version

Summary of OsREG441 (All List)

OrganismOryza sativa  
IDOsREG441  
SequenceACCGGGCC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1078  

Entry Sequences (1078 entries)

LocusGene modelSequenceDescription
Os01g0144600006-037-H02ACCGGGCCCACANONE 
006-037-H02ACCGGGCCGTGGTGATGGGCCCGNONE 
AK061501ACCGGGCCCACAConserved hypothetical protein. 
AK061501ACCGGGCCGTGGTGATGGGCCCGConserved hypothetical protein. 
AK102823ACCGGGCCCACANONE 
AK102823ACCGGGCCGTGGTGATGGGCCCGNONE 
J033108P10ACCGGGCCCACANONE 
J033108P10ACCGGGCCGTGGTGATGGGCCCGNONE 
J043026K08ACCGGGCCCACANONE 
J043026K08ACCGGGCCGTGGTGATGGGCCCGNONE 
J090009H21ACCGGGCCCACANONE 
J090009H21ACCGGGCCGTGGTGATGGGCCCGNONE 
Os01g0188400AK072842GGCCCGGTNONE 
AK121770GGCCCGGTNONE 
D16499GGCCCGGTNADP-dependent malic enzyme, chloroplast precursor (EC 1.1.1.40) (NADP-ME). 
J100053F23GGCCCGGTNONE 
J100060J17GGCCCGGTNONE 
Os01g0239700AK067723ACCGGGCCCACAASimilar to Leucine-rich receptor-like protein kinase. 
AK122130ACCGGGCCCACAANONE 
Os01g0283400AK119993ACCGGGCCCConserved hypothetical protein. 
Os01g0377700AK059266ACCGGGCCUbiquitin domain containing protein. 
AK107503ACCGGGCCNONE 
J065165L07ACCGGGCCNONE 
J075196J11ACCGGGCCNONE 
Os01g0514700AK069218GGCCCGGTProtein kinase domain containing protein. 
Os01g0588700AK066951CTCGGCCCGGTProtein of unknown function DUF572 family protein. 
AK071911CTCGGCCCGGTNONE 
J013059D18CTCGGCCCGGTNONE 
J013090C12CTCGGCCCGGTNONE 
J090043F17CTCGGCCCGGTNONE 
Os01g0642900009-109-F01ACCGGGCCGGANONE 
AK063836ACCGGGCCGGASingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560ACCGGGCCGGANONE 
J033043K18ACCGGGCCGGANONE 
J100023C05ACCGGGCCGGANONE 
J100038C15ACCGGGCCGGANONE 
J100039C23ACCGGGCCGGANONE 
Os01g0649000AK073564ACCGGGCCWD40-like domain containing protein. 
Os01g0667400016-057-F02ACCGGGCCNONE 
AK064236ACCGGGCCConserved hypothetical protein. 
Os01g0700200AK100961ACCGGGCCSimilar to Chromosome condensation regulator protein (Fragment). 
J023141C11ACCGGGCCNONE 
Os01g0756300014-074-B05ACCGGCCCGGTNONE 
AK069648ACCGGCCCGGTConserved hypothetical protein. 
Os01g0770500AK071653ACCGGGCCCCNONE 
AK099603ACCGGGCCCCSimilar to ABC transporter ATP-binding protein. 
Os01g0785400AK063368ACCGGGCCGH3 auxin-responsive promoter family protein. 
Os01g0818600AK066550TGTGGGCCCGGTLeucine rich repeat, N-terminal domain containing protein. 
Os01g0856900AK107570CGGACGGCCCGGTGlycoside hydrolase, starch-binding domain containing protein. 
J065081B03CGGACGGCCCGGTNONE 
J075028J03CGGACGGCCCGGTNONE 
J075052C05CGGACGGCCCGGTNONE 
J075199J04CGGACGGCCCGGTNONE 
J090052L20CGGACGGCCCGGTNONE 
J090075L24CGGACGGCCCGGTNONE 
Os01g0887700AF045571CGTGGACCGGGCCCATGNONE 
AF047428CGTGGACCGGGCCCATGNONE 
AK071139CGTGGACCGGGCCCATGZinc finger, FYVE/PHD-type domain containing protein. 
J023082D05CGTGGACCGGGCCCATGNONE 
J065062L19CGTGGACCGGGCCCATGNONE 
J065116H15CGTGGACCGGGCCCATGNONE 
J065194N09CGTGGACCGGGCCCATGNONE 
J100074C19CGTGGACCGGGCCCATGNONE 
Os01g0927500AK068802TCTGGCCCGGTProtein kinase domain containing protein. 
AK101312TCTGGCCCGGTNONE 
J013159J12TCTGGCCCGGTNONE 
J033033P12TCTGGCCCGGTNONE 
J043034L07TCTGGCCCGGTNONE 
Os01g0952600AK067525ACCGGGCCCACCCNONE 
AK070047ACCGGGCCCACCCSimilar to LacZ (Fragment). 
Os02g0123200016-017-F04AAACGGCCCGGTNONE 
J033057C03AAACGGCCCGGTNONE 
J033087C11AAACGGCCCGGTNONE 
J033108J20AAACGGCCCGGTNONE 
J043015P08AAACGGCCCGGTNONE 
Os02g0137800AK060530ACCGGGCCCCACCCCCCAConserved hypothetical protein. 
AK101629ACCGGGCCCCACCCCCCANONE 
J065195A10ACCGGGCCCCACCCCCCANONE 
Os02g0202600AK068376ACCGGGCCNONE 
AK099277ACCGGGCCNONE 
AK101844ACCGGGCCTetratricopeptide-like helical domain containing protein. 
J080001G13ACCGGGCCNONE 
J080011J23ACCGGGCCNONE 
J080015F12ACCGGGCCNONE 
J080017J03ACCGGGCCNONE 
J080030J24ACCGGGCCNONE 
J080038H02ACCGGGCCNONE 
J080041G13ACCGGGCCNONE 
J080044B13ACCGGGCCNONE 
J080044L10ACCGGGCCNONE 
J080046H11ACCGGGCCNONE 
J080057J01ACCGGGCCNONE 
J080062E13ACCGGGCCNONE 
J080062N11ACCGGGCCNONE 
J080063C17ACCGGGCCNONE 
J080064K11ACCGGGCCNONE 
J080064N09ACCGGGCCNONE 
J080067C17ACCGGGCCNONE 
J080067C23ACCGGGCCNONE 
J080069J21ACCGGGCCNONE 
J080070L23ACCGGGCCNONE 
J080085N15ACCGGGCCNONE 
J080094F03ACCGGGCCNONE 
Os02g0562300AK073250ACCGGGCCCCACGTCalmodulin binding protein-like family protein. 
Os02g0566300AK066077ACCGGGCCNONE 
Os02g0614400016-088-D04ACCGGGCCCAATNONE 
AK071805ACCGGGCCCAATConserved hypothetical protein. 
J023108N22ACCGGGCCCAATNONE 
Os02g0631000AK068667ACCGGGCCCCConserved hypothetical protein. 
