109303ACCCGCGCNONE 
AK121978ACCCGCGCSimilar to Spotted leaf protein 11 (Spotted leaf11) (Cell death-related protein SPL11). 
Os03g0278500AK070850GCGCGGGTPolyadenylate binding protein, human types 1, 2, 3, 4 family protein. 
J023031B16GCGCGGGTNONE 
Os03g0284500012-066-D02GCGCGGGTNONE 
AK105295GCGCGGGTNONE 
AK121300GCGCGGGTHAD-superfamily subfamily IIA hydrolase, CECR5 protein. 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0320500AK108145GCGCGGGTVQ domain containing protein. 
J065122I01GCGCGGGTNONE 
J100057H12GCGCGGGTNONE 
J100078A15GCGCGGGTNONE 
Os03g0323100009-108-G02ACCCGCGCGGGTNONE 
AK062803ACCCGCGCGGGTHypothetical protein. 
AK070776ACCCGCGCGGGTNONE 
Os03g0323200AK067323ACCCGCGCGGGTSimilar to Protoporphyrin IX Mg-chelatase subunit precursor. 
Os03g0327800J023133J12GCGCGGGTNONE 
J065118C24GCGCGGGTNONE 
J065136O13GCGCGGGTNo apical meristem (NAM) protein domain containing protein. 
J065184M03GCGCGGGTNONE 
J075105K14GCGCGGGTNONE 
J075115E14GCGCGGGTNONE 
J075166M18GCGCGGGTNONE 
J075178F01GCGCGGGTNONE 
J090008O14GCGCGGGTNONE 
J090075F12GCGCGGGTNONE 
J100019F12GCGCGGGTNONE 
J100074P18GCGCGGGTNONE 
J100075D15GCGCGGGTNONE 
Os03g0381000AK069332ACCCGCGCSimilar to Aldose 1-epimerase-like protein. 
J023010L17ACCCGCGCNONE 
Os03g0577000012-055-F04AGGGCCCAACCCGCGCNONE 
AK061051AGGGCCCAACCCGCGCSimilar to Ribosomal protein S3 (Fragment). 
AK099146AGGGCCCAACCCGCGCNONE 
J065060A01AGGGCCCAACCCGCGCNONE 
J075079B17AGGGCCCAACCCGCGCNONE 
J075134K12AGGGCCCAACCCGCGCNONE 
J090048F23AGGGCCCAACCCGCGCNONE 
J090072I19AGGGCCCAACCCGCGCNONE 
J100087C19AGGGCCCAACCCGCGCNONE 
J100090C21AGGGCCCAACCCGCGCNONE 
Os03g0708400006-108-F11CGACCCGCGCNONE 
AK066216CGACCCGCGCProtein of unknown function DUF1295 family protein. 
Os03g0710000006-023-G11CACACACCCGCGCNONE 
006-050-E05CACACACCCGCGCNONE 
AK060065CACACACCCGCGCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK099364CACACACCCGCGCNONE 
AK104418CACACACCCGCGCNONE 
J033051P12CACACACCCGCGCNONE 
J065046L09CACACACCCGCGCNONE 
J075021F06CACACACCCGCGCNONE 
J075106P12CACACACCCGCGCNONE 
Os03g0755100AK066049ACCCGCGCSimilar to Transporter associated with antigen processing-like protein. 
Os03g0822900AK099787ACCCGCGCZinc finger, BED-type predicted domain containing protein. 
J013042C24ACCCGCGCNONE 
J013096O21ACCCGCGCNONE 
J023109I23ACCCGCGCNONE 
J033106N09ACCCGCGCNONE 
J033107H03ACCCGCGCNONE 
J033118G03ACCCGCGCNONE 
J033145I24ACCCGCGCNONE 
J065138D15ACCCGCGCNONE 
J065140L13ACCCGCGCNONE 
J065179M13ACCCGCGCNONE 
J065200F05ACCCGCGCNONE 
J075104F20ACCCGCGCNONE 
J075143A15ACCCGCGCNONE 
J075197J11ACCCGCGCNONE 
Os03g0829600AK071298GCGCGGGTNONE 
AK119707GCGCGGGTConserved hypothetical protein. 
J023084A07GCGCGGGTNONE 
Os03g0835600AK101677ACCCGCGCAcyl-coA-binding protein, ACBP family protein. 
AK101677ACCCGCGCAcyl-coA-binding protein, ACBP family protein. 
Os03g0836400J100086B18GCGCGGGTHarpin-induced 1 domain containing protein. 
Os03g0844800AK071813GGCCGTGGGACCCGCGCConserved hypothetical protein. 
J023114B14GGCCGTGGGACCCGCGCNONE 
Os04g0293600AK063003GCGCGGGTHypothetical protein. 
Os04g0296700006-027-B07ACCCGCGCNONE 
J023010D04ACCCGCGCNONE 
J065094E11ACCCGCGCNONE 
J065130C07ACCCGCGCNONE 
J075025F05ACCCGCGCNONE 
J075194J02ACCCGCGCNONE 
Os04g0489600003-130-E01CATCCCCCACCCGCGCNONE 
AK062301CATCCCCCACCCGCGCNONE 
AK068039CATCCCCCACCCGCGCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os04g0509800AK072717GCGCGGGTGGGCConserved hypothetical protein. 
