version

Summary of OsREG440 (All List)

OrganismOryza sativa  
IDOsREG440  
SequenceACCGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
AACCG(G/A)  overlapping GT1 box  
PLACE Motif 
Total Entry Count994  

Entry Sequences (994 entries)

LocusGene modelSequenceDescription
Os01g0134500AK111908ACCGGCCCSimilar to Delta-7-sterol-C5(6)-desaturase (EC 1.3.3.-) (Delta-7-C-5 sterol desaturase) (Delta7-sterol-C5-desaturase). 
AK112014ACCGGCCCNONE 
Os01g0156300AK107993ACCGGCCCSimilar to Cappuccino protein. 
Os01g0203300015-045-F03ACCGGCCCATCTNONE 
015-045-F03ACCGGCCCATTNONE 
AK106329ACCGGCCCATCTConserved hypothetical protein. 
AK106329ACCGGCCCATTConserved hypothetical protein. 
Os01g0236800Os01g0236800GGGCCGGTSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
Os01g0276500006-030-E04GGGCCGGTNONE 
AK061002GGGCCGGTSimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)]. 
AK099335GGGCCGGTNONE 
Os01g0303300J053035N19ACCGGCCCACGCNONE 
J075042F02ACCGGCCCACGCNONE 
J075068E10ACCGGCCCACGCNONE 
J075116E19ACCGGCCCACGCNONE 
J075131C10ACCGGCCCACGCNONE 
J075145J11ACCGGCCCACGCNONE 
J075157P20ACCGGCCCACGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12ACCGGCCCACGCNONE 
Os01g0316800009-188-E08ACCGGCCCATAANONE 
AK058821ACCGGCCCATAANONE 
AK119788ACCGGCCCATAASimilar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1). 
J065098A09ACCGGCCCATAANONE 
J065102J21ACCGGCCCATAANONE 
J065173M10ACCGGCCCATAANONE 
J075066K08ACCGGCCCATAANONE 
J080302B04ACCGGCCCATAANONE 
J080310P14ACCGGCCCATAANONE 
J080311I23ACCGGCCCATAANONE 
J080319N12ACCGGCCCATAANONE 
J100024D14ACCGGCCCATAANONE 
J100055N12ACCGGCCCATAANONE 
Os01g0337900AK120645ACCGGCCCSimilar to Dihydrolipoamide dehydrogenase. 
Os01g0346400J100032G11ACCGGCCCATTConserved hypothetical protein. 
Os01g0358300AK060388GTGGTGGGCCGGTTTGGGCTTTTNONE 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-C09AAAAGCCCAAACCGGCCCACCACNONE 
006-088-H03AAAAGCCCAAACCGGCCCACCACNONE 
006-102-H05AAAAGCCCAAACCGGCCCACCACNONE 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
J013105M07AAAAGCCCAAACCGGCCCACCACNONE 
J013155A16AAAAGCCCAAACCGGCCCACCACNONE 
J033025C03AAAAGCCCAAACCGGCCCACCACNONE 
J033072L20AAAAGCCCAAACCGGCCCACCACNONE 
J033095I15AAAAGCCCAAACCGGCCCACCACNONE 
J033105E03AAAAGCCCAAACCGGCCCACCACNONE 
J033112G18AAAAGCCCAAACCGGCCCACCACNONE 
J033125D09AAAAGCCCAAACCGGCCCACCACNONE 
J065100L16AAAAGCCCAAACCGGCCCACCACNONE 
J065176I05AAAAGCCCAAACCGGCCCACCACNONE 
J090001C14AAAAGCCCAAACCGGCCCACCACNONE 
J090058E15AAAAGCCCAAACCGGCCCACCACNONE 
J090068F07AAAAGCCCAAACCGGCCCACCACNONE 
Os01g0513700AK058445ACCGGCCCATGGNONE 
AK068877ACCGGCCCATGGSybindin-like protein family protein. 
J023001F01ACCGGCCCATGGNONE 
J065065I18ACCGGCCCATGGNONE 
J065165A09ACCGGCCCATGGNONE 
J065184N12ACCGGCCCATGGNONE 
J065205M05ACCGGCCCATGGNONE 
J075172I17ACCGGCCCATGGNONE 
J090025O09ACCGGCCCATGGNONE 
J100087H03ACCGGCCCATGGNONE 
Os01g0606900AK065697ACCGGCCCACGGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os01g0613900014-018-D04ACCGGCCCACAANONE 
AK119181ACCGGCCCACAAProtein of unknown function UPF0052 and CofD family protein. 
J023119M14ACCGGCCCACAANONE 
J065019A15ACCGGCCCACAANONE 
J075090J10ACCGGCCCACAANONE 
J075195H12ACCGGCCCACAANONE 
Os01g0679000AK058515ACCGGCCCATGARNA polymerase III subunit RPC82, C -terminal domain containing protein. 
J013149O08ACCGGCCCATGANONE 
J033064N24ACCGGCCCATGANONE 
J043022M20ACCGGCCCATGANONE 
J065075K20ACCGGCCCATGANONE 
J065081K04ACCGGCCCATGANONE 
J065128K13ACCGGCCCATGANONE 
J065131K12ACCGGCCCATGANONE 
J065137H20ACCGGCCCATGANONE 
J065205A09ACCGGCCCATGANONE 
J090030C13ACCGGCCCATGANONE 
J090053I08ACCGGCCCATGANONE 
J090054O22ACCGGCCCATGANONE 
J090082C15ACCGGCCCATGANONE 
J090097P12ACCGGCCCATGANONE 
Os01g0695200015-090-F01ACCGGCCCNONE 
015-090-F01ATCCCCCACCGGCCCNONE 
AK064145ACCGGCCCProtein of unknown function DUF266, plant family protein. 
AK064145ATCCCCCACCGGCCCProtein of unknown function DUF266, plant family protein. 
J065163N10ACCGGCCCNONE 
J065163N10ATCCCCCACCGGCCCNONE 
J100051F21ACCGGCCCNONE 
J100051F21ATCCCCCACCGGCCCNONE 
Os01g0706100AK072799CTTGGGCCGGTConserved hypothetical protein. 
J013049G14CTTGGGCCGGTNONE 
J023136E17CTTGGGCCGGTNONE 
Os01g0720600016-050-G11AGAGTGGGCCGGTNONE 
AK066808AGAGTGGGCCGGTNONE 
AK100976AGAGTGGGCCGGTNONE 
AK106541AGAGTGGGCCGGTStarch synthase IVa (Glycogen (Starch) synthase-like). 
AY373257AGAGTGGGCCGGTNONE 
J100039H11AGAGTGGGCCGGTNONE 
J100072K02AGAGTGGGCCGGTNONE 
Os01g0731800AK121474ACCGGCCCRINGv domain containing protein. 
J023148N13ACCGGCCCNONE 
J065136G08ACCGGCCCNONE 
Os01g0738600AK073479ACCGGCCCENTH/VHS domain containing protein. 