J013159L03ACCGGGCCCCNONE 
J023119O20ACCGGGCCCCNONE 
J090098N20ACCGGGCCCCNONE 
Os02g0634700AK071869ACCGGGCCNONE 
J013129B13ACCGGGCCNONE 
J013134D24ACCGGGCCNONE 
Os02g0658500AK120166ACCGGGCCCGCATGTCAGTGNONE 
Os02g0790500015-026-D01ACCGGGCCNONE 
016-030-D09ACCGGGCCNONE 
AK100050ACCGGGCCGlycosyl transferase, family 20 domain containing protein. 
Os02g0792900AK068367ACCGGCCCGGTTMS membrane protein/tumour differentially expressed protein family protein. 
AK104731ACCGGCCCGGTNONE 
AK106174ACCGGCCCGGTNONE 
AK119191ACCGGCCCGGTNONE 
Os03g0101800006-069-F11ACCGGGCCGGCNONE 
006-089-G08ACCGGGCCGGCNONE 
006-120-D03ACCGGGCCGGCNONE 
AK061092ACCGGGCCGGCNONE 
AK061186ACCGGGCCGGCProtein of unknown function Cys-rich family protein. 
AK103196ACCGGGCCGGCNONE 
AK104399ACCGGGCCGGCNONE 
J033090H19ACCGGGCCGGCNONE 
J033121P22ACCGGGCCGGCNONE 
J065096C01ACCGGGCCGGCNONE 
J065097C05ACCGGGCCGGCNONE 
J065134I12ACCGGGCCGGCNONE 
J075061L02ACCGGGCCGGCNONE 
J075076K08ACCGGGCCGGCNONE 
J075091K01ACCGGGCCGGCNONE 
J080302F08ACCGGGCCGGCNONE 
J080304F11ACCGGGCCGGCNONE 
J080306I01ACCGGGCCGGCNONE 
J080307F02ACCGGGCCGGCNONE 
J080309G06ACCGGGCCGGCNONE 
J080313P12ACCGGGCCGGCNONE 
J080317C19ACCGGGCCGGCNONE 
J090036F13ACCGGGCCGGCNONE 
J090097P16ACCGGGCCGGCNONE 
J100025K18ACCGGGCCGGCNONE 
J100060J21ACCGGGCCGGCNONE 
Os03g0102200AK120183TCGGCCCGGCCCGGTSimilar to DNA-directed RNA polymerase II 14.5 kDa polypeptide (EC 2.7.7.6) (RPB9) (RPB14.5). 
J013034D10TCGGCCCGGCCCGGTNONE 
J065116C05TCGGCCCGGCCCGGTNONE 
J065120N21TCGGCCCGGCCCGGTNONE 
J090049D24TCGGCCCGGCCCGGTNONE 
Os03g0168200AK099530GGACGGCCCGGTConserved hypothetical protein. 
Os03g0191200AK070228TGGTGGGCCCGGTWW/Rsp5/WWP domain containing protein. 
Os03g0192400009-081-A03TACGGCCCGGTNONE 
009-159-B02TACGGCCCGGTNONE 
AK070573TACGGCCCGGTGRIM-19 family protein. 
J023056B01TACGGCCCGGTNONE 
J023075G06TACGGCCCGGTNONE 
J033048K16TACGGCCCGGTNONE 
J033048L16TACGGCCCGGTNONE 
J053031H23TACGGCCCGGTNONE 
J065002H14TACGGCCCGGTNONE 
J065006G22TACGGCCCGGTNONE 
J065032G13TACGGCCCGGTNONE 
J065056A09TACGGCCCGGTNONE 
J065078I01TACGGCCCGGTNONE 
J065095G01TACGGCCCGGTNONE 
J065095I18TACGGCCCGGTNONE 
J065134M18TACGGCCCGGTNONE 
J065158P07TACGGCCCGGTNONE 
J065165K17TACGGCCCGGTNONE 
J065181J12TACGGCCCGGTNONE 
J065189N09TACGGCCCGGTNONE 
J065200D13TACGGCCCGGTNONE 
J065202H20TACGGCCCGGTNONE 
J065215K20TACGGCCCGGTNONE 
J075049N19TACGGCCCGGTNONE 
J075147J16TACGGCCCGGTNONE 
J090081E19TACGGCCCGGTNONE 
J100017C16TACGGCCCGGTNONE 
J100039M16TACGGCCCGGTNONE 
J100043E23TACGGCCCGGTNONE 
J100063L12TACGGCCCGGTNONE 
J100079F22TACGGCCCGGTNONE 
Os03g0278000014-078-B07GGCCCGGTNONE 
AB079064GGCCCGGTNONE 
AK060031GGCCCGGTNONE 
AK100908GGCCCGGTUDP-glucuronic acid decarboxylase. 
J023007P12GGCCCGGTNONE 
J023045J24GGCCCGGTNONE 
J023054L14GGCCCGGTNONE 
J023085K21GGCCCGGTNONE 
J023121H11GGCCCGGTNONE 
J023125J04GGCCCGGTNONE 
J023126B13GGCCCGGTNONE 
J023132P15GGCCCGGTNONE 
J033117K15GGCCCGGTNONE 
J033140G17GGCCCGGTNONE 
J043034K23GGCCCGGTNONE 
J043037H03GGCCCGGTNONE 
J053064B01GGCCCGGTNONE 
J075146I22GGCCCGGTNONE 
J090001H15GGCCCGGTNONE 
J090043P06GGCCCGGTNONE 
J090067M04GGCCCGGTNONE 
J090095K23GGCCCGGTNONE 
J100017L23GGCCCGGTNONE 
J100031B08GGCCCGGTNONE 
J100070O13GGCCCGGTNONE 
J100088D21GGCCCGGTNONE 
Os03g0295700AK067856ACCGGGCCCCConserved hypothetical protein. 
Os03g0302700006-099-F12GGCCCGGTNONE 
AK112010GGCCCGGTZinc finger, RING-type domain containing protein. 
AK121656GGCCCGGTNONE 
J075090A19GGCCCGGTNONE 
J075148M06GGCCCGGTNONE 
Os03g0304800009-082-C07ACCGGGCCNONE 
AK062656ACCGGGCCLg106-like family protein. 
J065137I19ACCGGGCCNONE 
J075056G22ACCGGGCCNONE 
J075179O16ACCGGGCCNONE 
J075188O11ACCGGGCCNONE 
Os03g0356484009-038-H01ACCGGGCCCCACANONE 
AK105146ACCGGGCCCCACATetratricopeptide-like helical domain containing protein. 
J065204G11ACCGGGCCCCACANONE 
Os03g0397400AB112772ACCGGGCCNONE 
AK069928ACCGGGCCSimilar to Low affinity calcium transporter CAX2 (Fragment). 
J023014O18ACCGGGCCNONE 
J023036P06ACCGGGCCNONE 
J023145E24ACCGGGCCNONE 
J033142I11ACCGGGCCNONE 
J043003A10ACCGGGCCNONE 
J075023H21ACCGGGCCNONE 
J075145O10ACCGGGCCNONE 
J075149A03ACCGGGCCNONE 
J090099B09ACCGGGCCNONE 
J100017L14ACCGGGCCNONE 
J100050K18ACCGGGCCNONE 
J100063P16ACCGGGCCNONE 
Os03g0695600006-103-C09ACCGGGCCNONE 
014-029-B11ACCGGGCCNONE 
AB026566ACCGGGCCNONE 
AK061228ACCGGGCCProteasome subunit beta type 2 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit beta-4). 