Os04g0511400AK070476CACGCCACGCGCGGGTNONE 
AK072430CACGCCACGCGCGGGTSugar transporter family protein. 
J023054A07CACGCCACGCGCGGGTNONE 
Os04g0634800AK107772ACCCGCGCConserved hypothetical protein. 
J065046O17ACCCGCGCNONE 
J065121F10ACCCGCGCNONE 
J075173G21ACCCGCGCNONE 
J090081F22ACCCGCGCNONE 
J100037A09ACCCGCGCNONE 
J100056M24ACCCGCGCNONE 
Os04g0649600009-019-A10ACCCGCGCNONE 
009-019-A10GCCCAGTTGCCCACCCGCGCNONE 
009-059-G07ACCCGCGCNONE 
009-059-G07GCCCAGTTGCCCACCCGCGCNONE 
009-068-D06ACCCGCGCNONE 
009-068-D06GCCCAGTTGCCCACCCGCGCNONE 
AK105164ACCCGCGCConserved hypothetical protein. 
AK105164GCCCAGTTGCCCACCCGCGCConserved hypothetical protein. 
J100056J15ACCCGCGCNONE 
J100056J15GCCCAGTTGCCCACCCGCGCNONE 
Os04g0673400Os04g0673400ACCCGCGCSimilar to Uracil-DNA glycosylase (EC 3.2.2.-) (UDG). 
Os04g0677400AK069563ACCCGCGCNONE 
AK069752ACCCGCGCProtein of unknown function DUF639 family protein. 
J023022G06ACCCGCGCNONE 
J023030K02ACCCGCGCNONE 
J023030L01ACCCGCGCNONE 
Os05g0111200009-033-A06CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
AK101693CGGACGGCGCGGGTGGGTGGGCCCCACASimilar to Amino acid selective channel protein. 
J065006E13CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075001D12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075005J18CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075009L08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075012M21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075019K17CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075020D07CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075041D11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075051C03CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075060C05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075079N09CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075094B04CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075108E08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075115G05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075147L21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075161G12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168J11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168L11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075174F22CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
Os05g0186300AK070360ACCCGCGCGACSimilar to NADP-malic enzyme. 
AK099249ACCCGCGCGACNONE 
AY435404ACCCGCGCGACNONE 
J023006D11ACCCGCGCGACNONE 
J023059P07ACCCGCGCGACNONE 
Os05g0209500009-103-C11GCGCGGGTNONE 
009-147-H05GCGCGGGTNONE 
AK105188GCGCGGGTConserved hypothetical protein. 
J065076G22GCGCGGGTNONE 
J065095C01GCGCGGGTNONE 
J065168J16GCGCGGGTNONE 
J065198O13GCGCGGGTNONE 
J065212K19GCGCGGGTNONE 
Os05g0437200014-036-D04CGACCCGCGCNONE 
AK059283CGACCCGCGCNONE 
AK121867CGACCCGCGCProtein of unknown function DUF502 family protein. 
Os05g0521600013-027-G05ACCCGCGCNONE 
AK063238ACCCGCGCVirulence factor, pectin lyase fold family protein. 
Os06g0171700AK103771GCGCGGGTGGTGGGGCTTGGCdk-activating kinase assembly factor (MAT1) family protein. 
J033143J20GCGCGGGTGGTGGGGCTTGGNONE 
Os06g0308300AK059211CGACCCGCGCNONE 
AK101549CGACCCGCGCNONE 
AK102553CGACCCGCGCSimilar to 65kD microtubule associated protein. 
J090014G18CGACCCGCGCNONE 
J090082B01CGACCCGCGCNONE 
Os06g0558700AY785762CCCACCCGCGCSimilar to Poly(A) polymerase. 
Os06g0658400J065217K01ACCCGCGCConserved hypothetical protein. 
Os06g0724700AK109634GCGCGGGTProtein kinase-like domain containing protein. 
Os07g0191700AK066389ACCCGCGCGACGTGGGGCCCACGCSimilar to AT.I.24-9 protein (Fragment). 
AK103768ACCCGCGCGACGTGGGGCCCACGCNONE 
Os07g0207400014-085-E12GCGCGGGTNONE 
AK063732GCGCGGGTSimilar to RF12 protein (Fragment). 
Os07g0246200012-046-B07ACCCGCGCNONE 
012-046-B07CTGGCCCACCCGCGCNONE 
AB021259ACCCGCGCNONE 
AB021259CTGGCCCACCCGCGCNONE 
AK065341ACCCGCGCSimilar to Calreticulin (Fragment). 
AK065341CTGGCCCACCCGCGCSimilar to Calreticulin (Fragment). 
