version

Summary of OsREG445 (All List)

OrganismOryza sativa  
IDOsREG445  
SequenceACGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE MotifAACAAAC  Core of AACA motifs found in rice (O.s.) glutelin genes, involved in controlling the endosperm-specific expression; AACA is also closely associated with the GCN4 motif in all rice glutelin genes and together have been shown to confer endosperm-specific enhancement to the truncated -90 CaMV 35S promoter; See also S000045, S000181, S000276;  
Total Entry Count4340  

Entry Sequences (4340 entries)

LocusGene modelSequenceDescription
Os01g0101600AK099952TACGGCCCAACARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK122118TACGGCCCAACANONE 
J013123J12TACGGCCCAACANONE 
J033026O19TACGGCCCAACANONE 
J033128C08TACGGCCCAACANONE 
J065116M14TACGGCCCAACANONE 
J090058F15TACGGCCCAACANONE 
J090079F20TACGGCCCAACANONE 
Os01g0104400006-026-B08TTATGGGCCGTGGNONE 
006-030-C01TTATGGGCCGTGGNONE 
006-055-E02TTATGGGCCGTGGNONE 
006-061-B12TTATGGGCCGTGGNONE 
006-064-F06TTATGGGCCGTGGNONE 
006-078-G10TTATGGGCCGTGGNONE 
006-079-G09TTATGGGCCGTGGNONE 
006-080-B08TTATGGGCCGTGGNONE 
006-100-E07TTATGGGCCGTGGNONE 
006-110-E01TTATGGGCCGTGGNONE 
006-118-D10TTATGGGCCGTGGNONE 
006-120-C12TTATGGGCCGTGGNONE 
AK060132TTATGGGCCGTGGNONE 
AK071375TTATGGGCCGTGGRicin B-related lectin domain containing protein. 
AK104555TTATGGGCCGTGGNONE 
AK104820TTATGGGCCGTGGNONE 
J023121J21TTATGGGCCGTGGNONE 
Os01g0148700006-099-B04CATGGGCCGTTTNONE 
AK101727CATGGGCCGTTTProtein of unknown function DUF1677, Oryza sativa family protein. 
AK109379CATGGGCCGTTTNONE 
J023101J18CATGGGCCGTTTNONE 
J033036D19CATGGGCCGTTTNONE 
J033051P05CATGGGCCGTTTNONE 
J033061D21CATGGGCCGTTTNONE 
J033071M06CATGGGCCGTTTNONE 
J033072D18CATGGGCCGTTTNONE 
J033073M13CATGGGCCGTTTNONE 
J033084N02CATGGGCCGTTTNONE 
J065092C13CATGGGCCGTTTNONE 
J080017H24CATGGGCCGTTTNONE 
J080032E16CATGGGCCGTTTNONE 
J080077J07CATGGGCCGTTTNONE 
Os01g0150000006-053-H07GTGGGTCCAACGGCCCAGCNONE 
006-081-C11GTGGGTCCAACGGCCCAGCNONE 
009-050-D04GTGGGTCCAACGGCCCAGCNONE 
AK060948GTGGGTCCAACGGCCCAGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18GTGGGTCCAACGGCCCAGCNONE 
J023112H22GTGGGTCCAACGGCCCAGCNONE 
J065048P05GTGGGTCCAACGGCCCAGCNONE 
J100068N20GTGGGTCCAACGGCCCAGCNONE 
J100073A02GTGGGTCCAACGGCCCAGCNONE 
Os01g0164500AK068747CACGGCCCAATSimilar to ATP-dependent RNA helicase-like protein. 
AK103737CACGGCCCAATNONE 
Os01g0166800AK073783GGACGGCCCATTAGGCCCAATAConserved hypothetical protein. 
AK099378GGACGGCCCATTAGGCCCAATANONE 
J033026H10GGACGGCCCATTAGGCCCAATANONE 
J033067O18GGACGGCCCATTAGGCCCAATANONE 
J033108A17GGACGGCCCATTAGGCCCAATANONE 
J065015J11GGACGGCCCATTAGGCCCAATANONE 
J065204P09GGACGGCCCATTAGGCCCAATANONE 
Os01g0192550J065164G16CACGGCCCATGGGCCCGGCConserved hypothetical protein. 
J065164G16GACGGCCCACGGConserved hypothetical protein. 
Os01g0219500AK106863TTTTGGGCCGTTNONE 
AK109524TTTTGGGCCGTTPlant lipid transfer protein/Par allergen family protein. 
J075053J18TTTTGGGCCGTTNONE 
J080023G09TTTTGGGCCGTTNONE 
J080051F19TTTTGGGCCGTTNONE 
J080085H15TTTTGGGCCGTTNONE 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE 
Os01g0239100Os01g0239100CACGGCCCACGCHeat shock protein DnaJ family protein. 
Os01g0258600J075028F17GACGGCCCAGGCCCACGGCCCACANONE 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
J075071B09GACGGCCCAGGCCCACGGCCCACANONE 
J075093E04GACGGCCCAGGCCCACGGCCCACANONE 
J100033B11GACGGCCCAGGCCCACGGCCCACANONE 
Os01g0269100011-080-F08GTGTGGGCCGTANONE 
AK067610GTGTGGGCCGTASimilar to Rab proteins geranylgeranyltransferase component A 2 (Rab escort protein 2) (REP-2) (Choroideraemia-like protein). 
J013059P18GTGTGGGCCGTANONE 
J013112F12GTGTGGGCCGTANONE 
J023002M17GTGTGGGCCGTANONE 
J023022J24GTGTGGGCCGTANONE 
J033050A10GTGTGGGCCGTANONE 
J033091A17GTGTGGGCCGTANONE 
J033123E17GTGTGGGCCGTANONE 
J033143H04GTGTGGGCCGTANONE 
J043005H18GTGTGGGCCGTANONE 
J075038A05GTGTGGGCCGTANONE 
J075091K23GTGTGGGCCGTANONE 
J075118O05GTGTGGGCCGTANONE 
J075195P17GTGTGGGCCGTANONE 
J090027J21GTGTGGGCCGTANONE 
J100024I09GTGTGGGCCGTANONE 
J100032D15GTGTGGGCCGTANONE 
J100071I02GTGTGGGCCGTANONE 
J100080E01GTGTGGGCCGTANONE 
J100086A08GTGTGGGCCGTANONE 
Os01g0276500006-030-E04ACGTGGGCCGTANONE 
AK061002ACGTGGGCCGTASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)]. 
AK099335ACGTGGGCCGTANONE 
Os01g0299400AK107814GGTTGGGCCAATTTTGGGCCGTASterile alpha motif homology domain containing protein. 
J065112H10GGTTGGGCCAATTTTGGGCCGTANONE 
Os01g0316800009-188-E08GACGGCCCATTTNONE 
AK058821GACGGCCCATTTNONE 
AK119788GACGGCCCATTTSimilar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1). 
J065098A09GACGGCCCATTTNONE 
J065102J21GACGGCCCATTTNONE 
J065173M10GACGGCCCATTTNONE 
J075066K08GACGGCCCATTTNONE 
J080302B04GACGGCCCATTTNONE 
J080310P14GACGGCCCATTTNONE 
J080311I23GACGGCCCATTTNONE 
J080319N12GACGGCCCATTTNONE 
J100024D14GACGGCCCATTTNONE 
J100055N12GACGGCCCATTTNONE 
Os01g0346700AK071793CACGGCCCACGCConserved hypothetical protein. 
J023114F06CACGGCCCACGCNONE 
Os01g0525000015-038-B04CACGGCCCAGCNONE 
AK064104CACGGCCCAGCConserved hypothetical protein. 
Os01g0582400AK069484AATGGGCCGTAATCTCGGCCCGTTSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12AATGGGCCGTAATCTCGGCCCGTTNONE 
J023036F15AATGGGCCGTAATCTCGGCCCGTTNONE 
J023095O16AATGGGCCGTAATCTCGGCCCGTTNONE 
J033102M15AATGGGCCGTAATCTCGGCCCGTTNONE 
J043013I06AATGGGCCGTAATCTCGGCCCGTTNONE 
J065083M21AATGGGCCGTAATCTCGGCCCGTTNONE 
J065176A17AATGGGCCGTAATCTCGGCCCGTTNONE 
Os01g0593700Os01g0593700AAACGGCCCAATSulphate anion transporter family protein. 
Os01g0618500011-019-D03GAGGCCCACTACGGCCCACCTNONE 
AK067476GAGGCCCACTACGGCCCACCTSimilar to RNA helicase (Fragment). 
J013020E19GAGGCCCACTACGGCCCACCTNONE 
J033046J12GAGGCCCACTACGGCCCACCTNONE 
J033055D06GAGGCCCACTACGGCCCACCTNONE 
Os01g0621700AK108938GACGGCCCAACCMyosin tail 2 domain containing protein. 
J100033P13GACGGCCCAACCNONE 
Os01g0642900009-109-F01AAACGGCCCATATNONE 
AK063836AAACGGCCCATATSingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560AAACGGCCCATATNONE 
J033043K18AAACGGCCCATATNONE 
J100023C05AAACGGCCCATATNONE 
J100038C15AAACGGCCCATATNONE 
J100039C23AAACGGCCCATATNONE 
Os01g0679000AK058515CCGTGGGCCGTGRNA polymerase III subunit RPC82, C -terminal domain containing protein. 
J013149O08CCGTGGGCCGTGNONE 
J033064N24CCGTGGGCCGTGNONE 
J043022M20CCGTGGGCCGTGNONE 
J065075K20CCGTGGGCCGTGNONE 
J065081K04CCGTGGGCCGTGNONE 
J065128K13CCGTGGGCCGTGNONE 
J065131K12CCGTGGGCCGTGNONE 
J065137H20CCGTGGGCCGTGNONE 
J065205A09CCGTGGGCCGTGNONE 
J090030C13CCGTGGGCCGTGNONE 
J090053I08CCGTGGGCCGTGNONE 
J090054O22CCGTGGGCCGTGNONE 
J090082C15CCGTGGGCCGTGNONE 
J090097P12CCGTGGGCCGTGNONE 
Os01g0686800006-098-B12GGACGGCCCAAATNONE 
006-113-H04GGACGGCCCAAATNONE 
AK060428GGACGGCCCAAATNONE 
AK098877GGACGGCCCAAATNONE 
AK098893GGACGGCCCAAATNONE 
AK121587GGACGGCCCAAATGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231GGACGGCCCAAATNONE 
J013001E12GGACGGCCCAAATNONE 
J013001N15GGACGGCCCAAATNONE 
J013098G22GGACGGCCCAAATNONE 
J023004P15GGACGGCCCAAATNONE 
J023014D09GGACGGCCCAAATNONE 
J023020G09GGACGGCCCAAATNONE 
J023034A19GGACGGCCCAAATNONE 
J023050I11GGACGGCCCAAATNONE 
J023079D13GGACGGCCCAAATNONE 
J023091B11GGACGGCCCAAATNONE 
J023099M03GGACGGCCCAAATNONE 
J023101H20GGACGGCCCAAATNONE 
J023106P14GGACGGCCCAAATNONE 
J023111F19GGACGGCCCAAATNONE 
J023132C22GGACGGCCCAAATNONE 
J023139O03GGACGGCCCAAATNONE 
J023146O10GGACGGCCCAAATNONE 
J033022G16GGACGGCCCAAATNONE 
J033030C10GGACGGCCCAAATNONE 
J033032G18GGACGGCCCAAATNONE 
J033034N09GGACGGCCCAAATNONE 
J033037K24GGACGGCCCAAATNONE 
J033038B22GGACGGCCCAAATNONE 
J033061E06GGACGGCCCAAATNONE 
J033065F08GGACGGCCCAAATNONE 
J033065I24GGACGGCCCAAATNONE 
J033069L01GGACGGCCCAAATNONE 
J033086N21GGACGGCCCAAATNONE 
J033102I06GGACGGCCCAAATNONE 
J033111N07GGACGGCCCAAATNONE 
J033118K11GGACGGCCCAAATNONE 
J033125D08GGACGGCCCAAATNONE 
J033129P22GGACGGCCCAAATNONE 
J033131L12GGACGGCCCAAATNONE 
J033139D08GGACGGCCCAAATNONE 
J033141J08GGACGGCCCAAATNONE 
J043024B14GGACGGCCCAAATNONE 
J053048G19GGACGGCCCAAATNONE 
J065023B15GGACGGCCCAAATNONE 
J065082C15GGACGGCCCAAATNONE 
J065087D24GGACGGCCCAAATNONE 
J065122D11GGACGGCCCAAATNONE 
J065128P13GGACGGCCCAAATNONE 
J065149I19GGACGGCCCAAATNONE 
J065154E16GGACGGCCCAAATNONE 
J065156K21GGACGGCCCAAATNONE 
J065166H09GGACGGCCCAAATNONE 
J065169F24GGACGGCCCAAATNONE 
J065194I16GGACGGCCCAAATNONE 
J065213M20GGACGGCCCAAATNONE 
J075020F19GGACGGCCCAAATNONE 
J075051J16GGACGGCCCAAATNONE 
J075093C18GGACGGCCCAAATNONE 
J075119H02GGACGGCCCAAATNONE 
J075120J11GGACGGCCCAAATNONE 
J075173A15GGACGGCCCAAATNONE 
J080302B05GGACGGCCCAAATNONE 
J080304G10GGACGGCCCAAATNONE 
J080305E13GGACGGCCCAAATNONE 
J080315L11GGACGGCCCAAATNONE 
J090005H15GGACGGCCCAAATNONE 
J090021C24GGACGGCCCAAATNONE 
J090025H24GGACGGCCCAAATNONE 
J090025M11GGACGGCCCAAATNONE 
J090026C22GGACGGCCCAAATNONE 
J090027H15GGACGGCCCAAATNONE 
J090034B17GGACGGCCCAAATNONE 
J090045G11GGACGGCCCAAATNONE 
J090048H02GGACGGCCCAAATNONE 
J090051N04GGACGGCCCAAATNONE 
J090052I06GGACGGCCCAAATNONE 
J090054L17GGACGGCCCAAATNONE 
J090060M22GGACGGCCCAAATNONE 
J090075N17GGACGGCCCAAATNONE 
J090079K13GGACGGCCCAAATNONE 
J090086H08GGACGGCCCAAATNONE 
J090094N20GGACGGCCCAAATNONE 
J100021F03GGACGGCCCAAATNONE 
J100031M01GGACGGCCCAAATNONE 
J100033I18GGACGGCCCAAATNONE 
J100034P07GGACGGCCCAAATNONE 
J100043M16GGACGGCCCAAATNONE 
J100046J12GGACGGCCCAAATNONE 
J100055F09GGACGGCCCAAATNONE 
J100057D19GGACGGCCCAAATNONE 
J100060O10GGACGGCCCAAATNONE 
J100064G09GGACGGCCCAAATNONE 
J100077F24GGACGGCCCAAATNONE 
J100080E12GGACGGCCCAAATNONE 
J100089J04GGACGGCCCAAATNONE 
Os01g0705300AK102719AAATGGGCCGTGConserved hypothetical protein. 