AK099128ACCGGGCCNONE 
J023041C17ACCGGGCCNONE 
J043030L19ACCGGGCCNONE 
J065002E17ACCGGGCCNONE 
J065042H23ACCGGGCCNONE 
J065110P10ACCGGGCCNONE 
J065112D10ACCGGGCCNONE 
J065114B21ACCGGGCCNONE 
J065124B02ACCGGGCCNONE 
J065138P08ACCGGGCCNONE 
J065182O20ACCGGGCCNONE 
J065216N05ACCGGGCCNONE 
J075060D19ACCGGGCCNONE 
J075097M03ACCGGGCCNONE 
J075098I11ACCGGGCCNONE 
J075142I15ACCGGGCCNONE 
J090018B21ACCGGGCCNONE 
J090034E12ACCGGGCCNONE 
J090042N01ACCGGGCCNONE 
Os03g0711600X88799TCCGGCCCGGTSimilar to DNA binding protein (Fragment). 
Os03g0712200AK073205AACTGGGCCCGGTTGGGCCAGZinc finger, RanBP2-type domain containing protein. 
AK073205ACCGGGCCGGGZinc finger, RanBP2-type domain containing protein. 
AK098968AACTGGGCCCGGTTGGGCCAGNONE 
AK098968ACCGGGCCGGGNONE 
Os03g0736600AK060375GGGGCCCGGTCCAGAConserved hypothetical protein. 
Os03g0755000AK068540ACCGGGCCCATACSimilar to Serine/threonine kinase (Fragment). 
Os03g0767700AK073586TCGGCCCAATAAACGGGCCCGGTConserved hypothetical protein. 
J033050D05TCGGCCCAATAAACGGGCCCGGTNONE 
Os03g0797600006-034-B06GGCCCGGTNONE 
009-066-A01GGCCCGGTNONE 
014-035-H08GGCCCGGTNONE 
AK067446GGCCCGGTSimilar to Helix-loop-helix protein homolog. 
AK068388GGCCCGGTNONE 
AK104412GGCCCGGTNONE 
Os03g0821900AK070847AGTGGGCCTACCGGGCCAAAGCCCACASimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
AK070847GGCCCGGTSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0837900AK068346ACCGGGCCCACACStreptomyces cyclase/dehydrase family protein. 
Os03g0851000006-098-C01ACCGGGCCNONE 
AK060496ACCGGGCCSimilar to Transcription factor homolog BTF3-like protein. 
AK102202ACCGGGCCNONE 
AK104157ACCGGGCCNONE 
J033087F19ACCGGGCCNONE 
J065087I16ACCGGGCCNONE 
J065113G04ACCGGGCCNONE 
J090026M02ACCGGGCCNONE 
J090027I04ACCGGGCCNONE 
J100073E19ACCGGGCCNONE 
Os03g0855700AK070400GCTGGGCCCGGTNucleic acid-binding, OB-fold domain containing protein. 
Os04g0122000AK072577ACCGGGCCNONE 
Os04g0386500AK070265GGCCCGGTConserved hypothetical protein. 
Os04g0444900AK063657ACCGGGCCCCACACSimilar to Alfin-1. 
AK098960ACCGGGCCCCACACNONE 
J065037L14ACCGGGCCCCACACNONE 
J065037P22ACCGGGCCCCACACNONE 
J065173O15ACCGGGCCCCACACNONE 
Os04g0476000Os04g0476000ACCGGGCCCAATATetratricopeptide-like helical domain containing protein. 
Os04g0513100AK067841ACCGGGCCGSimilar to Beta-glucosidase. 
J075105F14ACCGGGCCGNONE 
Os04g0526800006-051-F03GCCGGCCCGGTNONE 
AK061581GCCGGCCCGGTGRAM domain containing protein. 
J065188M01GCCGGCCCGGTNONE 
J100043J05GCCGGCCCGGTNONE 
Os04g0528300AK058387ACCGGGCCNONE 
Os04g0541700AK109177ACCGGGCCGGGNONE 
AY554030ACCGGGCCGGGNONE 
J065055P13ACCGGGCCGGGNONE 
J065057N20ACCGGGCCGGGNONE 
J065136D07ACCGGGCCGGGNONE 
Os04g0542900AK068610TTCGGCCCGGTConserved hypothetical protein. 
Os04g0636900009-009-D04CGGCCCGGTNONE 
009-010-G07CGGCCCGGTNONE 
009-048-H10CGGCCCGGTNONE 
013-066-B10CGGCCCGGTNONE 
014-093-G08CGGCCCGGTNONE 
015-025-C07CGGCCCGGTNONE 
J013058C15CGGCCCGGTNONE 
J013058E15CGGCCCGGTNONE 
J013072N16CGGCCCGGTNONE 
J013102O16CGGCCCGGTNONE 
J090069E22CGGCCCGGTNONE 
J100030G19CGGCCCGGTNONE 
J100050F15CGGCCCGGTNONE 
J100050L20CGGCCCGGTNONE 
J100054F18CGGCCCGGTNONE 
J100083P05CGGCCCGGTNONE 
Os04g0660200AK120239GGCCCGGTCCACGABC-1 domain containing protein. 
Os04g0673400Os04g0673400ACCGGGCCGGGCSimilar to Uracil-DNA glycosylase (EC 3.2.2.-) (UDG). 
Os04g0690600011-007-D04GCCGGCCCGGTNONE 
AK109449GCCGGCCCGGTConserved hypothetical protein. 
J065019H13GCCGGCCCGGTNONE 
J065021N08GCCGGCCCGGTNONE 
J065085C08GCCGGCCCGGTNONE 
J065214O07GCCGGCCCGGTNONE 
Os05g0161200AB042936GGCCCGGTNONE 
AK121808GGCCCGGTDNA polymerase III clamp loader subunit, C-terminal domain containing protein. 
Os05g0225800AK070646GGCCCGGTSimilar to Szp protein. 
J023063L01GGCCCGGTNONE 
J023129H15GGCCCGGTNONE 
Os05g0325200J090038J19CCAGGCCCGGTCyclin-like domain containing protein. 
Os05g0346300009-033-C06CGTGGACCGGGCCNONE 
AF529175CGTGGACCGGGCCNONE 
AK061627CGTGGACCGGGCCSimilar to 40S ribosomal protein S7. 
AK103081CGTGGACCGGGCCNONE 
AK104191CGTGGACCGGGCCNONE 
J013049B09CGTGGACCGGGCCNONE 
J023142E24CGTGGACCGGGCCNONE 
J033052M14CGTGGACCGGGCCNONE 
J033089N04CGTGGACCGGGCCNONE 
J033118F01CGTGGACCGGGCCNONE 
J065054E07CGTGGACCGGGCCNONE 
J065066L18CGTGGACCGGGCCNONE 
J065078C21CGTGGACCGGGCCNONE 
J065127G23CGTGGACCGGGCCNONE 
J065128N24CGTGGACCGGGCCNONE 
J065144P17CGTGGACCGGGCCNONE 
J065147P14CGTGGACCGGGCCNONE 
J065170E16CGTGGACCGGGCCNONE 
J065175D17CGTGGACCGGGCCNONE 
J065176M05CGTGGACCGGGCCNONE 
J065218G20CGTGGACCGGGCCNONE 
J090074J12CGTGGACCGGGCCNONE 
J100019H16CGTGGACCGGGCCNONE 
J100031N24CGTGGACCGGGCCNONE 
J100072G08CGTGGACCGGGCCNONE 
J100086I23CGTGGACCGGGCCNONE 
Os05g0346400AK058872GGCCCGGTCCACGNONE 
AK102727GGCCCGGTCCACGProtein of unknown function DUF538 family protein. 
