version

Summary of OsREG442 (All List)

OrganismOryza sativa  
IDOsREG442  
SequenceACGCGTCC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1056  

Entry Sequences (1056 entries)

LocusGene modelSequenceDescription
Os01g0158200AK071183ACGCGTCCSimilar to Serine carboxypeptidase II-1 precursor (EC 3.4.16.6) (CP-MII.1) (Fragment). 
Os01g0179700006-084-G02ACGCGTCCNONE 
AK059888ACGCGTCCNONE 
AK069903ACGCGTCCSimilar to GTP-binding protein YPTM2. 
J023036J02ACGCGTCCNONE 
J023147D03ACGCGTCCNONE 
J023149D02ACGCGTCCNONE 
J065124C04ACGCGTCCNONE 
J075085J11ACGCGTCCNONE 
J075108D02ACGCGTCCNONE 
J075108H04ACGCGTCCNONE 
J075187F19ACGCGTCCNONE 
J075194L02ACGCGTCCNONE 
J075195G09ACGCGTCCNONE 
J090013E16ACGCGTCCNONE 
J100043A09ACGCGTCCNONE 
J100051E07ACGCGTCCNONE 
J100084A11ACGCGTCCNONE 
Os01g0363600014-029-H08GGACGCGTGGNONE 
AK063667GGACGCGTGGConserved hypothetical protein. 
Os01g0384800009-073-F04ACGCGTCCNONE 
009-149-E07ACGCGTCCNONE 
AK119688ACGCGTCCConserved hypothetical protein. 
AK120910ACGCGTCCNONE 
J013033N16ACGCGTCCNONE 
J023034B07ACGCGTCCNONE 
J023034J16ACGCGTCCNONE 
J065105O09ACGCGTCCNONE 
J065194F07ACGCGTCCNONE 
J075070L22ACGCGTCCNONE 
J075128L01ACGCGTCCNONE 
J075164C09ACGCGTCCNONE 
J100028M15ACGCGTCCNONE 
J100042M14ACGCGTCCNONE 
J100063D20ACGCGTCCNONE 
J100066A19ACGCGTCCNONE 
J100079K09ACGCGTCCNONE 
J100079K17ACGCGTCCNONE 
Os01g0550300006-081-F12GGACGCGTNONE 
006-114-A02GGACGCGTNONE 
006-117-A04GGACGCGTNONE 
011-003-H03GGACGCGTNONE 
011-025-B09GGACGCGTNONE 
011-069-B06GGACGCGTNONE 
011-074-D07GGACGCGTNONE 
012-029-E03GGACGCGTNONE 
012-050-F04GGACGCGTNONE 
012-072-D11GGACGCGTNONE 
013-093-E04GGACGCGTNONE 
015-070-C10GGACGCGTNONE 
015-089-A01GGACGCGTNONE 
015-095-H06GGACGCGTNONE 
016-014-H08GGACGCGTNONE 
016-056-E07GGACGCGTNONE 
016-089-A01GGACGCGTNONE 
AK061870GGACGCGTSimilar to Gda-1 protein. 
AK067529GGACGCGTNONE 
AK106151GGACGCGTNONE 
J013039D11GGACGCGTNONE 
J013050K19GGACGCGTNONE 
J013069F08GGACGCGTNONE 
J013108E24GGACGCGTNONE 
J013132D19GGACGCGTNONE 
J023039B18GGACGCGTNONE 
J023088C10GGACGCGTNONE 
J023121M13GGACGCGTNONE 
J033034I21GGACGCGTNONE 
J033118N14GGACGCGTNONE 
J033150M22GGACGCGTNONE 
J043004F18GGACGCGTNONE 
J043005J04GGACGCGTNONE 
J043020E12GGACGCGTNONE 
J065063C02GGACGCGTNONE 
J065102D15GGACGCGTNONE 
J065200P03GGACGCGTNONE 
J065208C22GGACGCGTNONE 
J065215B03GGACGCGTNONE 
J075013N21GGACGCGTNONE 
J075024P21GGACGCGTNONE 
J075027L19GGACGCGTNONE 
J075037F12GGACGCGTNONE 
J075084P15GGACGCGTNONE 
J075086M06GGACGCGTNONE 
J075116A02GGACGCGTNONE 
J075136P18GGACGCGTNONE 
J075181A01GGACGCGTNONE 
J075198O11GGACGCGTNONE 
J080002B20GGACGCGTNONE 
J080003E05GGACGCGTNONE 
J080005A18GGACGCGTNONE 
J080005E02GGACGCGTNONE 
J080005O18GGACGCGTNONE 
J080007B04GGACGCGTNONE 
J080007L18GGACGCGTNONE 
J080008C17GGACGCGTNONE 
J080011I03GGACGCGTNONE 
J080014B07GGACGCGTNONE 
J080014B09GGACGCGTNONE 
J080015A11GGACGCGTNONE 
J080016B07GGACGCGTNONE 
J080017H23GGACGCGTNONE 
J080020G09GGACGCGTNONE 
J080020I23GGACGCGTNONE 
J080021E15GGACGCGTNONE 
J080023O13GGACGCGTNONE 
J080024H17GGACGCGTNONE 
J080029P12GGACGCGTNONE 
J080030A15GGACGCGTNONE 
J080032I03GGACGCGTNONE 
J080032P18GGACGCGTNONE 
J080034E10GGACGCGTNONE 
J080038I23GGACGCGTNONE 
J080040B22GGACGCGTNONE 
J080040M13GGACGCGTNONE 
J080041E07GGACGCGTNONE 
J080042C08GGACGCGTNONE 
J080042H08GGACGCGTNONE 
J080043H10GGACGCGTNONE 
J080046J02GGACGCGTNONE 
J080050D12GGACGCGTNONE 
J080052C17GGACGCGTNONE 
J080054A05GGACGCGTNONE 
J080054J23GGACGCGTNONE 
J080056A15GGACGCGTNONE 
J080056F18GGACGCGTNONE 
J080059P07GGACGCGTNONE 
J080063J18GGACGCGTNONE 
J080066F15GGACGCGTNONE 
J080067G12GGACGCGTNONE 
J080070G15GGACGCGTNONE 
J080071B08GGACGCGTNONE 
J080071M08GGACGCGTNONE 
J080071N03GGACGCGTNONE 
J080074C01GGACGCGTNONE 
J080076F22GGACGCGTNONE 
J080076N23GGACGCGTNONE 
J080077F23GGACGCGTNONE 
J080077P10GGACGCGTNONE 
J080078A19GGACGCGTNONE 
J080078H07GGACGCGTNONE 
J080079G16GGACGCGTNONE 
J080079N23GGACGCGTNONE 
J080084L04GGACGCGTNONE 
J080084N12GGACGCGTNONE 
J080084N17GGACGCGTNONE 
J080086H08GGACGCGTNONE 
J080088M01GGACGCGTNONE 
J080090M14GGACGCGTNONE 
J080092F06GGACGCGTNONE 
J080095B14GGACGCGTNONE 
J080095C09GGACGCGTNONE 
J080095F20GGACGCGTNONE 
J080095H12GGACGCGTNONE 
J080096H22GGACGCGTNONE 
J090010O21GGACGCGTNONE 
J090012K22GGACGCGTNONE 
J090051I21GGACGCGTNONE 
J090065G14GGACGCGTNONE 
J090077H03GGACGCGTNONE 
J100035M10GGACGCGTNONE 
J100049C19GGACGCGTNONE 
J100051K11GGACGCGTNONE 
J100064C12GGACGCGTNONE 
J100064F13GGACGCGTNONE 
J100084H08GGACGCGTNONE 
Os01g0597600J075191I06GGACGCGTAmino acid/polyamine transporter II family protein. 
