version

Summary of OsREG443 (All List)

OrganismOryza sativa  
IDOsREG443  
SequenceACGCGTGG  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1230  

Entry Sequences (1230 entries)

LocusGene modelSequenceDescription
Os01g0131600006-030-A03GGGTGGGCCCACGCGTNONE 
006-049-C10GGGTGGGCCCACGCGTNONE 
006-054-E02GGGTGGGCCCACGCGTNONE 
011-035-H02GGGTGGGCCCACGCGTNONE 
011-036-E04GGGTGGGCCCACGCGTNONE 
012-047-C08GGGTGGGCCCACGCGTNONE 
012-079-F08GGGTGGGCCCACGCGTNONE 
012-097-C02GGGTGGGCCCACGCGTNONE 
012-100-A07GGGTGGGCCCACGCGTNONE 
013-015-H05GGGTGGGCCCACGCGTNONE 
013-047-A03GGGTGGGCCCACGCGTNONE 
013-051-B05GGGTGGGCCCACGCGTNONE 
013-061-G02GGGTGGGCCCACGCGTNONE 
013-077-H02GGGTGGGCCCACGCGTNONE 
015-005-D04GGGTGGGCCCACGCGTNONE 
015-064-B06GGGTGGGCCCACGCGTNONE 
015-072-D02GGGTGGGCCCACGCGTNONE 
016-073-E09GGGTGGGCCCACGCGTNONE 
016-088-H03GGGTGGGCCCACGCGTNONE 
AK062063GGGTGGGCCCACGCGTNONE 
AK101133GGGTGGGCCCACGCGTSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277GGGTGGGCCCACGCGTNONE 
AK119645GGGTGGGCCCACGCGTNONE 
AY341828GGGTGGGCCCACGCGTNONE 
J013036O08GGGTGGGCCCACGCGTNONE 
J013037M17GGGTGGGCCCACGCGTNONE 
J013039B11GGGTGGGCCCACGCGTNONE 
J013039L20GGGTGGGCCCACGCGTNONE 
J013047B20GGGTGGGCCCACGCGTNONE 
J013048E23GGGTGGGCCCACGCGTNONE 
J013051E12GGGTGGGCCCACGCGTNONE 
J013051F12GGGTGGGCCCACGCGTNONE 
J013056B05GGGTGGGCCCACGCGTNONE 
J013057N24GGGTGGGCCCACGCGTNONE 
J013064D21GGGTGGGCCCACGCGTNONE 
J013065G24GGGTGGGCCCACGCGTNONE 
J013075L13GGGTGGGCCCACGCGTNONE 
J013075L24GGGTGGGCCCACGCGTNONE 
J013092F04GGGTGGGCCCACGCGTNONE 
J013092F10GGGTGGGCCCACGCGTNONE 
J013092M16GGGTGGGCCCACGCGTNONE 
J013096K06GGGTGGGCCCACGCGTNONE 
J013111F10GGGTGGGCCCACGCGTNONE 
J013120B17GGGTGGGCCCACGCGTNONE 
J013120P07GGGTGGGCCCACGCGTNONE 
J013122F18GGGTGGGCCCACGCGTNONE 
J013122H23GGGTGGGCCCACGCGTNONE 
J013126I15GGGTGGGCCCACGCGTNONE 
J013126L17GGGTGGGCCCACGCGTNONE 
J013129C15GGGTGGGCCCACGCGTNONE 
J013146A04GGGTGGGCCCACGCGTNONE 
J013146A06GGGTGGGCCCACGCGTNONE 
J013153F01GGGTGGGCCCACGCGTNONE 
J013156O06GGGTGGGCCCACGCGTNONE 
J013162D05GGGTGGGCCCACGCGTNONE 
J023008N04GGGTGGGCCCACGCGTNONE 
J023010D06GGGTGGGCCCACGCGTNONE 
J023011I23GGGTGGGCCCACGCGTNONE 
J023023I15GGGTGGGCCCACGCGTNONE 
J023025C08GGGTGGGCCCACGCGTNONE 
J023029H02GGGTGGGCCCACGCGTNONE 
J023033C18GGGTGGGCCCACGCGTNONE 
J023037D21GGGTGGGCCCACGCGTNONE 
J023049F17GGGTGGGCCCACGCGTNONE 
J023052B15GGGTGGGCCCACGCGTNONE 
J023061D03GGGTGGGCCCACGCGTNONE 
J023062M01GGGTGGGCCCACGCGTNONE 
J023089D24GGGTGGGCCCACGCGTNONE 
J023109J20GGGTGGGCCCACGCGTNONE 
J023109M21GGGTGGGCCCACGCGTNONE 
J023120N04GGGTGGGCCCACGCGTNONE 
J023122A04GGGTGGGCCCACGCGTNONE 
J023134F23GGGTGGGCCCACGCGTNONE 
J023149E20GGGTGGGCCCACGCGTNONE 
J033022A12GGGTGGGCCCACGCGTNONE 
J033022C04GGGTGGGCCCACGCGTNONE 
J033024K06GGGTGGGCCCACGCGTNONE 
J033026F23GGGTGGGCCCACGCGTNONE 
J033029J19GGGTGGGCCCACGCGTNONE 
J033040H20GGGTGGGCCCACGCGTNONE 
J033042P21GGGTGGGCCCACGCGTNONE 
J033043F14GGGTGGGCCCACGCGTNONE 
J033044G11GGGTGGGCCCACGCGTNONE 
J033052L10GGGTGGGCCCACGCGTNONE 
J033052O03GGGTGGGCCCACGCGTNONE 
J033052P03GGGTGGGCCCACGCGTNONE 
J033079B20GGGTGGGCCCACGCGTNONE 
J033089D21GGGTGGGCCCACGCGTNONE 
J033094P04GGGTGGGCCCACGCGTNONE 
J033103N02GGGTGGGCCCACGCGTNONE 
J033110J19GGGTGGGCCCACGCGTNONE 
J033114E17GGGTGGGCCCACGCGTNONE 
J033115K04GGGTGGGCCCACGCGTNONE 
J033119I06GGGTGGGCCCACGCGTNONE 
J033121L10GGGTGGGCCCACGCGTNONE 
J033123H14GGGTGGGCCCACGCGTNONE 
J033136H10GGGTGGGCCCACGCGTNONE 
J033139L07GGGTGGGCCCACGCGTNONE 
J033143G23GGGTGGGCCCACGCGTNONE 
J043021F16GGGTGGGCCCACGCGTNONE 
J080304G01GGGTGGGCCCACGCGTNONE 
J080305H24GGGTGGGCCCACGCGTNONE 
J080309B11GGGTGGGCCCACGCGTNONE 
J080315N09GGGTGGGCCCACGCGTNONE 
J080319J20GGGTGGGCCCACGCGTNONE 
J090014D01GGGTGGGCCCACGCGTNONE 
J090067F08GGGTGGGCCCACGCGTNONE 
J090079P18GGGTGGGCCCACGCGTNONE 
J090082K13GGGTGGGCCCACGCGTNONE 
J090093K17GGGTGGGCCCACGCGTNONE 
J090099G18GGGTGGGCCCACGCGTNONE 
J100022K14GGGTGGGCCCACGCGTNONE 
J100052G17GGGTGGGCCCACGCGTNONE 
Os01g0138500AK073435CCACGCGTProtein of unknown function DUF789 family protein. 
J023118K18CCACGCGTNONE 
J033039C22CCACGCGTNONE 
Os01g0139900AK121677CCACGCGTConserved hypothetical protein. 
J033069D19CCACGCGTNONE 
Os01g0172400AK065102ACGCGTGGTGGGNONE 
AK100365ACGCGTGGTGGGNONE 
AK119523ACGCGTGGTGGGNONE 
D73411ACGCGTGGTGGGPhospholipase D alpha 1 precursor (EC 3.1.4.4) (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1). 
J013001N03ACGCGTGGTGGGNONE 
J013052B12ACGCGTGGTGGGNONE 
J013071F15ACGCGTGGTGGGNONE 
J013108F19ACGCGTGGTGGGNONE 
J023025E17ACGCGTGGTGGGNONE 
J023083O10ACGCGTGGTGGGNONE 
J023084M17ACGCGTGGTGGGNONE 
J023100D16ACGCGTGGTGGGNONE 
J023107O10ACGCGTGGTGGGNONE 
J023119F08ACGCGTGGTGGGNONE 
J033035B07ACGCGTGGTGGGNONE 
J033052C18ACGCGTGGTGGGNONE 
J033092H11ACGCGTGGTGGGNONE 
J033096D02ACGCGTGGTGGGNONE 
J033117A16ACGCGTGGTGGGNONE 
J043010E08ACGCGTGGTGGGNONE 
J043013C12ACGCGTGGTGGGNONE 
J065001M15ACGCGTGGTGGGNONE 
J065021O11ACGCGTGGTGGGNONE 
J065089O20ACGCGTGGTGGGNONE 
J065117N05ACGCGTGGTGGGNONE 
J065129L11ACGCGTGGTGGGNONE 
J065170F18ACGCGTGGTGGGNONE 
J090066E11ACGCGTGGTGGGNONE 
J090076N24ACGCGTGGTGGGNONE 
J090093G21ACGCGTGGTGGGNONE 
J100041H17ACGCGTGGTGGGNONE 
J100050D07ACGCGTGGTGGGNONE 
J100063A06ACGCGTGGTGGGNONE 
Os01g0272600015-046-G06CCACGCGTNONE 
AK067786CCACGCGTConserved hypothetical protein. 