AK102719AGATGGGCCGTGGGCCGTGConserved hypothetical protein. 
AK102719CACGGCCCATCTConserved hypothetical protein. 
AK103903AAATGGGCCGTGNONE 
AK103903AGATGGGCCGTGGGCCGTGNONE 
AK103903CACGGCCCATCTNONE 
J013146O16AAATGGGCCGTGNONE 
J013146O16AGATGGGCCGTGGGCCGTGNONE 
J013146O16CACGGCCCATCTNONE 
J023024O09AAATGGGCCGTGNONE 
J023024O09AGATGGGCCGTGGGCCGTGNONE 
J023024O09CACGGCCCATCTNONE 
J033105F22AAATGGGCCGTGNONE 
J033105F22AGATGGGCCGTGGGCCGTGNONE 
J033105F22CACGGCCCATCTNONE 
J033150L19AAATGGGCCGTGNONE 
J033150L19AGATGGGCCGTGGGCCGTGNONE 
J033150L19CACGGCCCATCTNONE 
J075008G14AAATGGGCCGTGNONE 
J075008G14AGATGGGCCGTGGGCCGTGNONE 
J075008G14CACGGCCCATCTNONE 
J090089L03AAATGGGCCGTGNONE 
J090089L03AGATGGGCCGTGGGCCGTGNONE 
J090089L03CACGGCCCATCTNONE 
J100040H18AAATGGGCCGTGNONE 
J100040H18AGATGGGCCGTGGGCCGTGNONE 
J100040H18CACGGCCCATCTNONE 
Os01g0705500AK063120AGATGGGCCGTGConserved hypothetical protein. 
AK063120CACGGCCCACGGCCCATCTConserved hypothetical protein. 
AK063120CACGGCCCATTTConserved hypothetical protein. 
J065063M12AGATGGGCCGTGNONE 
J065063M12CACGGCCCACGGCCCATCTNONE 
J065063M12CACGGCCCATTTNONE 
J065165C11AGATGGGCCGTGNONE 
J065165C11CACGGCCCACGGCCCATCTNONE 
J065165C11CACGGCCCATTTNONE 
Os01g0708700AK102451CAACGGCCCAAGIQ calmodulin-binding region domain containing protein. 
Os01g0730300AK101207GTCAGTGGGCCGTCCHAD-superfamily hydrolase subfamily IIB protein. 
AK109542GTCAGTGGGCCGTCCNONE 
Os01g0764000006-021-G03GACGGCCCACCCACCAACNONE 
006-025-C07GACGGCCCACCCACCAACNONE 
006-029-G11GACGGCCCACCCACCAACNONE 
006-030-C04GACGGCCCACCCACCAACNONE 
006-035-E05GACGGCCCACCCACCAACNONE 
006-037-G01GACGGCCCACCCACCAACNONE 
006-038-C01GACGGCCCACCCACCAACNONE 
006-039-G05GACGGCCCACCCACCAACNONE 
006-042-E11GACGGCCCACCCACCAACNONE 
006-044-H04GACGGCCCACCCACCAACNONE 
006-045-A10GACGGCCCACCCACCAACNONE 
006-045-C05GACGGCCCACCCACCAACNONE 
006-047-A11GACGGCCCACCCACCAACNONE 
006-048-H10GACGGCCCACCCACCAACNONE 
006-050-C01GACGGCCCACCCACCAACNONE 
006-050-H11GACGGCCCACCCACCAACNONE 
006-051-G10GACGGCCCACCCACCAACNONE 
006-051-G11GACGGCCCACCCACCAACNONE 
006-056-B04GACGGCCCACCCACCAACNONE 
006-063-F04GACGGCCCACCCACCAACNONE 
006-063-H12GACGGCCCACCCACCAACNONE 
006-065-G09GACGGCCCACCCACCAACNONE 
006-067-F11GACGGCCCACCCACCAACNONE 
006-073-D10GACGGCCCACCCACCAACNONE 
006-074-G09GACGGCCCACCCACCAACNONE 
006-075-D04GACGGCCCACCCACCAACNONE 
006-077-C10GACGGCCCACCCACCAACNONE 
006-082-A10GACGGCCCACCCACCAACNONE 
006-084-C12GACGGCCCACCCACCAACNONE 
006-085-F05GACGGCCCACCCACCAACNONE 
006-087-H12GACGGCCCACCCACCAACNONE 
006-092-E10GACGGCCCACCCACCAACNONE 
006-094-C06GACGGCCCACCCACCAACNONE 
006-096-G11GACGGCCCACCCACCAACNONE 
006-097-H11GACGGCCCACCCACCAACNONE 
006-101-A07GACGGCCCACCCACCAACNONE 
006-101-G08GACGGCCCACCCACCAACNONE 
006-110-E08GACGGCCCACCCACCAACNONE 
006-111-D04GACGGCCCACCCACCAACNONE 
006-116-H04GACGGCCCACCCACCAACNONE 
AK058894GACGGCCCACCCACCAACNONE 
AK059818GACGGCCCACCCACCAACSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142GACGGCCCACCCACCAACNONE 
J013119N15GACGGCCCACCCACCAACNONE 
J013123P15GACGGCCCACCCACCAACNONE 
J023055F24GACGGCCCACCCACCAACNONE 
J023125K17GACGGCCCACCCACCAACNONE 
J053050A20GACGGCCCACCCACCAACNONE 
J053056P10GACGGCCCACCCACCAACNONE 
J053074D19GACGGCCCACCCACCAACNONE 
J053078A14GACGGCCCACCCACCAACNONE 
J053086P10GACGGCCCACCCACCAACNONE 
J053094N23GACGGCCCACCCACCAACNONE 
J053095M23GACGGCCCACCCACCAACNONE 
J065006D02GACGGCCCACCCACCAACNONE 
J065030A17GACGGCCCACCCACCAACNONE 
J065030K04GACGGCCCACCCACCAACNONE 
J065035L12GACGGCCCACCCACCAACNONE 
J065046E12GACGGCCCACCCACCAACNONE 
J065065H19GACGGCCCACCCACCAACNONE 
J065073C01GACGGCCCACCCACCAACNONE 
J065105F01GACGGCCCACCCACCAACNONE 
J065131N16GACGGCCCACCCACCAACNONE 
J065144O13GACGGCCCACCCACCAACNONE 
J065160E12GACGGCCCACCCACCAACNONE 
J065160K02GACGGCCCACCCACCAACNONE 
J065163F09GACGGCCCACCCACCAACNONE 
J065165E18GACGGCCCACCCACCAACNONE 
J065174E04GACGGCCCACCCACCAACNONE 
J065175O08GACGGCCCACCCACCAACNONE 
J065191N24GACGGCCCACCCACCAACNONE 
J065193D19GACGGCCCACCCACCAACNONE 
J065198D04GACGGCCCACCCACCAACNONE 
J065200G09GACGGCCCACCCACCAACNONE 
J075016L06GACGGCCCACCCACCAACNONE 
J075017J11GACGGCCCACCCACCAACNONE 
J075019L08GACGGCCCACCCACCAACNONE 
J075028M08GACGGCCCACCCACCAACNONE 
J075029K05GACGGCCCACCCACCAACNONE 
J075039K04GACGGCCCACCCACCAACNONE 
J075047J22GACGGCCCACCCACCAACNONE 
J075079H13GACGGCCCACCCACCAACNONE 
J075095K14GACGGCCCACCCACCAACNONE 
J075111D21GACGGCCCACCCACCAACNONE 
J075131A19GACGGCCCACCCACCAACNONE 
J075147G20GACGGCCCACCCACCAACNONE 
J075158F11GACGGCCCACCCACCAACNONE 
J075166N10GACGGCCCACCCACCAACNONE 
J075196G09GACGGCCCACCCACCAACNONE 
J075198I24GACGGCCCACCCACCAACNONE 
J090001L08GACGGCCCACCCACCAACNONE 
J090026G07GACGGCCCACCCACCAACNONE 
J090050M15GACGGCCCACCCACCAACNONE 
J090071A01GACGGCCCACCCACCAACNONE 
J090072P16GACGGCCCACCCACCAACNONE 
J090078D22GACGGCCCACCCACCAACNONE 
J090089C18GACGGCCCACCCACCAACNONE 
J100019B07GACGGCCCACCCACCAACNONE 
J100019H15GACGGCCCACCCACCAACNONE 
J100019P09GACGGCCCACCCACCAACNONE 
J100023A16GACGGCCCACCCACCAACNONE 
J100023B09GACGGCCCACCCACCAACNONE 
J100026O18GACGGCCCACCCACCAACNONE 
J100027E09GACGGCCCACCCACCAACNONE 
J100028F22GACGGCCCACCCACCAACNONE 
J100029P05GACGGCCCACCCACCAACNONE 
J100031M19GACGGCCCACCCACCAACNONE 
J100032A11GACGGCCCACCCACCAACNONE 
J100036G19GACGGCCCACCCACCAACNONE 
J100038E22GACGGCCCACCCACCAACNONE 
J100040A12GACGGCCCACCCACCAACNONE 
J100040L02GACGGCCCACCCACCAACNONE 
J100043O13GACGGCCCACCCACCAACNONE 
J100045E20GACGGCCCACCCACCAACNONE 
J100046H18GACGGCCCACCCACCAACNONE 
J100047E08GACGGCCCACCCACCAACNONE 
J100050E08GACGGCCCACCCACCAACNONE 
J100050P14GACGGCCCACCCACCAACNONE 
J100051G10GACGGCCCACCCACCAACNONE 
J100052L12GACGGCCCACCCACCAACNONE 
J100056G24GACGGCCCACCCACCAACNONE 
J100066B15GACGGCCCACCCACCAACNONE 
J100068O15GACGGCCCACCCACCAACNONE 
J100070J16GACGGCCCACCCACCAACNONE 
J100074I22GACGGCCCACCCACCAACNONE 
J100075M12GACGGCCCACCCACCAACNONE 
J100077M09GACGGCCCACCCACCAACNONE 
J100077O14GACGGCCCACCCACCAACNONE 
J100079J08GACGGCCCACCCACCAACNONE 
J100080I16GACGGCCCACCCACCAACNONE 
Os01g0807000AK109751GACGGCCCAGAConserved hypothetical protein. 
Os01g0810000AK102143ATATGGGCCGTCAGGCCCAATTNONE 
AK120752ATATGGGCCGTCAGGCCCAATTUtp11 family protein. 
J023006E09ATATGGGCCGTCAGGCCCAATTNONE 
J033086A13ATATGGGCCGTCAGGCCCAATTNONE 
J033133K07ATATGGGCCGTCAGGCCCAATTNONE 
J065066L16ATATGGGCCGTCAGGCCCAATTNONE 
J065161C01ATATGGGCCGTCAGGCCCAATTNONE 
J100027D18ATATGGGCCGTCAGGCCCAATTNONE 
J100063J12ATATGGGCCGTCAGGCCCAATTNONE 
Os01g0821800015-005-A04TACGGCCCAATTNONE 
AK073951TACGGCCCAATTNONE 
AK103171TACGGCCCAATTNONE 
AK119168TACGGCCCAATTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J023031A22TACGGCCCAATTNONE 
J033098N09TACGGCCCAATTNONE 
J033121G11TACGGCCCAATTNONE 
J090030L03TACGGCCCAATTNONE 
Os01g0838300J090017B22AATGGGCCGTANONE 
J090017B22AGTGGGCCGTTGNONE 
J090061B04AATGGGCCGTANONE 
J090061B04AGTGGGCCGTTGNONE 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0841000009-005-A12ATCTGGGCCGTCCNONE 
AK059601ATCTGGGCCGTCCENTH/VHS domain containing protein. 
AK103342ATCTGGGCCGTCCNONE 
J023022C02ATCTGGGCCGTCCNONE 
J023030C09ATCTGGGCCGTCCNONE 
J033075D24ATCTGGGCCGTCCNONE 
J033123O16ATCTGGGCCGTCCNONE 
J033126C16ATCTGGGCCGTCCNONE 
J065120M23ATCTGGGCCGTCCNONE 
J065190I23ATCTGGGCCGTCCNONE 
J090090G01ATCTGGGCCGTCCNONE 
Os01g0844800AK099801ATCTGGGCCGTCSimilar to Pumilio RBD (Fragment). 
AK102882ATCTGGGCCGTCNONE 
AK103686ATCTGGGCCGTCNONE 
Os01g0863166J065007F23CCACGGCCCATTTNONE 
J065124H21CCACGGCCCATTTConserved hypothetical protein. 
Os01g0865600AK068033GGTGGGCCGTCNONE 
AK099677GGTGGGCCGTCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J090007G21GGTGGGCCGTCNONE 
J090023C20GGTGGGCCGTCNONE 
J090039J16GGTGGGCCGTCNONE 
J090054K15GGTGGGCCGTCNONE 
Os01g0867300AK067919AATGGGCCGTCCGTCCGTCCSimilar to OSE2-like protein (Fragment). 
J013123H12AATGGGCCGTCCGTCCGTCCNONE 
J033046C11AATGGGCCGTCCGTCCGTCCNONE 
J033051I17AATGGGCCGTCCGTCCGTCCNONE 
U25283AATGGGCCGTCCGTCCGTCCNONE 
Os01g0867600AK102226CGGACGGCCCAGATSimilar to UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). 
Os01g0876500J053026A07CGATGGGCCGTGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17CGATGGGCCGTGNONE 
Os01g0888800AK070163TACGGCCCAAAAConserved hypothetical protein. 
J065181H02TACGGCCCAAAANONE 
Os01g0900900009-066-B01CCACGGCCCACGGCCCACGGNONE 
009-137-A03CCACGGCCCACGGCCCACGGNONE 
AK120577CCACGGCCCACGGCCCACGGOvarian tumour, otubain domain containing protein. 
J023133N05CCACGGCCCACGGCCCACGGNONE 
Os01g0915800AK103859TACGGCCCAATASimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TACGGCCCAATANONE 
J090056H03TACGGCCCAATANONE 
J090058L14TACGGCCCAATANONE 
J090058P16TACGGCCCAATANONE 
J090076C19TACGGCCCAATANONE 
J100086P14TACGGCCCAATANONE 
Os01g0920200AK120182AAACGGCCCAAAASimilar to E(Y)2 homolog (DC6) (Enhancer of yellow 2 homolog). 