AK099348ACCCGCGCNONE 
AK099348CTGGCCCACCCGCGCNONE 
AK104328ACCCGCGCNONE 
AK104328CTGGCCCACCCGCGCNONE 
AK104826ACCCGCGCNONE 
AK104826CTGGCCCACCCGCGCNONE 
J013000E04ACCCGCGCNONE 
J013000E04CTGGCCCACCCGCGCNONE 
J013093M19ACCCGCGCNONE 
J013093M19CTGGCCCACCCGCGCNONE 
J013108J08ACCCGCGCNONE 
J013108J08CTGGCCCACCCGCGCNONE 
J013118G03ACCCGCGCNONE 
J013118G03CTGGCCCACCCGCGCNONE 
J013121I07ACCCGCGCNONE 
J013121I07CTGGCCCACCCGCGCNONE 
J013153K07ACCCGCGCNONE 
J013153K07CTGGCCCACCCGCGCNONE 
J023028N07ACCCGCGCNONE 
J023028N07CTGGCCCACCCGCGCNONE 
J023034F12ACCCGCGCNONE 
J023034F12CTGGCCCACCCGCGCNONE 
J023043J11ACCCGCGCNONE 
J023043J11CTGGCCCACCCGCGCNONE 
J023087A03ACCCGCGCNONE 
J023087A03CTGGCCCACCCGCGCNONE 
J023099N05ACCCGCGCNONE 
J023099N05CTGGCCCACCCGCGCNONE 
J023105B02ACCCGCGCNONE 
J023105B02CTGGCCCACCCGCGCNONE 
J023110H02ACCCGCGCNONE 
J023110H02CTGGCCCACCCGCGCNONE 
J023112E15ACCCGCGCNONE 
J023112E15CTGGCCCACCCGCGCNONE 
J023132C20ACCCGCGCNONE 
J023132C20CTGGCCCACCCGCGCNONE 
J023134G12ACCCGCGCNONE 
J023134G12CTGGCCCACCCGCGCNONE 
J023138O12ACCCGCGCNONE 
J023138O12CTGGCCCACCCGCGCNONE 
J033031E05ACCCGCGCNONE 
J033031E05CTGGCCCACCCGCGCNONE 
J033032C03ACCCGCGCNONE 
J033032C03CTGGCCCACCCGCGCNONE 
J033039K10ACCCGCGCNONE 
J033039K10CTGGCCCACCCGCGCNONE 
J033050P09ACCCGCGCNONE 
J033050P09CTGGCCCACCCGCGCNONE 
J033074D03ACCCGCGCNONE 
J033074D03CTGGCCCACCCGCGCNONE 
J033075G14ACCCGCGCNONE 
J033075G14CTGGCCCACCCGCGCNONE 
J033075I23ACCCGCGCNONE 
J033075I23CTGGCCCACCCGCGCNONE 
J033081H23ACCCGCGCNONE 
J033081H23CTGGCCCACCCGCGCNONE 
J033087N08ACCCGCGCNONE 
J033087N08CTGGCCCACCCGCGCNONE 
J033110B03ACCCGCGCNONE 
J033110B03CTGGCCCACCCGCGCNONE 
J033148H22ACCCGCGCNONE 
J033148H22CTGGCCCACCCGCGCNONE 
J043027F13ACCCGCGCNONE 
J043027F13CTGGCCCACCCGCGCNONE 
J043031H01ACCCGCGCNONE 
J043031H01CTGGCCCACCCGCGCNONE 
J080003O10ACCCGCGCNONE 
J080003O10CTGGCCCACCCGCGCNONE 
J080022D10ACCCGCGCNONE 
J080022D10CTGGCCCACCCGCGCNONE 
J080029I12ACCCGCGCNONE 
J080029I12CTGGCCCACCCGCGCNONE 
J080034A09ACCCGCGCNONE 
J080034A09CTGGCCCACCCGCGCNONE 
J080035H20ACCCGCGCNONE 
J080035H20CTGGCCCACCCGCGCNONE 
J080049C10ACCCGCGCNONE 
J080049C10CTGGCCCACCCGCGCNONE 
J080053G14ACCCGCGCNONE 
J080053G14CTGGCCCACCCGCGCNONE 
J080055J22ACCCGCGCNONE 
J080055J22CTGGCCCACCCGCGCNONE 
J080058J04ACCCGCGCNONE 
J080058J04CTGGCCCACCCGCGCNONE 
J080069E14ACCCGCGCNONE 
J080069E14CTGGCCCACCCGCGCNONE 
J080069M23ACCCGCGCNONE 
J080069M23CTGGCCCACCCGCGCNONE 
J080072E19ACCCGCGCNONE 
J080072E19CTGGCCCACCCGCGCNONE 
J080072I03ACCCGCGCNONE 
J080072I03CTGGCCCACCCGCGCNONE 
J080075B13ACCCGCGCNONE 
J080075B13CTGGCCCACCCGCGCNONE 
J080078I11ACCCGCGCNONE 
J080078I11CTGGCCCACCCGCGCNONE 
J080081F16ACCCGCGCNONE 
J080081F16CTGGCCCACCCGCGCNONE 
J080088O10ACCCGCGCNONE 
J080088O10CTGGCCCACCCGCGCNONE 
J080089G18ACCCGCGCNONE 
J080089G18CTGGCCCACCCGCGCNONE 
J090009C10ACCCGCGCNONE 