AK120616ACCGGCCCNONE 
J013046M12ACCGGCCCNONE 
J013152B11ACCGGCCCNONE 
J023007A09ACCGGCCCNONE 
J023007N03ACCGGCCCNONE 
J023042A01ACCGGCCCNONE 
J023059P06ACCGGCCCNONE 
J023113A05ACCGGCCCNONE 
J033044K11ACCGGCCCNONE 
J033082E04ACCGGCCCNONE 
J090033B13ACCGGCCCNONE 
J090062H08ACCGGCCCNONE 
J100086G23ACCGGCCCNONE 
Os01g0749900AK103588TGGATGGGCCGGTProtein of unknown function DUF250 domain containing protein. 
J033090O22TGGATGGGCCGGTNONE 
J033133C05TGGATGGGCCGGTNONE 
J065122N01TGGATGGGCCGGTNONE 
J065188K04TGGATGGGCCGGTNONE 
J090012D18TGGATGGGCCGGTNONE 
J100074N02TGGATGGGCCGGTNONE 
Os01g0756300014-074-B05ACCGGCCCGGTNONE 
AK069648ACCGGCCCGGTConserved hypothetical protein. 
Os01g0764600AK060621ACCGGCCCAGCFosfomycin resistance kinase FomA family protein. 
J013111L18ACCGGCCCAGCNONE 
J013134N08ACCGGCCCAGCNONE 
Os01g0764800AK102809ACCGGCCCSimilar to Nt-gh3 deduced protein. 
Os01g0770400006-112-B08GTGCGGTGGGCCGGTNONE 
AK061253GTGCGGTGGGCCGGTNONE 
AK061585GTGCGGTGGGCCGGTCyclin-like F-box domain containing protein. 
Os01g0800800AK108093ACCGGCCCACAConserved hypothetical protein. 
Os01g0813800AK063065CCTGGGCCGGTNONE 
Os01g0827500AK111814ACCGGCCCExo70 exocyst complex subunit family protein. 
Os01g0872700AK066633ACCGGCCCNONE 
AK100381ACCGGCCCPutative 5-3 exonuclease domain containing protein. 
J013028K13ACCGGCCCNONE 
J013038C19ACCGGCCCNONE 
J023024P16ACCGGCCCNONE 
J023074N21ACCGGCCCNONE 
J023085E21ACCGGCCCNONE 
J033034K14ACCGGCCCNONE 
J033044N04ACCGGCCCNONE 
J033052O10ACCGGCCCNONE 
J033087J09ACCGGCCCNONE 
J033129L17ACCGGCCCNONE 
J033143O07ACCGGCCCNONE 
J065014M22ACCGGCCCNONE 
J065025H10ACCGGCCCNONE 
J065051H21ACCGGCCCNONE 
J065123E05ACCGGCCCNONE 
J065181P03ACCGGCCCNONE 
J100064B21ACCGGCCCNONE 
Os01g0888700AK073376ACCGGCCCACGCCTCProtein of unknown function RIO1 family protein. 
J033030B16ACCGGCCCACGCCTCNONE 
J033098D06ACCGGCCCACGCCTCNONE 
J033112A12ACCGGCCCACGCCTCNONE 
J043003L24ACCGGCCCACGCCTCNONE 
Os01g0889000AK103621TTGTGGGCCGGTTetratricopeptide-like helical domain containing protein. 
Os01g0929500AK111399AGTTGGGCCTTACTGGGCCGGTSimilar to Carbonyl reductase-like protein. 
AK120263AGTTGGGCCTTACTGGGCCGGTNONE 
Os01g0949200AK102412ACCGGCCCAACTNONE 
J033093A04ACCGGCCCAACTNONE 
J065053P06ACCGGCCCAACTNONE 
J100086D18ACCGGCCCAACTNONE 
Os02g0105400009-186-H01GGGCCGGTNONE 
011-071-C07GGGCCGGTNONE 
014-024-F03GGGCCGGTNONE 
AK105416GGGCCGGTNONE 
D13817GGGCCGGTNONE 
J023087J24GGGCCGGTNONE 
J065191M15GGGCCGGTNONE 
Os02g0162500009-181-F03ACCGGCCCAATTNONE 
AK058907ACCGGCCCAATTNONE 
AK121223ACCGGCCCAATTSimilar to 40S ribosomal protein S14. 
J023090I10ACCGGCCCAATTNONE 
J023136J11ACCGGCCCAATTNONE 
J053097J20ACCGGCCCAATTNONE 
J053098F01ACCGGCCCAATTNONE 
J065065B09ACCGGCCCAATTNONE 
J065082M04ACCGGCCCAATTNONE 
J065188O05ACCGGCCCAATTNONE 
J075057P15ACCGGCCCAATTNONE 
J075061J08ACCGGCCCAATTNONE 
J075061N15ACCGGCCCAATTNONE 
J075131I08ACCGGCCCAATTNONE 
J075141H13ACCGGCCCAATTNONE 
J080062E14ACCGGCCCAATTNONE 
J080062P15ACCGGCCCAATTNONE 
J080318G17ACCGGCCCAATTNONE 
J080319G19ACCGGCCCAATTNONE 
J090001L10ACCGGCCCAATTNONE 
J090024I18ACCGGCCCAATTNONE 
J090033F24ACCGGCCCAATTNONE 
J090036M16ACCGGCCCAATTNONE 
J090040I24ACCGGCCCAATTNONE 
J090048P06ACCGGCCCAATTNONE 
J090049B12ACCGGCCCAATTNONE 
J090068C02ACCGGCCCAATTNONE 
J090069O04ACCGGCCCAATTNONE 
J090084H22ACCGGCCCAATTNONE 
J100022L03ACCGGCCCAATTNONE 
J100028O14ACCGGCCCAATTNONE 
J100028O18ACCGGCCCAATTNONE 
J100032A15ACCGGCCCAATTNONE 
J100033D21ACCGGCCCAATTNONE 
J100034J23ACCGGCCCAATTNONE 
J100043K22ACCGGCCCAATTNONE 
J100052M22ACCGGCCCAATTNONE 
J100053N03ACCGGCCCAATTNONE 
J100074N24ACCGGCCCAATTNONE 
J100082J10ACCGGCCCAATTNONE 
Os02g0179100AK058557CACGCCACCGGCCCATACMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10CACGCCACCGGCCCATACNONE 
Os02g0227000J023084F07ACCGGCCCATTTNONE 
J033051H22ACCGGCCCATTTProtein of unknown function UPF0054 family protein. 
Os02g0266200AK099647TTCGTGGGCCGGGCCGGTCACTGACANONE 
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein. 
Os02g0522000AK101294GCTGGGCCGGTGGACGCGTCGCRetrotransposon gag protein family protein. 
Os02g0530300014-069-H07GGGCCGGTNONE 
AK063708GGGCCGGTZinc finger, A20-type domain containing protein. 
Os02g0556100006-100-D03GGGCCGGTNONE 
AK059938GGGCCGGTNONE 
AK103125GGGCCGGTNAD-dependent epimerase/dehydratase family protein. 