J033105N07GGCCCGGTCCACGNONE 
J100077I17GGCCCGGTCCACGNONE 
Os05g0350600AK066244ACCGGGCCCCACCCCACCACSimilar to Atranbp1b protein. 
J075100E12ACCGGGCCCCACCCCACCACNONE 
J090024D03ACCGGGCCCCACCCCACCACNONE 
J100027C02ACCGGGCCCCACCCCACCACNONE 
J100053P05ACCGGGCCCCACCCCACCACNONE 
J100055P22ACCGGGCCCCACCCCACCACNONE 
Os05g0361900006-033-D04CTCGGCCCGGTNONE 
AK060107CTCGGCCCGGTMitochondrial substrate carrier family protein. 
AK104602CTCGGCCCGGTNONE 
AK104747CTCGGCCCGGTNONE 
J033133L03CTCGGCCCGGTNONE 
J080001O06CTCGGCCCGGTNONE 
J080004F05CTCGGCCCGGTNONE 
J080005D12CTCGGCCCGGTNONE 
J080008G19CTCGGCCCGGTNONE 
J080015D10CTCGGCCCGGTNONE 
J080015H22CTCGGCCCGGTNONE 
J080016K15CTCGGCCCGGTNONE 
J080018D12CTCGGCCCGGTNONE 
J080020A01CTCGGCCCGGTNONE 
J080027A09CTCGGCCCGGTNONE 
J080032F05CTCGGCCCGGTNONE 
J080039D09CTCGGCCCGGTNONE 
J080043J19CTCGGCCCGGTNONE 
J080052G22CTCGGCCCGGTNONE 
J080052M15CTCGGCCCGGTNONE 
J080053D22CTCGGCCCGGTNONE 
J080061I18CTCGGCCCGGTNONE 
J080064O14CTCGGCCCGGTNONE 
J080075K01CTCGGCCCGGTNONE 
J080082I02CTCGGCCCGGTNONE 
J080095C14CTCGGCCCGGTNONE 
J100028N14CTCGGCCCGGTNONE 
Os05g0405400J090016P17CACGGCCCGGTNONE 
Os05g0430200J090095K16ACCGGGCCCACCTGTCNONE 
Os05g0476400AK106783ACCGGGCCConserved hypothetical protein. 
Os05g0548100AK060333CACGGCCCGGTConserved hypothetical protein. 
AK100682CACGGCCCGGTNONE 
J013151E01CACGGCCCGGTNONE 
J023113L22CACGGCCCGGTNONE 
J043027A19CACGGCCCGGTNONE 
J075093E06CACGGCCCGGTNONE 
J090060D15CACGGCCCGGTNONE 
J090082J03CACGGCCCGGTNONE 
J100050E01CACGGCCCGGTNONE 
Os05g0553700006-100-D08ACCGGGCCGGTNONE 
AK099747ACCGGGCCGGTNONE 
AK101606ACCGGGCCGGTNONE 
AK103396ACCGGGCCGGTSimilar to Syntaxin 71 (AtSYP71). 
J033022M23ACCGGGCCGGTNONE 
J090086G01ACCGGGCCGGTNONE 
Os06g0319700AK120884GGCCCGGCCCGGTSimilar to 60S ribosomal protein L31. 
J013089A14GGCCCGGCCCGGTNONE 
J023028N24GGCCCGGCCCGGTNONE 
J033098H21GGCCCGGCCCGGTNONE 
J033118G04GGCCCGGCCCGGTNONE 
J090056P15GGCCCGGCCCGGTNONE 
J090062B02GGCCCGGCCCGGTNONE 
J100024B09GGCCCGGCCCGGTNONE 
J100060I04GGCCCGGCCCGGTNONE 
J100078H11GGCCCGGCCCGGTNONE 
J100080A14GGCCCGGCCCGGTNONE 
J100086F18GGCCCGGCCCGGTNONE 
Os06g0338900016-067-B02ACCGGGCCGTGNONE 
AK100837ACCGGGCCGTGNucleotidyl transferase domain containing protein. 
J013058L01ACCGGGCCGTGNONE 
J013135N01ACCGGGCCGTGNONE 
J023123E15ACCGGGCCGTGNONE 
J033051J01ACCGGGCCGTGNONE 
J090002O21ACCGGGCCGTGNONE 
J090013F06ACCGGGCCGTGNONE 
J090056F16ACCGGGCCGTGNONE 
J090081G13ACCGGGCCGTGNONE 
J090090P21ACCGGGCCGTGNONE 
J100039F05ACCGGGCCGTGNONE 
J100059J03ACCGGGCCGTGNONE 
Os06g0590301J033139K16CACGGCCCGGTNONE 
J065011M13CACGGCCCGGTNONE 
J065027D20CACGGCCCGGTNONE 
J065039O05CACGGCCCGGTGlucose/ribitol dehydrogenase family protein. 
J065051O10CACGGCCCGGTNONE 
J065128I21CACGGCCCGGTNONE 
J065163P10CACGGCCCGGTNONE 
J065169H02CACGGCCCGGTNONE 
Os06g0656300006-034-G12CACGGCCCGGTNONE 
006-056-B10CACGGCCCGGTNONE 
006-089-A09CACGGCCCGGTNONE 
006-104-H10CACGGCCCGGTNONE 
006-108-G10CACGGCCCGGTNONE 
006-111-C10CACGGCCCGGTNONE 
006-113-G11CACGGCCCGGTNONE 
006-119-H10CACGGCCCGGTNONE 
009-033-E11CACGGCCCGGTNONE 
009-106-C06CACGGCCCGGTNONE 
009-160-F06CACGGCCCGGTNONE 
AK060123CACGGCCCGGTNONE 
AK060127CACGGCCCGGTProtein of unknown function DUF588 family protein. 
AK104184CACGGCCCGGTNONE 
J065042D07CACGGCCCGGTNONE 
J075029H23CACGGCCCGGTNONE 
J075151L06CACGGCCCGGTNONE 
J090027A16CACGGCCCGGTNONE 
Os06g0670100AK102577TACGGCCCGGTHypothetical protein. 
Os06g0711600016-047-G09TTCGGCCCGGTNONE 
AK064384TTCGGCCCGGTmRNA splicing factor SYF2 family protein. 
AK102831TTCGGCCCGGTNONE 
J013072P18TTCGGCCCGGTNONE 
J023049G01TTCGGCCCGGTNONE 
J023088I01TTCGGCCCGGTNONE 
J033023I22TTCGGCCCGGTNONE 
J033106I12TTCGGCCCGGTNONE 
J033109G07TTCGGCCCGGTNONE 
J065030F22TTCGGCCCGGTNONE 
J065132H19TTCGGCCCGGTNONE 
J080301D07TTCGGCCCGGTNONE 
J080305C09TTCGGCCCGGTNONE 
J080312C03TTCGGCCCGGTNONE 
J080313I15TTCGGCCCGGTNONE 
J080315B09TTCGGCCCGGTNONE 
J090056N21TTCGGCCCGGTNONE 
J100027B07TTCGGCCCGGTNONE 
Os06g0715000AK107114AACGGGCCCGGTConserved hypothetical protein. 