J090009C10CTGGCCCACCCGCGCNONE 
J090022D23ACCCGCGCNONE 
J090022D23CTGGCCCACCCGCGCNONE 
J090023A15ACCCGCGCNONE 
J090023A15CTGGCCCACCCGCGCNONE 
J090024M10ACCCGCGCNONE 
J090024M10CTGGCCCACCCGCGCNONE 
J090038F24ACCCGCGCNONE 
J090038F24CTGGCCCACCCGCGCNONE 
J090039O13ACCCGCGCNONE 
J090039O13CTGGCCCACCCGCGCNONE 
J090040N12ACCCGCGCNONE 
J090040N12CTGGCCCACCCGCGCNONE 
J090054I18ACCCGCGCNONE 
J090054I18CTGGCCCACCCGCGCNONE 
J090061C16ACCCGCGCNONE 
J090061C16CTGGCCCACCCGCGCNONE 
J090063H23ACCCGCGCNONE 
J090063H23CTGGCCCACCCGCGCNONE 
J090067F21ACCCGCGCNONE 
J090067F21CTGGCCCACCCGCGCNONE 
J090075A01ACCCGCGCNONE 
J090075A01CTGGCCCACCCGCGCNONE 
J090076K11ACCCGCGCNONE 
J090076K11CTGGCCCACCCGCGCNONE 
J090078L11ACCCGCGCNONE 
J090078L11CTGGCCCACCCGCGCNONE 
J090079P03ACCCGCGCNONE 
J090079P03CTGGCCCACCCGCGCNONE 
J090087D23ACCCGCGCNONE 
J090087D23CTGGCCCACCCGCGCNONE 
J090087G22ACCCGCGCNONE 
J090087G22CTGGCCCACCCGCGCNONE 
J090089F03ACCCGCGCNONE 
J090089F03CTGGCCCACCCGCGCNONE 
J090092A04ACCCGCGCNONE 
J090092A04CTGGCCCACCCGCGCNONE 
J100024L17ACCCGCGCNONE 
J100024L17CTGGCCCACCCGCGCNONE 
J100031P13ACCCGCGCNONE 
J100031P13CTGGCCCACCCGCGCNONE 
J100032H05ACCCGCGCNONE 
J100032H05CTGGCCCACCCGCGCNONE 
J100036P03ACCCGCGCNONE 
J100036P03CTGGCCCACCCGCGCNONE 
J100038L07ACCCGCGCNONE 
J100038L07CTGGCCCACCCGCGCNONE 
J100043I20ACCCGCGCNONE 
J100043I20CTGGCCCACCCGCGCNONE 
J100069A21ACCCGCGCNONE 
J100069A21CTGGCCCACCCGCGCNONE 
J100078G06ACCCGCGCNONE 
J100078G06CTGGCCCACCCGCGCNONE 
J100081J24ACCCGCGCNONE 
J100081J24CTGGCCCACCCGCGCNONE 
J100081N04ACCCGCGCNONE 
J100081N04CTGGCCCACCCGCGCNONE 
J100084K16ACCCGCGCNONE 
J100084K16CTGGCCCACCCGCGCNONE 
J100085O06ACCCGCGCNONE 
J100085O06CTGGCCCACCCGCGCNONE 
J100088L13ACCCGCGCNONE 
J100088L13CTGGCCCACCCGCGCNONE 
J100090O21ACCCGCGCNONE 
J100090O21CTGGCCCACCCGCGCNONE 
Os07g0258400AK121534ACCCGCGCGCCCACGCGNONE 
L41217ACCCGCGCGCCCACGCGNONE 
S81897ACCCGCGCGCCCACGCGOsNramp1 (Integral membrane protein). 
Os07g0264100J013123F19ACCCGCGCNONE 
Os07g0274700J065002G18CCCGTGGGCCCCCACCCGCGCNONE 
J065092L19CCCGTGGGCCCCCACCCGCGCNONE 
J065099K11CCCGTGGGCCCCCACCCGCGCNONE 
J065103L08CCCGTGGGCCCCCACCCGCGCNONE 
J065185I19CCCGTGGGCCCCCACCCGCGCNONE 
J075004L22CCCGTGGGCCCCCACCCGCGCNONE 
J075007G03CCCGTGGGCCCCCACCCGCGCNONE 
J075020E09CCCGTGGGCCCCCACCCGCGCNONE 
J075046B02CCCGTGGGCCCCCACCCGCGCNONE 
J075070D08CCCGTGGGCCCCCACCCGCGCNONE 
J075118L24CCCGTGGGCCCCCACCCGCGCNONE 
J075140C15CCCGTGGGCCCCCACCCGCGCNONE 
J075157A21CCCGTGGGCCCCCACCCGCGCNONE 
J075165J01CCCGTGGGCCCCCACCCGCGCNONE 
J075172J18CCCGTGGGCCCCCACCCGCGCNONE 
J075177P10CCCGTGGGCCCCCACCCGCGCNONE 
J100042D15CCCGTGGGCCCCCACCCGCGCNONE 
J100053M21CCCGTGGGCCCCCACCCGCGCNONE 
J100067M12CCCGTGGGCCCCCACCCGCGCNONE 
Os07g0407350J065005B03GCGCGGGTNONE 
J065058G23GCGCGGGTNONE 
J065144A11GCGCGGGTNONE 
J065175J02GCGCGGGTConserved hypothetical protein. 