J033107B22GGGCCGGTNONE 
J033119M03GGGCCGGTNONE 
J033120L06GGGCCGGTNONE 
J043007B02GGGCCGGTNONE 
J043012G03GGGCCGGTNONE 
J043024A02GGGCCGGTNONE 
J043027J18GGGCCGGTNONE 
J100019E06GGGCCGGTNONE 
J100069C22GGGCCGGTNONE 
Os02g0629800AK121915ATTGGGCCGGTSimilar to Defensin precursor. 
J033106C08ATTGGGCCGGTNONE 
J065053G20ATTGGGCCGGTNONE 
J065114P06ATTGGGCCGGTNONE 
J065174H18ATTGGGCCGGTNONE 
J065183J04ATTGGGCCGGTNONE 
J080310C15ATTGGGCCGGTNONE 
Os02g0651900AK101633AATGGGCCGGTNONE 
AK102949AATGGGCCGGTConserved hypothetical protein. 
J080018N20AATGGGCCGGTNONE 
J080062I19AATGGGCCGGTNONE 
J100064N12AATGGGCCGGTNONE 
J100083B11AATGGGCCGGTNONE 
J100089D08AATGGGCCGGTNONE 
Os02g0672500AK109266ACCGGCCCACACNONE 
Os02g0697200015-013-B10TGTTGGGCCGGTNONE 
AK059475TGTTGGGCCGGTNONE 
AK102993TGTTGGGCCGGTConserved hypothetical protein. 
J033079I18TGTTGGGCCGGTNONE 
J033082A14TGTTGGGCCGGTNONE 
J065047H08TGTTGGGCCGGTNONE 
J065131M14TGTTGGGCCGGTNONE 
Os02g0757900006-114-B06ACCGGCCCGTTTTGGGCCCACCCNONE 
AK061269ACCGGCCCGTTTTGGGCCCACCCSimilar to Poly(A)-binding protein II-like. 
AK071146ACCGGCCCGTTTTGGGCCCACCCNONE 
J023081D16ACCGGCCCGTTTTGGGCCCACCCNONE 
J043034B17ACCGGCCCGTTTTGGGCCCACCCNONE 
J065027M09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065043F02ACCGGCCCGTTTTGGGCCCACCCNONE 
J065086G05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065093A05ACCGGCCCGTTTTGGGCCCACCCNONE 
J065109F16ACCGGCCCGTTTTGGGCCCACCCNONE 
J065130N09ACCGGCCCGTTTTGGGCCCACCCNONE 
J065154D24ACCGGCCCGTTTTGGGCCCACCCNONE 
J065199L11ACCGGCCCGTTTTGGGCCCACCCNONE 
J075166H22ACCGGCCCGTTTTGGGCCCACCCNONE 
Os02g0758000013-065-E04GGGTGGGCCCAAAACGGGCCGGTNONE 
014-002-E03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-004-B07GGGTGGGCCCAAAACGGGCCGGTNONE 
014-038-F03GGGTGGGCCCAAAACGGGCCGGTNONE 
014-072-G02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-078-E02GGGTGGGCCCAAAACGGGCCGGTNONE 
014-081-H11GGGTGGGCCCAAAACGGGCCGGTNONE 
016-060-C11GGGTGGGCCCAAAACGGGCCGGTNONE 
AK064389GGGTGGGCCCAAAACGGGCCGGTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
AK074003GGGTGGGCCCAAAACGGGCCGGTNONE 
AK105464GGGTGGGCCCAAAACGGGCCGGTNONE 
J033076P21GGGTGGGCCCAAAACGGGCCGGTNONE 
Os02g0778200AK065948ACCGGCCCAAGTTGGCCCAAGAminoacyl-tRNA synthetase, class I family protein. 
Os02g0792900AK068367ACCGGCCCGGTTMS membrane protein/tumour differentially expressed protein family protein. 
AK104731ACCGGCCCGGTNONE 
AK106174ACCGGCCCGGTNONE 
AK119191ACCGGCCCGGTNONE 
Os02g0823800AK120318ACCGGCCCATATConserved hypothetical protein. 
J075055J16ACCGGCCCATATNONE 
Os03g0130700AK110670GCTGGGCCGGTNONE 
Os03g0131500AK109755TCCGGGCCGGTVitamin K epoxide reductase domain containing protein. 
Os03g0145700AK065716AAATGGGCCGGTNONE 
J013039F14AAATGGGCCGGTNONE 
J013091M20AAATGGGCCGGTNONE 
J065059P20AAATGGGCCGGTNONE 
J065128M07AAATGGGCCGGTNONE 
J065136N23AAATGGGCCGGTNONE 
J065163H21AAATGGGCCGGTNONE 
J065176B18AAATGGGCCGGTNONE 
J065177A17AAATGGGCCGGTNONE 
J065201F24AAATGGGCCGGTNONE 
Os03g0192400009-081-A03AGTTGGGCCGGTNONE 
009-159-B02AGTTGGGCCGGTNONE 
AK070573AGTTGGGCCGGTGRIM-19 family protein. 
J023056B01AGTTGGGCCGGTNONE 
J023075G06AGTTGGGCCGGTNONE 
J033048K16AGTTGGGCCGGTNONE 
J033048L16AGTTGGGCCGGTNONE 
J053031H23AGTTGGGCCGGTNONE 
J065002H14AGTTGGGCCGGTNONE 
J065006G22AGTTGGGCCGGTNONE 
J065032G13AGTTGGGCCGGTNONE 
J065056A09AGTTGGGCCGGTNONE 
J065078I01AGTTGGGCCGGTNONE 
J065095G01AGTTGGGCCGGTNONE 
J065095I18AGTTGGGCCGGTNONE 
J065134M18AGTTGGGCCGGTNONE 
J065158P07AGTTGGGCCGGTNONE 
J065165K17AGTTGGGCCGGTNONE 
J065181J12AGTTGGGCCGGTNONE 
J065189N09AGTTGGGCCGGTNONE 
J065200D13AGTTGGGCCGGTNONE 
J065202H20AGTTGGGCCGGTNONE 
J065215K20AGTTGGGCCGGTNONE 
J075049N19AGTTGGGCCGGTNONE 
J075147J16AGTTGGGCCGGTNONE 
J090081E19AGTTGGGCCGGTNONE 
J100017C16AGTTGGGCCGGTNONE 
J100039M16AGTTGGGCCGGTNONE 
J100043E23AGTTGGGCCGGTNONE 
J100063L12AGTTGGGCCGGTNONE 
J100079F22AGTTGGGCCGGTNONE 
Os03g0195900J065063O15GGAGTGGGCCGGTNONE 
Os03g0260600AK106649GGGCCGGTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0276500011-014-A06ACCGGCCCAACNONE 
012-043-E04ACCGGCCCAACNONE 
012-096-G01ACCGGCCCAACNONE 
014-005-A07ACCGGCCCAACNONE 
014-031-F09ACCGGCCCAACNONE 
014-040-C09ACCGGCCCAACNONE 
014-092-G02ACCGGCCCAACNONE 
AK072830ACCGGCCCAACNONE 
AK099275ACCGGCCCAACNONE 
AK109474ACCGGCCCAACSimilar to Heat shock protein 70. 