Os01g0363600014-029-H08GGACGCGTGGNONE 
AK063667GGACGCGTGGConserved hypothetical protein. 
Os01g0372100J075029A10ACGCGTGGConserved hypothetical protein. 
Os01g0389200006-065-G12CCACGCGTGGNONE 
006-091-F03CCACGCGTGGNONE 
AK061076CCACGCGTGGProtein of unknown function DUF679 family protein. 
J065034P08CCACGCGTGGNONE 
J065132P04CCACGCGTGGNONE 
J065214D12CCACGCGTGGNONE 
Os01g0391100012-001-B05CGCGACGCGTGGCCGAGACGTGGCNONE 
012-053-F01CGCGACGCGTGGCCGAGACGTGGCNONE 
AK063499CGCGACGCGTGGCCGAGACGTGGCNONE 
J065021A04CGCGACGCGTGGCCGAGACGTGGCNONE 
J065076H06CGCGACGCGTGGCCGAGACGTGGCNONE 
J065181E05CGCGACGCGTGGCCGAGACGTGGCNONE 
J065187A05CGCGACGCGTGGCCGAGACGTGGCNONE 
J075036C17CGCGACGCGTGGCCGAGACGTGGCNONE 
J075051C18CGCGACGCGTGGCCGAGACGTGGCNONE 
J075063L16CGCGACGCGTGGCCGAGACGTGGCNONE 
J075079M08CGCGACGCGTGGCCGAGACGTGGCNONE 
J075112H15CGCGACGCGTGGCCGAGACGTGGCNONE 
J075135F10CGCGACGCGTGGCCGAGACGTGGCNONE 
J075164H06CGCGACGCGTGGCCGAGACGTGGCNONE 
J075195N02CGCGACGCGTGGCCGAGACGTGGCNONE 
Os01g0633000006-075-A01ACGCGTGGGCCAGANONE 
009-064-A11ACGCGTGGGCCAGANONE 
009-153-F07ACGCGTGGGCCAGANONE 
AK062051ACGCGTGGGCCAGASimilar to 50S ribosomal protein L31. 
J013073B08ACGCGTGGGCCAGANONE 
J065006K19ACGCGTGGGCCAGANONE 
J065053P08ACGCGTGGGCCAGANONE 
J065057D08ACGCGTGGGCCAGANONE 
J065086P07ACGCGTGGGCCAGANONE 
J065095C14ACGCGTGGGCCAGANONE 
J065116B05ACGCGTGGGCCAGANONE 
J065164L20ACGCGTGGGCCAGANONE 
J065185K19ACGCGTGGGCCAGANONE 
J065191E21ACGCGTGGGCCAGANONE 
J065199P21ACGCGTGGGCCAGANONE 
J065216M12ACGCGTGGGCCAGANONE 
J075002M09ACGCGTGGGCCAGANONE 
J075016N10ACGCGTGGGCCAGANONE 
J075041K05ACGCGTGGGCCAGANONE 
J075094E04ACGCGTGGGCCAGANONE 
J075154O04ACGCGTGGGCCAGANONE 
J075176D22ACGCGTGGGCCAGANONE 
J075186M09ACGCGTGGGCCAGANONE 
J075191H20ACGCGTGGGCCAGANONE 
Os01g0644200014-007-H12CCACGCGTCCNONE 
AK063634CCACGCGTCCConserved hypothetical protein. 
AY549310CCACGCGTCCNONE 
J075068F10CCACGCGTCCNONE 
J075082A11CCACGCGTCCNONE 
Os01g0698300AK058744CCACGCGTNONE 
J090068O06CCACGCGTNONE 
Os01g0701900AK066793CGCGACGCGTGGSimilar to Phosphatidylinositol transfer-like protein III. 
Os01g0720700J033124M22GCCCACGCGTCCNONE 
J065006G21GCCCACGCGTCCNONE 
J065025M24GCCCACGCGTCCNONE 
J065041J02GCCCACGCGTCCNONE 
J065044B14GCCCACGCGTCCNONE 
J065061J06GCCCACGCGTCCNONE 
J065116L21GCCCACGCGTCCNONE 
J075030F18GCCCACGCGTCCNONE 
J075034K17GCCCACGCGTCCNONE 
J075063I02GCCCACGCGTCCNONE 
J075110D21GCCCACGCGTCCSimilar to Serine acetyltransferase. 
J075188L15GCCCACGCGTCCNONE 
J075197B17GCCCACGCGTCCNONE 
Os01g0761100AK122112CCCACGCGTTesmin/TSO1-like, CXC domain containing protein. 
Os01g0788900AK073287ACGCGTGGNONE 
Os01g0805800006-057-H04GGGGCCCACGCGTCATCCACCNONE 
006-106-H01GGGGCCCACGCGTCATCCACCNONE 
AK059963GGGGCCCACGCGTCATCCACCNONE 
AK103408GGGGCCCACGCGTCATCCACCRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0813400006-025-B06CCACGCGTGCGNONE 
006-030-C07CCACGCGTGCGNONE 
006-068-F06CCACGCGTGCGNONE 
006-096-E09CCACGCGTGCGNONE 
006-097-B11CCACGCGTGCGNONE 
006-104-H02CCACGCGTGCGNONE 
AK062251CCACGCGTGCGNONE 
AK065370CCACGCGTGCGSimilar to ADP-ribosylation factor 1. 
J013022G24CCACGCGTGCGNONE 
J013104C07CCACGCGTGCGNONE 
J023074M17CCACGCGTGCGNONE 
J043027C07CCACGCGTGCGNONE 
J065026K05CCACGCGTGCGNONE 
J065103I01CCACGCGTGCGNONE 
J090025M17CCACGCGTGCGNONE 
J100027L03CCACGCGTGCGNONE 
J100054I20CCACGCGTGCGNONE 
Os01g0838725J065088G05ACGCGTGGNONE 
J065135D24ACGCGTGGConserved hypothetical protein. 
Os01g0841000009-005-A12CACGCCACGCGTNONE 
AK059601CACGCCACGCGTENTH/VHS domain containing protein. 
AK103342CACGCCACGCGTNONE 
J023022C02CACGCCACGCGTNONE 
J023030C09CACGCCACGCGTNONE 
J033075D24CACGCCACGCGTNONE 
J033123O16CACGCCACGCGTNONE 
J033126C16CACGCCACGCGTNONE 
J065120M23CACGCCACGCGTNONE 
J065190I23CACGCCACGCGTNONE 
J090090G01CACGCCACGCGTNONE 
Os01g0846300AK065949CCACGCGTSimilar to Protein phosphatase 2C. 
Os01g0849600AK108159CCACGCGTSimilar to ENOD18 protein (Fragment). 
Os01g0871600AK103248CCACGCGTGCGTGF-beta receptor, type I/II extracellular region family protein. 
Os01g0885600AK059523GCCCCCACGCGTEsterase/lipase/thioesterase domain containing protein. 
J065013G01GCCCCCACGCGTNONE 
J065063D03GCCCCCACGCGTNONE 
J065143H01GCCCCCACGCGTNONE 
J065146F08GCCCCCACGCGTNONE 
J065153D14GCCCCCACGCGTNONE 
J065170E02GCCCCCACGCGTNONE 
J065175M22GCCCCCACGCGTNONE 
J065186E13GCCCCCACGCGTNONE 
J075023J16GCCCCCACGCGTNONE 
J075176J06GCCCCCACGCGTNONE 
Os01g0913300AK100698ACGCGTGGTGF-beta receptor, type I/II extracellular region family protein. 
J023030J07ACGCGTGGNONE 
J023102B09ACGCGTGGNONE 
J023102N03ACGCGTGGNONE 
J023114K11ACGCGTGGNONE 
J023140A21ACGCGTGGNONE 
J043017F23ACGCGTGGNONE 
J075058O15ACGCGTGGNONE 
Os01g0916000015-035-A02CCACGCGTNONE 
AK106300CCACGCGTConserved hypothetical protein. 