J013034A14AAACGGCCCAAAANONE 
J013063O14AAACGGCCCAAAANONE 
J023023D20AAACGGCCCAAAANONE 
J075121J02AAACGGCCCAAAANONE 
Os01g0924000004-020-C09TGATGGGCCGTANONE 
005-014-A06TGATGGGCCGTANONE 
009-085-G12TGATGGGCCGTANONE 
009-123-A08TGATGGGCCGTANONE 
009-134-A05TGATGGGCCGTANONE 
009-137-F06TGATGGGCCGTANONE 
016-016-B08TGATGGGCCGTANONE 
AF050674TGATGGGCCGTANONE 
AK061690TGATGGGCCGTASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797TGATGGGCCGTANONE 
J013040A15TGATGGGCCGTANONE 
J013104L20TGATGGGCCGTANONE 
J013127E12TGATGGGCCGTANONE 
J013158O05TGATGGGCCGTANONE 
J023012E09TGATGGGCCGTANONE 
J023126L23TGATGGGCCGTANONE 
J023143B03TGATGGGCCGTANONE 
J065005B16TGATGGGCCGTANONE 
J065101J15TGATGGGCCGTANONE 
J065105K16TGATGGGCCGTANONE 
J065155K16TGATGGGCCGTANONE 
J065171M17TGATGGGCCGTANONE 
J065182F07TGATGGGCCGTANONE 
J065187D10TGATGGGCCGTANONE 
J065194I24TGATGGGCCGTANONE 
J065207E24TGATGGGCCGTANONE 
J075001C24TGATGGGCCGTANONE 
J075090O10TGATGGGCCGTANONE 
J075095H17TGATGGGCCGTANONE 
J075109M24TGATGGGCCGTANONE 
J075123C18TGATGGGCCGTANONE 
J075148G22TGATGGGCCGTANONE 
J090009B09TGATGGGCCGTANONE 
J090075K17TGATGGGCCGTANONE 
J090081H23TGATGGGCCGTANONE 
J090097H21TGATGGGCCGTANONE 
J100063P14TGATGGGCCGTANONE 
Os01g0934500AK073211CAACGGCCCATGGConserved hypothetical protein. 
AK073211CCGTGGGCCGTAConserved hypothetical protein. 
Os01g0937300AK062872AGGTGGGCCGTCNONE 
J033136K12AGGTGGGCCGTCNONE 
J053048E20AGGTGGGCCGTCNONE 
J053088K08AGGTGGGCCGTCNONE 
J065011G23AGGTGGGCCGTCNONE 
J065202J09AGGTGGGCCGTCNONE 
Os01g0938900006-059-H02GACGGCCCAGCCCATTTNONE 
009-074-D12GACGGCCCAGCCCATTTNONE 
AK059437GACGGCCCAGCCCATTTNONE 
AK101971GACGGCCCAGCCCATTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK109341GACGGCCCAGCCCATTTNONE 
J023121P08GACGGCCCAGCCCATTTNONE 
J033046G24GACGGCCCAGCCCATTTNONE 
J033048E04GACGGCCCAGCCCATTTNONE 
J033048F04GACGGCCCAGCCCATTTNONE 
J033076L24GACGGCCCAGCCCATTTNONE 
J065173H07GACGGCCCAGCCCATTTNONE 
J065184H09GACGGCCCAGCCCATTTNONE 
Os01g0939100AK070064GTTTGGGCCGTASimilar to Calmodulin-stimulated calcium-ATPase. 
Os01g0944700006-058-E06CTTGGGCCGTGGNONE 
006-065-A04CTTGGGCCGTGGNONE 
006-076-E07CTTGGGCCGTGGNONE 
006-087-A09CTTGGGCCGTGGNONE 
006-091-B05CTTGGGCCGTGGNONE 
006-105-C12CTTGGGCCGTGGNONE 
006-108-G03CTTGGGCCGTGGNONE 
006-113-C02CTTGGGCCGTGGNONE 
006-115-G03CTTGGGCCGTGGNONE 
009-047-H03CTTGGGCCGTGGNONE 
009-120-E11CTTGGGCCGTGGNONE 
009-195-C06CTTGGGCCGTGGNONE 
009-199-D12CTTGGGCCGTGGNONE 
013-006-E01CTTGGGCCGTGGNONE 
013-025-C06CTTGGGCCGTGGNONE 
013-035-D10CTTGGGCCGTGGNONE 
AF443600CTTGGGCCGTGGNONE 
AK070056CTTGGGCCGTGGSimilar to Beta-1,3-glucanase precursor. 
J013106C20CTTGGGCCGTGGNONE 
J023023O17CTTGGGCCGTGGNONE 
J023038J21CTTGGGCCGTGGNONE 
J023041A20CTTGGGCCGTGGNONE 
J023066P09CTTGGGCCGTGGNONE 
J023072F21CTTGGGCCGTGGNONE 
J023090L19CTTGGGCCGTGGNONE 
J023093M17CTTGGGCCGTGGNONE 
J023120D21CTTGGGCCGTGGNONE 
J023134O19CTTGGGCCGTGGNONE 
J023141D14CTTGGGCCGTGGNONE 
J033026N18CTTGGGCCGTGGNONE 
J033048M05CTTGGGCCGTGGNONE 
J033070N13CTTGGGCCGTGGNONE 
J033143C11CTTGGGCCGTGGNONE 
J033143O12CTTGGGCCGTGGNONE 
J043015L22CTTGGGCCGTGGNONE 
J053048D16CTTGGGCCGTGGNONE 
J053053L14CTTGGGCCGTGGNONE 
J053059O17CTTGGGCCGTGGNONE 
J053060N14CTTGGGCCGTGGNONE 
J053077B10CTTGGGCCGTGGNONE 
J053090L06CTTGGGCCGTGGNONE 
J053090M04CTTGGGCCGTGGNONE 
J075032N21CTTGGGCCGTGGNONE 
J075074O15CTTGGGCCGTGGNONE 
J075078I24CTTGGGCCGTGGNONE 
J090081N23CTTGGGCCGTGGNONE 
Os01g0946200AK071060CACGGCCCAAGNo apical meristem (NAM) protein domain containing protein. 
J023080K20CACGGCCCAAGNONE 
Os01g0949200AK102412CGGACGGCCCACCANONE 
J033093A04CGGACGGCCCACCANONE 
J065053P06CGGACGGCCCACCANONE 
J100086D18CGGACGGCCCACCANONE 
Os01g0953100AK064981AGTGGGCCGTANONE 
AK068882AGTGGGCCGTAProtein of unknown function DUF594 family protein. 
J013001C07AGTGGGCCGTANONE 
J013169K14AGTGGGCCGTANONE 
J033114G07AGTGGGCCGTANONE 
J065035K15AGTGGGCCGTANONE 
J065082E12AGTGGGCCGTANONE 
Os01g0960300AK100099TCTGGGCCGTASimilar to Glucose inhibited division protein A. 
Os01g0960400AK111512CCCGTGGGCCGTGGProtein kinase-like domain containing protein. 
Os01g0963300AK067544CTGGCCCACGGCCCACTSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os01g0966200009-079-H11TGTTGGGCCGTANONE 
009-124-G10TGTTGGGCCGTANONE 
AK058564TGTTGGGCCGTAProtein of unknown function YGGT family protein. 
AK098935TGTTGGGCCGTANONE 
Os01g0971900AK067739ATCCGACGGCCCAGASimilar to BPM. 
Os02g0103700009-031-C12AACGGCCCACCANONE 
AK062502AACGGCCCACCANONE 
AK102186AACGGCCCACCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17AACGGCCCACCANONE 
J065161I07AACGGCCCACCANONE 
J065184G15AACGGCCCACCANONE 
J075123E02AACGGCCCACCANONE 
Os02g0119400AK060055GACGGCCCATATNONE 
AK102774GACGGCCCATATSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GACGGCCCATATNONE 
J075175F09GACGGCCCATATNONE 
J090011H05GACGGCCCATATNONE 
J090091O05GACGGCCCATATNONE 
Os02g0119700AK108777CCACGGCCCAATAProtein prenyltransferase domain containing protein. 
AK108777TTGGCCCAAATACGGCCCACTProtein prenyltransferase domain containing protein. 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0121200AK070123TGGATGGGCCGTGNONE 
AK121751TGGATGGGCCGTGProtein of unknown function DUF890 family protein. 
Os02g0129900Os02g0129900TACGGCCCAACTPGAP1-like family protein. 
Os02g0148600AK059287GACGGCCCAGAConserved hypothetical protein. 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0162500009-181-F03CCTGGGCCGTCNONE 
AK058907CCTGGGCCGTCNONE 
AK121223CCTGGGCCGTCSimilar to 40S ribosomal protein S14. 
J023090I10CCTGGGCCGTCNONE 
J023136J11CCTGGGCCGTCNONE 
J053097J20CCTGGGCCGTCNONE 
J053098F01CCTGGGCCGTCNONE 
J065065B09CCTGGGCCGTCNONE 
J065082M04CCTGGGCCGTCNONE 
J065188O05CCTGGGCCGTCNONE 
J075057P15CCTGGGCCGTCNONE 
J075061J08CCTGGGCCGTCNONE 
J075061N15CCTGGGCCGTCNONE 
J075131I08CCTGGGCCGTCNONE 
J075141H13CCTGGGCCGTCNONE 
J080062E14CCTGGGCCGTCNONE 
J080062P15CCTGGGCCGTCNONE 
J080318G17CCTGGGCCGTCNONE 
J080319G19CCTGGGCCGTCNONE 
J090001L10CCTGGGCCGTCNONE 
J090024I18CCTGGGCCGTCNONE 
J090033F24CCTGGGCCGTCNONE 
J090036M16CCTGGGCCGTCNONE 
J090040I24CCTGGGCCGTCNONE 
J090048P06CCTGGGCCGTCNONE 
J090049B12CCTGGGCCGTCNONE 
J090068C02CCTGGGCCGTCNONE 
J090069O04CCTGGGCCGTCNONE 
J090084H22CCTGGGCCGTCNONE 
J100022L03CCTGGGCCGTCNONE 
J100028O14CCTGGGCCGTCNONE 
J100028O18CCTGGGCCGTCNONE 
J100032A15CCTGGGCCGTCNONE 
J100033D21CCTGGGCCGTCNONE 
J100034J23CCTGGGCCGTCNONE 
J100043K22CCTGGGCCGTCNONE 
J100052M22CCTGGGCCGTCNONE 
J100053N03CCTGGGCCGTCNONE 
J100074N24CCTGGGCCGTCNONE 
J100082J10CCTGGGCCGTCNONE 
Os02g0186500AK068056AAACGGCCCACTSimilar to Protein kinase-like protein. 
AK099031AAACGGCCCACTNONE 
J013111A12AAACGGCCCACTNONE 
J013127K13AAACGGCCCACTNONE 
J013132O11AAACGGCCCACTNONE 
J023056A11AAACGGCCCACTNONE 
J023078M08AAACGGCCCACTNONE 
J033081F07AAACGGCCCACTNONE 
J090079E24AAACGGCCCACTNONE 
J090097I02AAACGGCCCACTNONE 
Os02g0188500AK102004AAACGGCCCAAAANONE 
AK106917AAACGGCCCAAAAUbiquitin domain containing protein. 
J090039N13AAACGGCCCAAAANONE 
Os02g0192700004-020-H12CCTGGGCCGTCNONE 
006-024-H06CCTGGGCCGTCNONE 
006-042-F06CCTGGGCCGTCNONE 
006-050-D04CCTGGGCCGTCNONE 
006-059-E10CCTGGGCCGTCNONE 
006-070-B02CCTGGGCCGTCNONE 
006-084-A09CCTGGGCCGTCNONE 
006-114-E11CCTGGGCCGTCNONE 
006-117-E05CCTGGGCCGTCNONE 
009-126-D11CCTGGGCCGTCNONE 
AK061629CCTGGGCCGTCSimilar to Thioredoxin peroxidase. 
AK065909CCTGGGCCGTCNONE 
J013043E11CCTGGGCCGTCNONE 
J065038I09CCTGGGCCGTCNONE 
J065078C12CCTGGGCCGTCNONE 
J065122O14CCTGGGCCGTCNONE 
J065198H04CCTGGGCCGTCNONE 
Os02g0219900004-018-E11ATCGGACGGCCCACGTNONE 
AK060915ATCGGACGGCCCACGTNONE 
AK099194ATCGGACGGCCCACGTNONE 
AK104206ATCGGACGGCCCACGTNONE 
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07ATCGGACGGCCCACGTNONE 
Os02g0230200AK105482GACGGCCCATTTConserved hypothetical protein. 
Os02g0250600J075143F23AGTTGGGCCGTCLate embryogenesis abundant protein repeat containing protein. 
Os02g0252100AF139211TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AK062577TACGGCCCATTAAAGCCCAGGCCCAAAASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J013156E01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065001D02TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065042A05TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065116H01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065167P13TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065168N07TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075093G21TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075109H15TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075194P17TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
Os02g0312700AK072956CACGGCCCAAAGTCCCACCATP11 family protein. 
AK072956CGATGGGCCGTGATP11 family protein. 
AK102909CACGGCCCAAAGTCCCACCNONE 
AK102909CGATGGGCCGTGNONE 
J065017G18CACGGCCCAAAGTCCCACCNONE 
J065017G18CGATGGGCCGTGNONE 
J075066A05CACGGCCCAAAGTCCCACCNONE 
J075066A05CGATGGGCCGTGNONE 
Os02g0321000AK121840TAATGGGCCGTTTTetratricopeptide-like helical domain containing protein. 
Os02g0321800AK067188GGGCTGGGCCGTANONE 
AK070852GGGCTGGGCCGTAB-cell receptor-associated 31-like family protein. 
J013094K24GGGCTGGGCCGTANONE 
Os02g0461200012-026-A12CACGGCCCAACTNONE 
AK063459CACGGCCCAACTConserved hypothetical protein. 
J065183F11CACGGCCCAACTNONE 
J075190G18CACGGCCCAACTNONE 
Os02g0478700AK099723GACGGCCCAGATRibosomal protein S27. 
J013089A06GACGGCCCAGATNONE 
J065068E01GACGGCCCAGATNONE 
J065217F15GACGGCCCAGATNONE 
Os02g0496900AK059542AAGGCCCACACGGCCCACCTConserved hypothetical protein. 
J053031E06AAGGCCCACACGGCCCACCTNONE 
J065195E11AAGGCCCACACGGCCCACCTNONE 
J090008P16AAGGCCCACACGGCCCACCTNONE 
Os02g0555000015-020-G02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK065270TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK121253TGTGGGCTCTGGGCCGTGGGCCGTCProtein of unknown function, ATP binding family protein. 
J013002L01TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023060A02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023101O11TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023140A15TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033042H19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033046C02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033080N19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065026I02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065040C18TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J090004I16TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
Os02g0591800AK060611ATATGGGCCGTGGTGGCCCATTBrix domain containing protein. 