J013036E08ACCGGCCCAACNONE 
J013047P03ACCGGCCCAACNONE 
J013048H14ACCGGCCCAACNONE 
J013060E24ACCGGCCCAACNONE 
J013093N10ACCGGCCCAACNONE 
J013123K11ACCGGCCCAACNONE 
J013153C09ACCGGCCCAACNONE 
J023010D20ACCGGCCCAACNONE 
J023027O13ACCGGCCCAACNONE 
J023029B01ACCGGCCCAACNONE 
J023063G14ACCGGCCCAACNONE 
J023083D09ACCGGCCCAACNONE 
J023091M13ACCGGCCCAACNONE 
J023121M10ACCGGCCCAACNONE 
J023126D10ACCGGCCCAACNONE 
J023139H01ACCGGCCCAACNONE 
J023145B18ACCGGCCCAACNONE 
J033029G15ACCGGCCCAACNONE 
J033050K13ACCGGCCCAACNONE 
J033057L09ACCGGCCCAACNONE 
J033092M15ACCGGCCCAACNONE 
J065007N14ACCGGCCCAACNONE 
J065038E07ACCGGCCCAACNONE 
J065043A09ACCGGCCCAACNONE 
J065100C19ACCGGCCCAACNONE 
J065117C02ACCGGCCCAACNONE 
J065213I04ACCGGCCCAACNONE 
J090001F01ACCGGCCCAACNONE 
J090025D07ACCGGCCCAACNONE 
J090037C11ACCGGCCCAACNONE 
J090047N11ACCGGCCCAACNONE 
J090053O05ACCGGCCCAACNONE 
J090070F11ACCGGCCCAACNONE 
J090082O16ACCGGCCCAACNONE 
J090085F20ACCGGCCCAACNONE 
J090096N08ACCGGCCCAACNONE 
Os03g0278200AK103544GGGCCGGTNAD-dependent epimerase/dehydratase family protein. 
Os03g0319300006-021-E05AACGGGCCGGTNONE 
006-022-H12AACGGGCCGGTNONE 
009-187-E02AACGGGCCGGTNONE 
AF042840AACGGGCCGGTNONE 
AK059756AACGGGCCGGTCalmodulin (CaM). 
AK070090AACGGGCCGGTNONE 
J065017J02AACGGGCCGGTNONE 
J065028G17AACGGGCCGGTNONE 
J065045N09AACGGGCCGGTNONE 
J065078F21AACGGGCCGGTNONE 
J065091H01AACGGGCCGGTNONE 
J065112B19AACGGGCCGGTNONE 
J065186E08AACGGGCCGGTNONE 
J065199G12AACGGGCCGGTNONE 
J075030K07AACGGGCCGGTNONE 
J075050B02AACGGGCCGGTNONE 
J075057G07AACGGGCCGGTNONE 
J075070F01AACGGGCCGGTNONE 
J075093N12AACGGGCCGGTNONE 
J075095K13AACGGGCCGGTNONE 
J075102D14AACGGGCCGGTNONE 
J075103B17AACGGGCCGGTNONE 
J075114K05AACGGGCCGGTNONE 
J075142F18AACGGGCCGGTNONE 
J075154L11AACGGGCCGGTNONE 
J075185F08AACGGGCCGGTNONE 
J090012A14AACGGGCCGGTNONE 
J090044L10AACGGGCCGGTNONE 
J100044C12AACGGGCCGGTNONE 
J100088J19AACGGGCCGGTNONE 
Os03g0372900AK100417ACCGGCCCCyclin-like F-box domain containing protein. 
Os03g0647800003-103-H03ACCGGCCCACCAACNONE 
006-104-G09ACCGGCCCACCAACNONE 
AK070243ACCGGCCCACCAACConserved hypothetical protein. 
J100056F22ACCGGCCCACCAACNONE 
Os03g0656900AK066416ATATGGGCCGGTNusB/RsmB/TIM44 domain containing protein. 
J065157L23ATATGGGCCGGTNONE 
J065166P22ATATGGGCCGGTNONE 
Os03g0685900009-026-A09TATTGGGCCGGTNONE 
009-145-C09TATTGGGCCGGTNONE 
AK062981TATTGGGCCGGTConserved hypothetical protein. 
J065001D12TATTGGGCCGGTNONE 
J065023B10TATTGGGCCGGTNONE 
J065041E10TATTGGGCCGGTNONE 
J065046C01TATTGGGCCGGTNONE 
J065146I22TATTGGGCCGGTNONE 
J065184F20TATTGGGCCGGTNONE 
J075011E15TATTGGGCCGGTNONE 
J075048H17TATTGGGCCGGTNONE 
J075070H15TATTGGGCCGGTNONE 
J075133C01TATTGGGCCGGTNONE 
J075170D02TATTGGGCCGGTNONE 
J090001G08TATTGGGCCGGTNONE 
J090026B09TATTGGGCCGGTNONE 
J100055M03TATTGGGCCGGTNONE 
Os03g0687700AK064673ACCGGCCCGCAConserved hypothetical protein. 
AK119706ACCGGCCCGCANONE 
J075042I10ACCGGCCCGCANONE 
J075111I20ACCGGCCCGCANONE 
J075176K09ACCGGCCCGCANONE 
J080072D18ACCGGCCCGCANONE 
J080306M23ACCGGCCCGCANONE 
Os03g0695600006-103-C09ACCGGCCCACTNONE 
014-029-B11ACCGGCCCACTNONE 
AB026566ACCGGCCCACTNONE 
AK061228ACCGGCCCACTProteasome subunit beta type 2 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit beta-4). 
AK099128ACCGGCCCACTNONE 
J023041C17ACCGGCCCACTNONE 
J043030L19ACCGGCCCACTNONE 
J065002E17ACCGGCCCACTNONE 
J065042H23ACCGGCCCACTNONE 
J065110P10ACCGGCCCACTNONE 
J065112D10ACCGGCCCACTNONE 
J065114B21ACCGGCCCACTNONE 
J065124B02ACCGGCCCACTNONE 
J065138P08ACCGGCCCACTNONE 
J065182O20ACCGGCCCACTNONE 
J065216N05ACCGGCCCACTNONE 
J075060D19ACCGGCCCACTNONE 
J075097M03ACCGGCCCACTNONE 
J075098I11ACCGGCCCACTNONE 
J075142I15ACCGGCCCACTNONE 
J090018B21ACCGGCCCACTNONE 
J090034E12ACCGGCCCACTNONE 
J090042N01ACCGGCCCACTNONE 
Os03g0756800009-100-H11CCGTGGGCCGGTGGGCCCGNONE 
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein. 
J013095D02CCGTGGGCCGGTGGGCCCGNONE 
J023091G12CCGTGGGCCGGTGGGCCCGNONE 
J065207J17CCGTGGGCCGGTGGGCCCGNONE 
J100067G13CCGTGGGCCGGTGGGCCCGNONE 
J100089L11CCGTGGGCCGGTGGGCCCGNONE 
Os03g0769600AK100054ACCGGCCCATCTResB-like family protein. 