Os01g0598600AK104992GGACGCGTNONE 
Os01g0614500AK120636ACGCGTCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os01g0624700AK111416ACGCGTCCSimilar to WRKY transcription factor 12. 
AY676924ACGCGTCCNONE 
AY870601ACGCGTCCNONE 
Os01g0644200014-007-H12CCACGCGTCCNONE 
AK063634CCACGCGTCCConserved hypothetical protein. 
AY549310CCACGCGTCCNONE 
J075068F10CCACGCGTCCNONE 
J075082A11CCACGCGTCCNONE 
Os01g0673600AK122067ACGCGTCCSimilar to Ubiquitin-conjugating enzyme E2. 
J013036H06ACGCGTCCNONE 
J013110B18ACGCGTCCNONE 
J013162K06ACGCGTCCNONE 
J023121H14ACGCGTCCNONE 
J033061M10ACGCGTCCNONE 
J033117D10ACGCGTCCNONE 
J033145L07ACGCGTCCNONE 
J043027L23ACGCGTCCNONE 
J053032D15ACGCGTCCNONE 
J053046J22ACGCGTCCNONE 
J065026F01ACGCGTCCNONE 
J065160C17ACGCGTCCNONE 
J065207H23ACGCGTCCNONE 
J075019E11ACGCGTCCNONE 
J075073M16ACGCGTCCNONE 
J075101K09ACGCGTCCNONE 
J075114I09ACGCGTCCNONE 
J075165J18ACGCGTCCNONE 
J075195P10ACGCGTCCNONE 
J100049H06ACGCGTCCNONE 
J100052A10ACGCGTCCNONE 
J100066D15ACGCGTCCNONE 
Os01g0691100013-047-D03GGACGCGTNONE 
AK064045GGACGCGTSimilar to Lipid transfer protein (Fragment). 
AK122117GGACGCGTNONE 
J033128B08GGACGCGTNONE 
Os01g0691300J075112P14GGACGCGTPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
Os01g0720700J033124M22GCCCACGCGTCCNONE 
J065006G21GCCCACGCGTCCNONE 
J065025M24GCCCACGCGTCCNONE 
J065041J02GCCCACGCGTCCNONE 
J065044B14GCCCACGCGTCCNONE 
J065061J06GCCCACGCGTCCNONE 
J065116L21GCCCACGCGTCCNONE 
J075030F18GCCCACGCGTCCNONE 
J075034K17GCCCACGCGTCCNONE 
J075063I02GCCCACGCGTCCNONE 
J075110D21GCCCACGCGTCCSimilar to Serine acetyltransferase. 
J075188L15GCCCACGCGTCCNONE 
J075197B17GCCCACGCGTCCNONE 
Os01g0749400AK064990ACGCGTCCNONE 
AK067731ACGCGTCCHAD-superfamily hydrolase subfamily IIB protein. 
AK103775ACGCGTCCNONE 
J023001B06ACGCGTCCNONE 
Os01g0796001J080009E05GGACGCGTNONE 
J080020O16GGACGCGTNONE 
J080021P05GGACGCGTConserved hypothetical protein. 
J080022D16GGACGCGTNONE 
J080026A11GGACGCGTNONE 
J080040F20GGACGCGTNONE 
J080041F13GGACGCGTNONE 
J080050C15GGACGCGTNONE 
J080058J01GGACGCGTNONE 
J080062G22GGACGCGTNONE 
J080079L02GGACGCGTNONE 
Os01g0805200009-031-F03GGACGCGTCCNONE 
AK066239GGACGCGTCCConserved hypothetical protein. 
AK104864GGACGCGTCCNONE 
J013058M15GGACGCGTCCNONE 
J023013J10GGACGCGTCCNONE 
J053024C05GGACGCGTCCNONE 
J065078N15GGACGCGTCCNONE 
J065206B14GGACGCGTCCNONE 
J075016E22GGACGCGTCCNONE 
J075044O08GGACGCGTCCNONE 
J075157L16GGACGCGTCCNONE 
J080001D07GGACGCGTCCNONE 
J080001I05GGACGCGTCCNONE 
J080003N24GGACGCGTCCNONE 
J080005G15GGACGCGTCCNONE 
J080013I04GGACGCGTCCNONE 
J080018D01GGACGCGTCCNONE 
J080025E19GGACGCGTCCNONE 
J080027H24GGACGCGTCCNONE 
J080029C05GGACGCGTCCNONE 
J080033J18GGACGCGTCCNONE 
J080034N13GGACGCGTCCNONE 
J080037G21GGACGCGTCCNONE 
J080038K05GGACGCGTCCNONE 
J080039I17GGACGCGTCCNONE 
J080047F14GGACGCGTCCNONE 
J080047J22GGACGCGTCCNONE 
J080059A22GGACGCGTCCNONE 
J080062A12GGACGCGTCCNONE 
J080062K14GGACGCGTCCNONE 
J080068E09GGACGCGTCCNONE 
J080072M10GGACGCGTCCNONE 
J080079G07GGACGCGTCCNONE 
J080080F19GGACGCGTCCNONE 
J080081N09GGACGCGTCCNONE 
J080090M11GGACGCGTCCNONE 
J080096B11GGACGCGTCCNONE 
J080097D06GGACGCGTCCNONE 
J080097K16GGACGCGTCCNONE 
Os01g0813900AK101729CGCGACGCGTCCSimilar to ZIGA1 protein (Fragment). 
Os01g0838725J065088G05GGACGCGTNONE 
J065135D24GGACGCGTConserved hypothetical protein. 
Os01g0844900AK066659ACGCGTCCHomeodomain-like containing protein. 
Os01g0863300014-030-D08CGCACGCGTCCNONE 
AK111571CGCACGCGTCCSimilar to MCB2 protein. 
J013071A13CGCACGCGTCCNONE 
J075060E09CGCACGCGTCCNONE 
J075138C14CGCACGCGTCCNONE 
J075150M17CGCACGCGTCCNONE 
Os01g0864500AK068115GGACGCGTHarpin-induced 1 domain containing protein. 
J013135B08GGACGCGTNONE 
J065042J10GGACGCGTNONE 
J065086N19GGACGCGTNONE 
J065099N09GGACGCGTNONE 
J065127A08GGACGCGTNONE 
J065168F10GGACGCGTNONE 
J065190L11GGACGCGTNONE 
J065206C24GGACGCGTNONE 
J065219A10GGACGCGTNONE 
J075096N19GGACGCGTNONE 
J075153J21GGACGCGTNONE 
J100070D02GGACGCGTNONE 
Os02g0252100AF139211GGACGCGTNONE 
AK062577GGACGCGTSimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051GGACGCGTNONE 
J013156E01GGACGCGTNONE 
J065001D02GGACGCGTNONE 
J065042A05GGACGCGTNONE 
J065116H01GGACGCGTNONE 
J065167P13GGACGCGTNONE 
J065168N07GGACGCGTNONE 
J075093G21GGACGCGTNONE 
J075109H15GGACGCGTNONE 
J075194P17GGACGCGTNONE 
Os02g0317500AK102355GGACGCGTCyclin-like F-box domain containing protein. 