Os07g0419500J065210A06GCCACGTGGGTGGGCCCCACCCCCACCCGCGCNONE 
Os07g0567700006-108-A09CGACCCGCGCNONE 
AK061242CGACCCGCGCSimilar to SCARECROW. 
AK120140CGACCCGCGCNONE 
J075098N22CGACCCGCGCNONE 
J075194P18CGACCCGCGCNONE 
J080054H07CGACCCGCGCNONE 
Os07g0568300AK067784TCGTGGGCCCCACCCGCGCNONE 
AK067895TCGTGGGCCCCACCCGCGCSimilar to ZF protein (Fragment). 
J013119M01TCGTGGGCCCCACCCGCGCNONE 
J013120B09TCGTGGGCCCCACCCGCGCNONE 
J013123G12TCGTGGGCCCCACCCGCGCNONE 
J023012C12TCGTGGGCCCCACCCGCGCNONE 
J023020G17TCGTGGGCCCCACCCGCGCNONE 
J023037E23TCGTGGGCCCCACCCGCGCNONE 
J033076I01TCGTGGGCCCCACCCGCGCNONE 
J033108A07TCGTGGGCCCCACCCGCGCNONE 
J033138J02TCGTGGGCCCCACCCGCGCNONE 
J075033L09TCGTGGGCCCCACCCGCGCNONE 
J075049E02TCGTGGGCCCCACCCGCGCNONE 
J075060N23TCGTGGGCCCCACCCGCGCNONE 
J075094H13TCGTGGGCCCCACCCGCGCNONE 
J075179L18TCGTGGGCCCCACCCGCGCNONE 
J080005P09TCGTGGGCCCCACCCGCGCNONE 
J080044J03TCGTGGGCCCCACCCGCGCNONE 
J080062G20TCGTGGGCCCCACCCGCGCNONE 
J080063L23TCGTGGGCCCCACCCGCGCNONE 
J080065B16TCGTGGGCCCCACCCGCGCNONE 
J080071K09TCGTGGGCCCCACCCGCGCNONE 
J080089C23TCGTGGGCCCCACCCGCGCNONE 
J090008P21TCGTGGGCCCCACCCGCGCNONE 
J090046B22TCGTGGGCCCCACCCGCGCNONE 
J090094C19TCGTGGGCCCCACCCGCGCNONE 
J090096B19TCGTGGGCCCCACCCGCGCNONE 
J100060G03TCGTGGGCCCCACCCGCGCNONE 
J100082D16TCGTGGGCCCCACCCGCGCNONE 
Os07g0581300AK061656ACCCGCGCNONE 
J033129C21ACCCGCGCNONE 
Os07g0623600AK063642ACCCGCGCConserved hypothetical protein. 
AK063642GTGGTGGGTGGGGGCGCGGGTGCGGTGConserved hypothetical protein. 
Os07g0658400AK120896ACCCGCGCNONE 
Os07g0672500AK067432GCGCGGGTSMAD/FHA domain containing protein. 
AK119940GCGCGGGTNONE 
Os07g0677200AK122028GCGCGGGTNONE 
J033112F05GCGCGGGTNONE 
J043038E12GCGCGGGTNONE 
Os07g0691200AK068807GCGCGGGTNONE 
AK072158GCGCGGGTNONE 
J013001D13GCGCGGGTNONE 
J013022D09GCGCGGGTNONE 
J013028C24GCGCGGGTNONE 
J013032M14GCGCGGGTNONE 
J023097E13GCGCGGGTNONE 
J065095A22GCGCGGGTNONE 
Os08g0102800AK120363ACCCGCGCConserved hypothetical protein. 
J013068G21ACCCGCGCNONE 
J065044O17ACCCGCGCNONE 
J065048G16ACCCGCGCNONE 
J065089P09ACCCGCGCNONE 
J065111C11ACCCGCGCNONE 
J075088I23ACCCGCGCNONE 
Os08g0119500J080315K03CGACCCGCGCMethyltransferase type 11 domain containing protein. 
Os08g0184800016-029-D09ACCCGCGCNONE 
AK066827ACCCGCGCNONE 
AK071706ACCCGCGCNONE 
AK072453ACCCGCGCHypothetical protein. 