Os03g0774200AK065851ACCGGCCCNONE 
AK119532ACCGGCCCSimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15ACCGGCCCNONE 
J023107I03ACCGGCCCNONE 
J065156I19ACCGGCCCNONE 
J065176L07ACCGGCCCNONE 
J100066F15ACCGGCCCNONE 
Os03g0822900AK099787GGCTGGGCCGGTZinc finger, BED-type predicted domain containing protein. 
J013042C24GGCTGGGCCGGTNONE 
J013096O21GGCTGGGCCGGTNONE 
J023109I23GGCTGGGCCGGTNONE 
J033106N09GGCTGGGCCGGTNONE 
J033107H03GGCTGGGCCGGTNONE 
J033118G03GGCTGGGCCGGTNONE 
J033145I24GGCTGGGCCGGTNONE 
J065138D15GGCTGGGCCGGTNONE 
J065140L13GGCTGGGCCGGTNONE 
J065179M13GGCTGGGCCGGTNONE 
J065200F05GGCTGGGCCGGTNONE 
J075104F20GGCTGGGCCGGTNONE 
J075143A15GGCTGGGCCGGTNONE 
J075197J11GGCTGGGCCGGTNONE 
Os03g0846400AK067706GGGCCGGTNONE 
AK070549GGGCCGGTPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os04g0253000005-012-H08ACCGGCCCACCNONE 
009-095-D01ACCGGCCCACCNONE 
016-090-D11ACCGGCCCACCNONE 
AK073668ACCGGCCCACCSimilar to Histone H1. 
J013088G23ACCGGCCCACCNONE 
J013162C07ACCGGCCCACCNONE 
J023031N06ACCGGCCCACCNONE 
J023039N07ACCGGCCCACCNONE 
J023083I01ACCGGCCCACCNONE 
J023083O14ACCGGCCCACCNONE 
J023122B19ACCGGCCCACCNONE 
J023133L08ACCGGCCCACCNONE 
J033052L06ACCGGCCCACCNONE 
J033080E10ACCGGCCCACCNONE 
J090032L14ACCGGCCCACCNONE 
J100022N05ACCGGCCCACCNONE 
J100029A08ACCGGCCCACCNONE 
J100029H18ACCGGCCCACCNONE 
J100066D09ACCGGCCCACCNONE 
J100077M22ACCGGCCCACCNONE 
Os04g0378200AK103076ACCGGCCCAAACSterile alpha motif SAM domain containing protein. 
J033118E02ACCGGCCCAAACNONE 
J065065F15ACCGGCCCAAACNONE 
J090080I24ACCGGCCCAAACNONE 
Os04g0447400AK070858CTTGGGCTTTTATATGGGCCGGTSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09CTTGGGCTTTTATATGGGCCGGTNONE 
J023003G16CTTGGGCTTTTATATGGGCCGGTNONE 
J023006F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023008D10CTTGGGCTTTTATATGGGCCGGTNONE 
J023010A01CTTGGGCTTTTATATGGGCCGGTNONE 
J023012M16CTTGGGCTTTTATATGGGCCGGTNONE 
J023023H17CTTGGGCTTTTATATGGGCCGGTNONE 
J023029B12CTTGGGCTTTTATATGGGCCGGTNONE 
J023030F09CTTGGGCTTTTATATGGGCCGGTNONE 
J023034K03CTTGGGCTTTTATATGGGCCGGTNONE 
J023045A16CTTGGGCTTTTATATGGGCCGGTNONE 
J023048I04CTTGGGCTTTTATATGGGCCGGTNONE 
J023056C09CTTGGGCTTTTATATGGGCCGGTNONE 
J023056F05CTTGGGCTTTTATATGGGCCGGTNONE 
J023058B21CTTGGGCTTTTATATGGGCCGGTNONE 
J023058N06CTTGGGCTTTTATATGGGCCGGTNONE 
J023059F03CTTGGGCTTTTATATGGGCCGGTNONE 
J023059M19CTTGGGCTTTTATATGGGCCGGTNONE 
J023060P05CTTGGGCTTTTATATGGGCCGGTNONE 
J023062D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023063F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023068K15CTTGGGCTTTTATATGGGCCGGTNONE 
J023069L04CTTGGGCTTTTATATGGGCCGGTNONE 
J023075I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023086H01CTTGGGCTTTTATATGGGCCGGTNONE 
J023086I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023091M08CTTGGGCTTTTATATGGGCCGGTNONE 
J023095A07CTTGGGCTTTTATATGGGCCGGTNONE 
J023110K06CTTGGGCTTTTATATGGGCCGGTNONE 
J023113D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023126J05CTTGGGCTTTTATATGGGCCGGTNONE 
J023140F04CTTGGGCTTTTATATGGGCCGGTNONE 
J023141N19CTTGGGCTTTTATATGGGCCGGTNONE 
Os04g0551800016-049-G12GTTTGGGCCGGTNONE 
AK121568GTTTGGGCCGGTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06GTTTGGGCCGGTNONE 
J013111B11GTTTGGGCCGGTNONE 
J013121H23GTTTGGGCCGGTNONE 
J023012A17GTTTGGGCCGGTNONE 
J023092M05GTTTGGGCCGGTNONE 
J033026P14GTTTGGGCCGGTNONE 
J033033C10GTTTGGGCCGGTNONE 
J033033M10GTTTGGGCCGGTNONE 
J033035C24GTTTGGGCCGGTNONE 
J033052E19GTTTGGGCCGGTNONE 
J033140K19GTTTGGGCCGGTNONE 
J065036F18GTTTGGGCCGGTNONE 
J065067L12GTTTGGGCCGGTNONE 
J065095G09GTTTGGGCCGGTNONE 
J065115B08GTTTGGGCCGGTNONE 
J065218E24GTTTGGGCCGGTNONE 
J090002N13GTTTGGGCCGGTNONE 
J090008B12GTTTGGGCCGGTNONE 
J090016F24GTTTGGGCCGGTNONE 
J090019H14GTTTGGGCCGGTNONE 
J090020G20GTTTGGGCCGGTNONE 
J090029L18GTTTGGGCCGGTNONE 
J090057C23GTTTGGGCCGGTNONE 
J090073H23GTTTGGGCCGGTNONE 
J090081C16GTTTGGGCCGGTNONE 
J090081E21GTTTGGGCCGGTNONE 
J090084L14GTTTGGGCCGGTNONE 
J090086M01GTTTGGGCCGGTNONE 
J090089E16GTTTGGGCCGGTNONE 
J100031P12GTTTGGGCCGGTNONE 
J100090N23GTTTGGGCCGGTNONE 
Os04g0650500AK066690ACATGGGCCGGTConserved hypothetical protein. 
AK104273ACATGGGCCGGTNONE 
Os04g0658300AK067399TAATGGGCCGGTSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0668900AF085174ACCGGCCCACCNONE 
AK067891ACCGGCCCACCSimilar to Plastid terminal oxidase. 
Os04g0678800AK072212ACCGGCCCGTTN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065ACCGGCCCGTTNONE 
Os04g0682300AK061384TTGTGGGCCGGTSimilar to Phosphomannomutase 2 (EC 5.4.2.8) (PMM 2). 
AK104004TTGTGGGCCGGTNONE 
J033102P12TTGTGGGCCGGTNONE 
J100038F01TTGTGGGCCGGTNONE 
Os05g0180700J100062K04GCTGGGCCGGTConserved hypothetical protein. 