AK102534ATATGGGCCGTGGTGGCCCATTNONE 
J075057H08ATATGGGCCGTGGTGGCCCATTNONE 
J075179P18ATATGGGCCGTGGTGGCCCATTNONE 
J080011H01ATATGGGCCGTGGTGGCCCATTNONE 
J080018E14ATATGGGCCGTGGTGGCCCATTNONE 
J080026N17ATATGGGCCGTGGTGGCCCATTNONE 
J080047A13ATATGGGCCGTGGTGGCCCATTNONE 
J080049C17ATATGGGCCGTGGTGGCCCATTNONE 
J080050G07ATATGGGCCGTGGTGGCCCATTNONE 
J080064D10ATATGGGCCGTGGTGGCCCATTNONE 
J080080A03ATATGGGCCGTGGTGGCCCATTNONE 
J080080G20ATATGGGCCGTGGTGGCCCATTNONE 
J080080I03ATATGGGCCGTGGTGGCCCATTNONE 
J080081H12ATATGGGCCGTGGTGGCCCATTNONE 
J080090K07ATATGGGCCGTGGTGGCCCATTNONE 
J080092O06ATATGGGCCGTGGTGGCCCATTNONE 
J080096B07ATATGGGCCGTGGTGGCCCATTNONE 
J080097M08ATATGGGCCGTGGTGGCCCATTNONE 
Os02g0602300AK065609CCGTGGGCCGTGNONE 
AK065609GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
AK066929CCGTGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GTGGTGGGCCGTGCCTGGGCCGCGCACGCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08CCGTGGGCCGTGNONE 
J013092L08GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
J090040I23CCGTGGGCCGTGNONE 
J090040I23GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
Os02g0618400AK099283CCTGGGCCGTGGNONE 
AK111807CCTGGGCCGTGGSimilar to Snapdragon myb protein 305 homolog. 
J090053M16CCTGGGCCGTGGNONE 
J090067D02CCTGGGCCGTGGNONE 
Os02g0621600AK071074CACGGCCCACAANONE 
AK108575CACGGCCCACAAConserved hypothetical protein. 
J023078O20CACGGCCCACAANONE 
J075025M01CACGGCCCACAANONE 
J090047L11CACGGCCCACAANONE 
Os02g0631000AK068667ATCTGGGCCGTGConserved hypothetical protein. 
J013159L03ATCTGGGCCGTGNONE 
J023119O20ATCTGGGCCGTGNONE 
J090098N20ATCTGGGCCGTGNONE 
Os02g0633200012-053-F09CACGGCCCAATAGGCCCATTANONE 
015-051-C09CACGGCCCAATAGGCCCATTANONE 
AK063500CACGGCCCAATAGGCCCATTAProtein prenyltransferase domain containing protein. 
J065019K23CACGGCCCAATAGGCCCATTANONE 
J065205C16CACGGCCCAATAGGCCCATTANONE 
Os02g0636300AK100670CCGTGGGCCGTGGDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11CCGTGGGCCGTGGNONE 
J023022F15CCGTGGGCCGTGGNONE 
J023112J15CCGTGGGCCGTGGNONE 
J023145M22CCGTGGGCCGTGGNONE 
J043017P16CCGTGGGCCGTGGNONE 
Os02g0644000AB081464GTGGCGTGGGCCGTCGGATCNONE 
AK101360GTGGCGTGGGCCGTCGGATCNONE 
AY062178GTGGCGTGGGCCGTCGGATCNONE 
J023043E22GTGGCGTGGGCCGTCGGATCNONE 
J033024F05GTGGCGTGGGCCGTCGGATCNONE 
J033035H01GTGGCGTGGGCCGTCGGATCNONE 
J033042J19GTGGCGTGGGCCGTCGGATCNONE 
J033057G18GTGGCGTGGGCCGTCGGATCNONE 
J033111F09GTGGCGTGGGCCGTCGGATCNONE 
J033115L11GTGGCGTGGGCCGTCGGATCNONE 
J033143I16GTGGCGTGGGCCGTCGGATCNONE 
J033143M21GTGGCGTGGGCCGTCGGATCNONE 
J075072B10GTGGCGTGGGCCGTCGGATCNONE 
J075072L04GTGGCGTGGGCCGTCGGATCNONE 
J075088F01GTGGCGTGGGCCGTCGGATCNONE 
J075196H23GTGGCGTGGGCCGTCGGATCNONE 
Os02g0646200009-031-C03AACGGCCCATGNONE 
AK071507AACGGCCCATGZinc finger, B-box domain containing protein. 
J023090D24AACGGCCCATGNONE 
Os02g0646400AK067828AGTGGGCCGTTSimilar to Glutaredoxin. 
J013120N01AGTGGGCCGTTNONE 
J065021N01AGTGGGCCGTTNONE 
J065021N02AGTGGGCCGTTNONE 
J065053O18AGTGGGCCGTTNONE 
J090067J17AGTGGGCCGTTNONE 
Os02g0655300006-024-H05TACGGCCCAAGNONE 
006-032-G04TACGGCCCAAGNONE 
006-045-F03TACGGCCCAAGNONE 
006-076-D04TACGGCCCAAGNONE 
006-086-C09TACGGCCCAAGNONE 
006-104-C07TACGGCCCAAGNONE 
AK061544TACGGCCCAAGNONE 
AK103778TACGGCCCAAGNONE 
AK106107TACGGCCCAAGNONE 
AK120006TACGGCCCAAGNONE 
AY363174TACGGCCCAAGSimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21TACGGCCCAAGNONE 
J065021C16TACGGCCCAAGNONE 
J065182F01TACGGCCCAAGNONE 
J075063I18TACGGCCCAAGNONE 
J075151E01TACGGCCCAAGNONE 
J075198K18TACGGCCCAAGNONE 
J090026M06TACGGCCCAAGNONE 
J090081H02TACGGCCCAAGNONE 
J100061E20TACGGCCCAAGNONE 
Os02g0668500006-056-A05CCAACGGCCCAGGNONE 
AK060958CCAACGGCCCAGGNONE 
AK071867CCAACGGCCCAGGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15CCAACGGCCCAGGNONE 
J065013J03CCAACGGCCCAGGNONE 
J065021P16CCAACGGCCCAGGNONE 
J065044B07CCAACGGCCCAGGNONE 
J065059E23CCAACGGCCCAGGNONE 
J065087N20CCAACGGCCCAGGNONE 
J065185I04CCAACGGCCCAGGNONE 
J065190G19CCAACGGCCCAGGNONE 
J065199C15CCAACGGCCCAGGNONE 
J065213L12CCAACGGCCCAGGNONE 
J080305C01CCAACGGCCCAGGNONE 
J080308C07CCAACGGCCCAGGNONE 
J080310F02CCAACGGCCCAGGNONE 
Os02g0670400009-189-H11TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
AB079636TGTTGGGCCATCCCACACGGCCCAGCCCSimilar to HMGc1 protein. 
J090001B08TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
Os02g0672500AK109266CCACGGCCCACCTNONE 
Os02g0673700AB028130AACGGCCCACGCZinc finger, Dof-type family protein. 
Os02g0678300J075035C01AACGGCCCATGGlucose-methanol-choline oxidoreductase domain containing protein. 
J075148E09AACGGCCCATGNONE 
J080024A08AACGGCCCATGNONE 
J080063C14AACGGCCCATGNONE 
J080072L04AACGGCCCATGNONE 
J080074H15AACGGCCCATGNONE 
J080080E22AACGGCCCATGNONE 
J080086H10AACGGCCCATGNONE 
J080093B21AACGGCCCATGNONE 
J080094G01AACGGCCCATGNONE 
J080306H24AACGGCCCATGNONE 
Os02g0682600AK108470TACGGCCCAATTZinc finger, Tim10/DDP-type family protein. 
J065019B06TACGGCCCAATTNONE 
J065065L01TACGGCCCAATTNONE 
Os02g0697500AK105680CACGGCCCATGSimilar to Selenium-binding protein-like. 
Os02g0717100014-089-G06CACGGCCCATTANONE 
AK063741CACGGCCCATTAEsterase/lipase/thioesterase domain containing protein. 
J065052A22CACGGCCCATTANONE 
Os02g0717800009-009-B02AAATGGGCCGTTTNONE 
J065185P06AAATGGGCCGTTTNONE 
J100061J04AAATGGGCCGTTTNONE 
J100064M21AAATGGGCCGTTTNONE 
Os02g0727500009-018-G06CACGGCCCAATTNONE 
AK121427CACGGCCCAATTConserved hypothetical protein. 
J023136B21CACGGCCCAATTNONE 
J033044C13CACGGCCCAATTNONE 
J043037O12CACGGCCCAATTNONE 
J053072C14CACGGCCCAATTNONE 
J065008B15CACGGCCCAATTNONE 
J065033I12CACGGCCCAATTNONE 
J065077I18CACGGCCCAATTNONE 
J065149G03CACGGCCCAATTNONE 
J065159H07CACGGCCCAATTNONE 
J065162I17CACGGCCCAATTNONE 
J065168H02CACGGCCCAATTNONE 
J065176N09CACGGCCCAATTNONE 
J065178K23CACGGCCCAATTNONE 
J065216N03CACGGCCCAATTNONE 
J080001G08CACGGCCCAATTNONE 
J080002C09CACGGCCCAATTNONE 
J080007N17CACGGCCCAATTNONE 
J080009B04CACGGCCCAATTNONE 
J080009B17CACGGCCCAATTNONE 
J080011O15CACGGCCCAATTNONE 
J080022B06CACGGCCCAATTNONE 
J080022C13CACGGCCCAATTNONE 
J080024L04CACGGCCCAATTNONE 
J080031G21CACGGCCCAATTNONE 
J080035N14CACGGCCCAATTNONE 
J080036O14CACGGCCCAATTNONE 
J080040P10CACGGCCCAATTNONE 
J080042D03CACGGCCCAATTNONE 
J080042H05CACGGCCCAATTNONE 
J080042I20CACGGCCCAATTNONE 
J080043A01CACGGCCCAATTNONE 
J080043F17CACGGCCCAATTNONE 
J080046I19CACGGCCCAATTNONE 
J080053L20CACGGCCCAATTNONE 
J080055A20CACGGCCCAATTNONE 
J080055F01CACGGCCCAATTNONE 
J080056L02CACGGCCCAATTNONE 
J080058H02CACGGCCCAATTNONE 
J080059F11CACGGCCCAATTNONE 
J080062C03CACGGCCCAATTNONE 
J080064A07CACGGCCCAATTNONE 
J080064K15CACGGCCCAATTNONE 
J080067M17CACGGCCCAATTNONE 
J080067N17CACGGCCCAATTNONE 
J080068G07CACGGCCCAATTNONE 
J080069H15CACGGCCCAATTNONE 
J080069L08CACGGCCCAATTNONE 
J080069L20CACGGCCCAATTNONE 
J080069L21CACGGCCCAATTNONE 
J080069N20CACGGCCCAATTNONE 
J080071N24CACGGCCCAATTNONE 
J080074K17CACGGCCCAATTNONE 
J080076H08CACGGCCCAATTNONE 
J080082F19CACGGCCCAATTNONE 
J080086O16CACGGCCCAATTNONE 
J090025A19CACGGCCCAATTNONE 
J090025M06CACGGCCCAATTNONE 
J090070D02CACGGCCCAATTNONE 
Os02g0731500J065098J18GCCACACGGCCCACGGAWPM-19-like family protein. 
J065123G07GCCACACGGCCCACGGNONE 
Os02g0751300J033055P08CGGACGGCCCAGATProtein of unknown function DUF581 family protein. 
Os02g0752300AK072544AACGGCCCAACCConserved hypothetical protein. 
J023132N16AACGGCCCAACCNONE 
J033069F17AACGGCCCAACCNONE 
Os02g0760300009-137-D04ATCCAACGGCCCAGGNONE 
AK063850ATCCAACGGCCCAGGSimilar to Immunophilin. 
AK121481ATCCAACGGCCCAGGNONE 
J023149K16ATCCAACGGCCCAGGNONE 
J033098A18ATCCAACGGCCCAGGNONE 
J065017E05ATCCAACGGCCCAGGNONE 
J065088E24ATCCAACGGCCCAGGNONE 
J080305N16ATCCAACGGCCCAGGNONE 
J080306F22ATCCAACGGCCCAGGNONE 
J080306P07ATCCAACGGCCCAGGNONE 
J080318H06ATCCAACGGCCCAGGNONE 
J090013M21ATCCAACGGCCCAGGNONE 
J100029G11ATCCAACGGCCCAGGNONE 
Os02g0776800AB042415GACGGCCCATCANONE 
AK072308GACGGCCCATCAReplication protein A 70kDa. 
AK101212GACGGCCCATCANONE 
J033031B02GACGGCCCATCANONE 
J090004E18GACGGCCCATCANONE 
J090084C24GACGGCCCATCANONE 
Os02g0777950J090078H24AAACGGCCCATAAConserved hypothetical protein. 
Os02g0780800J090080O19ACGTGGGCCGTGGNONE 
J090091I06ACGTGGGCCGTGGNONE 
Os02g0782200AK070439TACGGCCCAGANONE 
AK101869TACGGCCCAGANOT2/NOT3/NOT5 domain containing protein. 
Os02g0788500006-024-A02AAACGGCCCAAGNONE 
006-031-G02AAACGGCCCAAGNONE 
006-081-F11AAACGGCCCAAGNONE 
006-082-H05AAACGGCCCAAGNONE 
AK061452AAACGGCCCAAGConserved hypothetical protein. 
AK104117AAACGGCCCAAGNONE 
AK104526AAACGGCCCAAGNONE 
J075024D11AAACGGCCCAAGNONE 
J075056B12AAACGGCCCAAGNONE 
J075108H12AAACGGCCCAAGNONE 
J075156P10AAACGGCCCAAGNONE 
J075197A19AAACGGCCCAAGNONE 
Os02g0791800AK066282TACTGGGCCGTCCNONE 
AK099697TACTGGGCCGTCCWD-40 repeat containing protein. 
AY445625TACTGGGCCGTCCNONE 
J053065H07TACTGGGCCGTCCNONE 
J065108P05TACTGGGCCGTCCNONE 
J065154P22TACTGGGCCGTCCNONE 
J100037P04TACTGGGCCGTCCNONE 
J100068K05TACTGGGCCGTCCNONE 
Os02g0805900AK073740AGCCCACGGCCCACCTDcp2, box A domain containing protein. 
J013068E03AGCCCACGGCCCACCTNONE 
J033066K03AGCCCACGGCCCACCTNONE 
J033092C14AGCCCACGGCCCACCTNONE 
J065020G11AGCCCACGGCCCACCTNONE 
J065098E16AGCCCACGGCCCACCTNONE 
J065124L06AGCCCACGGCCCACCTNONE 
J065134M23AGCCCACGGCCCACCTNONE 
J065187M23AGCCCACGGCCCACCTNONE 
J065208G07AGCCCACGGCCCACCTNONE 
J075002G10AGCCCACGGCCCACCTNONE 
J075004L01AGCCCACGGCCCACCTNONE 
J075051K23AGCCCACGGCCCACCTNONE 
J090063C03AGCCCACGGCCCACCTNONE 
J090071J21AGCCCACGGCCCACCTNONE 
J100078K12AGCCCACGGCCCACCTNONE 
Os02g0806000AK072745AGGTGGGCCGTGGGCTGCN5-related N-acetyltransferase domain containing protein. 
J013130C06AGGTGGGCCGTGGGCTNONE 
J013154L12AGGTGGGCCGTGGGCTNONE 
J023135J07AGGTGGGCCGTGGGCTNONE 
J065038E23AGGTGGGCCGTGGGCTNONE 
J065042C10AGGTGGGCCGTGGGCTNONE 
J090075B11AGGTGGGCCGTGGGCTNONE 
J100033J17AGGTGGGCCGTGGGCTNONE 
Os02g0814800AK109850ATTTGGGCCGTGGlutathione S-transferase, C-terminal-like domain containing protein. 