J065039N02GGACGCGTNONE 
J065213B01GGACGCGTNONE 
J075173H12GGACGCGTNONE 
J090087A18GGACGCGTNONE 
J100025O06GGACGCGTNONE 
Os02g0509600AK111075CCACGCGTCCConserved hypothetical protein. 
J065033B09CCACGCGTCCNONE 
J065069L04CCACGCGTCCNONE 
J065089H14CCACGCGTCCNONE 
J065119J16CCACGCGTCCNONE 
J065142J22CCACGCGTCCNONE 
J065168B14CCACGCGTCCNONE 
J065203L03CCACGCGTCCNONE 
J075044C18CCACGCGTCCNONE 
J075068D13CCACGCGTCCNONE 
J075152O09CCACGCGTCCNONE 
Os02g0522000AK101294GCTGGGCCGGTGGACGCGTCGCRetrotransposon gag protein family protein. 
Os02g0613200AK064869GGACGCGTGGNONE 
AK065051GGACGCGTGGNONE 
AK098853GGACGCGTGGConserved hypothetical protein. 
AK098974GGACGCGTGGNONE 
J013000H15GGACGCGTGGNONE 
J013001I18GGACGCGTGGNONE 
J013022I18GGACGCGTGGNONE 
J013025D06GGACGCGTGGNONE 
J013037H17GGACGCGTGGNONE 
J013043F22GGACGCGTGGNONE 
J013075E01GGACGCGTGGNONE 
J013088D09GGACGCGTGGNONE 
J013088E19GGACGCGTGGNONE 
J013102O18GGACGCGTGGNONE 
J013110C08GGACGCGTGGNONE 
J013118C06GGACGCGTGGNONE 
J013119F22GGACGCGTGGNONE 
J013128K14GGACGCGTGGNONE 
J013158C17GGACGCGTGGNONE 
J023013P15GGACGCGTGGNONE 
J023044L21GGACGCGTGGNONE 
J033023I04GGACGCGTGGNONE 
J033038I22GGACGCGTGGNONE 
J033095M02GGACGCGTGGNONE 
J043022F05GGACGCGTGGNONE 
J080307N20GGACGCGTGGNONE 
J080315C02GGACGCGTGGNONE 
J080316A15GGACGCGTGGNONE 
J080316G03GGACGCGTGGNONE 
J090029E24GGACGCGTGGNONE 
J090031H15GGACGCGTGGNONE 
J090034F13GGACGCGTGGNONE 
J090047G02GGACGCGTGGNONE 
J090069M24GGACGCGTGGNONE 
J100052E15GGACGCGTGGNONE 
Os02g0668500006-056-A05GCCCACGCGTCCNONE 
AK060958GCCCACGCGTCCNONE 
AK071867GCCCACGCGTCCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15GCCCACGCGTCCNONE 
J065013J03GCCCACGCGTCCNONE 
J065021P16GCCCACGCGTCCNONE 
J065044B07GCCCACGCGTCCNONE 
J065059E23GCCCACGCGTCCNONE 
J065087N20GCCCACGCGTCCNONE 
J065185I04GCCCACGCGTCCNONE 
J065190G19GCCCACGCGTCCNONE 
J065199C15GCCCACGCGTCCNONE 
J065213L12GCCCACGCGTCCNONE 
J080305C01GCCCACGCGTCCNONE 
J080308C07GCCCACGCGTCCNONE 
J080310F02GCCCACGCGTCCNONE 
Os02g0730300AK098897ACCCCCCACGCGTCCNONE 
AK111629ACCCCCCACGCGTCCSimilar to Potassium transporter HAK3p (Fragment). 
Os02g0741500AK068867ACGCGTCCRibbon-helix-helix domain containing protein. 
Os02g0749800013-004-C10ACGCGTCCNONE 
016-002-A10ACGCGTCCNONE 
AK064731ACGCGTCCMitochodrial transcription termination factor-related family protein. 
AK065868ACGCGTCCNONE 
J013043F09ACGCGTCCNONE 
J065005K17ACGCGTCCNONE 
Os02g0803200AK063404ACGCGTCCSimilar to 30S ribosomal protein S15. 
Os02g0816800013-089-A09GGACGCGTCCACCAACNONE 
AK102271GGACGCGTCCACCAACNAD-dependent epimerase/dehydratase family protein. 
J013105O04GGACGCGTCCACCAACNONE 
J013124I08GGACGCGTCCACCAACNONE 
J023002E08GGACGCGTCCACCAACNONE 
J023025C01GGACGCGTCCACCAACNONE 
J023037O12GGACGCGTCCACCAACNONE 
J023049N06GGACGCGTCCACCAACNONE 
J023069G18GGACGCGTCCACCAACNONE 
J033029M02GGACGCGTCCACCAACNONE 
J033037L22GGACGCGTCCACCAACNONE 
J033089A08GGACGCGTCCACCAACNONE 
J033103L07GGACGCGTCCACCAACNONE 
J033125L19GGACGCGTCCACCAACNONE 
J090008N20GGACGCGTCCACCAACNONE 
J090041F23GGACGCGTCCACCAACNONE 
J090092H16GGACGCGTCCACCAACNONE 
Os03g0140700AK070000ACGCGTCCTetratricopeptide-like helical domain containing protein. 
Os03g0160200AK064836CCCACCACGCGTCCConserved hypothetical protein. 
AK064836GTGACGTGGACCGGACGCGTCCConserved hypothetical protein. 