J100028B12CCACGCGTNONE 
J100035N14CCACGCGTNONE 
J100042J01CCACGCGTNONE 
J100045K22CCACGCGTNONE 
J100054P19CCACGCGTNONE 
J100063O03CCACGCGTNONE 
J100066I09CCACGCGTNONE 
J100066K05CCACGCGTNONE 
J100072B04CCACGCGTNONE 
J100073K11CCACGCGTNONE 
J100078J18CCACGCGTNONE 
J100079L10CCACGCGTNONE 
J100080P17CCACGCGTNONE 
J100081E17CCACGCGTNONE 
J100085J05CCACGCGTNONE 
J100087N20CCACGCGTNONE 
Os02g0121100012-035-F06CGGGCCCACGCGTNONE 
013-031-H05CGGGCCCACGCGTNONE 
013-058-E11CGGGCCCACGCGTNONE 
014-010-D01CGGGCCCACGCGTNONE 
AK070711CGGGCCCACGCGTConserved hypothetical protein. 
AK119758CGGGCCCACGCGTNONE 
J013033G12CGGGCCCACGCGTNONE 
J023007M16CGGGCCCACGCGTNONE 
J023020K20CGGGCCCACGCGTNONE 
J023061H10CGGGCCCACGCGTNONE 
J033027H20CGGGCCCACGCGTNONE 
J033051E18CGGGCCCACGCGTNONE 
J090005F12CGGGCCCACGCGTNONE 
J090017A20CGGGCCCACGCGTNONE 
J090018G11CGGGCCCACGCGTNONE 
J090062C18CGGGCCCACGCGTNONE 
J100027N10CGGGCCCACGCGTNONE 
J100032L14CGGGCCCACGCGTNONE 
J100045C14CGGGCCCACGCGTNONE 
J100061M09CGGGCCCACGCGTNONE 
J100062K11CGGGCCCACGCGTNONE 
J100064H11CGGGCCCACGCGTNONE 
J100074H16CGGGCCCACGCGTNONE 
J100082N01CGGGCCCACGCGTNONE 
Os02g0288200AK073147CCCGGCCCCACGCGTNONE 
AK102886CCCGGCCCCACGCGTConserved hypothetical protein. 
Os02g0498650J075129C20ACGCGTGGConserved hypothetical protein. 
J090063B16ACGCGTGGNONE 
J090081H04ACGCGTGGNONE 
J090087C03ACGCGTGGNONE 
Os02g0509600AK111075CCACGCGTCCConserved hypothetical protein. 
J065033B09CCACGCGTCCNONE 
J065069L04CCACGCGTCCNONE 
J065089H14CCACGCGTCCNONE 
J065119J16CCACGCGTCCNONE 
J065142J22CCACGCGTCCNONE 
J065168B14CCACGCGTCCNONE 
J065203L03CCACGCGTCCNONE 
J075044C18CCACGCGTCCNONE 
J075068D13CCACGCGTCCNONE 
J075152O09CCACGCGTCCNONE 
Os02g0562700006-035-C05ACGCGTGGNONE 
AB110167ACGCGTGGNONE 
AK071800ACGCGTGGSimilar to Gamma hydroxybutyrate dehydrogenase (EC 1.1.1.61). 
AK104168ACGCGTGGNONE 
AK109435ACGCGTGGNONE 
AY224558ACGCGTGGNONE 
J023013M13ACGCGTGGNONE 
J023059I08ACGCGTGGNONE 
J023084C06ACGCGTGGNONE 
J023114G06ACGCGTGGNONE 
J023142A09ACGCGTGGNONE 
J033026E14ACGCGTGGNONE 
J053042M10ACGCGTGGNONE 
J053082K21ACGCGTGGNONE 
J065105J15ACGCGTGGNONE 
J065150F02ACGCGTGGNONE 
J075177H05ACGCGTGGNONE 
J080040B16ACGCGTGGNONE 
J090077J10ACGCGTGGNONE 
Os02g0574600AK059246CCACGCGTGCCCCACCConserved hypothetical protein. 
Os02g0609000AK062391ACGCGTGGConserved hypothetical protein. 
Os02g0613200AK064869GGACGCGTGGNONE 
AK065051GGACGCGTGGNONE 
AK098853GGACGCGTGGConserved hypothetical protein. 
AK098974GGACGCGTGGNONE 
J013000H15GGACGCGTGGNONE 
J013001I18GGACGCGTGGNONE 
J013022I18GGACGCGTGGNONE 
J013025D06GGACGCGTGGNONE 
J013037H17GGACGCGTGGNONE 
J013043F22GGACGCGTGGNONE 
J013075E01GGACGCGTGGNONE 
J013088D09GGACGCGTGGNONE 
J013088E19GGACGCGTGGNONE 
J013102O18GGACGCGTGGNONE 
J013110C08GGACGCGTGGNONE 
J013118C06GGACGCGTGGNONE 
J013119F22GGACGCGTGGNONE 
J013128K14GGACGCGTGGNONE 
J013158C17GGACGCGTGGNONE 
J023013P15GGACGCGTGGNONE 
J023044L21GGACGCGTGGNONE 
J033023I04GGACGCGTGGNONE 
J033038I22GGACGCGTGGNONE 
J033095M02GGACGCGTGGNONE 
J043022F05GGACGCGTGGNONE 
J080307N20GGACGCGTGGNONE 
J080315C02GGACGCGTGGNONE 
J080316A15GGACGCGTGGNONE 
J080316G03GGACGCGTGGNONE 
J090029E24GGACGCGTGGNONE 
J090031H15GGACGCGTGGNONE 
J090034F13GGACGCGTGGNONE 
J090047G02GGACGCGTGGNONE 
J090069M24GGACGCGTGGNONE 
J100052E15GGACGCGTGGNONE 
Os02g0626100003-107-B06CAGGTGGGCCACGCGTCGCGNONE 
AK120127CAGGTGGGCCACGCGTCGCGNONE 
Os02g0628600J100044L04CCACGCGTTranscriptional factor B3 family protein. 
Os02g0649300014-043-A05GGTGGGGCCCACGCGTNONE 
AK063685GGTGGGGCCCACGCGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0668500006-056-A05GCCCACGCGTCCNONE 
AK060958GCCCACGCGTCCNONE 
AK071867GCCCACGCGTCCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15GCCCACGCGTCCNONE 
J065013J03GCCCACGCGTCCNONE 
J065021P16GCCCACGCGTCCNONE 
J065044B07GCCCACGCGTCCNONE 
J065059E23GCCCACGCGTCCNONE 
J065087N20GCCCACGCGTCCNONE 
J065185I04GCCCACGCGTCCNONE 
J065190G19GCCCACGCGTCCNONE 
J065199C15GCCCACGCGTCCNONE 
J065213L12GCCCACGCGTCCNONE 
J080305C01GCCCACGCGTCCNONE 
J080308C07GCCCACGCGTCCNONE 
J080310F02GCCCACGCGTCCNONE 
Os02g0670400009-189-H11CCCACGCGTCGCNONE 
AB079636CCCACGCGTCGCSimilar to HMGc1 protein. 
J090001B08CCCACGCGTCGCNONE 
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0730300AK098897ACCCCCCACGCGTCCNONE 
AK111629ACCCCCCACGCGTCCSimilar to Potassium transporter HAK3p (Fragment). 
Os02g0733300AK101108CCACGCGTSimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4). 
AK105446CCACGCGTNONE 
Os03g0124300AK069148ACGCGTGGGCCCCACCConserved hypothetical protein. 
AK106076ACGCGTGGGCCCCACCNONE 
J023003G19ACGCGTGGGCCCCACCNONE 
Os03g0136900AK067183GCCCACCACGCGTCTCSimilar to Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase). 
Os03g0141200AK068968AGCCCACGCGTCGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092AGCCCACGCGTCGCGNONE 
J023003L18AGCCCACGCGTCGCGNONE 
J023022K18AGCCCACGCGTCGCGNONE 
J023107H13AGCCCACGCGTCGCGNONE 
J023107K02AGCCCACGCGTCGCGNONE 
Os03g0160200AK064836CCCACCACGCGTCCConserved hypothetical protein. 