Os05g0223300AK069616ACCGGCCCATTTSimilar to RNA-binding protein. 
J080093O15ACCGGCCCATTTNONE 
J090061N02ACCGGCCCATTTNONE 
Os05g0227700AK067567AGTTGGGCTTGGACCGGCCCGTTConserved hypothetical protein. 
AK068760AGTTGGGCTTGGACCGGCCCGTTNONE 
J013108C14AGTTGGGCTTGGACCGGCCCGTTNONE 
Os05g0227800AK110997AACGGGCCGGTCCAAGCCCAAHomeodomain-like containing protein. 
Os05g0283600AK100359GCGTGGGCCGGTConserved hypothetical protein. 
AK106958GCGTGGGCCGGTNONE 
AK109539GCGTGGGCCGGTNONE 
J023083K23GCGTGGGCCGGTNONE 
Os05g0295900AK069962AACTGGGCCGGTConserved hypothetical protein. 
Os05g0377000Os05g0377000ACCGGCCCATCASimilar to Acyl carrier protein (ACP). 
Os05g0397700AK067298GGCCGGGCCGGGCCGGTSecY protein family protein. 
Os05g0424700AK107848GGGCCGGTSimilar to Copper transporter 1. 
Os05g0451200AK073037ACCGGCCCACGTConserved hypothetical protein. 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0499800016-065-G04ACCGGCCCNONE 
AK064392ACCGGCCCNONE 
AK103146ACCGGCCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J023075J11ACCGGCCCNONE 
J033120I02ACCGGCCCNONE 
Os05g0502800016-060-H05CCCATCCACCGGCCCGCANONE 
AK064242CCCATCCACCGGCCCGCANONE 
AK065486CCCATCCACCGGCCCGCANAF1 domain containing protein. 
Os05g0508500009-110-H08GGGCCGGTNONE 
009-135-B09GGGCCGGTNONE 
009-165-D10GGGCCGGTNONE 
AB053294GGGCCGGTNONE 
AK059385GGGCCGGTNONE 
AK106758GGGCCGGTSimilar to Thioredoxin H. 
J013121L08GGGCCGGTNONE 
J023069L24GGGCCGGTNONE 
J023146O17GGGCCGGTNONE 
J043030D01GGGCCGGTNONE 
J065084D15GGGCCGGTNONE 
J090046E10GGGCCGGTNONE 
J090078J10GGGCCGGTNONE 
Os05g0509200AK061566ACTGGGCCGGTNADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK099007ACTGGGCCGGTNONE 
AK100226ACTGGGCCGGTNONE 
J013114B12ACTGGGCCGGTNONE 
J023048D09ACTGGGCCGGTNONE 
Os05g0512500009-036-D05GTGGTGGGCCGGTNONE 
AK062441GTGGTGGGCCGGTCT20 family protein. 
J080003C10GTGGTGGGCCGGTNONE 
J080046G11GTGGTGGGCCGGTNONE 
Os05g0536900009-033-D11AGATGGGCCGGGCCGGTNONE 
AK105140AGATGGGCCGGGCCGGTSimilar to RAB7A. 
Os05g0540100AB021666ACCGGCCCNONE 
AK060623ACCGGCCCNONE 
AK103819ACCGGCCCFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0553700006-100-D08ACCGGGCCGGTNONE 
AK099747ACCGGGCCGGTNONE 
AK101606ACCGGGCCGGTNONE 
AK103396ACCGGGCCGGTSimilar to Syntaxin 71 (AtSYP71). 
J033022M23ACCGGGCCGGTNONE 
J090086G01ACCGGGCCGGTNONE 
Os05g0567300013-039-F11CCATGGGCTTTGTTGGGCCGGTNONE 
AK112068CCATGGGCTTTGTTGGGCCGGTGTP-binding protein, HSR1-related domain containing protein. 
Os05g0576300015-055-B11ACCGGCCCCACCNONE 
AK106354ACCGGCCCCACCZinc finger, CCCH-type domain containing protein. 
Os06g0134000AK102796TCCGGCCCAACCGGCCCACCCNONE 
Os06g0136000AK060303ACCGGCCCAATSimilar to Hypersensitive-induced reaction protein 4. 
AK102678ACCGGCCCAATNONE 
J075185K19ACCGGCCCAATNONE 
J090028C16ACCGGCCCAATNONE 
J090099N12ACCGGCCCAATNONE 
J100070O10ACCGGCCCAATNONE 
Os06g0232000006-109-B11ACCGGCCCACCNONE 
011-080-C04ACCGGCCCACCNONE 
016-019-G01ACCGGCCCACCNONE 
AB110192ACCGGCCCACCNONE 
AK068966ACCGGCCCACCNONE 
AK071776ACCGGCCCACCConserved hypothetical protein. 
AK106053ACCGGCCCACCNONE 
J013146K14ACCGGCCCACCNONE 
J023013A10ACCGGCCCACCNONE 
J023029O20ACCGGCCCACCNONE 
J023110G05ACCGGCCCACCNONE 
J023135H04ACCGGCCCACCNONE 
J033125H14ACCGGCCCACCNONE 
J043009N01ACCGGCCCACCNONE 
J090096E06ACCGGCCCACCNONE 
J100070G19ACCGGCCCACCNONE 
Os06g0236200J075111M01ACCGGCCCACACConserved hypothetical protein. 
J075171D01ACCGGCCCACACNONE 
Os06g0332500009-108-G06ACCGGCCCAGTNONE 
009-119-F06ACCGGCCCAGTNONE 
AK121262ACCGGCCCAGTConserved hypothetical protein. 
J023104L05ACCGGCCCAGTNONE 
J033022F22ACCGGCCCAGTNONE 
Os06g0348800AF318581GCGCGCGACCGGCCCNONE 
AK061946GCGCGCGACCGGCCCNONE 
AK065184GCGCGCGACCGGCCCNONE 
AK098909GCGCGCGACCGGCCCNONE 
AK098915GCGCGCGACCGGCCCHomeodomain-like containing protein. 
AK122161GCGCGCGACCGGCCCNONE 
J013002D22GCGCGCGACCGGCCCNONE 
J013002F22GCGCGCGACCGGCCCNONE 
J013002I19GCGCGCGACCGGCCCNONE 
J013022A07GCGCGCGACCGGCCCNONE 
J013135J08GCGCGCGACCGGCCCNONE 
J033147G01GCGCGCGACCGGCCCNONE 
J075012G19GCGCGCGACCGGCCCNONE 
J075049L03GCGCGCGACCGGCCCNONE 
J075068G02GCGCGCGACCGGCCCNONE 
J075145E15GCGCGCGACCGGCCCNONE 
J075145J09GCGCGCGACCGGCCCNONE 
J075155B11GCGCGCGACCGGCCCNONE 
J075173E22GCGCGCGACCGGCCCNONE 
J075180B11GCGCGCGACCGGCCCNONE 
J075195D12GCGCGCGACCGGCCCNONE 
Os06g0498500AK099764GCAGCCCACCCGACTGGGCCGGTNONE 
AK103794GCAGCCCACCCGACTGGGCCGGTNucleolar complex-associated family protein. 