AK071081CCCACCACGCGTCCNONE 
AK071081GTGACGTGGACCGGACGCGTCCNONE 
AK100712CCCACCACGCGTCCNONE 
AK100712GTGACGTGGACCGGACGCGTCCNONE 
AK104859CCCACCACGCGTCCNONE 
AK104859GTGACGTGGACCGGACGCGTCCNONE 
J013000F21CCCACCACGCGTCCNONE 
J013000F21GTGACGTGGACCGGACGCGTCCNONE 
J013024G05CCCACCACGCGTCCNONE 
J013024G05GTGACGTGGACCGGACGCGTCCNONE 
J013035E12CCCACCACGCGTCCNONE 
J013035E12GTGACGTGGACCGGACGCGTCCNONE 
J013041A17CCCACCACGCGTCCNONE 
J013041A17GTGACGTGGACCGGACGCGTCCNONE 
J013045D10CCCACCACGCGTCCNONE 
J013045D10GTGACGTGGACCGGACGCGTCCNONE 
J013045F04CCCACCACGCGTCCNONE 
J013045F04GTGACGTGGACCGGACGCGTCCNONE 
J013046F04CCCACCACGCGTCCNONE 
J013046F04GTGACGTGGACCGGACGCGTCCNONE 
J013047F10CCCACCACGCGTCCNONE 
J013047F10GTGACGTGGACCGGACGCGTCCNONE 
J013051E10CCCACCACGCGTCCNONE 
J013051E10GTGACGTGGACCGGACGCGTCCNONE 
J013059J07CCCACCACGCGTCCNONE 
J013059J07GTGACGTGGACCGGACGCGTCCNONE 
J013059O17CCCACCACGCGTCCNONE 
J013059O17GTGACGTGGACCGGACGCGTCCNONE 
J013060A20CCCACCACGCGTCCNONE 
J013060A20GTGACGTGGACCGGACGCGTCCNONE 
J013063J23CCCACCACGCGTCCNONE 
J013063J23GTGACGTGGACCGGACGCGTCCNONE 
J013066D19CCCACCACGCGTCCNONE 
J013066D19GTGACGTGGACCGGACGCGTCCNONE 
J013069O08CCCACCACGCGTCCNONE 
J013069O08GTGACGTGGACCGGACGCGTCCNONE 
J013088K24CCCACCACGCGTCCNONE 
J013088K24GTGACGTGGACCGGACGCGTCCNONE 
J013098G04CCCACCACGCGTCCNONE 
J013098G04GTGACGTGGACCGGACGCGTCCNONE 
J013100I15CCCACCACGCGTCCNONE 
J013100I15GTGACGTGGACCGGACGCGTCCNONE 
J013102E18CCCACCACGCGTCCNONE 
J013102E18GTGACGTGGACCGGACGCGTCCNONE 
J013102O09CCCACCACGCGTCCNONE 
J013102O09GTGACGTGGACCGGACGCGTCCNONE 
J013119M18CCCACCACGCGTCCNONE 
J013119M18GTGACGTGGACCGGACGCGTCCNONE 
J013123I19CCCACCACGCGTCCNONE 
J013123I19GTGACGTGGACCGGACGCGTCCNONE 
J013146H15CCCACCACGCGTCCNONE 
J013146H15GTGACGTGGACCGGACGCGTCCNONE 
J013149A14CCCACCACGCGTCCNONE 
J013149A14GTGACGTGGACCGGACGCGTCCNONE 
J023003A05CCCACCACGCGTCCNONE 
J023003A05GTGACGTGGACCGGACGCGTCCNONE 
J023013O19CCCACCACGCGTCCNONE 
J023013O19GTGACGTGGACCGGACGCGTCCNONE 
J023044M05CCCACCACGCGTCCNONE 
J023044M05GTGACGTGGACCGGACGCGTCCNONE 
J023048O03CCCACCACGCGTCCNONE 
J023048O03GTGACGTGGACCGGACGCGTCCNONE 
J023049L17CCCACCACGCGTCCNONE 
J023049L17GTGACGTGGACCGGACGCGTCCNONE 
J023060D22CCCACCACGCGTCCNONE 
J023060D22GTGACGTGGACCGGACGCGTCCNONE 
J023060F20CCCACCACGCGTCCNONE 
J023060F20GTGACGTGGACCGGACGCGTCCNONE 
J023069G09CCCACCACGCGTCCNONE 
J023069G09GTGACGTGGACCGGACGCGTCCNONE 
J023086E11CCCACCACGCGTCCNONE 
J023086E11GTGACGTGGACCGGACGCGTCCNONE 
J023091I09CCCACCACGCGTCCNONE 
J023091I09GTGACGTGGACCGGACGCGTCCNONE 
J023091M19CCCACCACGCGTCCNONE 
J023091M19GTGACGTGGACCGGACGCGTCCNONE 
J023101D06CCCACCACGCGTCCNONE 
J023101D06GTGACGTGGACCGGACGCGTCCNONE 
J023109B03CCCACCACGCGTCCNONE 
J023109B03GTGACGTGGACCGGACGCGTCCNONE 
J023113B14CCCACCACGCGTCCNONE 
J023113B14GTGACGTGGACCGGACGCGTCCNONE 
J023114B19CCCACCACGCGTCCNONE 
J023114B19GTGACGTGGACCGGACGCGTCCNONE 
J023115H16CCCACCACGCGTCCNONE 
J023115H16GTGACGTGGACCGGACGCGTCCNONE 
J023134F22CCCACCACGCGTCCNONE 
J023134F22GTGACGTGGACCGGACGCGTCCNONE 
J023139I06CCCACCACGCGTCCNONE 
J023139I06GTGACGTGGACCGGACGCGTCCNONE 
J023150C02CCCACCACGCGTCCNONE 
J023150C02GTGACGTGGACCGGACGCGTCCNONE 
J033033A14CCCACCACGCGTCCNONE 
J033033A14GTGACGTGGACCGGACGCGTCCNONE 
J033058O11CCCACCACGCGTCCNONE 
J033058O11GTGACGTGGACCGGACGCGTCCNONE 
J033060H13CCCACCACGCGTCCNONE 
J033060H13GTGACGTGGACCGGACGCGTCCNONE 
J033075P14CCCACCACGCGTCCNONE 
J033075P14GTGACGTGGACCGGACGCGTCCNONE 
J033084O05CCCACCACGCGTCCNONE 
J033084O05GTGACGTGGACCGGACGCGTCCNONE 
J033087G04CCCACCACGCGTCCNONE 
J033087G04GTGACGTGGACCGGACGCGTCCNONE 
J033092E18CCCACCACGCGTCCNONE 
J033092E18GTGACGTGGACCGGACGCGTCCNONE 
J033101G23CCCACCACGCGTCCNONE 
J033101G23GTGACGTGGACCGGACGCGTCCNONE 
J033112I05CCCACCACGCGTCCNONE 
J033112I05GTGACGTGGACCGGACGCGTCCNONE 
J033118E14CCCACCACGCGTCCNONE 
J033118E14GTGACGTGGACCGGACGCGTCCNONE 
J033118P04CCCACCACGCGTCCNONE 
J033118P04GTGACGTGGACCGGACGCGTCCNONE 
J033123C07CCCACCACGCGTCCNONE 
J033123C07GTGACGTGGACCGGACGCGTCCNONE 
J043003C01CCCACCACGCGTCCNONE 
J043003C01GTGACGTGGACCGGACGCGTCCNONE 
J043024B21CCCACCACGCGTCCNONE 
J043024B21GTGACGTGGACCGGACGCGTCCNONE 
J043030N04CCCACCACGCGTCCNONE 
J043030N04GTGACGTGGACCGGACGCGTCCNONE 
J043039J02CCCACCACGCGTCCNONE 
J043039J02GTGACGTGGACCGGACGCGTCCNONE 
J043039N08CCCACCACGCGTCCNONE 