AK071081CCCACCACGCGTCCNONE 
AK100712CCCACCACGCGTCCNONE 
AK104859CCCACCACGCGTCCNONE 
J013000F21CCCACCACGCGTCCNONE 
J013024G05CCCACCACGCGTCCNONE 
J013035E12CCCACCACGCGTCCNONE 
J013041A17CCCACCACGCGTCCNONE 
J013045D10CCCACCACGCGTCCNONE 
J013045F04CCCACCACGCGTCCNONE 
J013046F04CCCACCACGCGTCCNONE 
J013047F10CCCACCACGCGTCCNONE 
J013051E10CCCACCACGCGTCCNONE 
J013059J07CCCACCACGCGTCCNONE 
J013059O17CCCACCACGCGTCCNONE 
J013060A20CCCACCACGCGTCCNONE 
J013063J23CCCACCACGCGTCCNONE 
J013066D19CCCACCACGCGTCCNONE 
J013069O08CCCACCACGCGTCCNONE 
J013088K24CCCACCACGCGTCCNONE 
J013098G04CCCACCACGCGTCCNONE 
J013100I15CCCACCACGCGTCCNONE 
J013102E18CCCACCACGCGTCCNONE 
J013102O09CCCACCACGCGTCCNONE 
J013119M18CCCACCACGCGTCCNONE 
J013123I19CCCACCACGCGTCCNONE 
J013146H15CCCACCACGCGTCCNONE 
J013149A14CCCACCACGCGTCCNONE 
J023003A05CCCACCACGCGTCCNONE 
J023013O19CCCACCACGCGTCCNONE 
J023044M05CCCACCACGCGTCCNONE 
J023048O03CCCACCACGCGTCCNONE 
J023049L17CCCACCACGCGTCCNONE 
J023060D22CCCACCACGCGTCCNONE 
J023060F20CCCACCACGCGTCCNONE 
J023069G09CCCACCACGCGTCCNONE 
J023086E11CCCACCACGCGTCCNONE 
J023091I09CCCACCACGCGTCCNONE 
J023091M19CCCACCACGCGTCCNONE 
J023101D06CCCACCACGCGTCCNONE 
J023109B03CCCACCACGCGTCCNONE 
J023113B14CCCACCACGCGTCCNONE 
J023114B19CCCACCACGCGTCCNONE 
J023115H16CCCACCACGCGTCCNONE 
J023134F22CCCACCACGCGTCCNONE 
J023139I06CCCACCACGCGTCCNONE 
J023150C02CCCACCACGCGTCCNONE 
J033033A14CCCACCACGCGTCCNONE 
J033058O11CCCACCACGCGTCCNONE 
J033060H13CCCACCACGCGTCCNONE 
J033075P14CCCACCACGCGTCCNONE 
J033084O05CCCACCACGCGTCCNONE 
J033087G04CCCACCACGCGTCCNONE 
J033092E18CCCACCACGCGTCCNONE 
J033101G23CCCACCACGCGTCCNONE 
J033112I05CCCACCACGCGTCCNONE 
J033118E14CCCACCACGCGTCCNONE 
J033118P04CCCACCACGCGTCCNONE 
J033123C07CCCACCACGCGTCCNONE 
J043003C01CCCACCACGCGTCCNONE 
J043024B21CCCACCACGCGTCCNONE 
J043030N04CCCACCACGCGTCCNONE 
J043039J02CCCACCACGCGTCCNONE 
J043039N08CCCACCACGCGTCCNONE 
J075006N21CCCACCACGCGTCCNONE 
J075008A16CCCACCACGCGTCCNONE 
J075018J16CCCACCACGCGTCCNONE 
J075023G04CCCACCACGCGTCCNONE 
J075134F18CCCACCACGCGTCCNONE 
J075181B05CCCACCACGCGTCCNONE 
J090014O14CCCACCACGCGTCCNONE 
J090020H22CCCACCACGCGTCCNONE 
J090022G17CCCACCACGCGTCCNONE 
J090023J24CCCACCACGCGTCCNONE 
J090033H01CCCACCACGCGTCCNONE 
J090038A03CCCACCACGCGTCCNONE 
J090041O22CCCACCACGCGTCCNONE 
J090049E10CCCACCACGCGTCCNONE 
J090063E24CCCACCACGCGTCCNONE 
J090080N12CCCACCACGCGTCCNONE 
J100021G23CCCACCACGCGTCCNONE 
J100028P06CCCACCACGCGTCCNONE 
J100060L21CCCACCACGCGTCCNONE 
J100077D16CCCACCACGCGTCCNONE 
J100088I09CCCACCACGCGTCCNONE 
Os03g0168100012-058-G09CCACGCGTCCNONE 
014-008-F07CCACGCGTCCNONE 
015-084-D03CCACGCGTCCNONE 
AK121575CCACGCGTCCLate embryogenesis abundant protein repeat containing protein. 
J033024H14CCACGCGTCCNONE 
J033036H02CCACGCGTCCNONE 
J033044I19CCACGCGTCCNONE 
J033098F11CCACGCGTCCNONE 
J033125I22CCACGCGTCCNONE 
J033128N18CCACGCGTCCNONE 
J033132L19CCACGCGTCCNONE 
J033149G13CCACGCGTCCNONE 
J075052I19CCACGCGTCCNONE 
J075099H16CCACGCGTCCNONE 
J075099P11CCACGCGTCCNONE 
J075122I20CCACGCGTCCNONE 
J075172K14CCACGCGTCCNONE 
J075188H01CCACGCGTCCNONE 
Os03g0214200AK100623CCACGCGTProtein of unknown function DUF1675 family protein. 
J075053B18CCACGCGTNONE 
Os03g0216900AK073615ACGCGTGGPrefoldin domain containing protein. 
Os03g0277000AK100522CCACGCGTCGCGCGCSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0278300016-006-D06CCACGCGTNONE 
AK060280CCACGCGTNONE 
AK064165CCACGCGTSimilar to ALY protein. 
AK071965CCACGCGTNONE 
AK072759CCACGCGTNONE 
AK100762CCACGCGTNONE 
AK119667CCACGCGTNONE 
J090024H18CCACGCGTNONE 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0316200009-196-H10CCACGCGTNONE 
013-011-H03CCACGCGTNONE 
014-031-F04CCACGCGTNONE 
014-083-C08CCACGCGTNONE 
AK071812CCACGCGTSimilar to Galactinol synthase (Fragment). 
AK103958CCACGCGTNONE 
J023054E12CCACGCGTNONE 
J023075G21CCACGCGTNONE 
J023113D08CCACGCGTNONE 
J065067M09CCACGCGTNONE 
J065102E07CCACGCGTNONE 
J065103M07CCACGCGTNONE 
Os03g0327600014-081-C01CCACGCGTNONE 
AK069815CCACGCGTRicin B-related lectin domain containing protein. 
X95402CCACGCGTNONE 
Os03g0335300AK098846ACACGTGGACCACGCGTNONE 
AK098891ACACGTGGACCACGCGTNONE 
AK111509ACACGTGGACCACGCGTSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847ACACGTGGACCACGCGTNONE 
AK121413ACACGTGGACCACGCGTNONE 
Os03g0340700011-070-H05ACGCGTGGNONE 
AK100470ACGCGTGGTetratricopeptide-like helical domain containing protein. 
J013158I08ACGCGTGGNONE 
J023009H24ACGCGTGGNONE 
J023031L20ACGCGTGGNONE 
J023093E24ACGCGTGGNONE 
J023105J11ACGCGTGGNONE 
J100059O05ACGCGTGGNONE 
J100075G03ACGCGTGGNONE 
J100086J06ACGCGTGGNONE 
Os03g0397400AB112772CCCACGCGTNONE 
AK069928CCCACGCGTSimilar to Low affinity calcium transporter CAX2 (Fragment). 
J023014O18CCCACGCGTNONE 
J023036P06CCCACGCGTNONE 
J023145E24CCCACGCGTNONE 
J033142I11CCCACGCGTNONE 
J043003A10CCCACGCGTNONE 
J075023H21CCCACGCGTNONE 
J075145O10CCCACGCGTNONE 
J075149A03CCCACGCGTNONE 
J090099B09CCCACGCGTNONE 
J100017L14CCCACGCGTNONE 
J100050K18CCCACGCGTNONE 
J100063P16CCCACGCGTNONE 
Os03g0418600AK122114ACGCGTGGConserved hypothetical protein. 
J033128A11ACGCGTGGNONE 
Os03g0439700AK065720CCACGCGTProtein of unknown function DUF1230 family protein. 
J013041G12CCACGCGTNONE 
J065030N09CCACGCGTNONE 
J065084A03CCACGCGTNONE 
J065167B14CCACGCGTNONE 
J100025F06CCACGCGTNONE 
J100032J16CCACGCGTNONE 
J100040L01CCACGCGTNONE 
J100074M13CCACGCGTNONE 
Os03g0561249J065016H04CGCGACGCGTGGConserved hypothetical protein. 
Os03g0623100014-072-D06CCACGCGTNONE 
014-072-D06CCACGCGTGCGNONE 
014-072-G11CCACGCGTNONE 
014-072-G11CCACGCGTGCGNONE 
AK063716CCACGCGTConserved hypothetical protein. 