Os06g0725400J065086O07ACCGGGCCSimilar to BLE1 protein. 
J065114J19ACCGGGCCNONE 
Os07g0142000AK059877ACCGGGCCCACAReticulon family protein. 
AK099414ACCGGGCCCACANONE 
Os07g0173200AK061624ACCGGGCCCACGTFrigida-like family protein. 
AK065275ACCGGGCCCACGTNONE 
AK098856ACCGGGCCCACGTNONE 
AK098899ACCGGGCCCACGTNONE 
Os07g0438800AK060412ACCGGGCCCCACGNONE 
AK100065ACCGGGCCCCACGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195ACCGGGCCCCACGNONE 
AY224478ACCGGGCCCCACGNONE 
J013160O05ACCGGGCCCCACGNONE 
J023030C05ACCGGGCCCCACGNONE 
J033025O04ACCGGGCCCCACGNONE 
J033121P15ACCGGGCCCCACGNONE 
J043034I23ACCGGGCCCCACGNONE 
J065022N01ACCGGGCCCCACGNONE 
J065022N02ACCGGGCCCCACGNONE 
J065023M01ACCGGGCCCCACGNONE 
J065101G13ACCGGGCCCCACGNONE 
J075058P13ACCGGGCCCCACGNONE 
J075186K10ACCGGGCCCCACGNONE 
J075199F17ACCGGGCCCCACGNONE 
Os07g0561300AK072982ACCGGGCCCCACACGCyclin-like F-box domain containing protein. 
J023149I22ACCGGGCCCCACACGNONE 
J065149C18ACCGGGCCCCACACGNONE 
J065166N15ACCGGGCCCCACACGNONE 
J075011J01ACCGGGCCCCACACGNONE 
J075013I05ACCGGGCCCCACACGNONE 
J075039H11ACCGGGCCCCACACGNONE 
J075067J09ACCGGGCCCCACACGNONE 
J075084E08ACCGGGCCCCACACGNONE 
J075085E12ACCGGGCCCCACACGNONE 
J075090D11ACCGGGCCCCACACGNONE 
J075092D12ACCGGGCCCCACACGNONE 
J075126N17ACCGGGCCCCACACGNONE 
J075179F01ACCGGGCCCCACACGNONE 
J075184P21ACCGGGCCCCACACGNONE 
Os07g0605200AF091458CCCGTGGGCCCCACCGGGCCNONE 
AF139665CCCGTGGGCCCCACCGGGCCNONE 
AJ011675CCCGTGGGCCCCACCGGGCCNONE 
AK064704CCCGTGGGCCCCACCGGGCCMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
J075159J15CCCGTGGGCCCCACCGGGCCNONE 
J090034M06CCCGTGGGCCCCACCGGGCCNONE 
J090079L24CCCGTGGGCCCCACCGGGCCNONE 
Os07g0606600AK111621ACCGGGCCNONE 
AK112118ACCGGGCCSimilar to Nuclear factor Y transcription factor subunit B homolog. 
J080301F22ACCGGGCCNONE 
Os07g0661600006-050-D12ACCGGGCCNONE 
009-124-B10ACCGGGCCNONE 
AK061123ACCGGGCCNONE 
AK066432ACCGGGCCSimilar to RNA-binding protein-like protein. 
AK104664ACCGGGCCNONE 
J013064M13ACCGGGCCNONE 
J013122O12ACCGGGCCNONE 
J033044A16ACCGGGCCNONE 
J033144D14ACCGGGCCNONE 
J090078P13ACCGGGCCNONE 
Os08g0135900AK072535CCGATCCGGTGGGCCCGGTSimilar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment). 
Os08g0195400006-057-E04CACGGCCCGGTNONE 
006-060-B10CACGGCCCGGTNONE 
AK070464CACGGCCCGGTConserved hypothetical protein. 
AK104389CACGGCCCGGTNONE 
AK106140CACGGCCCGGTNONE 
J023013G08CACGGCCCGGTNONE 
J023054K19CACGGCCCGGTNONE 
J023089D18CACGGCCCGGTNONE 
J023092K05CACGGCCCGGTNONE 
J033025A08CACGGCCCGGTNONE 
J033067P12CACGGCCCGGTNONE 
J033098A10CACGGCCCGGTNONE 
J065219L04CACGGCCCGGTNONE 
J090021P06CACGGCCCGGTNONE 
J090062M05CACGGCCCGGTNONE 
J090079F15CACGGCCCGGTNONE 
J100041H19CACGGCCCGGTNONE 
Os08g0206600AK064336TCGGCCCGGTAICARFT/IMPCHase bienzyme family protein. 
AK102764TCGGCCCGGTNONE 
Os08g0224200AK101331CGGACGGCCCGGTSimilar to Ythdf2-prov protein. 
Os08g0363000015-090-A07TAATGGGCCTCCGGCCCGGTNONE 
AK103677TAATGGGCCTCCGGCCCGGTNONE 
AK106532TAATGGGCCTCCGGCCCGGTProtein of unknown function DUF295 family protein. 
J033136B21TAATGGGCCTCCGGCCCGGTNONE 
J033136E01TAATGGGCCTCCGGCCCGGTNONE 
J043029N11TAATGGGCCTCCGGCCCGGTNONE 
J065071G13TAATGGGCCTCCGGCCCGGTNONE 
J065105J22TAATGGGCCTCCGGCCCGGTNONE 
J075084B18TAATGGGCCTCCGGCCCGGTNONE 
Os08g0473900012-010-C04ACCGGGCCCCNONE 
012-025-A10ACCGGGCCCCNONE 
012-025-C03ACCGGGCCCCNONE 
012-030-H02ACCGGGCCCCNONE 
012-033-A03ACCGGGCCCCNONE 
012-044-F02ACCGGGCCCCNONE 
012-046-F01ACCGGGCCCCNONE 
012-050-C04ACCGGGCCCCNONE 
012-051-G08ACCGGGCCCCNONE 
012-051-H03ACCGGGCCCCNONE 
012-056-F12ACCGGGCCCCNONE 
012-062-E07ACCGGGCCCCNONE 
012-067-C12ACCGGGCCCCNONE 
012-073-B07ACCGGGCCCCNONE 
012-078-H09ACCGGGCCCCNONE 
012-083-G12ACCGGGCCCCNONE 
012-086-C12ACCGGGCCCCNONE 
012-089-H12ACCGGGCCCCNONE 
012-091-B09ACCGGGCCCCNONE 
012-092-G08ACCGGGCCCCNONE 
014-045-D08ACCGGGCCCCNONE 
015-004-H02ACCGGGCCCCNONE 
015-005-G05ACCGGGCCCCNONE 
015-007-D06ACCGGGCCCCNONE 
015-014-G04ACCGGGCCCCNONE 
015-019-G11ACCGGGCCCCNONE 
015-037-G04ACCGGGCCCCNONE 
015-044-D02ACCGGGCCCCNONE 
015-046-A05ACCGGGCCCCNONE 
015-049-D09ACCGGGCCCCNONE 
015-052-F12ACCGGGCCCCNONE 