J043039N08GTGACGTGGACCGGACGCGTCCNONE 
J075006N21CCCACCACGCGTCCNONE 
J075006N21GTGACGTGGACCGGACGCGTCCNONE 
J075008A16CCCACCACGCGTCCNONE 
J075008A16GTGACGTGGACCGGACGCGTCCNONE 
J075018J16CCCACCACGCGTCCNONE 
J075018J16GTGACGTGGACCGGACGCGTCCNONE 
J075023G04CCCACCACGCGTCCNONE 
J075023G04GTGACGTGGACCGGACGCGTCCNONE 
J075134F18CCCACCACGCGTCCNONE 
J075134F18GTGACGTGGACCGGACGCGTCCNONE 
J075181B05CCCACCACGCGTCCNONE 
J075181B05GTGACGTGGACCGGACGCGTCCNONE 
J090014O14CCCACCACGCGTCCNONE 
J090014O14GTGACGTGGACCGGACGCGTCCNONE 
J090020H22CCCACCACGCGTCCNONE 
J090020H22GTGACGTGGACCGGACGCGTCCNONE 
J090022G17CCCACCACGCGTCCNONE 
J090022G17GTGACGTGGACCGGACGCGTCCNONE 
J090023J24CCCACCACGCGTCCNONE 
J090023J24GTGACGTGGACCGGACGCGTCCNONE 
J090033H01CCCACCACGCGTCCNONE 
J090033H01GTGACGTGGACCGGACGCGTCCNONE 
J090038A03CCCACCACGCGTCCNONE 
J090038A03GTGACGTGGACCGGACGCGTCCNONE 
J090041O22CCCACCACGCGTCCNONE 
J090041O22GTGACGTGGACCGGACGCGTCCNONE 
J090049E10CCCACCACGCGTCCNONE 
J090049E10GTGACGTGGACCGGACGCGTCCNONE 
J090063E24CCCACCACGCGTCCNONE 
J090063E24GTGACGTGGACCGGACGCGTCCNONE 
J090080N12CCCACCACGCGTCCNONE 
J090080N12GTGACGTGGACCGGACGCGTCCNONE 
J100021G23CCCACCACGCGTCCNONE 
J100021G23GTGACGTGGACCGGACGCGTCCNONE 
J100028P06CCCACCACGCGTCCNONE 
J100028P06GTGACGTGGACCGGACGCGTCCNONE 
J100060L21CCCACCACGCGTCCNONE 
J100060L21GTGACGTGGACCGGACGCGTCCNONE 
J100077D16CCCACCACGCGTCCNONE 
J100077D16GTGACGTGGACCGGACGCGTCCNONE 
J100088I09CCCACCACGCGTCCNONE 
J100088I09GTGACGTGGACCGGACGCGTCCNONE 
Os03g0168100012-058-G09CCACGCGTCCNONE 
014-008-F07CCACGCGTCCNONE 
015-084-D03CCACGCGTCCNONE 
AK121575CCACGCGTCCLate embryogenesis abundant protein repeat containing protein. 
J033024H14CCACGCGTCCNONE 
J033036H02CCACGCGTCCNONE 
J033044I19CCACGCGTCCNONE 
J033098F11CCACGCGTCCNONE 
J033125I22CCACGCGTCCNONE 
J033128N18CCACGCGTCCNONE 
J033132L19CCACGCGTCCNONE 
J033149G13CCACGCGTCCNONE 
J075052I19CCACGCGTCCNONE 
J075099H16CCACGCGTCCNONE 
J075099P11CCACGCGTCCNONE 
J075122I20CCACGCGTCCNONE 
J075172K14CCACGCGTCCNONE 
J075188H01CCACGCGTCCNONE 
Os03g0235000AK103019ACGCGTCCNONE 
J033116N23ACGCGTCCNONE 
Os03g0240800006-092-D05GGACGCGTNONE 
AK059292GGACGCGTNONE 
AK061178GGACGCGTSimilar to AGL157Cp. 
AK121552GGACGCGTNONE 
J023131D06GGACGCGTNONE 
J033033E14GGACGCGTNONE 
J033105B01GGACGCGTNONE 
J033114L18GGACGCGTNONE 
J033132N24GGACGCGTNONE 
J065032H03GGACGCGTNONE 
J065115J20GGACGCGTNONE 
J065150C05GGACGCGTNONE 
J080302A11GGACGCGTNONE 
J080302H16GGACGCGTNONE 
J080305M12GGACGCGTNONE 
J080306F13GGACGCGTNONE 
J080312A06GGACGCGTNONE 
J090088P09GGACGCGTNONE 
Os03g0278300016-006-D06ACGCGTCCNONE 
AK060280ACGCGTCCNONE 
AK064165ACGCGTCCSimilar to ALY protein. 
AK071965ACGCGTCCNONE 
AK072759ACGCGTCCNONE 
AK100762ACGCGTCCNONE 
AK119667ACGCGTCCNONE 
J090024H18ACGCGTCCNONE 
Os03g0292100Os03g0292100CACCGCACGCGTCCProtein phosphatase 2C family protein. 
Os03g0319300006-021-E05ACGCGTCCNONE 
006-022-H12ACGCGTCCNONE 
009-187-E02ACGCGTCCNONE 
AF042840ACGCGTCCNONE 
AK059756ACGCGTCCCalmodulin (CaM). 
AK070090ACGCGTCCNONE 
J065017J02ACGCGTCCNONE 
J065028G17ACGCGTCCNONE 
J065045N09ACGCGTCCNONE 
J065078F21ACGCGTCCNONE 
J065091H01ACGCGTCCNONE 
J065112B19ACGCGTCCNONE 
J065186E08ACGCGTCCNONE 
J065199G12ACGCGTCCNONE 
J075030K07ACGCGTCCNONE 
J075050B02ACGCGTCCNONE 
J075057G07ACGCGTCCNONE 
J075070F01ACGCGTCCNONE 
J075093N12ACGCGTCCNONE 
J075095K13ACGCGTCCNONE 
J075102D14ACGCGTCCNONE 
J075103B17ACGCGTCCNONE 
J075114K05ACGCGTCCNONE 
J075142F18ACGCGTCCNONE 
J075154L11ACGCGTCCNONE 
J075185F08ACGCGTCCNONE 
J090012A14ACGCGTCCNONE 
J090044L10ACGCGTCCNONE 
J100044C12ACGCGTCCNONE 
J100088J19ACGCGTCCNONE 
Os03g0340500012-007-F10ACGCGTCCNONE 
AK099406ACGCGTCCNONE 
AK102158ACGCGTCCSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13ACGCGTCCNONE 
J013063E02ACGCGTCCNONE 
J013063I02ACGCGTCCNONE 
J013157O07ACGCGTCCNONE 
J023131N05ACGCGTCCNONE 
J033033P05ACGCGTCCNONE 
J033040N16ACGCGTCCNONE 
J033044M19ACGCGTCCNONE 
J033086F24ACGCGTCCNONE 
J033097H01ACGCGTCCNONE 
J033106C22ACGCGTCCNONE 
J033128M13ACGCGTCCNONE 
J033133I15ACGCGTCCNONE 
J043027A21ACGCGTCCNONE 
J090028A09ACGCGTCCNONE 
J090053D06ACGCGTCCNONE 
J090083O17ACGCGTCCNONE 
J090099H10ACGCGTCCNONE 
J100036M05ACGCGTCCNONE 
Os03g0374100AK066002CCCCACACGCGTCCHepatocellular carcinoma-associated antigen 59 family protein. 