AK104021ACCCGCGCNONE 
J013057C24ACCCGCGCNONE 
J013111I20ACCCGCGCNONE 
J023060J16ACCCGCGCNONE 
J023112F07ACCCGCGCNONE 
J023119K08ACCCGCGCNONE 
J033075M21ACCCGCGCNONE 
J033109A21ACCCGCGCNONE 
J065153H16ACCCGCGCNONE 
J100044B22ACCCGCGCNONE 
Os08g0191000AK065037GCGCGGGTAuxin Efflux Carrier family protein. 
J013001H10GCGCGGGTNONE 
J013030P17GCGCGGGTNONE 
J013043K03GCGCGGGTNONE 
J013093J12GCGCGGGTNONE 
J013146A21GCGCGGGTNONE 
J023028M24GCGCGGGTNONE 
J023028N23GCGCGGGTNONE 
J023030L03GCGCGGGTNONE 
J023049N04GCGCGGGTNONE 
J023130K14GCGCGGGTNONE 
J023139J23GCGCGGGTNONE 
J023140J22GCGCGGGTNONE 
J033051C24GCGCGGGTNONE 
J033085D23GCGCGGGTNONE 
J090032M04GCGCGGGTNONE 
J100017G19GCGCGGGTNONE 
Os08g0280200AK069036GCGCGGGTC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os08g0299600AK107112GCGCGGGTCyclin-like F-box domain containing protein. 
Os08g0483900AK107626ACCCGCGCTTTCCCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J065013A13ACCCGCGCTTTCCCNONE 
J065194B03ACCCGCGCTTTCCCNONE 
Os08g0485700AK068131ACCCGCGCNONE 
J013130L03ACCCGCGCNONE 
Os08g0518200012-031-C05ACCCGCGCNONE 
AK063992ACCCGCGCMitochodrial transcription termination factor-related family protein. 
AK102043ACCCGCGCNONE 
J013028H02ACCCGCGCNONE 
J033023M02ACCCGCGCNONE 
J033061N12ACCCGCGCNONE 
J033081L13ACCCGCGCNONE 
J065066O06ACCCGCGCNONE 
J065103F03ACCCGCGCNONE 
J065192D06ACCCGCGCNONE 
J075123I19ACCCGCGCNONE 
J075165E22ACCCGCGCNONE 
J075182H17ACCCGCGCNONE 
J090048D16ACCCGCGCNONE 
Os08g0525500009-041-D07GCGCGGGTNONE 
AK063792GCGCGGGTNONE 
AK073336GCGCGGGTProtein prenyltransferase domain containing protein. 
Os08g0565200AK108143ACCCGCGCPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os09g0108400016-081-D07GTGGGACCCGCGCNONE 
AK071505GTGGGACCCGCGCConserved hypothetical protein. 
AK106506GTGGGACCCGCGCNONE 
Os09g0480600AK107853ACCCGCGCHypothetical protein. 
Os09g0503100AK108272GCGCGGGTSimilar to Quinone-oxidoreductase QR1 (Fragment). 
J065122I08GCGCGGGTNONE 
J065177B18GCGCGGGTNONE 
Os09g0558200016-083-C09GGCCGTGGCGCGGGTNONE 
AK068834GGCCGTGGCGCGGGTNONE 
AK103673GGCCGTGGCGCGGGTHomeodomain-like containing protein. 
J013159M18GGCCGTGGCGCGGGTNONE 
J065022I04GGCCGTGGCGCGGGTNONE 
J065089B19GGCCGTGGCGCGGGTNONE 
Os11g0100100009-122-C12GCGCGGGTSimilar to Gamma-aminobutyric acid receptor-associated protein-like 2 (GABA(A) receptor-associated protein-like 2) (Ganglioside expression factor 2) (GEF-2) (General protein transport factor p16) (MAP1 light chain 3 related protein). 
Os11g0432900AK059355GCGCGGGTNONE 
Os12g0242500J065129F10AATGGGCCGGCGCGGGTGCGGGCCNONE 
J090032G12AATGGGCCGGCGCGGGTGCGGGCCConserved hypothetical protein. 