Os02g0816700009-132-E07TAATGGGCCGTAGGCCCATTTNONE 
AK059572TAATGGGCCGTAGGCCCATTTConserved hypothetical protein. 
Os02g0816800013-089-A09AAATGGGCCTACGGCCCATTANONE 
AK102271AAATGGGCCTACGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
J013105O04AAATGGGCCTACGGCCCATTANONE 
J013124I08AAATGGGCCTACGGCCCATTANONE 
J023002E08AAATGGGCCTACGGCCCATTANONE 
J023025C01AAATGGGCCTACGGCCCATTANONE 
J023037O12AAATGGGCCTACGGCCCATTANONE 
J023049N06AAATGGGCCTACGGCCCATTANONE 
J023069G18AAATGGGCCTACGGCCCATTANONE 
J033029M02AAATGGGCCTACGGCCCATTANONE 
J033037L22AAATGGGCCTACGGCCCATTANONE 
J033089A08AAATGGGCCTACGGCCCATTANONE 
J033103L07AAATGGGCCTACGGCCCATTANONE 
J033125L19AAATGGGCCTACGGCCCATTANONE 
J090008N20AAATGGGCCTACGGCCCATTANONE 
J090041F23AAATGGGCCTACGGCCCATTANONE 
J090092H16AAATGGGCCTACGGCCCATTANONE 
Os02g0823600AK070498AGTTGGGCCGTTGGConserved hypothetical protein. 
J065055C02AGTTGGGCCGTTGGNONE 
J065098A17AGTTGGGCCGTTGGNONE 
J065119B13AGTTGGGCCGTTGGNONE 
J065146F10AGTTGGGCCGTTGGNONE 
J065209G06AGTTGGGCCGTTGGNONE 
J080001K12AGTTGGGCCGTTGGNONE 
J080004O17AGTTGGGCCGTTGGNONE 
J080005P21AGTTGGGCCGTTGGNONE 
J080009M18AGTTGGGCCGTTGGNONE 
J080013O18AGTTGGGCCGTTGGNONE 
J080014B04AGTTGGGCCGTTGGNONE 
J080014O21AGTTGGGCCGTTGGNONE 
J080015B04AGTTGGGCCGTTGGNONE 
J080016B17AGTTGGGCCGTTGGNONE 
J080017G09AGTTGGGCCGTTGGNONE 
J080022A17AGTTGGGCCGTTGGNONE 
J080024M10AGTTGGGCCGTTGGNONE 
J080025F17AGTTGGGCCGTTGGNONE 
J080025O16AGTTGGGCCGTTGGNONE 
J080029H09AGTTGGGCCGTTGGNONE 
J080030G24AGTTGGGCCGTTGGNONE 
J080031E02AGTTGGGCCGTTGGNONE 
J080032A18AGTTGGGCCGTTGGNONE 
J080032G24AGTTGGGCCGTTGGNONE 
J080033C05AGTTGGGCCGTTGGNONE 
J080033N19AGTTGGGCCGTTGGNONE 
J080035H10AGTTGGGCCGTTGGNONE 
J080035L05AGTTGGGCCGTTGGNONE 
J080042N09AGTTGGGCCGTTGGNONE 
J080044C14AGTTGGGCCGTTGGNONE 
J080048K16AGTTGGGCCGTTGGNONE 
J080050L07AGTTGGGCCGTTGGNONE 
J080051L06AGTTGGGCCGTTGGNONE 
J080051P22AGTTGGGCCGTTGGNONE 
J080053D09AGTTGGGCCGTTGGNONE 
J080053J15AGTTGGGCCGTTGGNONE 
J080053O12AGTTGGGCCGTTGGNONE 
J080057L01AGTTGGGCCGTTGGNONE 
J080062E08AGTTGGGCCGTTGGNONE 
J080062I09AGTTGGGCCGTTGGNONE 
J080063A21AGTTGGGCCGTTGGNONE 
J080063E04AGTTGGGCCGTTGGNONE 
J080063E08AGTTGGGCCGTTGGNONE 
J080064D15AGTTGGGCCGTTGGNONE 
J080064N15AGTTGGGCCGTTGGNONE 
J080068F13AGTTGGGCCGTTGGNONE 
J080070L16AGTTGGGCCGTTGGNONE 
J080072O17AGTTGGGCCGTTGGNONE 
J080075A07AGTTGGGCCGTTGGNONE 
J080076H10AGTTGGGCCGTTGGNONE 
J080077K19AGTTGGGCCGTTGGNONE 
J080078E19AGTTGGGCCGTTGGNONE 
J080082A02AGTTGGGCCGTTGGNONE 
J080083O05AGTTGGGCCGTTGGNONE 
J080091I07AGTTGGGCCGTTGGNONE 
J080094K10AGTTGGGCCGTTGGNONE 
J080094N03AGTTGGGCCGTTGGNONE 
J080096F09AGTTGGGCCGTTGGNONE 
J080097O04AGTTGGGCCGTTGGNONE 
J090037B19AGTTGGGCCGTTGGNONE 
J100017A13AGTTGGGCCGTTGGNONE 
J100068N22AGTTGGGCCGTTGGNONE 
J100072C06AGTTGGGCCGTTGGNONE 
Os02g0827600AK068455TCCGACGGCCCACCTGConserved hypothetical protein. 
Os02g0828200AK071199TACGGCCCAGANONE 
Os03g0115200009-112-E09TCGGACGGCCCATGNONE 
AK071287TCGGACGGCCCATGSimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06TCGGACGGCCCATGNONE 
J065075D17TCGGACGGCCCATGNONE 
J065108G15TCGGACGGCCCATGNONE 
J065165A16TCGGACGGCCCATGNONE 
J075015O12TCGGACGGCCCATGNONE 
J075022O06TCGGACGGCCCATGNONE 
J075031H14TCGGACGGCCCATGNONE 
J075033D10TCGGACGGCCCATGNONE 
J075070A04TCGGACGGCCCATGNONE 
J075127A05TCGGACGGCCCATGNONE 
J100070B16TCGGACGGCCCATGNONE 
Os03g0119100AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
J023024E17CCATGGGCCCACGGCCCATTNONE 
J023122B02CCATGGGCCCACGGCCCATTNONE 
J090094E15CCATGGGCCCACGGCCCATTNONE 
Os03g0120300AK066854ACATGGGCCGTGProtein of unknown function DUF1084 family protein. 
AK104882ACATGGGCCGTGNONE 
J013075C10ACATGGGCCGTGNONE 
J090012B18ACATGGGCCGTGNONE 
J090087J08ACATGGGCCGTGNONE 
Os03g0124300AK069148CCACGGCCCAAACConserved hypothetical protein. 
AK106076CCACGGCCCAAACNONE 
J023003G19CCACGGCCCAAACNONE 
Os03g0132900006-025-D05CACGGCCCAAGNONE 
006-080-C01CACGGCCCAAGNONE 
AF001501CACGGCCCAAGNONE 
AK059871CACGGCCCAAGNONE 
AK099355CACGGCCCAAGSimilar to Chitinase (EC 3.2.1.14) (Fragment). 
J033022O03CACGGCCCAAGNONE 
J033044P19CACGGCCCAAGNONE 
J033119B12CACGGCCCAAGNONE 
J075009H20CACGGCCCAAGNONE 
J075122E04CACGGCCCAAGNONE 
J075161D07CACGGCCCAAGNONE 
Os03g0139000006-059-C06TACGGCCCATCTNONE 
009-055-F07TACGGCCCATCTNONE 
AK060973TACGGCCCATCTConserved hypothetical protein. 
AK103850TACGGCCCATCTNONE 
Os03g0142900011-054-A05CAACGGCCCATTNONE 
AK067103CAACGGCCCATTNONE 
AK120438CAACGGCCCATTProtein of unknown function DUF946, plant family protein. 
J013097D18CAACGGCCCATTNONE 
J013098E18CAACGGCCCATTNONE 
J013099I17CAACGGCCCATTNONE 
J013108C09CAACGGCCCATTNONE 
J023045J15CAACGGCCCATTNONE 
J033034E13CAACGGCCCATTNONE 
J033095F07CAACGGCCCATTNONE 
J033102N22CAACGGCCCATTNONE 
J065016C14CAACGGCCCATTNONE 
J065034E13CAACGGCCCATTNONE 
J065065F21CAACGGCCCATTNONE 
J065159M09CAACGGCCCATTNONE 
J075012C13CAACGGCCCATTNONE 
J075017P18CAACGGCCCATTNONE 
J075018M03CAACGGCCCATTNONE 
J075021H19CAACGGCCCATTNONE 
J075070K23CAACGGCCCATTNONE 
J075077B18CAACGGCCCATTNONE 
J075085E20CAACGGCCCATTNONE 
J075090N23CAACGGCCCATTNONE 
J075137M16CAACGGCCCATTNONE 
J075151E03CAACGGCCCATTNONE 
J090042L02CAACGGCCCATTNONE 
J090060C21CAACGGCCCATTNONE 
J090089I17CAACGGCCCATTNONE 
J100024L19CAACGGCCCATTNONE 
J100025A06CAACGGCCCATTNONE 
J100033C24CAACGGCCCATTNONE 
J100052J17CAACGGCCCATTNONE 
J100063H10CAACGGCCCATTNONE 
J100073P04CAACGGCCCATTNONE 
J100075D01CAACGGCCCATTNONE 
J100077J17CAACGGCCCATTNONE 
J100087F03CAACGGCCCATTNONE 
J100087F09CAACGGCCCATTNONE 
Os03g0145600015-010-B10CGGACGGCCCATCTNONE 
AK106243CGGACGGCCCATCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os03g0149400AK111396CCACGGCCCACAProtein prenyltransferase domain containing protein. 
Os03g0153900015-084-H06GTTTGGGCCGTANONE 
AK106420GTTTGGGCCGTAAromatic-ring hydroxylase family protein. 
Os03g0159700012-100-B09TTTTGGGCCGTANONE 
AK063559TTTTGGGCCGTAProtein prenyltransferase domain containing protein. 
J065197I24TTTTGGGCCGTANONE 
J090089G20TTTTGGGCCGTANONE 
Os03g0160200AK064836CACGGCCCAGTConserved hypothetical protein. 
AK071081CACGGCCCAGTNONE 
AK100712CACGGCCCAGTNONE 
AK104859CACGGCCCAGTNONE 
J013000F21CACGGCCCAGTNONE 
J013024G05CACGGCCCAGTNONE 
J013035E12CACGGCCCAGTNONE 
J013041A17CACGGCCCAGTNONE 
J013045D10CACGGCCCAGTNONE 
J013045F04CACGGCCCAGTNONE 
J013046F04CACGGCCCAGTNONE 
J013047F10CACGGCCCAGTNONE 
J013051E10CACGGCCCAGTNONE 
J013059J07CACGGCCCAGTNONE 
J013059O17CACGGCCCAGTNONE 
J013060A20CACGGCCCAGTNONE 
J013063J23CACGGCCCAGTNONE 
J013066D19CACGGCCCAGTNONE 
J013069O08CACGGCCCAGTNONE 
J013088K24CACGGCCCAGTNONE 
J013098G04CACGGCCCAGTNONE 
J013100I15CACGGCCCAGTNONE 
J013102E18CACGGCCCAGTNONE 
J013102O09CACGGCCCAGTNONE 
J013119M18CACGGCCCAGTNONE 
J013123I19CACGGCCCAGTNONE 
J013146H15CACGGCCCAGTNONE 
J013149A14CACGGCCCAGTNONE 
J023003A05CACGGCCCAGTNONE 
J023013O19CACGGCCCAGTNONE 
J023044M05CACGGCCCAGTNONE 
J023048O03CACGGCCCAGTNONE 
J023049L17CACGGCCCAGTNONE 
J023060D22CACGGCCCAGTNONE 
J023060F20CACGGCCCAGTNONE 
J023069G09CACGGCCCAGTNONE 
J023086E11CACGGCCCAGTNONE 
J023091I09CACGGCCCAGTNONE 
J023091M19CACGGCCCAGTNONE 
J023101D06CACGGCCCAGTNONE 
J023109B03CACGGCCCAGTNONE 
J023113B14CACGGCCCAGTNONE 
J023114B19CACGGCCCAGTNONE 
J023115H16CACGGCCCAGTNONE 
J023134F22CACGGCCCAGTNONE 
J023139I06CACGGCCCAGTNONE 
J023150C02CACGGCCCAGTNONE 
J033033A14CACGGCCCAGTNONE 
J033058O11CACGGCCCAGTNONE 
J033060H13CACGGCCCAGTNONE 
J033075P14CACGGCCCAGTNONE 
J033084O05CACGGCCCAGTNONE 
J033087G04CACGGCCCAGTNONE 
J033092E18CACGGCCCAGTNONE 
J033101G23CACGGCCCAGTNONE 
J033112I05CACGGCCCAGTNONE 
J033118E14CACGGCCCAGTNONE 
J033118P04CACGGCCCAGTNONE 
J033123C07CACGGCCCAGTNONE 
J043003C01CACGGCCCAGTNONE 
J043024B21CACGGCCCAGTNONE 
J043030N04CACGGCCCAGTNONE 
J043039J02CACGGCCCAGTNONE 
J043039N08CACGGCCCAGTNONE 
J075006N21CACGGCCCAGTNONE 
J075008A16CACGGCCCAGTNONE 
J075018J16CACGGCCCAGTNONE 
J075023G04CACGGCCCAGTNONE 
J075134F18CACGGCCCAGTNONE 
J075181B05CACGGCCCAGTNONE 
J090014O14CACGGCCCAGTNONE 
J090020H22CACGGCCCAGTNONE 
J090022G17CACGGCCCAGTNONE 
J090023J24CACGGCCCAGTNONE 
J090033H01CACGGCCCAGTNONE 
J090038A03CACGGCCCAGTNONE 
J090041O22CACGGCCCAGTNONE 
J090049E10CACGGCCCAGTNONE 
J090063E24CACGGCCCAGTNONE 
J090080N12CACGGCCCAGTNONE 
J100021G23CACGGCCCAGTNONE 
J100028P06CACGGCCCAGTNONE 
J100060L21CACGGCCCAGTNONE 
J100077D16CACGGCCCAGTNONE 
J100088I09CACGGCCCAGTNONE 
Os03g0167000AK107307CCCGTGGGCCGTGGConserved hypothetical protein. 
J100070K07CCCGTGGGCCGTGGNONE 
Os03g0168200AK099530TGATGGGCCGTGConserved hypothetical protein. 
Os03g0181600AK067807TACGGCCCAACTSimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TACGGCCCAACTNONE 
Os03g0186800AK100356CACGGCCCAACAModifier of rudimentary, Modr family protein. 
AK100356CCACGGCCCAGTModifier of rudimentary, Modr family protein. 