AK099328CCCCACACGCGTCCNONE 
AK104845CCCCACACGCGTCCNONE 
Os03g0410700J065102A22CCGAGCCGACGCGTCCNONE 
Os03g0607200013-002-F05GGACGCGTNONE 
013-021-H08GGACGCGTNONE 
013-038-E10GGACGCGTNONE 
014-009-E05GGACGCGTNONE 
014-034-H01GGACGCGTNONE 
014-038-A08GGACGCGTNONE 
014-072-G08GGACGCGTNONE 
014-083-B06GGACGCGTNONE 
014-088-G10GGACGCGTNONE 
AK070268GGACGCGTGibberellin regulated protein family protein. 
J023044E14GGACGCGTNONE 
J065199F02GGACGCGTNONE 
J075001C09GGACGCGTNONE 
J075019F02GGACGCGTNONE 
J075061J21GGACGCGTNONE 
J075068G03GGACGCGTNONE 
J075126F10GGACGCGTNONE 
J075153F19GGACGCGTNONE 
J080305I04GGACGCGTNONE 
J080307F24GGACGCGTNONE 
J080312E23GGACGCGTNONE 
J080315M20GGACGCGTNONE 
J080317E18GGACGCGTNONE 
J090043I11GGACGCGTNONE 
Os03g0784400AK103474GGACGCGTGGGProtein of unknown function DUF1692 domain containing protein. 
J023135I15GGACGCGTGGGNONE 
J033130D12GGACGCGTGGGNONE 
J043035E20GGACGCGTGGGNONE 
J065206K15GGACGCGTGGGNONE 
J075053J20GGACGCGTGGGNONE 
J075129B11GGACGCGTGGGNONE 
J090003E22GGACGCGTGGGNONE 
J100023E23GGACGCGTGGGNONE 
Os03g0796600003-113-D10TGAGGGACGCGTGTCCCTCANONE 
011-076-B12TGAGGGACGCGTGTCCCTCANONE 
AK105257TGAGGGACGCGTGTCCCTCAProtein of unknown function DUF506, plant family protein. 
J075105C03TGAGGGACGCGTGTCCCTCANONE 
J080036O17TGAGGGACGCGTGTCCCTCANONE 
J080064E16TGAGGGACGCGTGTCCCTCANONE 
J080069E03TGAGGGACGCGTGTCCCTCANONE 
J080079E23TGAGGGACGCGTGTCCCTCANONE 
J090036H20TGAGGGACGCGTGTCCCTCANONE 
J100029L10TGAGGGACGCGTGTCCCTCANONE 
J100055G09TGAGGGACGCGTGTCCCTCANONE 
Os03g0820400009-042-F06ACGCGTCCCACCNONE 
009-046-E08ACGCGTCCCACCNONE 
009-079-B08ACGCGTCCCACCNONE 
009-111-H09ACGCGTCCCACCNONE 
009-150-D10ACGCGTCCCACCNONE 
015-073-H11ACGCGTCCCACCNONE 
AK119690ACGCGTCCCACCSimilar to ZPT2-13. 
AY286473ACGCGTCCCACCNONE 
AY305864ACGCGTCCCACCNONE 
J100051O21ACGCGTCCCACCNONE 
Os03g0833300012-091-F09ACGCGTCCNONE 
015-038-A05ACGCGTCCNONE 
AK065741ACGCGTCCNONE 
AK069847ACGCGTCCSimilar to Squamosa-promoter binding-like protein 8. 
AK072164ACGCGTCCNONE 
AK121030ACGCGTCCNONE 
J013040K13ACGCGTCCNONE 
J013122I04ACGCGTCCNONE 
J013130O11ACGCGTCCNONE 
J023003A13ACGCGTCCNONE 
J023003A14ACGCGTCCNONE 
J023034C10ACGCGTCCNONE 
J033058F07ACGCGTCCNONE 
J033065P18ACGCGTCCNONE 
J033124B15ACGCGTCCNONE 
J043001C15ACGCGTCCNONE 
J043031N15ACGCGTCCNONE 
J065090G07ACGCGTCCNONE 
J090043M05ACGCGTCCNONE 
J090053E11ACGCGTCCNONE 
J090066P15ACGCGTCCNONE 
J090067E22ACGCGTCCNONE 
Os03g0854800J090007D13CACACACCACGCGTCCNONE 
J090085N22CACACACCACGCGTCCNONE 
Os04g0372700009-110-D07GCGTGGGCCCACGCCACACGACGCGTCCNONE 
AK062814GCGTGGGCCCACGCCACACGACGCGTCCSimilar to Quinone-oxidoreductase QR1 (Fragment). 
J065021E21GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065099E23GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065120F10GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065165P14GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065208L18GCGTGGGCCCACGCCACACGACGCGTCCNONE 
Os04g0461600AK072586GGACGCGTSimilar to Fw2.2. 
J023056C16GGACGCGTNONE 
J023132E12GGACGCGTNONE 
J053089N03GGACGCGTNONE 
Os04g0482300015-088-C07ACGCGTCCNONE 
AK064143ACGCGTCCBTB domain containing protein. 
J065053L16ACGCGTCCNONE 
J065053N15ACGCGTCCNONE 
Os04g0518600009-024-C12ACGCGTCCNONE 
009-170-C11ACGCGTCCNONE 
AK063087ACGCGTCCHypothetical protein. 
J090037L15ACGCGTCCNONE 
Os04g0528300AK058387ACGCGTCCNONE 
J013000P15ACGCGTCCNONE 
Os04g0531100013-046-D02ACGCGTCCNONE 
AF090698ACGCGTCCNONE 
AK063584ACGCGTCCC2 calcium/lipid-binding region, CaLB domain containing protein. 
J065025M20ACGCGTCCNONE 
J065028L15ACGCGTCCNONE 
J065048O03ACGCGTCCNONE 
J065053K10ACGCGTCCNONE 
J065072H10ACGCGTCCNONE 
J065081H10ACGCGTCCNONE 
J065082N17ACGCGTCCNONE 
J065104K08ACGCGTCCNONE 
J065106M03ACGCGTCCNONE 
J065119I05ACGCGTCCNONE 
J065122F04ACGCGTCCNONE 
J065140N24ACGCGTCCNONE 
J065153G09ACGCGTCCNONE 
J065171H07ACGCGTCCNONE 
J065172M23ACGCGTCCNONE 
J065173K13ACGCGTCCNONE 
J065177D22ACGCGTCCNONE 
J065189H10ACGCGTCCNONE 
J065198H24ACGCGTCCNONE 
J065204D19ACGCGTCCNONE 
J075006C08ACGCGTCCNONE 
J075029I08ACGCGTCCNONE 
J075039A16ACGCGTCCNONE 
J075107I24ACGCGTCCNONE 
J075135M22ACGCGTCCNONE 
J075181P06ACGCGTCCNONE 
J075190O11ACGCGTCCNONE 
J075193F04ACGCGTCCNONE 
Os04g0566300009-017-D06ACGCGTCCACGCCACNONE 
AK062357ACGCGTCCACGCCACHypothetical protein. 
Os04g0607600AK109852GGACGCGTGGNONE 
AK120889GGACGCGTGGCation transporter family protein. 