015-054-E03ACCGGGCCCCNONE 
015-066-D02ACCGGGCCCCNONE 
015-070-H03ACCGGGCCCCNONE 
015-074-H10ACCGGGCCCCNONE 
015-077-C04ACCGGGCCCCNONE 
015-090-A10ACCGGGCCCCNONE 
015-091-F11ACCGGGCCCCNONE 
016-002-G04ACCGGGCCCCNONE 
016-004-E03ACCGGGCCCCNONE 
016-008-H10ACCGGGCCCCNONE 
016-015-G12ACCGGGCCCCNONE 
016-018-G01ACCGGGCCCCNONE 
016-023-C07ACCGGGCCCCNONE 
016-023-G06ACCGGGCCCCNONE 
016-027-G04ACCGGGCCCCNONE 
016-039-G04ACCGGGCCCCNONE 
016-044-A06ACCGGGCCCCNONE 
016-053-H06ACCGGGCCCCNONE 
016-063-H03ACCGGGCCCCNONE 
016-066-A01ACCGGGCCCCNONE 
016-066-E08ACCGGGCCCCNONE 
016-072-G03ACCGGGCCCCNONE 
016-088-C06ACCGGGCCCCNONE 
016-090-D01ACCGGGCCCCNONE 
AK073487ACCGGGCCCCAlpha-amylase isozyme 3D precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
AK119561ACCGGGCCCCNONE 
AK119761ACCGGGCCCCNONE 
J033024B15ACCGGGCCCCNONE 
J033040A17ACCGGGCCCCNONE 
J033041J03ACCGGGCCCCNONE 
J033093F11ACCGGGCCCCNONE 
J033117E15ACCGGGCCCCNONE 
J033128F11ACCGGGCCCCNONE 
J065006O09ACCGGGCCCCNONE 
J065010E21ACCGGGCCCCNONE 
J065011P15ACCGGGCCCCNONE 
J065013M15ACCGGGCCCCNONE 
J065019E20ACCGGGCCCCNONE 
J065021I21ACCGGGCCCCNONE 
J065022D23ACCGGGCCCCNONE 
J065024L10ACCGGGCCCCNONE 
J065026P16ACCGGGCCCCNONE 
J065027C20ACCGGGCCCCNONE 
J065027G06ACCGGGCCCCNONE 
J065027G23ACCGGGCCCCNONE 
J065028B11ACCGGGCCCCNONE 
J065030J05ACCGGGCCCCNONE 
J065031G17ACCGGGCCCCNONE 
J065034J07ACCGGGCCCCNONE 
J065037N01ACCGGGCCCCNONE 
J065040H20ACCGGGCCCCNONE 
J065041C22ACCGGGCCCCNONE 
J065044A21ACCGGGCCCCNONE 
J065044L06ACCGGGCCCCNONE 
J065045J02ACCGGGCCCCNONE 
J065048D10ACCGGGCCCCNONE 
J065049H23ACCGGGCCCCNONE 
J065049I21ACCGGGCCCCNONE 
J065052D03ACCGGGCCCCNONE 
J065055D22ACCGGGCCCCNONE 
J065057L13ACCGGGCCCCNONE 
J065058B13ACCGGGCCCCNONE 
J065059B04ACCGGGCCCCNONE 
J065059C05ACCGGGCCCCNONE 
J065059H01ACCGGGCCCCNONE 
J065059K01ACCGGGCCCCNONE 
J065063G19ACCGGGCCCCNONE 
J065073E20ACCGGGCCCCNONE 
J065075I10ACCGGGCCCCNONE 
J065081I24ACCGGGCCCCNONE 
J065084E05ACCGGGCCCCNONE 
J065084E12ACCGGGCCCCNONE 
J065084J12ACCGGGCCCCNONE 
J065086H18ACCGGGCCCCNONE 
J065087F07ACCGGGCCCCNONE 
J065095J02ACCGGGCCCCNONE 
J065097E24ACCGGGCCCCNONE 
J065102I06ACCGGGCCCCNONE 
J065104N21ACCGGGCCCCNONE 
J065105A16ACCGGGCCCCNONE 
J065107C13ACCGGGCCCCNONE 
J065108N11ACCGGGCCCCNONE 
J065112I04ACCGGGCCCCNONE 
J065112J05ACCGGGCCCCNONE 
J065112K17ACCGGGCCCCNONE 
J065115I05ACCGGGCCCCNONE 
J065120J21ACCGGGCCCCNONE 
J065120K18ACCGGGCCCCNONE 
J065121L19ACCGGGCCCCNONE 
J065123K20ACCGGGCCCCNONE 
J065123M10ACCGGGCCCCNONE 
J065124L18ACCGGGCCCCNONE 
J065127E19ACCGGGCCCCNONE 
J065128B05ACCGGGCCCCNONE 
J065130F11ACCGGGCCCCNONE 
J065130P06ACCGGGCCCCNONE 
J065132K13ACCGGGCCCCNONE 
J065134I17ACCGGGCCCCNONE 
J065139I11ACCGGGCCCCNONE 
J065141G14ACCGGGCCCCNONE 
J065141O04ACCGGGCCCCNONE 
J065146P07ACCGGGCCCCNONE 
J065148L24ACCGGGCCCCNONE 
J065154H20ACCGGGCCCCNONE 
J065155I05ACCGGGCCCCNONE 
J065165F05ACCGGGCCCCNONE 
J065166I20ACCGGGCCCCNONE 
J065168D14ACCGGGCCCCNONE 
J065168F12ACCGGGCCCCNONE 
J065169F17ACCGGGCCCCNONE 
J065169J11ACCGGGCCCCNONE 
J065169O14ACCGGGCCCCNONE 
J065171E05ACCGGGCCCCNONE 
J065171L21ACCGGGCCCCNONE 
J065175G24ACCGGGCCCCNONE 
J065178M19ACCGGGCCCCNONE 
J065179C17ACCGGGCCCCNONE 
J065179E04ACCGGGCCCCNONE 
J065180C03ACCGGGCCCCNONE 
J065182D08ACCGGGCCCCNONE 
J065183P17ACCGGGCCCCNONE 
J065188N09ACCGGGCCCCNONE 
J065190G15ACCGGGCCCCNONE 
J065190N03ACCGGGCCCCNONE 
J065191H11ACCGGGCCCCNONE 
J065193C13ACCGGGCCCCNONE 
J065193G19ACCGGGCCCCNONE 
J065199F19ACCGGGCCCCNONE 
J065202L20ACCGGGCCCCNONE 
J065204K12ACCGGGCCCCNONE 
J065206H08ACCGGGCCCCNONE 
J065208E02ACCGGGCCCCNONE 
J065210O09ACCGGGCCCCNONE 
J065211L19ACCGGGCCCCNONE 
J065211N19ACCGGGCCCCNONE 
J065212I06ACCGGGCCCCNONE 
J065213P21ACCGGGCCCCNONE 
J065215C14ACCGGGCCCCNONE 
J100032J03ACCGGGCCCCNONE 
M24287ACCGGGCCCCNONE 
Os08g0544800009-168-G01GGGGCCCGGTNONE 
011-046-D09GGGGCCCGGTNONE 
012-003-C08GGGGCCCGGTNONE 
012-042-B06GGGGCCCGGTNONE 
013-035-H12GGGGCCCGGTNONE 
013-072-A10GGGGCCCGGTNONE 
014-010-B11GGGGCCCGGTNONE 
014-097-E06GGGGCCCGGTNONE 
015-003-E12GGGGCCCGGTNONE 
015-040-B04GGGGCCCGGTNONE 
AK060536GGGGCCCGGTNONE 
AK102666GGGGCCCGGTNONE 
AK119660GGGGCCCGGTPCF2. 