Os03g0187700009-155-F05CCGTGGGCCGTCCGATCNONE 
J033140E21CCGTGGGCCGTCCGATCNONE 
J033142E21CCGTGGGCCGTCCGATCNONE 
J065014P17CCGTGGGCCGTCCGATCNONE 
J065083L20CCGTGGGCCGTCCGATCNONE 
J065092E08CCGTGGGCCGTCCGATCNONE 
J065154C08CCGTGGGCCGTCCGATCTarget SNARE coiled-coil region domain containing protein. 
J075142H08CCGTGGGCCGTCCGATCNONE 
J075175K21CCGTGGGCCGTCCGATCNONE 
J090070B20CCGTGGGCCGTCCGATCNONE 
J100071M06CCGTGGGCCGTCCGATCNONE 
Os03g0195200AK068949TACGGCCCAPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
Os03g0197000AK071163GGACGGCCCATCGConserved hypothetical protein. 
J023079A07GGACGGCCCATCGNONE 
Os03g0200500005-016-A06AGTGGGCCGTCCNONE 
AK069251AGTGGGCCGTCC40S ribosomal protein S3a (CYC07 protein). 
AK104243AGTGGGCCGTCCNONE 
AK104699AGTGGGCCGTCCNONE 
D26060AGTGGGCCGTCCNONE 
J013024H20AGTGGGCCGTCCNONE 
J013029C14AGTGGGCCGTCCNONE 
J013035O17AGTGGGCCGTCCNONE 
J013066B11AGTGGGCCGTCCNONE 
J013066B12AGTGGGCCGTCCNONE 
J013066B13AGTGGGCCGTCCNONE 
J013152M04AGTGGGCCGTCCNONE 
J023001A03AGTGGGCCGTCCNONE 
J023013H23AGTGGGCCGTCCNONE 
J023042L07AGTGGGCCGTCCNONE 
J023081L11AGTGGGCCGTCCNONE 
J023088I23AGTGGGCCGTCCNONE 
J023092N22AGTGGGCCGTCCNONE 
J023126A20AGTGGGCCGTCCNONE 
J023139A17AGTGGGCCGTCCNONE 
J023150G12AGTGGGCCGTCCNONE 
J033026M10AGTGGGCCGTCCNONE 
J033031H24AGTGGGCCGTCCNONE 
J033036C22AGTGGGCCGTCCNONE 
J033037P08AGTGGGCCGTCCNONE 
J033045G14AGTGGGCCGTCCNONE 
J033048A13AGTGGGCCGTCCNONE 
J033048B13AGTGGGCCGTCCNONE 
J033048K11AGTGGGCCGTCCNONE 
J033066A06AGTGGGCCGTCCNONE 
J033072H01AGTGGGCCGTCCNONE 
J033082K07AGTGGGCCGTCCNONE 
J033091G20AGTGGGCCGTCCNONE 
J033095C14AGTGGGCCGTCCNONE 
J033101N24AGTGGGCCGTCCNONE 
J033105L15AGTGGGCCGTCCNONE 
J033107J18AGTGGGCCGTCCNONE 
J033112L02AGTGGGCCGTCCNONE 
J033117I17AGTGGGCCGTCCNONE 
J043003K06AGTGGGCCGTCCNONE 
J043016I20AGTGGGCCGTCCNONE 
J043021A10AGTGGGCCGTCCNONE 
J043034F14AGTGGGCCGTCCNONE 
J065002O17AGTGGGCCGTCCNONE 
J065014B14AGTGGGCCGTCCNONE 
J065054N19AGTGGGCCGTCCNONE 
J065112P18AGTGGGCCGTCCNONE 
J065121B20AGTGGGCCGTCCNONE 
J065170M08AGTGGGCCGTCCNONE 
J065194B05AGTGGGCCGTCCNONE 
J090040F01AGTGGGCCGTCCNONE 
J090078O20AGTGGGCCGTCCNONE 
J090078P21AGTGGGCCGTCCNONE 
J090084E11AGTGGGCCGTCCNONE 
J100080B11AGTGGGCCGTCCNONE 
Os03g0213800AK103114CGATGGGCCGTTGMitochondrial substrate carrier family protein. 
Os03g0214900AK100534TCCAACGGCCCAGATConserved hypothetical protein. 
Os03g0219400AK100702ACATGGGCCGTCGlycoside hydrolase, family 20 protein. 
AK121985ACATGGGCCGTCNONE 
J023114O06ACATGGGCCGTCNONE 
J100043M20ACATGGGCCGTCNONE 
Os03g0245800013-094-D06CACGGCCCACCAGGCCCAGANONE 
AB020973CACGGCCCACCAGGCCCAGANONE 
AK063618CACGGCCCACCAGGCCCAGANONE 
AK120045CACGGCCCACCAGGCCCAGANONE 
AK120048CACGGCCCACCAGGCCCAGASimilar to Heat shock protein 26. 
J075104O17CACGGCCCACCAGGCCCAGANONE 
Os03g0260100AK066143GTGGCCCACGGCCCACCAConserved hypothetical protein. 
Os03g0265400006-022-A01TAATGGGCCGTTTNONE 
006-033-E05TAATGGGCCGTTTNONE 
006-035-A03TAATGGGCCGTTTNONE 
006-057-D09TAATGGGCCGTTTNONE 
006-058-D03TAATGGGCCGTTTNONE 
006-061-B04TAATGGGCCGTTTNONE 
006-076-C01TAATGGGCCGTTTNONE 
006-089-C09TAATGGGCCGTTTNONE 
006-092-D01TAATGGGCCGTTTNONE 
006-100-D06TAATGGGCCGTTTNONE 
009-014-G04TAATGGGCCGTTTNONE 
009-060-C06TAATGGGCCGTTTNONE 
009-098-A06TAATGGGCCGTTTNONE 
AK061468TAATGGGCCGTTTNONE 
AK104116TAATGGGCCGTTTNONE 
AK104424TAATGGGCCGTTTNONE 
AK120527TAATGGGCCGTTTSimilar to 50S ribosomal protein L4, chloroplast precursor (R-protein L4). 
J013127C20TAATGGGCCGTTTNONE 
J023031E11TAATGGGCCGTTTNONE 
J023150F18TAATGGGCCGTTTNONE 
J033037G14TAATGGGCCGTTTNONE 
J065073K02TAATGGGCCGTTTNONE 
J065085P13TAATGGGCCGTTTNONE 
J065161B21TAATGGGCCGTTTNONE 
J065197G23TAATGGGCCGTTTNONE 
Os03g0270700AK119531TGTTGGGCCGTANONE 
Os03g0276500011-014-A06AACGGCCCAAGNONE 
012-043-E04AACGGCCCAAGNONE 
012-096-G01AACGGCCCAAGNONE 
014-005-A07AACGGCCCAAGNONE 
014-031-F09AACGGCCCAAGNONE 
014-040-C09AACGGCCCAAGNONE 
014-092-G02AACGGCCCAAGNONE 
AK072830AACGGCCCAAGNONE 
AK099275AACGGCCCAAGNONE 
AK109474AACGGCCCAAGSimilar to Heat shock protein 70. 
J013036E08AACGGCCCAAGNONE 
J013047P03AACGGCCCAAGNONE 
J013048H14AACGGCCCAAGNONE 
J013060E24AACGGCCCAAGNONE 
J013093N10AACGGCCCAAGNONE 
J013123K11AACGGCCCAAGNONE 
J013153C09AACGGCCCAAGNONE 
J023010D20AACGGCCCAAGNONE 
J023027O13AACGGCCCAAGNONE 
J023029B01AACGGCCCAAGNONE 
J023063G14AACGGCCCAAGNONE 
J023083D09AACGGCCCAAGNONE 
J023091M13AACGGCCCAAGNONE 
J023121M10AACGGCCCAAGNONE 
J023126D10AACGGCCCAAGNONE 
J023139H01AACGGCCCAAGNONE 
J023145B18AACGGCCCAAGNONE 
J033029G15AACGGCCCAAGNONE 
J033050K13AACGGCCCAAGNONE 
J033057L09AACGGCCCAAGNONE 
J033092M15AACGGCCCAAGNONE 
J065007N14AACGGCCCAAGNONE 
J065038E07AACGGCCCAAGNONE 
J065043A09AACGGCCCAAGNONE 
J065100C19AACGGCCCAAGNONE 
J065117C02AACGGCCCAAGNONE 
J065213I04AACGGCCCAAGNONE 
J090001F01AACGGCCCAAGNONE 
J090025D07AACGGCCCAAGNONE 
J090037C11AACGGCCCAAGNONE 
J090047N11AACGGCCCAAGNONE 
J090053O05AACGGCCCAAGNONE 
J090070F11AACGGCCCAAGNONE 
J090082O16AACGGCCCAAGNONE 
J090085F20AACGGCCCAAGNONE 
J090096N08AACGGCCCAAGNONE 
Os03g0277500014-019-A09GTGTGGGCCGTGNONE 
AK063650GTGTGGGCCGTGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
J065043F18GTGTGGGCCGTGNONE 
J065092A08GTGTGGGCCGTGNONE 
J065122E17GTGTGGGCCGTGNONE 
J065182K12GTGTGGGCCGTGNONE 
J065197H15GTGTGGGCCGTGNONE 
J075115A05GTGTGGGCCGTGNONE 
Os03g0278900006-049-H12TACGGCCCAAATNONE 
006-082-A07TACGGCCCAAATNONE 
009-169-C04TACGGCCCAAATNONE 
AK066019TACGGCCCAAATATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TACGGCCCAAATNONE 
AY224460TACGGCCCAAATNONE 
J065021K17TACGGCCCAAATNONE 
J065141H24TACGGCCCAAATNONE 
J065142J20TACGGCCCAAATNONE 
J065152J03TACGGCCCAAATNONE 
J065163A13TACGGCCCAAATNONE 
J065191I21TACGGCCCAAATNONE 
J065193K12TACGGCCCAAATNONE 
J075003D01TACGGCCCAAATNONE 
J075017D24TACGGCCCAAATNONE 
J075060F20TACGGCCCAAATNONE 
J075154C11TACGGCCCAAATNONE 
J075173F04TACGGCCCAAATNONE 
Os03g0279400AK101851CCACGGCCCAAGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK106253CCACGGCCCAAGNONE 
J023079P21CCACGGCCCAAGNONE 
J023120G14CCACGGCCCAAGNONE 
J090042F16CCACGGCCCAAGNONE 
Os03g0279600006-070-A07CTGGGCCGTGNONE 
AK061080CTGGGCCGTGConserved hypothetical protein. 
AK071043CTGGGCCGTGNONE 
AK103191CTGGGCCGTGNONE 
J065077E22CTGGGCCGTGNONE 
J065208F22CTGGGCCGTGNONE 
J075156K12CTGGGCCGTGNONE 
Os03g0282900006-088-H05ACATGGGCTGATGGGCCGTGNONE 
AK061166ACATGGGCTGATGGGCCGTGNONE 
AK102161ACATGGGCTGATGGGCCGTGConserved hypothetical protein. 
AK104514ACATGGGCTGATGGGCCGTGNONE 
Os03g0284000Os03g0284000CTTGGGCCGTGCTTGGGCTGCConserved hypothetical protein. 
Os03g0298800009-079-B10TACGGCCCATCGNONE 
AK103337TACGGCCCATCGSimilar to Spliceosomal protein. 
Os03g0308500AK103891CCACGGCCCAGCCCDEAD/DEAH box helicase, N-terminal domain containing protein. 
Os03g0309000AK070071GGCCGTGGGCCGTGVirulence factor, pectin lyase fold family protein. 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0332700AK072820AAACGGCCCATAASimilar to ABC Transporter, ATP binding component. 
Os03g0335100AK107094CTTGGGCCGTTConserved hypothetical protein. 
Os03g0337800AK059309TGATGGGCCGACGGCCCAGCCCAGCCSimilar to 60S ribosomal protein L19 (Fragment). 
AK102721TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J023146K24TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033069H01TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033105G07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065009B17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065010F02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065068A06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065085M23TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065095H02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065118O17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065121I06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065138J02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065143L09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065146P12TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065169D03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065181E03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065184C13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188D08TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188O16TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075066J20TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075081E13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075175B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080301E05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080302B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080316P06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080319C09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090038K21TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090046J05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090098B03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100039N19TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100041E17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100081L04TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100089N15TGATGGGCCGACGGCCCAGCCCAGCCNONE 
Os03g0343500009-042-G06CCACGGCCCAACNONE 
009-063-D01CCACGGCCCAACNONE 
009-156-H09CCACGGCCCAACNONE 
AB117995CCACGGCCCAACNONE 
AK058737CCACGGCCCAACNONE 
AK059599CCACGGCCCAACSimilar to 60S ribosomal protein L22-2. 
AK121502CCACGGCCCAACNONE 
J023082D10CCACGGCCCAACNONE 
J033022G11CCACGGCCCAACNONE 
J075048M16CCACGGCCCAACNONE 
J075049O20CCACGGCCCAACNONE 
J075082I02CCACGGCCCAACNONE 
J075105G01CCACGGCCCAACNONE 
J075131K05CCACGGCCCAACNONE 
J080002H01CCACGGCCCAACNONE 
J080003H01CCACGGCCCAACNONE 
J080005G08CCACGGCCCAACNONE 
J080011M13CCACGGCCCAACNONE 
J080020M02CCACGGCCCAACNONE 
J080026N24CCACGGCCCAACNONE 
J080028L09CCACGGCCCAACNONE 
J080032O14CCACGGCCCAACNONE 
J080033J12CCACGGCCCAACNONE 
J080035D05CCACGGCCCAACNONE 
J080039H01CCACGGCCCAACNONE 
J080044B07CCACGGCCCAACNONE 
J080044E23CCACGGCCCAACNONE 
J080049N11CCACGGCCCAACNONE 
J080050A21CCACGGCCCAACNONE 
J080055L24CCACGGCCCAACNONE 
J080059N20CCACGGCCCAACNONE 
J080061F04CCACGGCCCAACNONE 
J080078I16CCACGGCCCAACNONE 
J080079G24CCACGGCCCAACNONE 
J080080K13CCACGGCCCAACNONE 
J080083G20CCACGGCCCAACNONE 
J080087B08CCACGGCCCAACNONE 
J080091L19CCACGGCCCAACNONE 
J080094D06CCACGGCCCAACNONE 
J090038L06CCACGGCCCAACNONE 
J090075H06CCACGGCCCAACNONE 
J090081D12CCACGGCCCAACNONE 
Os03g0344100009-166-F10CTTGGGCCGTGNONE 
AK061903CTTGGGCCGTGNONE 
AK065547CTTGGGCCGTGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24CTTGGGCCGTGNONE 
J033087C06CTTGGGCCGTGNONE 
J053073I09CTTGGGCCGTGNONE 
J065189D11CTTGGGCCGTGNONE 
J090032B15CTTGGGCCGTGNONE 
Os03g0352800009-030-G08ACATGGGCCGTANONE 
AK059673ACATGGGCCGTASimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17ACATGGGCCGTANONE 
J075050N19ACATGGGCCGTANONE 
J075104J18ACATGGGCCGTANONE 
J075142K05ACATGGGCCGTANONE 
J100050I19ACATGGGCCGTANONE 
J100057N04ACATGGGCCGTANONE 
Os03g0387100AB026559ATCGGACGGCCCACGTGNONE 
AF022735ATCGGACGGCCCACGTGNONE 
AK058567ATCGGACGGCCCACGTGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195ATCGGACGGCCCACGTGNONE 
J033030J15ATCGGACGGCCCACGTGNONE 
J033102N16ATCGGACGGCCCACGTGNONE 
J065056E08ATCGGACGGCCCACGTGNONE 
J065112M11ATCGGACGGCCCACGTGNONE 
J065170H07ATCGGACGGCCCACGTGNONE 
J075003P17ATCGGACGGCCCACGTGNONE 
J075074D06ATCGGACGGCCCACGTGNONE 
J075127F20ATCGGACGGCCCACGTGNONE 
J075129I01ATCGGACGGCCCACGTGNONE 
J075178A10ATCGGACGGCCCACGTGNONE 
J090071P12ATCGGACGGCCCACGTGNONE 
J100090D18ATCGGACGGCCCACGTGNONE 
Os03g0410700J065102A22AACTGGGCCGTGNONE 
Os03g0410900J065067F10CACGGCCCAGTTNONE 
J065073D08CACGGCCCAGTTNONE 
J065176C06CACGGCCCAGTTNONE 
J065189O13CACGGCCCAGTTNONE 
J065214E05CACGGCCCAGTTNONE 
J080007H09CACGGCCCAGTTNONE 
J080012B19CACGGCCCAGTTNONE 
J080020J16CACGGCCCAGTTNONE 
J080038J22CACGGCCCAGTTNONE 
J080045I09CACGGCCCAGTTNONE 
J080059M16CACGGCCCAGTTNONE 
J080060C19CACGGCCCAGTTNONE 
J080080P22CACGGCCCAGTTNONE 
J080083C03CACGGCCCAGTTNONE 
J080093M17CACGGCCCAGTTNONE 
J100029F12CACGGCCCAGTTLike-Sm ribonucleoprotein, core family protein. 