Os04g0679800AK060662GGACGCGTSimilar to RNA-binding protein-like protein. 
AK099987GGACGCGTNONE 
J013130B11GGACGCGTNONE 
J065049C17GGACGCGTNONE 
J075191N12GGACGCGTNONE 
J075191P12GGACGCGTNONE 
J100031C07GGACGCGTNONE 
Os05g0119200AK067943CCCACACGCGTCCConserved hypothetical protein. 
J013122C02CCCACACGCGTCCNONE 
J065077M14CCCACACGCGTCCNONE 
J065108P21CCCACACGCGTCCNONE 
J065138G20CCCACACGCGTCCNONE 
J065148H07CCCACACGCGTCCNONE 
J065205P09CCCACACGCGTCCNONE 
J075061H16CCCACACGCGTCCNONE 
J075140H13CCCACACGCGTCCNONE 
J075153H02CCCACACGCGTCCNONE 
J075170B14CCCACACGCGTCCNONE 
Os05g0127300AK106429CCGATCCGACGCGTCCGTCCGNONE 
AK121766CCGATCCGACGCGTCCGTCCGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J065021F23CCGATCCGACGCGTCCGTCCGNONE 
J100041J04CCGATCCGACGCGTCCGTCCGNONE 
Os05g0323900006-105-F01CCCACGCGTCCNONE 
009-161-D06CCCACGCGTCCNONE 
AK070528CCCACGCGTCCManganese-superoxide dismutase precursor (EC 1.15.1.1). 
AK104030CCCACGCGTCCNONE 
AK104160CCCACGCGTCCNONE 
AK119904CCCACGCGTCCNONE 
J023060D13CCCACGCGTCCNONE 
J033057E10CCCACGCGTCCNONE 
J043034F19CCCACGCGTCCNONE 
J053099K12CCCACGCGTCCNONE 
J065022N03CCCACGCGTCCNONE 
J065035G13CCCACGCGTCCNONE 
J065059M24CCCACGCGTCCNONE 
J065059N23CCCACGCGTCCNONE 
J065073I02CCCACGCGTCCNONE 
J065095L15CCCACGCGTCCNONE 
J065104I24CCCACGCGTCCNONE 
J065104J24CCCACGCGTCCNONE 
J065112L13CCCACGCGTCCNONE 
J065114J24CCCACGCGTCCNONE 
J065120J16CCCACGCGTCCNONE 
J065141I09CCCACGCGTCCNONE 
J065165E17CCCACGCGTCCNONE 
J065170C14CCCACGCGTCCNONE 
J065182I05CCCACGCGTCCNONE 
J065191K20CCCACGCGTCCNONE 
J065205L14CCCACGCGTCCNONE 
J075017M10CCCACGCGTCCNONE 
J075019O04CCCACGCGTCCNONE 
J075019O15CCCACGCGTCCNONE 
J075032E07CCCACGCGTCCNONE 
J075042D13CCCACGCGTCCNONE 
J075054J07CCCACGCGTCCNONE 
J075089O11CCCACGCGTCCNONE 
J075104G09CCCACGCGTCCNONE 
J075150N03CCCACGCGTCCNONE 
J075187A09CCCACGCGTCCNONE 
J075187D04CCCACGCGTCCNONE 
J090006G06CCCACGCGTCCNONE 
J090045C09CCCACGCGTCCNONE 
J090083D13CCCACGCGTCCNONE 
J090084B13CCCACGCGTCCNONE 
J100021H22CCCACGCGTCCNONE 
J100034A15CCCACGCGTCCNONE 
J100041N15CCCACGCGTCCNONE 
J100042D05CCCACGCGTCCNONE 
J100042D08CCCACGCGTCCNONE 
J100059P21CCCACGCGTCCNONE 
L19436CCCACGCGTCCNONE 
L34038CCCACGCGTCCNONE 
Os05g0357850J065118C17CCACGCGTCCHypothetical protein. 
J065159C03CCACGCGTCCNONE 
Os05g0405900AK072244GGACGCGTWD40-like domain containing protein. 
Os05g0460000011-074-F09GGGGCCCACCAACGCGTCCNONE 
J023002L01GGGGCCCACCAACGCGTCCNONE 
J023060I12GGGGCCCACCAACGCGTCCNONE 
J023060O12GGGGCCCACCAACGCGTCCNONE 
J023106P08GGGGCCCACCAACGCGTCCNONE 
J023141D17GGGGCCCACCAACGCGTCCNONE 
J023150E11GGGGCCCACCAACGCGTCCSimilar to 70 kDa heat shock cognate protein 1. 
J033030A20GGGGCCCACCAACGCGTCCNONE 
J033039H14GGGGCCCACCAACGCGTCCNONE 
J033101B11GGGGCCCACCAACGCGTCCNONE 
J033101B12GGGGCCCACCAACGCGTCCNONE 
J033114A09GGGGCCCACCAACGCGTCCNONE 
J090037G06GGGGCCCACCAACGCGTCCNONE 
J090048G13GGGGCCCACCAACGCGTCCNONE 
J090090F15GGGGCCCACCAACGCGTCCNONE 
Os05g0480000AK061052GGACGCGTProtein kinase domain containing protein. 
Os05g0534100Os05g0534100CCACGCGTCCAcid phosphatase/vanadium-dependent haloperoxidase related family protein. 
Os05g0577200AK069756CGCACGCGTCCCarboxylesterase, type B family protein. 
Os05g0594100006-034-F04ACGCGTCCNONE 
006-061-A02ACGCGTCCNONE 
009-081-E02ACGCGTCCNONE 
AK060122ACGCGTCCNONE 
AK106130ACGCGTCCSimilar to GDA2 protein. 
J023010C07ACGCGTCCNONE 
J023098J20ACGCGTCCNONE 
J023117G22ACGCGTCCNONE 
J023127J08ACGCGTCCNONE 
J033117G03ACGCGTCCNONE 
J033124I03ACGCGTCCNONE 
J043015K15ACGCGTCCNONE 
Os06g0102800AK068790ACGCGTCCConserved hypothetical protein. 
Os06g0141600006-035-C07GGACGCGTGGNONE 
AK059772GGACGCGTGGEarly nodulin 93 ENOD93 protein family protein. 
J075028K13GGACGCGTGGNONE 
J075070B17GGACGCGTGGNONE 
J075075G08GGACGCGTGGNONE 
J075081B21GGACGCGTGGNONE 
J075116B04GGACGCGTGGNONE 
J075133E10GGACGCGTGGNONE 
J075144I23GGACGCGTGGNONE 
J075147G16GGACGCGTGGNONE 
J075151E04GGACGCGTGGNONE 
J075162E07GGACGCGTGGNONE 
J075163P14GGACGCGTGGNONE 
J075182C07GGACGCGTGGNONE 
J075196O22GGACGCGTGGNONE 
J100086C12GGACGCGTGGNONE 
Os06g0142200AB018376GGACGCGTGGEarly nodulin. 