D87261GGGGCCCGGTNONE 
J090049N23GGGGCCCGGTNONE 
J090084G06GGGGCCCGGTNONE 
Os09g0241200AK120155TCGGCCCGGTConserved hypothetical protein. 
J013030A17TCGGCCCGGTNONE 
Os09g0533600AK070024ACCGGGCCGASimilar to Avr9/Cf-9 induced kinase 1. 
Os09g0539100AK071977ACCGGGCCCATTTSimilar to 3-dehydroquinate synthase-like protein. 
AK098959ACCGGGCCCATTTNONE 
Os11g0156600Os11g0156600ACCGGGCCCCACCTB2/DP1 and HVA22 related protein family protein. 
Os11g0210300009-169-E10GGCCCGGTNONE 
012-007-H08GGCCCGGTNONE 
012-065-A02GGCCCGGTNONE 
012-095-H06GGCCCGGTNONE 
015-007-F02GGCCCGGTNONE 
015-017-F10GGCCCGGTNONE 
015-078-F12GGCCCGGTNONE 
016-085-G04GGCCCGGTNONE 
AK061267GGCCCGGTNONE 
AK069330GGCCCGGTAlcohol dehydrogenase 1. 
D10412GGCCCGGTNONE 
J023026C01GGCCCGGTNONE 
J023037O21GGCCCGGTNONE 
J023044J09GGCCCGGTNONE 
J023066N19GGCCCGGTNONE 
J023100L06GGCCCGGTNONE 
J023121G14GGCCCGGTNONE 
J023132I24GGCCCGGTNONE 
J023134J18GGCCCGGTNONE 
J033024J23GGCCCGGTNONE 
J033029B21GGCCCGGTNONE 
J033030H09GGCCCGGTNONE 
J033040N09GGCCCGGTNONE 
J033050I11GGCCCGGTNONE 
J033052F03GGCCCGGTNONE 
J033067J22GGCCCGGTNONE 
J033068K15GGCCCGGTNONE 
J033070A13GGCCCGGTNONE 
J033072A02GGCCCGGTNONE 
J033072F17GGCCCGGTNONE 
J033081C02GGCCCGGTNONE 
J033082F08GGCCCGGTNONE 
J033086L02GGCCCGGTNONE 
J033087O09GGCCCGGTNONE 
J033088P05GGCCCGGTNONE 
J033094D13GGCCCGGTNONE 
J033098I11GGCCCGGTNONE 
J033102I15GGCCCGGTNONE 
J033102P13GGCCCGGTNONE 
J033103N07GGCCCGGTNONE 
J033109A11GGCCCGGTNONE 
J033109O05GGCCCGGTNONE 
J033111K07GGCCCGGTNONE 
J033113I09GGCCCGGTNONE 
J033113I10GGCCCGGTNONE 
J033115B12GGCCCGGTNONE 
J033121D20GGCCCGGTNONE 
J033125H21GGCCCGGTNONE 
J033128M09GGCCCGGTNONE 
J033135L03GGCCCGGTNONE 
J033136O13GGCCCGGTNONE 
J043003H06GGCCCGGTNONE 
J043010B17GGCCCGGTNONE 
J043015O11GGCCCGGTNONE 
J043026D03GGCCCGGTNONE 
J043030G18GGCCCGGTNONE 
J043035L17GGCCCGGTNONE 
J043037K04GGCCCGGTNONE 
J043040G24GGCCCGGTNONE 
J053024N13GGCCCGGTNONE 
J065035H08GGCCCGGTNONE 
J065116G23GGCCCGGTNONE 
J065138J15GGCCCGGTNONE 
J065161L12GGCCCGGTNONE 
J075011O04GGCCCGGTNONE 
J075109M05GGCCCGGTNONE 
J075133K12GGCCCGGTNONE 
J075167H23GGCCCGGTNONE 
J075198I09GGCCCGGTNONE 
J100023O11GGCCCGGTNONE 
J100042B17GGCCCGGTNONE 
J100052M16GGCCCGGTNONE 
J100059M23GGCCCGGTNONE 
J100076G19GGCCCGGTNONE 
X16296GGCCCGGTNONE 
Os11g0219400AK069850CACGGCCCGGTAnkyrin repeat containing protein. 
AK099123CACGGCCCGGTNONE 
J023143G18CACGGCCCGGTNONE 
Os11g0502700009-044-E07ACCGGGCCNONE 
AK065205ACCGGGCCConserved hypothetical protein. 
J013002F11ACCGGGCCNONE 
J100089O15ACCGGGCCNONE 
Os11g0604600006-022-C01ACCGGGCCCCACGCGTNONE 
AK061397ACCGGGCCCCACGCGTNONE 
AK102376ACCGGGCCCCACGCGTRINGv domain containing protein. 
J033091P05ACCGGGCCCCACGCGTNONE 
J065062C12ACCGGGCCCCACGCGTNONE 
J065062H09ACCGGGCCCCACGCGTNONE 
J065064A02ACCGGGCCCCACGCGTNONE 
J065101I16ACCGGGCCCCACGCGTNONE 
J065123F23ACCGGGCCCCACGCGTNONE 
J065155N12ACCGGGCCCCACGCGTNONE 
J065164F22ACCGGGCCCCACGCGTNONE 
J065181G08ACCGGGCCCCACGCGTNONE 
J075055H05ACCGGGCCCCACGCGTNONE 
J075058A22ACCGGGCCCCACGCGTNONE 
J075082H23ACCGGGCCCCACGCGTNONE 
J075111A14ACCGGGCCCCACGCGTNONE 
J075176I06ACCGGGCCCCACGCGTNONE 
Os11g0606300J075039E08ATTGGGCCGGCCCGGTNONE 
J075044E18ATTGGGCCGGCCCGGTNONE 
J075053G16ATTGGGCCGGCCCGGTConserved hypothetical protein. 
Os12g0150100009-047-B11ACCGGGCCGAAANONE 
AK105075ACCGGGCCGAAASimilar to 60S ribosomal protein L26A. 
J013067G22ACCGGGCCGAAANONE 
J033103F08ACCGGGCCGAAANONE 
J065029P11ACCGGGCCGAAANONE 
J065043B18ACCGGGCCGAAANONE 
J065123E16ACCGGGCCGAAANONE 
J065141O20ACCGGGCCGAAANONE 
J065161O04ACCGGGCCGAAANONE 
J065201M07ACCGGGCCGAAANONE 
J075058I23ACCGGGCCGAAANONE 
J075172J08ACCGGGCCGAAANONE 
J100040L13ACCGGGCCGAAANONE 
Os12g0188700005-011-B12ACCGGGCCNONE 
006-024-G04ACCGGGCCNONE 
006-065-G03ACCGGGCCNONE 
006-085-A08ACCGGGCCNONE 
006-103-A05ACCGGGCCNONE 
006-103-H09ACCGGGCCNONE 
009-070-G10ACCGGGCCNONE 
009-156-H08ACCGGGCCNONE 
009-158-A03ACCGGGCCNONE 
009-163-B11ACCGGGCCNONE 
AJ005841ACCGGGCCNONE 
AK061678ACCGGGCCSimilar to Thioredoxin (TRX). 