Os12g0274700003-008-G09ACCCGCGCNONE 
006-028-B09ACCCGCGCNONE 
006-029-D12ACCCGCGCNONE 
006-034-G05ACCCGCGCNONE 
006-036-A02ACCCGCGCNONE 
006-039-A08ACCCGCGCNONE 
006-057-H10ACCCGCGCNONE 
006-064-D08ACCCGCGCNONE 
006-064-G03ACCCGCGCNONE 
006-071-B05ACCCGCGCNONE 
006-089-D01ACCCGCGCNONE 
006-095-G02ACCCGCGCNONE 
006-098-H02ACCCGCGCNONE 
006-109-H01ACCCGCGCNONE 
006-115-H09ACCCGCGCNONE 
006-120-B02ACCCGCGCNONE 
009-005-E08ACCCGCGCNONE 
009-027-E04ACCCGCGCNONE 
009-028-A10ACCCGCGCNONE 
009-050-G03ACCCGCGCNONE 
009-070-E05ACCCGCGCNONE 
009-095-D10ACCCGCGCNONE 
009-103-A05ACCCGCGCNONE 
009-113-G09ACCCGCGCNONE 
009-116-E08ACCCGCGCNONE 
009-125-F02ACCCGCGCNONE 
009-125-F09ACCCGCGCNONE 
009-129-F03ACCCGCGCNONE 
009-130-F01ACCCGCGCNONE 
009-140-F07ACCCGCGCNONE 
009-151-F07ACCCGCGCNONE 
009-153-D04ACCCGCGCNONE 
009-165-D08ACCCGCGCNONE 
009-170-E11ACCCGCGCNONE 
009-171-C01ACCCGCGCNONE 
009-171-G05ACCCGCGCNONE 
009-189-F07ACCCGCGCNONE 
009-193-H05ACCCGCGCNONE 
009-194-D08ACCCGCGCNONE 
AF017364ACCCGCGCNONE 
AF052305ACCCGCGCNONE 
AK061611ACCCGCGCNONE 
AK119219ACCCGCGCNONE 
AK121444ACCCGCGCSimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
D00643ACCCGCGCNONE 
J013031F15ACCCGCGCNONE 
J013037P20ACCCGCGCNONE 
J013050D13ACCCGCGCNONE 
J013056J24ACCCGCGCNONE 
J013063C09ACCCGCGCNONE 
J013071M01ACCCGCGCNONE 
J013074G12ACCCGCGCNONE 
J013120E19ACCCGCGCNONE 
J013124M17ACCCGCGCNONE 
J013127I18ACCCGCGCNONE 
J013129G13ACCCGCGCNONE 
J013132L16ACCCGCGCNONE 
J013146M05ACCCGCGCNONE 
J023044F05ACCCGCGCNONE 
J023056E16ACCCGCGCNONE 
J023141B14ACCCGCGCNONE 
J065008E12ACCCGCGCNONE 
J065010I24ACCCGCGCNONE 
J065013B01ACCCGCGCNONE 
J065019L16ACCCGCGCNONE 
J065021E19ACCCGCGCNONE 
J065027G11ACCCGCGCNONE 
J065039B19ACCCGCGCNONE 
J065039K03ACCCGCGCNONE 
J065044I07ACCCGCGCNONE 
J065047B10ACCCGCGCNONE 
J065050A16ACCCGCGCNONE 
J065050B15ACCCGCGCNONE 
J065052H09ACCCGCGCNONE 
J065053K05ACCCGCGCNONE 
J065061H12ACCCGCGCNONE 
J065061M13ACCCGCGCNONE 
J065078M16ACCCGCGCNONE 
J065083L13ACCCGCGCNONE 
J065084L01ACCCGCGCNONE 
J065091O21ACCCGCGCNONE 
J065095D06ACCCGCGCNONE 
J065095J12ACCCGCGCNONE 
J065097I18ACCCGCGCNONE 
J065114N19ACCCGCGCNONE 
J065118P09ACCCGCGCNONE 
J065123D11ACCCGCGCNONE 
J065123F08ACCCGCGCNONE 
J065124B04ACCCGCGCNONE 
J065128C04ACCCGCGCNONE 
J065137J07ACCCGCGCNONE 
J065165K23ACCCGCGCNONE 
J065183D22ACCCGCGCNONE 
J065195B17ACCCGCGCNONE 
J065201N18ACCCGCGCNONE 
J065204K15ACCCGCGCNONE 
J065208F08ACCCGCGCNONE 
J075011P21ACCCGCGCNONE 
J075020D18ACCCGCGCNONE 
J075028H08ACCCGCGCNONE 
J075065H14ACCCGCGCNONE 
J075069O11ACCCGCGCNONE 
J075071P10ACCCGCGCNONE 
J075177C11ACCCGCGCNONE 
J080002E12ACCCGCGCNONE 
J080002F23ACCCGCGCNONE 
J080002J09ACCCGCGCNONE 
J080003L11ACCCGCGCNONE 
J080004C05ACCCGCGCNONE 
J080004E12ACCCGCGCNONE 
J080004L13ACCCGCGCNONE 
J080006E06ACCCGCGCNONE 
J080006H14ACCCGCGCNONE 
J080008B07ACCCGCGCNONE 
J080008C21ACCCGCGCNONE 
J080008G01ACCCGCGCNONE 
J080008I09ACCCGCGCNONE 
J080008J10ACCCGCGCNONE 
J080008O08ACCCGCGCNONE 
J080009C10ACCCGCGCNONE 
J080009M22ACCCGCGCNONE 
J080009O11ACCCGCGCNONE 