AK063716CCACGCGTGCGConserved hypothetical protein. 
J065136O20CCACGCGTNONE 
J065136O20CCACGCGTGCGNONE 
J075030G11CCACGCGTNONE 
J075030G11CCACGCGTGCGNONE 
J075034O21CCACGCGTNONE 
J075034O21CCACGCGTGCGNONE 
J075051D07CCACGCGTNONE 
J075051D07CCACGCGTGCGNONE 
J075066M05CCACGCGTNONE 
J075066M05CCACGCGTGCGNONE 
J075095G15CCACGCGTNONE 
J075095G15CCACGCGTGCGNONE 
Os03g0643100AK106587GCCCACGCGTGCGHomeodomain-like containing protein. 
Os03g0650400016-019-C03ACGCGTGGGNONE 
AK064367ACGCGTGGGNONE 
AK101644ACGCGTGGGConserved hypothetical protein. 
J033055N07ACGCGTGGGNONE 
J075172F12ACGCGTGGGNONE 
J090026P03ACGCGTGGGNONE 
J090031K19ACGCGTGGGNONE 
Os03g0699300AK120407CCACGCGTSimilar to Adenylosuccinate synthetase, chloroplast precursor (EC 6.3.4.4) (IMP-- aspartate ligase) (AdSS) (AMPSase). 
Os03g0739700003-104-A04CCACGCGTNONE 
AK062272CCACGCGTUncharacterized protein UPF0114 family protein. 
Os03g0784400AK103474GGACGCGTGGGProtein of unknown function DUF1692 domain containing protein. 
J023135I15GGACGCGTGGGNONE 
J033130D12GGACGCGTGGGNONE 
J043035E20GGACGCGTGGGNONE 
J065206K15GGACGCGTGGGNONE 
J075053J20GGACGCGTGGGNONE 
J075129B11GGACGCGTGGGNONE 
J090003E22GGACGCGTGGGNONE 
J100023E23GGACGCGTGGGNONE 
Os03g0803800012-043-D10CCACGCGTNONE 
AK063484CCACGCGTConserved hypothetical protein. 
Os03g0854800J090007D13CACACACCACGCGTCCNONE 
J090085N22CACACACCACGCGTCCNONE 
Os04g0128700AK107172ACGCGTGGGThioredoxin-like fold domain containing protein. 
J065102M16ACGCGTGGGNONE 
J065124K01ACGCGTGGGNONE 
J065129I12ACGCGTGGGNONE 
J065192C08ACGCGTGGGNONE 
Os04g0259800AK111548ACGCGTGGConserved hypothetical protein. 
Os04g0275966J065015F20ACGCGTGGConserved hypothetical protein. 
J065118M18ACGCGTGGNONE 
Os04g0313300AK121730ACGCGTGGConserved hypothetical protein. 
J033082F07ACGCGTGGNONE 
Os04g0319800J065187N03GCCCCACGCGTSimilar to Cytokinin-O-glucosyltransferase 2 (EC 2.4.1.-) (Zeatin O- glucosyltransferase 2). 
Os04g0434400014-079-B10CCACGCGTNONE 
014-079-B10GCCCACGCGTNONE 
AK063725CCACGCGTConserved hypothetical protein. 
AK063725GCCCACGCGTConserved hypothetical protein. 
Os04g0462200AK106790CCACGCGTPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
Os04g0482900AK100146ACGCGTGGConserved hypothetical protein. 
J065167L22ACGCGTGGNONE 
J065203J02ACGCGTGGNONE 
J075162M08ACGCGTGGNONE 
J080302C10ACGCGTGGNONE 
J080303F07ACGCGTGGNONE 
J080311E16ACGCGTGGNONE 
J080311N07ACGCGTGGNONE 
J080317N13ACGCGTGGNONE 
Os04g0483200AK069389CCACGCGTSteroid nuclear receptor, ligand-binding domain containing protein. 
AK121909CCACGCGTNONE 
J043031E24CCACGCGTNONE 
J043032N20CCACGCGTNONE 
J090078C11CCACGCGTNONE 
Os04g0552300006-074-A08CCACGCGTCTCNONE 
AK061100CCACGCGTCTCNegative regulatory factor PREG family protein. 
Os04g0604900AK059203CCACGCGTSimilar to Xyloglucan endotransglycosylase (Fragment). 
Os04g0607600AK109852GGACGCGTGGNONE 
AK120889GGACGCGTGGCation transporter family protein. 
Os04g0631200013-003-B06ACGCGTGGGTCCCNONE 
AK059277ACGCGTGGGTCCCSimilar to Xyloglucan endotransglycosylase (Fragment). 
AK099331ACGCGTGGGTCCCNONE 
J033024P08ACGCGTGGGTCCCNONE 
J033041G02ACGCGTGGGTCCCNONE 
J053075H12ACGCGTGGGTCCCNONE 
J065016B13ACGCGTGGGTCCCNONE 
J090075B22ACGCGTGGGTCCCNONE 
J100084K17ACGCGTGGGTCCCNONE 
Os04g0659400AK070174ACGCGTGGGENT domain containing protein. 
Os04g0678200006-037-E05GGGGCCCACGCGTNONE 
006-059-G04GGGGCCCACGCGTNONE 
006-097-A11GGGGCCCACGCGTNONE 
006-098-D11GGGGCCCACGCGTNONE 
009-154-H11GGGGCCCACGCGTNONE 
AK106193GGGGCCCACGCGTProtein of unknown function DUF1218 family protein. 
J013064K07GGGGCCCACGCGTNONE 
Os04g0685800AK070891GGCCGAAACGCGTGGSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345GGCCGAAACGCGTGGNONE 
J023069G19GGCCGAAACGCGTGGNONE 
J023097E09GGCCGAAACGCGTGGNONE 
J065071A01GGCCGAAACGCGTGGNONE 
J065186F08GGCCGAAACGCGTGGNONE 
J075044B21GGCCGAAACGCGTGGNONE 
J075120N18GGCCGAAACGCGTGGNONE 
J075131B22GGCCGAAACGCGTGGNONE 
J100041H18GGCCGAAACGCGTGGNONE 
J100042P13GGCCGAAACGCGTGGNONE 
Os05g0102500009-183-E08GGTCCCACGCGTNONE 
AK063894GGTCCCACGCGTNONE 
AK073341GGTCCCACGCGTConserved hypothetical protein. 
J023022C11GGTCCCACGCGTNONE 
J065095B14GGTCCCACGCGTNONE 
J065130O12GGTCCCACGCGTNONE 
J065142P07GGTCCCACGCGTNONE 
J065155L18GGTCCCACGCGTNONE 
Os05g0111200009-033-A06ACGCGTGGGCCACNONE 
AK101693ACGCGTGGGCCACSimilar to Amino acid selective channel protein. 
J065006E13ACGCGTGGGCCACNONE 
J075001D12ACGCGTGGGCCACNONE 
J075005J18ACGCGTGGGCCACNONE 
J075009L08ACGCGTGGGCCACNONE 
J075012M21ACGCGTGGGCCACNONE 
J075019K17ACGCGTGGGCCACNONE 
J075020D07ACGCGTGGGCCACNONE 
J075041D11ACGCGTGGGCCACNONE 
J075051C03ACGCGTGGGCCACNONE 
J075060C05ACGCGTGGGCCACNONE 
J075079N09ACGCGTGGGCCACNONE 
J075094B04ACGCGTGGGCCACNONE 
J075108E08ACGCGTGGGCCACNONE 
J075115G05ACGCGTGGGCCACNONE 
J075147L21ACGCGTGGGCCACNONE 
J075161G12ACGCGTGGGCCACNONE 
J075168J11ACGCGTGGGCCACNONE 
J075168L11ACGCGTGGGCCACNONE 
J075174F22ACGCGTGGGCCACNONE 
Os05g0116000AK058320CCCACGCGTNONE 
AK121775CCCACGCGT11-S plant seed storage protein family protein. 
J023003L12CCCACGCGTNONE 
J023025C18CCCACGCGTNONE 
J023074E20CCCACGCGTNONE 
J023128H09CCCACGCGTNONE 
J033092N18CCCACGCGTNONE 
J065009J09CCCACGCGTNONE 
J090073L21CCCACGCGTNONE 
Os05g0121800AK101222CCCACGCGTGGGCCCTConserved hypothetical protein. 
J033031D02CCCACGCGTGGGCCCTNONE 
J065078F10CCCACGCGTGGGCCCTNONE 
J065151J16CCCACGCGTGGGCCCTNONE 
J065151K04CCCACGCGTGGGCCCTNONE 
J090057E18CCCACGCGTGGGCCCTNONE 
Os05g0127300AK106429CCACGCGTCTCNONE 
AK121766CCACGCGTCTCRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J065021F23CCACGCGTCTCNONE 
J100041J04CCACGCGTCTCNONE 
Os05g0130300AK121958CCACGCGTConserved hypothetical protein. 