AK105832GGACGCGTGGNONE 
AK122162GGACGCGTGGNONE 
J033057P14GGACGCGTGGNONE 
J033147G13GGACGCGTGGNONE 
J043012H17GGACGCGTGGNONE 
J065065E18GGACGCGTGGNONE 
J065099L01GGACGCGTGGNONE 
J065119D03GGACGCGTGGNONE 
J065134O21GGACGCGTGGNONE 
J065160G17GGACGCGTGGNONE 
J065201C04GGACGCGTGGNONE 
J090056D21GGACGCGTGGNONE 
Os06g0152200AB001886GCCCACGCGTCCNONE 
AK072231GCCCACGCGTCCZinc-finger protein R2931. 
AK104083GCCCACGCGTCCNONE 
J065077H19GCCCACGCGTCCNONE 
J065208H22GCCCACGCGTCCNONE 
J100032H08GCCCACGCGTCCNONE 
Os06g0266800009-057-G11ACGCGTCCNONE 
AK062516ACGCGTCCSimilar to GAST1 protein precursor. 
Os06g0324400014-079-C07ACGCGTCCNONE 
AK063726ACGCGTCCLate embryogenesis abundant (LEA) group 1 family protein. 
J065159N12ACGCGTCCNONE 
J075053K06ACGCGTCCNONE 
Os06g0575100J100034A01ACGCGTCCConserved hypothetical protein. 
Os06g0625500006-034-A05CCAGGCCCAATACGCGTCCNONE 
AK058459CCAGGCCCAATACGCGTCCSimilar to Thioredoxin peroxidase. 
AK068955CCAGGCCCAATACGCGTCCNONE 
AK104130CCAGGCCCAATACGCGTCCNONE 
J023003C09CCAGGCCCAATACGCGTCCNONE 
J033043I02CCAGGCCCAATACGCGTCCNONE 
J065063E05CCAGGCCCAATACGCGTCCNONE 
J065190D24CCAGGCCCAATACGCGTCCNONE 
J065198I01CCAGGCCCAATACGCGTCCNONE 
J075107A02CCAGGCCCAATACGCGTCCNONE 
Os07g0124600AK073437GGACGCGTCTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24GGACGCGTCTCNONE 
J033136G07GGACGCGTCTCNONE 
J065092I12GGACGCGTCTCNONE 
J065132F04GGACGCGTCTCNONE 
J065143I11GGACGCGTCTCNONE 
Os07g0223100006-044-G07CCCACGCGTCCCACCNONE 
006-071-E10CCCACGCGTCCCACCNONE 
006-077-A04CCCACGCGTCCCACCNONE 
009-162-H05CCCACGCGTCCCACCNONE 
J023050M10CCCACGCGTCCCACCNONE 
J023055F05CCCACGCGTCCCACCNONE 
J023060I11CCCACGCGTCCCACCNONE 
J023101M01CCCACGCGTCCCACCNONE 
J065059J21CCCACGCGTCCCACCNONE 
J065087I18CCCACGCGTCCCACCNONE 
J065113L17CCCACGCGTCCCACCNONE 
J065123E19CCCACGCGTCCCACCNONE 
J065137O04CCCACGCGTCCCACCNONE 
J065217M03CCCACGCGTCCCACCNONE 
J090012O14CCCACGCGTCCCACCNONE 
J090014C13CCCACGCGTCCCACCNONE 
J090060C24CCCACGCGTCCCACCNONE 
J100037H14CCCACGCGTCCCACCNONE 
J100060E10CCCACGCGTCCCACCNONE 
J100067L04CCCACGCGTCCCACCNONE 
J100075G09CCCACGCGTCCCACCNONE 
J100077C15CCCACGCGTCCCACCNONE 
Os07g0448800AB029446GGACGCGTNONE 
Os07g0538200AK102249ACGCGTCCNONE 
AK103518ACGCGTCCProtein of unknown function DUF26 domain containing protein. 
Os07g0633200AK061338CACGCCACGCGTCCSimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451CACGCCACGCGTCCNONE 
J033096E22CACGCCACGCGTCCNONE 
J033125D06CACGCCACGCGTCCNONE 
J075048C23CACGCCACGCGTCCNONE 
J075050G02CACGCCACGCGTCCNONE 
J075104J04CACGCCACGCGTCCNONE 
J075144N04CACGCCACGCGTCCNONE 
Os07g0675250013-097-G10CCACGCGTCCNONE 
AK063620CCACGCGTCCConserved hypothetical protein. 
J075026H18CCACGCGTCCNONE 
J075192A02CCACGCGTCCNONE 
Os08g0408200AK111715ACGCGTCCSimilar to GAMYB-binding protein (Fragment). 
Os08g0465300AK108076ACGCGTCCConserved hypothetical protein. 
Os08g0544800009-168-G01ACGCGTCCTGGGCCGTCGGATCNONE 
011-046-D09ACGCGTCCTGGGCCGTCGGATCNONE 
012-003-C08ACGCGTCCTGGGCCGTCGGATCNONE 
012-042-B06ACGCGTCCTGGGCCGTCGGATCNONE 
013-035-H12ACGCGTCCTGGGCCGTCGGATCNONE 
013-072-A10ACGCGTCCTGGGCCGTCGGATCNONE 
014-010-B11ACGCGTCCTGGGCCGTCGGATCNONE 
014-097-E06ACGCGTCCTGGGCCGTCGGATCNONE 
015-003-E12ACGCGTCCTGGGCCGTCGGATCNONE 
015-040-B04ACGCGTCCTGGGCCGTCGGATCNONE 
AK060536ACGCGTCCTGGGCCGTCGGATCNONE 
AK102666ACGCGTCCTGGGCCGTCGGATCNONE 
AK119660ACGCGTCCTGGGCCGTCGGATCPCF2. 
D87261ACGCGTCCTGGGCCGTCGGATCNONE 
J090049N23ACGCGTCCTGGGCCGTCGGATCNONE 
J090084G06ACGCGTCCTGGGCCGTCGGATCNONE 
Os09g0269900AK064489ACGCGTCCConserved hypothetical protein. 
Os09g0443800AK107689GGACGCGTConserved hypothetical protein. 
Os11g0592000016-009-G07GGACGCGTNONE 
AK121059GGACGCGTSimilar to Barwin. 
J023056K07GGACGCGTNONE 
J065042D11GGACGCGTNONE 
J075011F19GGACGCGTNONE 
J075024L10GGACGCGTNONE 
J075070F17GGACGCGTNONE 
J075085G18GGACGCGTNONE 
J075118N24GGACGCGTNONE 
J100021P22GGACGCGTNONE 
J100043H20GGACGCGTNONE 
J100047L04GGACGCGTNONE 
J100056C08GGACGCGTNONE 
J100063M03GGACGCGTNONE 
Os11g0595200009-005-A06ACGCGTCCNONE 
AK071115ACGCGTCCNONE 
AK106159ACGCGTCCPAP fibrillin family protein. 
AY387683ACGCGTCCNONE 
AY387684ACGCGTCCNONE 
J065166K17ACGCGTCCNONE 
Os11g0655800AK099612GGACGCGTGGLipase, class 3 family protein. 
Os12g0242500J065129F10ACGCGTCCNONE 
J090032G12ACGCGTCCConserved hypothetical protein. 
Os12g0297400005-006-D01ACGCGTCCNONE 
AK061658ACGCGTCCHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.