J080009P22ACCCGCGCNONE 
J080010B11ACCCGCGCNONE 
J080010K04ACCCGCGCNONE 
J080011F13ACCCGCGCNONE 
J080013K07ACCCGCGCNONE 
J080014H24ACCCGCGCNONE 
J080015A13ACCCGCGCNONE 
J080015G11ACCCGCGCNONE 
J080015N21ACCCGCGCNONE 
J080016N04ACCCGCGCNONE 
J080018I15ACCCGCGCNONE 
J080018O22ACCCGCGCNONE 
J080020N07ACCCGCGCNONE 
J080021F19ACCCGCGCNONE 
J080021K02ACCCGCGCNONE 
J080023E20ACCCGCGCNONE 
J080025M08ACCCGCGCNONE 
J080026E10ACCCGCGCNONE 
J080027M18ACCCGCGCNONE 
J080029C04ACCCGCGCNONE 
J080030A07ACCCGCGCNONE 
J080030A13ACCCGCGCNONE 
J080030D14ACCCGCGCNONE 
J080030D18ACCCGCGCNONE 
J080031H14ACCCGCGCNONE 
J080031N07ACCCGCGCNONE 
J080032B12ACCCGCGCNONE 
J080036N19ACCCGCGCNONE 
J080036O03ACCCGCGCNONE 
J080038J23ACCCGCGCNONE 
J080040D10ACCCGCGCNONE 
J080040E08ACCCGCGCNONE 
J080041K04ACCCGCGCNONE 
J080042F24ACCCGCGCNONE 
J080042H22ACCCGCGCNONE 
J080042H23ACCCGCGCNONE 
J080044N24ACCCGCGCNONE 
J080045F16ACCCGCGCNONE 
J080046C04ACCCGCGCNONE 
J080046C19ACCCGCGCNONE 
J080046L07ACCCGCGCNONE 
J080046M19ACCCGCGCNONE 
J080048N16ACCCGCGCNONE 
J080048P05ACCCGCGCNONE 
J080049N15ACCCGCGCNONE 
J080050G22ACCCGCGCNONE 
J080052A09ACCCGCGCNONE 
J080052J01ACCCGCGCNONE 
J080053N04ACCCGCGCNONE 
J080055K09ACCCGCGCNONE 
J080056N06ACCCGCGCNONE 
J080057G09ACCCGCGCNONE 
J080058E22ACCCGCGCNONE 
J080059E04ACCCGCGCNONE 
J080061F19ACCCGCGCNONE 
J080062C19ACCCGCGCNONE 
J080062E15ACCCGCGCNONE 
J080063M12ACCCGCGCNONE 
J080063P12ACCCGCGCNONE 
J080064F02ACCCGCGCNONE 
J080064O16ACCCGCGCNONE 
J080065E22ACCCGCGCNONE 
J080066C18ACCCGCGCNONE 
J080068E10ACCCGCGCNONE 
J080068O13ACCCGCGCNONE 
J080069A09ACCCGCGCNONE 
J080069M24ACCCGCGCNONE 
J080071B21ACCCGCGCNONE 
J080071C23ACCCGCGCNONE 
J080072H01ACCCGCGCNONE 
J080072I16ACCCGCGCNONE 
J080074D12ACCCGCGCNONE 
J080075F18ACCCGCGCNONE 
J080075J08ACCCGCGCNONE 
J080075N24ACCCGCGCNONE 
J080076L02ACCCGCGCNONE 
J080076L21ACCCGCGCNONE 
J080077E23ACCCGCGCNONE 
J080079M18ACCCGCGCNONE 
J080080B19ACCCGCGCNONE 
J080080H19ACCCGCGCNONE 
J080080L11ACCCGCGCNONE 
J080081L18ACCCGCGCNONE 
J080082N16ACCCGCGCNONE 
J080083M19ACCCGCGCNONE 
J080084C20ACCCGCGCNONE 
J080084M05ACCCGCGCNONE 
J080085O19ACCCGCGCNONE 
J080086E02ACCCGCGCNONE 
J080087B17ACCCGCGCNONE 
J080088G21ACCCGCGCNONE 
J080088M20ACCCGCGCNONE 
J080089H02ACCCGCGCNONE 
J080090F01ACCCGCGCNONE 
J080090O03ACCCGCGCNONE 
J080091F10ACCCGCGCNONE 
J080091F21ACCCGCGCNONE 
J080091G07ACCCGCGCNONE 
J080091H02ACCCGCGCNONE 
J080092C01ACCCGCGCNONE 
J080092C08ACCCGCGCNONE 
J080092H03ACCCGCGCNONE 
J080092L08ACCCGCGCNONE 
J080094F04ACCCGCGCNONE 
J080094H13ACCCGCGCNONE 
J080095B19ACCCGCGCNONE 
J080096G21ACCCGCGCNONE 
J080096M14ACCCGCGCNONE 
J080097M21ACCCGCGCNONE 
J080308I23ACCCGCGCNONE 
J080319A21ACCCGCGCNONE 
J090009G07ACCCGCGCNONE 
J090015E19ACCCGCGCNONE 
L22155ACCCGCGCNONE 
Os12g0408800AK059660ACCCGCGCNONE 
AK068032ACCCGCGCNONE 
J013131D11ACCCGCGCNONE 
Os12g0535900006-061-F02GCGCGGGTCGNONE 
AK069422GCGCGGGTCGPlus-3 domain containing protein. 
AK109358GCGCGGGTCGNONE 
Os12g0638500AK072720ACCCGCGCConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.