Os03g0439800009-197-D03GACGGCCCAGTTNONE 
AK058503GACGGCCCAGTTNONE 
AK066154GACGGCCCAGTTConserved hypothetical protein. 
J065017G24GACGGCCCAGTTNONE 
J090084E18GACGGCCCAGTTNONE 
Os03g0577200006-030-H11ATCCGACGGCCCAGGNONE 
AK061735ATCCGACGGCCCAGGSimilar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A). 
AK098953ATCCGACGGCCCAGGNONE 
AK099558ATCCGACGGCCCAGGNONE 
AK104547ATCCGACGGCCCAGGNONE 
J013034B14ATCCGACGGCCCAGGNONE 
J013066J17ATCCGACGGCCCAGGNONE 
J090033N14ATCCGACGGCCCAGGNONE 
Os03g0612600009-073-H01GACGGCCCAGCNONE 
AK071403GACGGCCCAGCRibosomal protein L25-like domain containing protein. 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
J065038L22GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
J065185C13GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
Os03g0639800AK103237AGTGGGCCGTTSnf7 family protein. 
J023036L02AGTGGGCCGTTNONE 
J033108L13AGTGGGCCGTTNONE 
Os03g0643300AK099445GCCCACGCCCACGCCCACGCCCACGGCCCACGGSimilar to AER123Wp. 
AK108010GCCCACGCCCACGCCCACGCCCACGGCCCACGGNONE 
Os03g0647500015-025-E10AGTTGGGCTGGGCCGTANONE 
AK064308AGTTGGGCTGGGCCGTAConserved hypothetical protein. 
AK103649AGTTGGGCTGGGCCGTANONE 
J033135D01AGTTGGGCTGGGCCGTANONE 
Os03g0647800003-103-H03GACGGCCCATCTNONE 
006-104-G09GACGGCCCATCTNONE 
AK070243GACGGCCCATCTConserved hypothetical protein. 
J100056F22GACGGCCCATCTNONE 
Os03g0656900AK066416TACGGCCCATTTNusB/RsmB/TIM44 domain containing protein. 
J065157L23TACGGCCCATTTNONE 
J065166P22TACGGCCCATTTNONE 
Os03g0684400AK100086GATCGGACGGCCCAGATMg2+ transporter protein, CorA-like family protein. 
Os03g0690000AK062756GATCGGACGGCCCACGCConserved hypothetical protein. 
J080302F19GATCGGACGGCCCACGCNONE 
J080303J23GATCGGACGGCCCACGCNONE 
J080303K16GATCGGACGGCCCACGCNONE 
J080306B15GATCGGACGGCCCACGCNONE 
J080309C02GATCGGACGGCCCACGCNONE 
J080312F13GATCGGACGGCCCACGCNONE 
J080312M04GATCGGACGGCCCACGCNONE 
J080315L20GATCGGACGGCCCACGCNONE 
Os03g0701700011-034-E06GGTGTGTGGGCCGTGTGGCNONE 
AF013979GGTGTGTGGGCCGTGTGGCNONE 
AK065161GGTGTGTGGGCCGTGTGGCSimilar to Ethylene receptor. 
AK067813GGTGTGTGGGCCGTGTGGCNONE 
J013002C04GGTGTGTGGGCCGTGTGGCNONE 
J013035M07GGTGTGTGGGCCGTGTGGCNONE 
J013049B10GGTGTGTGGGCCGTGTGGCNONE 
J013065F11GGTGTGTGGGCCGTGTGGCNONE 
J013072K18GGTGTGTGGGCCGTGTGGCNONE 
J013073P08GGTGTGTGGGCCGTGTGGCNONE 
J013098F08GGTGTGTGGGCCGTGTGGCNONE 
J013154M13GGTGTGTGGGCCGTGTGGCNONE 
J023001H02GGTGTGTGGGCCGTGTGGCNONE 
J023003D16GGTGTGTGGGCCGTGTGGCNONE 
J023014P17GGTGTGTGGGCCGTGTGGCNONE 
J023036A22GGTGTGTGGGCCGTGTGGCNONE 
J023038N01GGTGTGTGGGCCGTGTGGCNONE 
J023042E11GGTGTGTGGGCCGTGTGGCNONE 
J023058O05GGTGTGTGGGCCGTGTGGCNONE 
J023084D05GGTGTGTGGGCCGTGTGGCNONE 
J023088O17GGTGTGTGGGCCGTGTGGCNONE 
J023138O11GGTGTGTGGGCCGTGTGGCNONE 
J023147A10GGTGTGTGGGCCGTGTGGCNONE 
J033029G18GGTGTGTGGGCCGTGTGGCNONE 
J033031N13GGTGTGTGGGCCGTGTGGCNONE 
J033090D09GGTGTGTGGGCCGTGTGGCNONE 
J033091I06GGTGTGTGGGCCGTGTGGCNONE 
J033096B20GGTGTGTGGGCCGTGTGGCNONE 
J033101A19GGTGTGTGGGCCGTGTGGCNONE 
J033135D03GGTGTGTGGGCCGTGTGGCNONE 
J043001L13GGTGTGTGGGCCGTGTGGCNONE 
J043020A13GGTGTGTGGGCCGTGTGGCNONE 
J053071K24GGTGTGTGGGCCGTGTGGCNONE 
J053092L14GGTGTGTGGGCCGTGTGGCNONE 
J053099F19GGTGTGTGGGCCGTGTGGCNONE 
J065009P22GGTGTGTGGGCCGTGTGGCNONE 
J065046A22GGTGTGTGGGCCGTGTGGCNONE 
J065099K22GGTGTGTGGGCCGTGTGGCNONE 
J065112O22GGTGTGTGGGCCGTGTGGCNONE 
J065119K11GGTGTGTGGGCCGTGTGGCNONE 
J065212B11GGTGTGTGGGCCGTGTGGCNONE 
J090022A11GGTGTGTGGGCCGTGTGGCNONE 
J090054F15GGTGTGTGGGCCGTGTGGCNONE 
J090076B20GGTGTGTGGGCCGTGTGGCNONE 
J090099M22GGTGTGTGGGCCGTGTGGCNONE 
J100032L01GGTGTGTGGGCCGTGTGGCNONE 
J100065H13GGTGTGTGGGCCGTGTGGCNONE 
Os03g0708600AK069199CACGGCCCAAATDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069199CACGGCCCAAGDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069658CACGGCCCAAATNONE 
AK069658CACGGCCCAAGNONE 
J023008E04CACGGCCCAAATNONE 
J023008E04CACGGCCCAAGNONE 
J023030D22CACGGCCCAAATNONE 
J023030D22CACGGCCCAAGNONE 
J033027E16CACGGCCCAAATNONE 
J033027E16CACGGCCCAAGNONE 
J033046D09CACGGCCCAAATNONE 
J033046D09CACGGCCCAAGNONE 
J033068I10CACGGCCCAAATNONE 
J033068I10CACGGCCCAAGNONE 
J033135A12CACGGCCCAAATNONE 
J033135A12CACGGCCCAAGNONE 
J065027E22CACGGCCCAAATNONE 
J065027E22CACGGCCCAAGNONE 
J065191K23CACGGCCCAAATNONE 
J065191K23CACGGCCCAAGNONE 
J090054D15CACGGCCCAAATNONE 
J090054D15CACGGCCCAAGNONE 
J090058J15CACGGCCCAAATNONE 
J090058J15CACGGCCCAAGNONE 
Os03g0711400AK100286CCAACGGCCCAGATSimilar to Coatomer alpha subunit. 
Os03g0726900AK072553GACGGCCCATTConserved hypothetical protein. 
AK100280GACGGCCCATTNONE 
Os03g0727100AK068587GTTTGGGCCGTAAGGCCCAACAConserved hypothetical protein. 
J013153F04GTTTGGGCCGTAAGGCCCAACANONE 
J065165J09GTTTGGGCCGTAAGGCCCAACANONE 
Os03g0735300AK071715ATCCGACGGCCCAGGAlba, DNA/RNA-binding protein family protein. 
J065100I07ATCCGACGGCCCAGGNONE 
Os03g0747300006-120-B12GACGGCCCAGATNONE 
AK060347GACGGCCCAGATNONE 
AK071214GACGGCCCAGATProtein of unknown function DUF124 family protein. 
J023082F22GACGGCCCAGATNONE 
J043034I22GACGGCCCAGATNONE 
J053037D23GACGGCCCAGATNONE 
J053043C01GACGGCCCAGATNONE 
J053083D14GACGGCCCAGATNONE 
J053100J21GACGGCCCAGATNONE 
J065008H11GACGGCCCAGATNONE 
J065024G19GACGGCCCAGATNONE 
J065030G05GACGGCCCAGATNONE 
J065073N07GACGGCCCAGATNONE 
J065101N18GACGGCCCAGATNONE 
J065129O04GACGGCCCAGATNONE 
J065152M14GACGGCCCAGATNONE 
J065161L08GACGGCCCAGATNONE 
J065191G23GACGGCCCAGATNONE 
J090008A11GACGGCCCAGATNONE 
J090047J20GACGGCCCAGATNONE 
J090047J23GACGGCCCAGATNONE 
J090064C23GACGGCCCAGATNONE 
J090087H06GACGGCCCAGATNONE 
J100027M11GACGGCCCAGATNONE 
J100081M15GACGGCCCAGATNONE 
J100084C22GACGGCCCAGATNONE 
J100086C11GACGGCCCAGATNONE 
Os03g0752800AB041020GACGGCCCAAAANONE 
AF058697GACGGCCCAAAAMADS14 protein. 
AF139664GACGGCCCAAAANONE 
AK121171GACGGCCCAAAANONE 
AY332478GACGGCCCAAAANONE 
AY551916GACGGCCCAAAANONE 
J023081C04GACGGCCCAAAANONE 
Os03g0766900AK066137CACGGCCCAATTAllene oxide synthase. 
AK071361CACGGCCCAATTNONE 
AK103989CACGGCCCAATTNONE 
J023090K09CACGGCCCAATTNONE 
J043022H11CACGGCCCAATTNONE 
J053078F12CACGGCCCAATTNONE 
Os03g0770100AK108776AACGGCCCAGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0772800009-023-E05CAACGGCCCAACANONE 
009-059-F12CAACGGCCCAACANONE 
009-114-B08CAACGGCCCAACANONE 
009-115-G09CAACGGCCCAACANONE 
009-151-D08CAACGGCCCAACANONE 
009-158-A10CAACGGCCCAACANONE 
009-191-H02CAACGGCCCAACANONE 
009-192-E05CAACGGCCCAACANONE 
009-197-F11CAACGGCCCAACANONE 
AK059576CAACGGCCCAACANONE 
AK121608CAACGGCCCAACACytochrome c oxidase, subunit VIa family protein. 
J023087H20CAACGGCCCAACANONE 
J023105P14CAACGGCCCAACANONE 
J033026P15CAACGGCCCAACANONE 
J033042K10CAACGGCCCAACANONE 
J033133C09CAACGGCCCAACANONE 
J065123K13CAACGGCCCAACANONE 
J075190D03CAACGGCCCAACANONE 
J080310M14CAACGGCCCAACANONE 
J080317L14CAACGGCCCAACANONE 
J100067J19CAACGGCCCAACANONE 
J100079H21CAACGGCCCAACANONE 
Os03g0786600AK109838TACGGCCCAATAProtein of unknown function DUF860, plant family protein. 
Os03g0793500AK103407GACGGCCCACANONE 
AK121620GACGGCCCACASimilar to Casein kinase-like protein. 
Os03g0793700AK121667CACGGCCCACACCupin 1 domain containing protein. 
AY098743CACGGCCCACACNONE 
Os03g0797600006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
Os03g0822900AK099787CACGGCCCACAAZinc finger, BED-type predicted domain containing protein. 
J013042C24CACGGCCCACAANONE 
J013096O21CACGGCCCACAANONE 
J023109I23CACGGCCCACAANONE 
J033106N09CACGGCCCACAANONE 
J033107H03CACGGCCCACAANONE 
J033118G03CACGGCCCACAANONE 
J033145I24CACGGCCCACAANONE 
J065138D15CACGGCCCACAANONE 
J065140L13CACGGCCCACAANONE 
J065179M13CACGGCCCACAANONE 
J065200F05CACGGCCCACAANONE 
J075104F20CACGGCCCACAANONE 
J075143A15CACGGCCCACAANONE 
J075197J11CACGGCCCACAANONE 
Os03g0824400AK070153CACGGCCCATGGNONE 
AK070153TACGGCCCACGCTGCGGCCCNONE 
AK104298CACGGCCCATGGSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
AK104298TACGGCCCACGCTGCGGCCCSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0829000AK071107TTATGGGCCGTAFumarylacetoacetate (FAA) hydrolase family protein. 
AK109501TTATGGGCCGTANONE 
AK121596TTATGGGCCGTANONE 
J065045C17TTATGGGCCGTANONE 
J065068E23TTATGGGCCGTANONE 
J065083N15TTATGGGCCGTANONE 
J065166P10TTATGGGCCGTANONE 
J065189B13TTATGGGCCGTANONE 
J090082J08TTATGGGCCGTANONE 
J100030P13TTATGGGCCGTANONE 
Os03g0833700011-060-A10TCATGGGCCGTTTNONE 
AK121918TCATGGGCCGTTTRNA 3'-terminal phosphate cyclase family protein. 