J033107M24CCACGCGTNONE 
Os05g0130500AK121598ACGCGTGGConserved hypothetical protein. 
Os05g0140800AK110652ACGCGTGGSimilar to Dormancy related protein (Fragment). 
J075019K14ACGCGTGGNONE 
J075020O11ACGCGTGGNONE 
J075028P06ACGCGTGGNONE 
J075050A16ACGCGTGGNONE 
J075051F18ACGCGTGGNONE 
J075085K03ACGCGTGGNONE 
J075112P22ACGCGTGGNONE 
J075118I09ACGCGTGGNONE 
J075144H09ACGCGTGGNONE 
J075166I07ACGCGTGGNONE 
J075191J02ACGCGTGGNONE 
J075195I23ACGCGTGGNONE 
Os05g0190500004-013-C07CCACGCGTNONE 
009-077-A01CCACGCGTNONE 
009-158-G03CCACGCGTNONE 
009-186-C08CCACGCGTNONE 
AK060968CCACGCGTNONE 
AK104246CCACGCGTNONE 
AK104460CCACGCGTNONE 
AK104519CCACGCGTNONE 
AK109335CCACGCGTSimilar to Acid phosphatase. 
Os05g0291700AK073234CATCCCCCACGCGTNONE 
AK099865CATCCCCCACGCGTConserved hypothetical protein. 
AK108453CATCCCCCACGCGTNONE 
Os05g0323900006-105-F01CCCACGCGTCCNONE 
009-161-D06CCCACGCGTCCNONE 
AK070528CCCACGCGTCCManganese-superoxide dismutase precursor (EC 1.15.1.1). 
AK104030CCCACGCGTCCNONE 
AK104160CCCACGCGTCCNONE 
AK119904CCCACGCGTCCNONE 
J023060D13CCCACGCGTCCNONE 
J033057E10CCCACGCGTCCNONE 
J043034F19CCCACGCGTCCNONE 
J053099K12CCCACGCGTCCNONE 
J065022N03CCCACGCGTCCNONE 
J065035G13CCCACGCGTCCNONE 
J065059M24CCCACGCGTCCNONE 
J065059N23CCCACGCGTCCNONE 
J065073I02CCCACGCGTCCNONE 
J065095L15CCCACGCGTCCNONE 
J065104I24CCCACGCGTCCNONE 
J065104J24CCCACGCGTCCNONE 
J065112L13CCCACGCGTCCNONE 
J065114J24CCCACGCGTCCNONE 
J065120J16CCCACGCGTCCNONE 
J065141I09CCCACGCGTCCNONE 
J065165E17CCCACGCGTCCNONE 
J065170C14CCCACGCGTCCNONE 
J065182I05CCCACGCGTCCNONE 
J065191K20CCCACGCGTCCNONE 
J065205L14CCCACGCGTCCNONE 
J075017M10CCCACGCGTCCNONE 
J075019O04CCCACGCGTCCNONE 
J075019O15CCCACGCGTCCNONE 
J075032E07CCCACGCGTCCNONE 
J075042D13CCCACGCGTCCNONE 
J075054J07CCCACGCGTCCNONE 
J075089O11CCCACGCGTCCNONE 
J075104G09CCCACGCGTCCNONE 
J075150N03CCCACGCGTCCNONE 
J075187A09CCCACGCGTCCNONE 
J075187D04CCCACGCGTCCNONE 
J090006G06CCCACGCGTCCNONE 
J090045C09CCCACGCGTCCNONE 
J090083D13CCCACGCGTCCNONE 
J090084B13CCCACGCGTCCNONE 
J100021H22CCCACGCGTCCNONE 
J100034A15CCCACGCGTCCNONE 
J100041N15CCCACGCGTCCNONE 
J100042D05CCCACGCGTCCNONE 
J100042D08CCCACGCGTCCNONE 
J100059P21CCCACGCGTCCNONE 
L19436CCCACGCGTCCNONE 
L34038CCCACGCGTCCNONE 
Os05g0357850J065118C17CCACGCGTCCHypothetical protein. 
J065159C03CCACGCGTCCNONE 
Os05g0380900AK067214CCACGCGTSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2). 
AK099962CCACGCGTNONE 
J065083M07CCACGCGTNONE 
Os05g0405900AK072244CCACGCGTWD40-like domain containing protein. 
Os05g0534100Os05g0534100CCACGCGTCCAcid phosphatase/vanadium-dependent haloperoxidase related family protein. 
Os05g0587000Os05g0587000CCACGCGTVirulence factor, pectin lyase fold family protein. 
Os06g0125500AK067671CCACGCGTNONE 
Os06g0134800014-049-H04CGCCACGTCTCTCCCCCACGCGTNONE 
AK063692CGCCACGTCTCTCCCCCACGCGTGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0141600006-035-C07GGACGCGTGGNONE 
AK059772GGACGCGTGGEarly nodulin 93 ENOD93 protein family protein. 
J075028K13GGACGCGTGGNONE 
J075070B17GGACGCGTGGNONE 
J075075G08GGACGCGTGGNONE 
J075081B21GGACGCGTGGNONE 
J075116B04GGACGCGTGGNONE 
J075133E10GGACGCGTGGNONE 
J075144I23GGACGCGTGGNONE 
J075147G16GGACGCGTGGNONE 
J075151E04GGACGCGTGGNONE 
J075162E07GGACGCGTGGNONE 
J075163P14GGACGCGTGGNONE 
J075182C07GGACGCGTGGNONE 
J075196O22GGACGCGTGGNONE 
J100086C12GGACGCGTGGNONE 
Os06g0142200AB018376GGACGCGTGGEarly nodulin. 
AK105832GGACGCGTGGNONE 
AK122162GGACGCGTGGNONE 
J033057P14GGACGCGTGGNONE 
J033147G13GGACGCGTGGNONE 
J043012H17GGACGCGTGGNONE 
J065065E18GGACGCGTGGNONE 
J065099L01GGACGCGTGGNONE 
J065119D03GGACGCGTGGNONE 
J065134O21GGACGCGTGGNONE 
J065160G17GGACGCGTGGNONE 
J065201C04GGACGCGTGGNONE 
J090056D21GGACGCGTGGNONE 
Os06g0147000AK120978GGGAAAGCCACGCGTConserved hypothetical protein. 
J023041N20GGGAAAGCCACGCGTNONE 
Os06g0152200AB001886GCCCACGCGTCCNONE 
AK072231GCCCACGCGTCCZinc-finger protein R2931. 
AK104083GCCCACGCGTCCNONE 
J065077H19GCCCACGCGTCCNONE 
J065208H22GCCCACGCGTCCNONE 
J100032H08GCCCACGCGTCCNONE 
Os06g0168600AK068858ACGCGTGGGGGSimilar to Ribonucleotide reductase. 
Os06g0246600AK107692CCAGGCCCCACGCGTSimilar to Glutamate receptor 3.3 precursor (Ligand-gated ion channel 3.3). 
Os06g0265000AK100247CCCACGCGTCTCSimilar to Asparagine synthetase. 
D83378CCCACGCGTCTCNONE 
J013033O15CCCACGCGTCTCNONE 
J013037K20CCCACGCGTCTCNONE 
J013058I07CCCACGCGTCTCNONE 
J033125M21CCCACGCGTCTCNONE 
J033142B02CCCACGCGTCTCNONE 
J043030E23CCCACGCGTCTCNONE 
J043034K11CCCACGCGTCTCNONE 
J053050B10CCCACGCGTCTCNONE 
J053061I09CCCACGCGTCTCNONE 
J053068F17CCCACGCGTCTCNONE 
J053074G11CCCACGCGTCTCNONE 
J053095N11CCCACGCGTCTCNONE 
J090028M17CCCACGCGTCTCNONE 
J090031O08CCCACGCGTCTCNONE 
J090094C22CCCACGCGTCTCNONE 
J100045M24CCCACGCGTCTCNONE 
J100055P03CCCACGCGTCTCNONE 
J100073O10CCCACGCGTCTCNONE 
J100081K21CCCACGCGTCTCNONE 
U55873CCCACGCGTCTCNONE 
Os06g0286351AK121119GGCCCCACGCGTArmadillo-like helical domain containing protein. 
Os06g0307900AK119309GCGACGCGTGGProtein of unknown function DUF1618 domain containing protein. 
AK120750GCGACGCGTGGNONE 
J023004O19GCGACGCGTGGNONE 
J033022G01GCGACGCGTGGNONE 
Os06g0326400AK065052ACGCGTGGNONE 
AK121116ACGCGTGGPyrophosphate-dependent phosphofructokinase PfpB family protein. 