AK121899GCAGCCCACCCGACTGGGCCGGTNONE 
Os06g0530200009-042-B02ACCGGCCCAGCNONE 
009-050-E10ACCGGCCCAGCNONE 
009-060-F07ACCGGCCCAGCNONE 
009-117-H08ACCGGCCCAGCNONE 
009-129-C10ACCGGCCCAGCNONE 
AK073116ACCGGCCCAGCConserved hypothetical protein. 
AK104077ACCGGCCCAGCNONE 
J065032N16ACCGGCCCAGCNONE 
J065153K07ACCGGCCCAGCNONE 
J065169N18ACCGGCCCAGCNONE 
J065190H18ACCGGCCCAGCNONE 
J075127E14ACCGGCCCAGCNONE 
J090008F20ACCGGCCCAGCNONE 
Os06g0592500AK119729CTGGGCTTGGTGGGCCGGTSimilar to Ethylene-responsive transcriptional coactivator. 
AK122052CTGGGCTTGGTGGGCCGGTNONE 
Os06g0647900AK073750ACCGGCCCAGATConserved hypothetical protein. 
J033029K17ACCGGCCCAGATNONE 
J033070L21ACCGGCCCAGATNONE 
Os06g0650100009-016-C02ACCGGCCCACCTNONE 
AK062354ACCGGCCCACCTSimilar to Polyubiquitin gene (Fragment). 
Os06g0725400J065086O07AATGGGCCGGGCCGGTSimilar to BLE1 protein. 
J065114J19AATGGGCCGGGCCGGTNONE 
Os07g0169600006-027-F04ACCGGCCCNONE 
006-043-C10ACCGGCCCNONE 
006-070-A04ACCGGCCCNONE 
006-081-F03ACCGGCCCNONE 
006-104-F02ACCGGCCCNONE 
012-006-D12ACCGGCCCNONE 
AK060318ACCGGCCCNONE 
AK121818ACCGGCCC2OG-Fe(II) oxygenase domain containing protein. 
J023065K01ACCGGCCCNONE 
J023086G17ACCGGCCCNONE 
J023093G16ACCGGCCCNONE 
J033024N04ACCGGCCCNONE 
J033099A15ACCGGCCCNONE 
J033107B14ACCGGCCCNONE 
J043026F14ACCGGCCCNONE 
J065043P20ACCGGCCCNONE 
J075118L16ACCGGCCCNONE 
J075162M22ACCGGCCCNONE 
J080004K13ACCGGCCCNONE 
J080024D10ACCGGCCCNONE 
J080037C21ACCGGCCCNONE 
J080039M17ACCGGCCCNONE 
J080040A03ACCGGCCCNONE 
J080044A07ACCGGCCCNONE 
J080045I07ACCGGCCCNONE 
J080052L06ACCGGCCCNONE 
J080053A20ACCGGCCCNONE 
J080060L15ACCGGCCCNONE 
J080060N22ACCGGCCCNONE 
J080062L23ACCGGCCCNONE 
J080069B19ACCGGCCCNONE 
J080086K15ACCGGCCCNONE 
J080089H16ACCGGCCCNONE 
J080089I23ACCGGCCCNONE 
J080094P07ACCGGCCCNONE 
J090032L18ACCGGCCCNONE 
J100044E09ACCGGCCCNONE 
J100045O03ACCGGCCCNONE 
J100066B11ACCGGCCCNONE 
J100069J24ACCGGCCCNONE 
Os07g0422100013-054-G11ACCGGCCCGGGNONE 
AK063592ACCGGCCCGGGNONE 
J065165K10ACCGGCCCGGGNONE 
J075021B01ACCGGCCCGGGNONE 
J075087H22ACCGGCCCGGGNONE 
J075118C10ACCGGCCCGGGNONE 
J075134N03ACCGGCCCGGGNONE 
J075151F23ACCGGCCCGGGNONE 
U57639ACCGGCCCGGGAWPM-19-like family protein. 
Os07g0462700009-033-D05ATTGGGCCGGTNONE 
AK073834ATTGGGCCGGTNONE 
AK104968ATTGGGCCGGTThioesterase superfamily domain containing protein. 
J065104G16ATTGGGCCGGTNONE 
J065197C14ATTGGGCCGGTNONE 
J065213E17ATTGGGCCGGTNONE 
J065215D11ATTGGGCCGGTNONE 
J075001J15ATTGGGCCGGTNONE 
J075026M11ATTGGGCCGGTNONE 
J075142G03ATTGGGCCGGTNONE 
J075178H04ATTGGGCCGGTNONE 
J100069P18ATTGGGCCGGTNONE 
Os07g0572500AK108612ACCGGCCCConserved hypothetical protein. 
AK108612ACCGGCCCAACCConserved hypothetical protein. 
Os07g0589400AK072501CACGTGGGCCGGTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK072501GGGCCGGTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617CACGTGGGCCGGTNONE 
AK104617GGGCCGGTNONE 
AK104756CACGTGGGCCGGTNONE 
AK104756GGGCCGGTNONE 
Os07g0606500AK068811ACCGGCCCNONE 
AK121873ACCGGCCCNONE 
J013159C05ACCGGCCCNONE 
J075158B14ACCGGCCCNONE 
Os07g0607200AK065746ACCGGCCCATTTProtein of unknown function DUF751 family protein. 
J065037B15ACCGGCCCATTTNONE 
J065042E20ACCGGCCCATTTNONE 
J065161I08ACCGGCCCATTTNONE 
Os07g0641700009-030-F09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
014-030-D10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AF009413AAATGGGCCGTGGAGGTGGGCCGGTSimilar to 10 kDa chaperonin (Protein CPN10) (Protein groES). 
AK059154AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK119728AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK122129AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023057A19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023143P09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J033132M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065039D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065062M22AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065071L10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065088N13AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065115D21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065187D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011B03AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075029J17AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075038J07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075065A18AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075083P05AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075101G24AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075127E19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075161K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075175D23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090044M07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065G16AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065J11AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090097M02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090099D02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100056A20AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100063M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
Os08g0118900AK109749TTATGGGCCGGTAdenylate kinase family protein. 
Os08g0427900AK103217ACCGGCCCACASimilar to Hin19 (Fragment). 
AK109208ACCGGCCCACANONE 
J080005C08ACCGGCCCACANONE 
J080010B10ACCGGCCCACANONE 
J080013C21ACCGGCCCACANONE 
J080022L12ACCGGCCCACANONE 
J080029C08ACCGGCCCACANONE 
J080029G09ACCGGCCCACANONE 
J080035L14ACCGGCCCACANONE 
J080040M20ACCGGCCCACANONE 
J080043M18ACCGGCCCACANONE 
J080045K15ACCGGCCCACANONE 
J080048I17ACCGGCCCACANONE 
J080051P16ACCGGCCCACANONE 
J080053L16ACCGGCCCACANONE 
J080059P14ACCGGCCCACANONE 
J080063E13ACCGGCCCACANONE 
J080075N18ACCGGCCCACANONE 
J080077E05ACCGGCCCACANONE 
J080080H23ACCGGCCCACANONE 
J080081L16ACCGGCCCACANONE 
J080083F17ACCGGCCCACANONE 
J080085C23ACCGGCCCACANONE 
J080086A12ACCGGCCCACANONE 
J080088N06ACCGGCCCACANONE 
J080092G10ACCGGCCCACANONE 
J080093F04ACCGGCCCACANONE 
J080094C03ACCGGCCCACANONE 
J090032L12ACCGGCCCACANONE 
Os08g0468400011-057-F06ACCGGCCCAATGGGCCATNONE 
AK063363ACCGGCCCAATGGGCCATHEC/Ndc80p family protein. 