AK120500ACCGGGCCNONE 
J013040H19ACCGGGCCNONE 
J013041B20ACCGGGCCNONE 
J013122B18ACCGGGCCNONE 
J013128C16ACCGGGCCNONE 
J023126A11ACCGGGCCNONE 
J023149O08ACCGGGCCNONE 
J033113L02ACCGGGCCNONE 
J065026F18ACCGGGCCNONE 
J065027A10ACCGGGCCNONE 
J065029H04ACCGGGCCNONE 
J065036L19ACCGGGCCNONE 
J065053G22ACCGGGCCNONE 
J065060P10ACCGGGCCNONE 
J065063G08ACCGGGCCNONE 
J065070F04ACCGGGCCNONE 
J065071J12ACCGGGCCNONE 
J065082A20ACCGGGCCNONE 
J065088K18ACCGGGCCNONE 
J065090J21ACCGGGCCNONE 
J065110I15ACCGGGCCNONE 
J065142N11ACCGGGCCNONE 
J065152O15ACCGGGCCNONE 
J065175N18ACCGGGCCNONE 
J065181H15ACCGGGCCNONE 
J065217M05ACCGGGCCNONE 
J075005B13ACCGGGCCNONE 
J075010A01ACCGGGCCNONE 
J075025N08ACCGGGCCNONE 
J075025O15ACCGGGCCNONE 
J075026N03ACCGGGCCNONE 
J075029K03ACCGGGCCNONE 
J075046J23ACCGGGCCNONE 
J075048H19ACCGGGCCNONE 
J075055G13ACCGGGCCNONE 
J075057N05ACCGGGCCNONE 
J075074K15ACCGGGCCNONE 
J075078O08ACCGGGCCNONE 
J075083L08ACCGGGCCNONE 
J075085A13ACCGGGCCNONE 
J075090M08ACCGGGCCNONE 
J075099F01ACCGGGCCNONE 
J075102M01ACCGGGCCNONE 
J075122C01ACCGGGCCNONE 
J075127M13ACCGGGCCNONE 
J075130F22ACCGGGCCNONE 
J075148P15ACCGGGCCNONE 
J075154P15ACCGGGCCNONE 
J075164F18ACCGGGCCNONE 
J075169C02ACCGGGCCNONE 
J075182G19ACCGGGCCNONE 
J075185N19ACCGGGCCNONE 
J075191F06ACCGGGCCNONE 
J075195E16ACCGGGCCNONE 
J080001I12ACCGGGCCNONE 
J080001N15ACCGGGCCNONE 
J080003E01ACCGGGCCNONE 
J080003F14ACCGGGCCNONE 
J080005L24ACCGGGCCNONE 
J080008B17ACCGGGCCNONE 
J080008L13ACCGGGCCNONE 
J080011M03ACCGGGCCNONE 
J080012E12ACCGGGCCNONE 
J080014N04ACCGGGCCNONE 
J080014N16ACCGGGCCNONE 
J080015K01ACCGGGCCNONE 
J080015K02ACCGGGCCNONE 
J080022N08ACCGGGCCNONE 
J080028B14ACCGGGCCNONE 
J080028P05ACCGGGCCNONE 
J080030O11ACCGGGCCNONE 
J080031B13ACCGGGCCNONE 
J080032B10ACCGGGCCNONE 
J080032L01ACCGGGCCNONE 
J080034F05ACCGGGCCNONE 
J080034H02ACCGGGCCNONE 
J080034L14ACCGGGCCNONE 
J080036D23ACCGGGCCNONE 
J080036E01ACCGGGCCNONE 
J080039D04ACCGGGCCNONE 
J080039E23ACCGGGCCNONE 
J080041B09ACCGGGCCNONE 
J080043J21ACCGGGCCNONE 
J080043N22ACCGGGCCNONE 
J080044M16ACCGGGCCNONE 
J080045L05ACCGGGCCNONE 
J080046F10ACCGGGCCNONE 
J080046N09ACCGGGCCNONE 
J080047B16ACCGGGCCNONE 
J080050P20ACCGGGCCNONE 
J080052G21ACCGGGCCNONE 
J080054C21ACCGGGCCNONE 
J080054E05ACCGGGCCNONE 
J080054P09ACCGGGCCNONE 
J080061F01ACCGGGCCNONE 
J080061O22ACCGGGCCNONE 
J080063B22ACCGGGCCNONE 
J080063F13ACCGGGCCNONE 
J080063P19ACCGGGCCNONE 
J080064D03ACCGGGCCNONE 
J080066K22ACCGGGCCNONE 
J080068J07ACCGGGCCNONE 
J080068N24ACCGGGCCNONE 
J080069G17ACCGGGCCNONE 
J080072D03ACCGGGCCNONE 
J080072H18ACCGGGCCNONE 
J080076N01ACCGGGCCNONE 
J080078N04ACCGGGCCNONE 
J080080D16ACCGGGCCNONE 
J080080P08ACCGGGCCNONE 
J080083K02ACCGGGCCNONE 
J080086E05ACCGGGCCNONE 
J080086P10ACCGGGCCNONE 
J080091G21ACCGGGCCNONE 
J080091K23ACCGGGCCNONE 
J080095G02ACCGGGCCNONE 
J080096L19ACCGGGCCNONE 
J080097G11ACCGGGCCNONE 
J080097H16ACCGGGCCNONE 
J080303H17ACCGGGCCNONE 
J080303M11ACCGGGCCNONE 
J080304C19ACCGGGCCNONE 
J080304E11ACCGGGCCNONE 
J080306N11ACCGGGCCNONE 
J080307N23ACCGGGCCNONE 
J080308G14ACCGGGCCNONE 
J080309F13ACCGGGCCNONE 
J080313I18ACCGGGCCNONE 
J080315E23ACCGGGCCNONE 
J080316D18ACCGGGCCNONE 
J080319M07ACCGGGCCNONE 
J080319O18ACCGGGCCNONE 
J090006J15ACCGGGCCNONE 
J090024O07ACCGGGCCNONE 
J090095K21ACCGGGCCNONE 
J100031C19ACCGGGCCNONE 
J100040B18ACCGGGCCNONE 
J100042M17ACCGGGCCNONE 
J100060L05ACCGGGCCNONE 
J100060O12ACCGGGCCNONE 
J100063O11ACCGGGCCNONE 
J100070B22ACCGGGCCNONE 
J100077D15ACCGGGCCNONE 
J100090B05ACCGGGCCNONE 
Os12g0256300AK073908TTCGGCCCGGTSimilar to Schizosaccharomyces pombe (Fragment). 
AK099579TTCGGCCCGGTNONE 
Os12g0477600009-115-E02ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-125-D04ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-152-E11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
013-003-H06ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
AK099534ACCGGGCCCACTGGGCCGGAGGCCCAAAAConserved hypothetical protein. 
J065109J18ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J065115L23ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075002K19ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075034D13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075038B07ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075051A21ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075052J11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075072A08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075080E10ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075101E13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075112F22ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075139O17ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075141K08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075146N01ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075171J24ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
Os12g0613500009-028-C05CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
011-081-E10CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AB118018CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK058205CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK101273CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACALissencephaly type-1-like homology motif domain containing protein. 
J033033A11CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.