J013107E23ACGCGTGGNONE 
J013129K13ACGCGTGGNONE 
J023010F22ACGCGTGGNONE 
J023120K19ACGCGTGGNONE 
Os06g0353700J065177D24ACGCGTGGConserved hypothetical protein. 
Os06g0502900AK103578CCACGCGTConserved hypothetical protein. 
AK120599CCACGCGTNONE 
J033132P14CCACGCGTNONE 
Os06g0595900AK066655CACGCCACGCGTGCGTranscription elongation factor S-II, central region domain containing protein. 
J075022F02CACGCCACGCGTGCGNONE 
J075055H13CACGCCACGCGTGCGNONE 
J075188H14CACGCCACGCGTGCGNONE 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0698748004-013-F09CCACGCGTCGCNONE 
006-099-E12CCACGCGTCGCNONE 
009-074-D06CCACGCGTCGCNONE 
009-081-C02CCACGCGTCGCNONE 
013-065-B10CCACGCGTCGCNONE 
AK100361CCACGCGTCGCConserved hypothetical protein. 
AK105781CCACGCGTCGCNONE 
J013088K23CCACGCGTCGCNONE 
J013158L05CCACGCGTCGCNONE 
J023083M02CCACGCGTCGCNONE 
J075034E21CCACGCGTCGCNONE 
J075049F24CCACGCGTCGCNONE 
J075055A21CCACGCGTCGCNONE 
J100044A04CCACGCGTCGCNONE 
J100058I01CCACGCGTCGCNONE 
Os07g0124100014-015-G11ACGCGTGGNONE 
AJ276693ACGCGTGGPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647ACGCGTGGNONE 
Os07g0173200AK061624CCACGCGTCGCFrigida-like family protein. 
AK065275CCACGCGTCGCNONE 
AK098856CCACGCGTCGCNONE 
AK098899CCACGCGTCGCNONE 
Os07g0185900009-023-G07CCACGCGTNONE 
009-105-E06CCACGCGTNONE 
009-125-B01CCACGCGTNONE 
009-169-A01CCACGCGTNONE 
AK070315CCACGCGTConserved hypothetical protein. 
J065140H13CCACGCGTNONE 
J100024L12CCACGCGTNONE 
Os07g0223100006-044-G07CCCACGCGTCCCACCNONE 
006-071-E10CCCACGCGTCCCACCNONE 
006-077-A04CCCACGCGTCCCACCNONE 
009-162-H05CCCACGCGTCCCACCNONE 
J023050M10CCCACGCGTCCCACCNONE 
J023055F05CCCACGCGTCCCACCNONE 
J023060I11CCCACGCGTCCCACCNONE 
J023101M01CCCACGCGTCCCACCNONE 
J065059J21CCCACGCGTCCCACCNONE 
J065087I18CCCACGCGTCCCACCNONE 
J065113L17CCCACGCGTCCCACCNONE 
J065123E19CCCACGCGTCCCACCNONE 
J065137O04CCCACGCGTCCCACCNONE 
J065217M03CCCACGCGTCCCACCNONE 
J090012O14CCCACGCGTCCCACCNONE 
J090014C13CCCACGCGTCCCACCNONE 
J090060C24CCCACGCGTCCCACCNONE 
J100037H14CCCACGCGTCCCACCNONE 
J100060E10CCCACGCGTCCCACCNONE 
J100067L04CCCACGCGTCCCACCNONE 
J100075G09CCCACGCGTCCCACCNONE 
J100077C15CCCACGCGTCCCACCNONE 
Os07g0262950J033120B02CGCGCGACGCGTGGConserved hypothetical protein. 
J075040G05CGCGCGACGCGTGGNONE 
J075160F23CGCGCGACGCGTGGNONE 
Os07g0502200006-027-C06ACGCGTGGGNONE 
012-007-C05ACGCGTGGGNONE 
AK120682ACGCGTGGGMulti antimicrobial extrusion protein MatE family protein. 
J053045G13ACGCGTGGGNONE 
J053064I18ACGCGTGGGNONE 
J053091G24ACGCGTGGGNONE 
J065016E10ACGCGTGGGNONE 
J065021B18ACGCGTGGGNONE 
J065022A17ACGCGTGGGNONE 
J065059D18ACGCGTGGGNONE 
J065063N19ACGCGTGGGNONE 
J065065O10ACGCGTGGGNONE 
J065196F12ACGCGTGGGNONE 
J065208I01ACGCGTGGGNONE 
J065218G15ACGCGTGGGNONE 
J100040G01ACGCGTGGGNONE 
J100060M03ACGCGTGGGNONE 
J100061P09ACGCGTGGGNONE 
J100065P05ACGCGTGGGNONE 
Os07g0582700AK110773CCACGCGTConserved hypothetical protein. 
Os07g0598500AK073214ACGCGTGGGTCCCACProtein prenyltransferase domain containing protein. 
J065192M24ACGCGTGGGTCCCACNONE 
J100039G03ACGCGTGGGTCCCACNONE 
Os07g0622700AK107120ACGCGTGGEpoxide hydrolase family protein. 
Os07g0633200AK061338CACGCCACGCGTCCSimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK061338CCACGCGTSimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451CACGCCACGCGTCCNONE 
AK073451CCACGCGTNONE 
J033096E22CACGCCACGCGTCCNONE 
J033096E22CCACGCGTNONE 
J033125D06CACGCCACGCGTCCNONE 
J033125D06CCACGCGTNONE 
J075048C23CACGCCACGCGTCCNONE 
J075048C23CCACGCGTNONE 
J075050G02CACGCCACGCGTCCNONE 
J075050G02CCACGCGTNONE 
J075104J04CACGCCACGCGTCCNONE 
J075104J04CCACGCGTNONE 
J075144N04CACGCCACGCGTCCNONE 
J075144N04CCACGCGTNONE 
Os07g0661600006-050-D12ACGCGTGGGCCCGGGNONE 
009-124-B10ACGCGTGGGCCCGGGNONE 
AK061123ACGCGTGGGCCCGGGNONE 
AK066432ACGCGTGGGCCCGGGSimilar to RNA-binding protein-like protein. 
AK104664ACGCGTGGGCCCGGGNONE 
J013064M13ACGCGTGGGCCCGGGNONE 
J013122O12ACGCGTGGGCCCGGGNONE 
J033044A16ACGCGTGGGCCCGGGNONE 
J033144D14ACGCGTGGGCCCGGGNONE 
J090078P13ACGCGTGGGCCCGGGNONE 
Os07g0675250013-097-G10CCACGCGTCCNONE 
AK063620CCACGCGTCCConserved hypothetical protein. 
J075026H18CCACGCGTCCNONE 
J075192A02CCACGCGTCCNONE 
Os07g0682800AK066262ACGCGTGGACCSimilar to Apyrase-like protein. 
Os08g0127600AK058365CCCACGCGTGCTGGGCCCCHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373CCCACGCGTGCTGGGCCCCNONE 
J013149L10CCCACGCGTGCTGGGCCCCNONE 
J075027H17CCCACGCGTGCTGGGCCCCNONE 
J075060F10CCCACGCGTGCTGGGCCCCNONE 
Os08g0127700012-086-F03GGGGCCCAGCACGCGTGGGNONE 
AK059350GGGGCCCAGCACGCGTGGGNONE 
AK099242GGGGCCCAGCACGCGTGGGNONE 
AK121348GGGGCCCAGCACGCGTGGGConserved hypothetical protein. 
J033027J18GGGGCCCAGCACGCGTGGGNONE 
J065012F22GGGGCCCAGCACGCGTGGGNONE 
J065046N17GGGGCCCAGCACGCGTGGGNONE 
J065197B02GGGGCCCAGCACGCGTGGGNONE 
J100018P04GGGGCCCAGCACGCGTGGGNONE 
J100052C14GGGGCCCAGCACGCGTGGGNONE 
J100083A12GGGGCCCAGCACGCGTGGGNONE 
Os08g0347200AK058279CCCACGCGTGGHypothetical protein. 
J100058J16CCCACGCGTGGNONE 
Os08g0389733J065044M19CCACGCGTNONE 
J065104D10CCACGCGTNONE 
J065110F18CCACGCGTNONE 
Os08g0450200AK072779ACGCGTGGGSimilar to Pectin methylesterase (Fragment). 
J023077K13ACGCGTGGGNONE 
Os08g0520100AK059686GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCNONE 
AK120052GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCPseudouridine synthase domain containing protein. 
Os09g0265050J065112H09CGCGCGACGCGTGGConserved hypothetical protein. 
Os09g0321000AK110666ACGCGTGGConserved hypothetical protein. 