J100048N11ACCGGCCCAATGGGCCATNONE 
Os08g0522500006-026-A04ACCGGCCCATCTNONE 
006-037-B02ACCGGCCCATCTNONE 
006-047-E11ACCGGCCCATCTNONE 
015-049-E10ACCGGCCCATCTNONE 
AK060080ACCGGCCCATCTNONE 
AK102814ACCGGCCCATCTNONE 
AK104718ACCGGCCCATCTNONE 
AK106190ACCGGCCCATCTGlycoside hydrolase, family 19 protein. 
J013068H02ACCGGCCCATCTNONE 
J033108M05ACCGGCCCATCTNONE 
J033116M13ACCGGCCCATCTNONE 
J065211H04ACCGGCCCATCTNONE 
J075195H03ACCGGCCCATCTNONE 
J075195I24ACCGGCCCATCTNONE 
Os08g0567200AK067161ACCGGCCCNONE 
J013094H15ACCGGCCCNONE 
J065209H08ACCGGCCCNONE 
Os09g0325100J080009O19ACCGGCCCNONE 
J080011H14ACCGGCCCConserved hypothetical protein. 
J080014F14ACCGGCCCNONE 
J080014M09ACCGGCCCNONE 
J080014N20ACCGGCCCNONE 
J080018K13ACCGGCCCNONE 
J080023C08ACCGGCCCNONE 
J080023C09ACCGGCCCNONE 
J080023K14ACCGGCCCNONE 
J080025I09ACCGGCCCNONE 
J080030J04ACCGGCCCNONE 
J080039D08ACCGGCCCNONE 
J080039L17ACCGGCCCNONE 
J080041B13ACCGGCCCNONE 
J080041P21ACCGGCCCNONE 
J080042J21ACCGGCCCNONE 
J080042L19ACCGGCCCNONE 
J080045F07ACCGGCCCNONE 
J080047B10ACCGGCCCNONE 
J080051F23ACCGGCCCNONE 
J080053D15ACCGGCCCNONE 
J080053K02ACCGGCCCNONE 
J080058K18ACCGGCCCNONE 
J080061M13ACCGGCCCNONE 
J080064M24ACCGGCCCNONE 
J080067H07ACCGGCCCNONE 
J080080B21ACCGGCCCNONE 
J080080D18ACCGGCCCNONE 
J080082G07ACCGGCCCNONE 
J080088B01ACCGGCCCNONE 
J080088E09ACCGGCCCNONE 
J080093L01ACCGGCCCNONE 
Os09g0458400AK070055ACCGGCCCAGAConserved hypothetical protein. 
AK120321ACCGGCCCAGANONE 
J065064N11ACCGGCCCAGANONE 
J065083J06ACCGGCCCAGANONE 
J065121D24ACCGGCCCAGANONE 
J065156I22ACCGGCCCAGANONE 
J065163J24ACCGGCCCAGANONE 
J075001I02ACCGGCCCAGANONE 
J090088O06ACCGGCCCAGANONE 
Os09g0477700AK121644ATATGGGCCGGTConserved hypothetical protein. 
Os09g0527700AK111128ACCGGCCCAACCSimilar to Auxin-induced protein IAA4. 
J065124H12ACCGGCCCAACCNONE 
J065181I07ACCGGCCCAACCNONE 
J065207G14ACCGGCCCAACCNONE 
Os09g0532700AK069946GCCCCACCGGCCCACGGAlpha/beta hydrolase family protein. 
Os11g0199600AK101774TCATGGGCCCATCACCGGCCCACAZinc finger, CCHC-type domain containing protein. 
AK120040TCATGGGCCCATCACCGGCCCACANONE 
J023047I06TCATGGGCCCATCACCGGCCCACANONE 
J033064L23TCATGGGCCCATCACCGGCCCACANONE 
J033117I01TCATGGGCCCATCACCGGCCCACANONE 
J033123I18TCATGGGCCCATCACCGGCCCACANONE 
J053026H17TCATGGGCCCATCACCGGCCCACANONE 
J053078G05TCATGGGCCCATCACCGGCCCACANONE 
J065102A09TCATGGGCCCATCACCGGCCCACANONE 
J065113G11TCATGGGCCCATCACCGGCCCACANONE 
J065207F20TCATGGGCCCATCACCGGCCCACANONE 
J075027K21TCATGGGCCCATCACCGGCCCACANONE 
Os11g0303200J023135L01GGGCCGGTNONE 
J075074O21GGGCCGGTNONE 
Os11g0549655J065008P04AGATGGGCTAATTGGGCCGGTGGCCCGGCNONE 
J065148G18AGATGGGCTAATTGGGCCGGTGGCCCGGCMaf-like protein family protein. 
Os12g0228900J033132F01CATGGGCCGGTNONE 
J043003P05CATGGGCCGGTNONE 
J065079N16CATGGGCCGGTNONE 
J065141L03CATGGGCCGGTNONE 
J075001I21CATGGGCCGGTNONE 
J075032L11CATGGGCCGGTNONE 
J075126O12CATGGGCCGGTNONE 
J100079E06CATGGGCCGGTNONE 
Os12g0274200009-166-H09ACCGGCCCAGCCNONE 
AK063071ACCGGCCCAGCCLipolytic enzyme, G-D-S-L family protein. 
Os12g0297500AK072331GGGCCGGTGlycoside hydrolase, starch-binding domain containing protein. 
Os12g0533500AK068646ACCGGCCCATCCACCCACTTGConserved hypothetical protein. 
J013158L10ACCGGCCCATCCACCCACTTGNONE 
J065083J02ACCGGCCCATCCACCCACTTGNONE 
J075079D02ACCGGCCCATCCACCCACTTGNONE 
J100037H16ACCGGCCCATCCACCCACTTGNONE 
J100075P13ACCGGCCCATCCACCCACTTGNONE 
Os12g0557800AK121691AAATGGGCCGGTGGGCCGTGProtein prenyltransferase domain containing protein. 
J013095M03AAATGGGCCGGTGGGCCGTGNONE 
J033071H11AAATGGGCCGGTGGGCCGTGNONE 
J065101B02AAATGGGCCGGTGGGCCGTGNONE 
Os12g0597500AK101904ACCGGCCCACCNONE 
AK103799ACCGGCCCACCAmidase, hydantoinase/carbamoylase family protein. 
J065206A02ACCGGCCCACCNONE 
J100078O15ACCGGCCCACCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.