Os09g0324000AK107774CCACGCGTSimilar to Oleosin. 
AK119722CCACGCGTNONE 
J065205O11CCACGCGTNONE 
J075150L22CCACGCGTNONE 
Os09g0371200J100027I16GCCCACGCGTMajor facilitator superfamily MFS_1 protein. 
Os09g0392000AK120392CCACGCGTConserved hypothetical protein. 
J013074N02CCACGCGTNONE 
Os09g0445600AK107839GCCCCACGCGTConserved hypothetical protein. 
Os09g0453800AK119212CACGCCACGCGTGCGNONE 
J023081A04CACGCCACGCGTGCGNONE 
J065180G14CACGCCACGCGTGCGNONE 
J100024A17CACGCCACGCGTGCGNONE 
J100030A05CACGCCACGCGTGCGNONE 
J100042I11CACGCCACGCGTGCGNONE 
J100054N05CACGCCACGCGTGCGNONE 
J100075G23CACGCCACGCGTGCGNONE 
Os09g0456200015-025-E01CCACGCGTCGCGCGCNONE 
AK065873CCACGCGTCGCGCGCSimilar to BZIP transcription factor ABI5. 
J013049N23CCACGCGTCGCGCGCNONE 
J033128E10CCACGCGTCGCGCGCNONE 
Os09g0463700016-008-D06CCACGCGTNONE 
AK060708CCACGCGTSimilar to AHM1. 
J090013G05CCACGCGTNONE 
Os09g0532000AK105810ACCCCCCACCGCACCACGCGTNONE 
AY850134ACCCCCCACCGCACCACGCGTConserved hypothetical protein. 
J065022C05ACCCCCCACCGCACCACGCGTNONE 
J065054B06ACCCCCCACCGCACCACGCGTNONE 
J065072C03ACCCCCCACCGCACCACGCGTNONE 
J065121O09ACCCCCCACCGCACCACGCGTNONE 
J065163P22ACCCCCCACCGCACCACGCGTNONE 
J065192G01ACCCCCCACCGCACCACGCGTNONE 
J065194H12ACCCCCCACCGCACCACGCGTNONE 
Os09g0569100009-133-D02CCACGCGTNONE 
AK071860CCACGCGTHaloacid dehalogenase-like hydrolase domain containing protein. 
J023117I03CCACGCGTNONE 
J065046H04CCACGCGTNONE 
J065051H17CCACGCGTNONE 
J065070C15CCACGCGTNONE 
J065088K22CCACGCGTNONE 
J065100H10CCACGCGTNONE 
J065110A06CCACGCGTNONE 
J100027K01CCACGCGTNONE 
J100079K16CCACGCGTNONE 
Os11g0170400AK066519CCCACGCGTGGConserved hypothetical protein. 
J013039A08CCCACGCGTGGNONE 
Os11g0195600AK068003CCACGCGTGGSimilar to Amino acid carrier (Fragment). 
AK104370CCACGCGTGGNONE 
Os11g0210300009-169-E10ACGCGTGGNONE 
012-007-H08ACGCGTGGNONE 
012-065-A02ACGCGTGGNONE 
012-095-H06ACGCGTGGNONE 
015-007-F02ACGCGTGGNONE 
015-017-F10ACGCGTGGNONE 
015-078-F12ACGCGTGGNONE 
016-085-G04ACGCGTGGNONE 
AK061267ACGCGTGGNONE 
AK069330ACGCGTGGAlcohol dehydrogenase 1. 
D10412ACGCGTGGNONE 
J023026C01ACGCGTGGNONE 
J023037O21ACGCGTGGNONE 
J023044J09ACGCGTGGNONE 
J023066N19ACGCGTGGNONE 
J023100L06ACGCGTGGNONE 
J023121G14ACGCGTGGNONE 
J023132I24ACGCGTGGNONE 
J023134J18ACGCGTGGNONE 
J033024J23ACGCGTGGNONE 
J033029B21ACGCGTGGNONE 
J033030H09ACGCGTGGNONE 
J033040N09ACGCGTGGNONE 
J033050I11ACGCGTGGNONE 
J033052F03ACGCGTGGNONE 
J033067J22ACGCGTGGNONE 
J033068K15ACGCGTGGNONE 
J033070A13ACGCGTGGNONE 
J033072A02ACGCGTGGNONE 
J033072F17ACGCGTGGNONE 
J033081C02ACGCGTGGNONE 
J033082F08ACGCGTGGNONE 
J033086L02ACGCGTGGNONE 
J033087O09ACGCGTGGNONE 
J033088P05ACGCGTGGNONE 
J033094D13ACGCGTGGNONE 
J033098I11ACGCGTGGNONE 
J033102I15ACGCGTGGNONE 
J033102P13ACGCGTGGNONE 
J033103N07ACGCGTGGNONE 
J033109A11ACGCGTGGNONE 
J033109O05ACGCGTGGNONE 
J033111K07ACGCGTGGNONE 
J033113I09ACGCGTGGNONE 
J033113I10ACGCGTGGNONE 
J033115B12ACGCGTGGNONE 
J033121D20ACGCGTGGNONE 
J033125H21ACGCGTGGNONE 
J033128M09ACGCGTGGNONE 
J033135L03ACGCGTGGNONE 
J033136O13ACGCGTGGNONE 
J043003H06ACGCGTGGNONE 
J043010B17ACGCGTGGNONE 
J043015O11ACGCGTGGNONE 
J043026D03ACGCGTGGNONE 
J043030G18ACGCGTGGNONE 
J043035L17ACGCGTGGNONE 
J043037K04ACGCGTGGNONE 
J043040G24ACGCGTGGNONE 
J053024N13ACGCGTGGNONE 
J065035H08ACGCGTGGNONE 
J065116G23ACGCGTGGNONE 
J065138J15ACGCGTGGNONE 
J065161L12ACGCGTGGNONE 
J075011O04ACGCGTGGNONE 
J075109M05ACGCGTGGNONE 
J075133K12ACGCGTGGNONE 
J075167H23ACGCGTGGNONE 
J075198I09ACGCGTGGNONE 
J100023O11ACGCGTGGNONE 
J100042B17ACGCGTGGNONE 
J100052M16ACGCGTGGNONE 
J100059M23ACGCGTGGNONE 
J100076G19ACGCGTGGNONE 
X16296ACGCGTGGNONE 
Os11g0267400AK069552CCACGCGTSimilar to ClpC. 
AK100126CCACGCGTNONE 
Os11g0513900AK101049CCACGCGTConserved hypothetical protein. 
Os11g0604600006-022-C01ACCGGGCCCCACGCGTNONE 
AK061397ACCGGGCCCCACGCGTNONE 
AK102376ACCGGGCCCCACGCGTRINGv domain containing protein. 
J033091P05ACCGGGCCCCACGCGTNONE 
J065062C12ACCGGGCCCCACGCGTNONE 
J065062H09ACCGGGCCCCACGCGTNONE 
J065064A02ACCGGGCCCCACGCGTNONE 
J065101I16ACCGGGCCCCACGCGTNONE 
J065123F23ACCGGGCCCCACGCGTNONE 
J065155N12ACCGGGCCCCACGCGTNONE 
J065164F22ACCGGGCCCCACGCGTNONE 
J065181G08ACCGGGCCCCACGCGTNONE 
J075055H05ACCGGGCCCCACGCGTNONE 
J075058A22ACCGGGCCCCACGCGTNONE 
J075082H23ACCGGGCCCCACGCGTNONE 
J075111A14ACCGGGCCCCACGCGTNONE 
J075176I06ACCGGGCCCCACGCGTNONE 
Os11g0642900AK108810CCACGCGTConserved hypothetical protein. 
Os11g0654100J065120O08CCACGCGTNONE 
J065175H19CCACGCGTNB-ARC domain containing protein. 
Os11g0655200J090090L03CCACGCGTNB-ARC domain containing protein. 
Os11g0655800AK099612GGACGCGTGGLipase, class 3 family protein. 
Os12g0108201013-071-B01CCCACGCGTGGNONE 
J013060C24CCCACGCGTGGNONE 
J023026L08CCCACGCGTGGHypothetical protein. 
Os12g0122450Os12g0122450CCCACGCGTNONE 
Os12g0255866J075127N18CGCGCGACGCGTGGConserved hypothetical protein. 
Os12g0277000AK066847CCACGCGTNONE 
Os12g0413201J065083D05ACGCGTGGNONE 
J065095J19ACGCGTGGNONE 
J065118H21ACGCGTGGNONE 
J065162E19ACGCGTGGNONE 
J065196J19ACGCGTGGConserved hypothetical protein. 
J065196M07ACGCGTGGNONE 
J075041N09ACGCGTGGNONE 
J075054K04ACGCGTGGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.