Os03g0841100AK120279TATTGGGCCGTGTCGGCCCACCTEGF domain containing protein. 
Os03g0843500AK067985TACGGCCCACANONE 
AK101661TACGGCCCACASimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454TACGGCCCACANONE 
J080302L23TACGGCCCACANONE 
Os03g0846400AK067706GCTGGGCCGTGTCTGGGCCGGGCCGTGNONE 
AK067706TGGTGGGCCGTGGCTGGGCTGGNONE 
AK070549GCTGGGCCGTGTCTGGGCCGGGCCGTGPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK070549TGGTGGGCCGTGGCTGGGCTGGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0847500AK073859AAATGGGCCGTGGSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0851100AF303468GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
AK102069GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTSimilar to Translational elongation factor EF-TuM. 
J033082G06GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J043036M21GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065158H05GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065192A04GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
Os03g0851200009-035-B01AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-134-F10AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-154-H05AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
AK059425AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCSimilar to CAXIP1 protein. 
J065065D24AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046O19AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075048O04AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075181I09AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J080303G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090086F12AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090088E07AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
Os03g0855600006-029-G09TCTGGGCCGTANONE 
006-033-E02TCTGGGCCGTANONE 
006-069-G07TCTGGGCCGTANONE 
006-083-A02TCTGGGCCGTANONE 
006-098-H04TCTGGGCCGTANONE 
009-054-C04TCTGGGCCGTANONE 
AK060030TCTGGGCCGTANONE 
AK061467TCTGGGCCGTAConserved hypothetical protein. 
AK067858TCTGGGCCGTANONE 
AK106030TCTGGGCCGTANONE 
J013123A10TCTGGGCCGTANONE 
J065001I24TCTGGGCCGTANONE 
J065015N21TCTGGGCCGTANONE 
J065016H07TCTGGGCCGTANONE 
J065040A05TCTGGGCCGTANONE 
J065040F01TCTGGGCCGTANONE 
J065066G17TCTGGGCCGTANONE 
J065077I09TCTGGGCCGTANONE 
J065099M22TCTGGGCCGTANONE 
J065135B13TCTGGGCCGTANONE 
J065144H19TCTGGGCCGTANONE 
J065146I03TCTGGGCCGTANONE 
J065169E02TCTGGGCCGTANONE 
J065177D21TCTGGGCCGTANONE 
J065189L20TCTGGGCCGTANONE 
J065207H13TCTGGGCCGTANONE 
J065210D24TCTGGGCCGTANONE 
J065212I03TCTGGGCCGTANONE 
J075007E21TCTGGGCCGTANONE 
J075013H07TCTGGGCCGTANONE 
J075023K06TCTGGGCCGTANONE 
J075031D23TCTGGGCCGTANONE 
J075038K09TCTGGGCCGTANONE 
J075084C08TCTGGGCCGTANONE 
J075098K20TCTGGGCCGTANONE 
J090028E04TCTGGGCCGTANONE 
J090031E20TCTGGGCCGTANONE 
J090042F06TCTGGGCCGTANONE 
J090049L05TCTGGGCCGTANONE 
J090086G03TCTGGGCCGTANONE 
J090096J04TCTGGGCCGTANONE 
J100035O03TCTGGGCCGTANONE 
J100053H24TCTGGGCCGTANONE 
J100056L17TCTGGGCCGTANONE 
J100058K06TCTGGGCCGTANONE 
J100059G09TCTGGGCCGTANONE 
J100081C15TCTGGGCCGTANONE 
Os03g0856200009-070-B07GACGGCCCATCANONE 
009-135-H05GACGGCCCATCANONE 
J100067D22GACGGCCCATCANONE 
J100067L13GACGGCCCATCANONE 
J100073I07GACGGCCCATCANONE 
J100080D01GACGGCCCATCANONE 
Os03g0858700006-024-D11GGTGGGGCTGGGCCGTCNONE 
AK061723GGTGGGGCTGGGCCGTCProtein of unknown function DUF1499 family protein. 
AK064976GGTGGGGCTGGGCCGTCNONE 
J013001B23GGTGGGGCTGGGCCGTCNONE 
Os04g0105500AK068066TACGGCCCAGTANONE 
AK071444TACGGCCCAGTASimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis. 
J013130G18TACGGCCCAGTANONE 
J023093I17TACGGCCCAGTANONE 
J033079J01TACGGCCCAGTANONE 
J043027J02TACGGCCCAGTANONE 
J065135G05TACGGCCCAGTANONE 
Os04g0115400015-048-B05TACGGCCCAATANONE 
AK070523TACGGCCCAATAD111/G-patch domain containing protein. 
Os04g0208400AK069629AGTGGGCCGTGCyclin-like F-box domain containing protein. 
AK069629CTTGGGCCGTGCTTGGGCCGTGGCyclin-like F-box domain containing protein. 
AK069629GCCGGCCCGGCACGGCCCAGCCyclin-like F-box domain containing protein. 
Os04g0218600009-123-A05GTGTGGGCCGTCNONE 
AK062873GTGTGGGCCGTCNONE 
AK103472GTGTGGGCCGTCConserved hypothetical protein. 
J090077A20GTGTGGGCCGTCNONE 
Os04g0407300AK101793GACGGCCCATCGNONE 
AK121980GACGGCCCATCGHypothetical protein. 
J033065K23GACGGCCCATCGNONE 
J033108L11GACGGCCCATCGNONE 
Os04g0418000006-025-C05AAACGGCCCATTTNONE 
006-025-D11AAACGGCCCATTTNONE 
006-045-F02AAACGGCCCATTTNONE 
006-060-B04AAACGGCCCATTTNONE 
006-063-E03AAACGGCCCATTTNONE 
006-070-G08AAACGGCCCATTTNONE 
006-072-H05AAACGGCCCATTTNONE 
AK061030AAACGGCCCATTTNONE 
AK099124AAACGGCCCATTTNONE 
AK106155AAACGGCCCATTTConserved hypothetical protein. 
AK119714AAACGGCCCATTTNONE 
J023039I07AAACGGCCCATTTNONE 
J065025N03AAACGGCCCATTTNONE 
Os04g0419100AK107777CACGGCCCAGTConserved hypothetical protein. 
J065037F08CACGGCCCAGTNONE 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0444900AK063657TACGGCCCAAGSimilar to Alfin-1. 
AK098960TACGGCCCAAGNONE 
J065037L14TACGGCCCAAGNONE 
J065037P22TACGGCCCAAGNONE 
J065173O15TACGGCCCAAGNONE 
Os04g0445100014-052-B04GAAGCCCAGCAAACGGCCCATCANONE 
AK063700GAAGCCCAGCAAACGGCCCATCASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0479300AK106088TACGGCCCAGCCConserved hypothetical protein. 
Os04g0479800AK121430GCAGCCCATGGGCTGGCACGGCCCATGCyclin-like F-box domain containing protein. 
J033099N03GCAGCCCATGGGCTGGCACGGCCCATGNONE 
J090035E10GCAGCCCATGGGCTGGCACGGCCCATGNONE 
Os04g0490000AK108365TTGTGGGCCGTASimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0495900AK061559TACGGCCCAAAAConserved hypothetical protein. 
Os04g0504600J065162K24GACGGCCCAACANONE 
Os04g0528100009-090-G06TACGGCCCACCCNONE 
009-168-C11TACGGCCCACCCNONE 
AK065957TACGGCCCACCCConserved hypothetical protein. 
J013039G20TACGGCCCACCCNONE 
J013044D08TACGGCCCACCCNONE 
J065013L14TACGGCCCACCCNONE 
J065143H08TACGGCCCACCCNONE 
J065146C14TACGGCCCACCCNONE 
J065149K22TACGGCCCACCCNONE 
J065156B18TACGGCCCACCCNONE 
J065201A04TACGGCCCACCCNONE 
J065209A04TACGGCCCACCCNONE 
Os04g0530000009-106-E11CACGGCCCAAAANONE 
011-012-E12CACGGCCCAAAANONE 
AK066169CACGGCCCAAAAConserved hypothetical protein. 
J013052P20CACGGCCCAAAANONE 
J090060G12CACGGCCCAAAANONE 
J100073H10CACGGCCCAAAANONE 
Os04g0531100013-046-D02CACGGCCCACGGNONE 
013-046-D02CCACGGCCCACNONE 
AF090698CACGGCCCACGGNONE 
AF090698CCACGGCCCACNONE 
AK063584CACGGCCCACGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK063584CCACGGCCCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
J065025M20CACGGCCCACGGNONE 
J065025M20CCACGGCCCACNONE 
J065028L15CACGGCCCACGGNONE 
J065028L15CCACGGCCCACNONE 
J065048O03CACGGCCCACGGNONE 
J065048O03CCACGGCCCACNONE 
J065053K10CACGGCCCACGGNONE 
J065053K10CCACGGCCCACNONE 
J065072H10CACGGCCCACGGNONE 
J065072H10CCACGGCCCACNONE 
J065081H10CACGGCCCACGGNONE 
J065081H10CCACGGCCCACNONE 
J065082N17CACGGCCCACGGNONE 
J065082N17CCACGGCCCACNONE 
J065104K08CACGGCCCACGGNONE 
J065104K08CCACGGCCCACNONE 
J065106M03CACGGCCCACGGNONE 
J065106M03CCACGGCCCACNONE 
J065119I05CACGGCCCACGGNONE 
J065119I05CCACGGCCCACNONE 
J065122F04CACGGCCCACGGNONE 
J065122F04CCACGGCCCACNONE 
J065140N24CACGGCCCACGGNONE 
J065140N24CCACGGCCCACNONE 
J065153G09CACGGCCCACGGNONE 
J065153G09CCACGGCCCACNONE 
J065171H07CACGGCCCACGGNONE 
J065171H07CCACGGCCCACNONE 
J065172M23CACGGCCCACGGNONE 
J065172M23CCACGGCCCACNONE 
J065173K13CACGGCCCACGGNONE 
J065173K13CCACGGCCCACNONE 
J065177D22CACGGCCCACGGNONE 
J065177D22CCACGGCCCACNONE 
J065189H10CACGGCCCACGGNONE 
J065189H10CCACGGCCCACNONE 
J065198H24CACGGCCCACGGNONE 
J065198H24CCACGGCCCACNONE 
J065204D19CACGGCCCACGGNONE 
J065204D19CCACGGCCCACNONE 
J075006C08CACGGCCCACGGNONE 
J075006C08CCACGGCCCACNONE 
J075029I08CACGGCCCACGGNONE 
J075029I08CCACGGCCCACNONE 
J075039A16CACGGCCCACGGNONE 
J075039A16CCACGGCCCACNONE 
J075107I24CACGGCCCACGGNONE 
J075107I24CCACGGCCCACNONE 
J075135M22CACGGCCCACGGNONE 
J075135M22CCACGGCCCACNONE 
J075181P06CACGGCCCACGGNONE 
J075181P06CCACGGCCCACNONE 
J075190O11CACGGCCCACGGNONE 
J075190O11CCACGGCCCACNONE 
J075193F04CACGGCCCACGGNONE 
J075193F04CCACGGCCCACNONE 
Os04g0549600AK101956CCACCAACGGCCCAGATHeat shock protein DnaJ family protein. 
J013057N16CCACCAACGGCCCAGATNONE 
Os04g0551300AK103502AACGGCCCAGCSimilar to Growth regulator like protein. 
AK103502CTTGGGCCGTCSimilar to Growth regulator like protein. 
Os04g0584100012-063-E01CACGGCCCATAANONE 
AK105292CACGGCCCATAAConserved hypothetical protein. 
Os04g0585100012-055-B08GGACGGCCCATGANONE 
AK105286GGACGGCCCATGAZinc finger, DHHC-type domain containing protein. 
Os04g0589600011-100-F04ATATGGGCTACTGGGCCGTANONE 
AK061833ATATGGGCTACTGGGCCGTAGlycosyl transferase, group 1 domain containing protein. 
AK098964ATATGGGCTACTGGGCCGTANONE 
AK100053ATATGGGCTACTGGGCCGTANONE 
Os04g0592500AK066893TACGGCCCAAAAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18TACGGCCCAAAANONE 
Os04g0595000AK106907TTTTGGGCCGTGGGCTPeptidase A1, pepsin family protein. 
Os04g0610500006-115-C07TACGGCCCAAATNONE 
AK066289TACGGCCCAAATPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817TACGGCCCAAATNONE 
J013096N09TACGGCCCAAATNONE 
J023054I11TACGGCCCAAATNONE 
J023121P20TACGGCCCAAATNONE 
J053039O20TACGGCCCAAATNONE 
J053071L20TACGGCCCAAATNONE 
J053088H23TACGGCCCAAATNONE 
J053096J03TACGGCCCAAATNONE 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
016-010-G05TGGATGGGCCGAGCACGGCCCAAANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
AK071230TGGATGGGCCGAGCACGGCCCAAAProtein prenyltransferase domain containing protein. 
Os04g0614500AK100259TGATGGGCCGTCAminotransferase class-III family protein. 
Os04g0636400006-064-G07AAATGGGCCGTGGNONE 
006-097-D05AAATGGGCCGTGGNONE 
AK061848AAATGGGCCGTGGSimilar to Senescence-associated protein 6. 
AK099573AAATGGGCCGTGGNONE 
J013035J20AAATGGGCCGTGGNONE 
Os04g0636600AK073550GACACGTGACTGGGCCGTGCGGTGConserved hypothetical protein. 
AK111077GACACGTGACTGGGCCGTGCGGTGNONE 
J033044F09GACACGTGACTGGGCCGTGCGGTGNONE 
J033091D12GACACGTGACTGGGCCGTGCGGTGNONE 
J043034F06GACACGTGACTGGGCCGTGCGGTGNONE 
J090017C08GACACGTGACTGGGCCGTGCGGTGNONE 
J090027K09GACACGTGACTGGGCCGTGCGGTGNONE 
J090033A12GACACGTGACTGGGCCGTGCGGTGNONE 
Os04g0636900011-028-G03AAACGGCCCAGTTNONE 
012-040-G03AAACGGCCCAGTTNONE 
AK058405AAACGGCCCAGTTNONE 
AK065789AAACGGCCCAGTTNONE 
AK101408AAACGGCCCAGTTNONE 
AK119286AAACGGCCCAGTTNONE 
J013042J24AAACGGCCCAGTTNONE 
J033037I12AAACGGCCCAGTTNONE 
J043031B12AAACGGCCCAGTTNONE 
J065152N10AAACGGCCCAGTTNONE 
J090060K17AAACGGCCCAGTTNONE 
J090083K14AAACGGCCCAGTTNONE 
J100046O13AAACGGCCCAGTTNONE 
J100066G22AAACGGCCCAGTTNONE 
Os04g0640800AK065522GTTTGGGCCGTCProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0644100AK106954CGGACGGCCCAGATSterile alpha motif homology domain containing protein. 
Os04g0649900006-036-D07TACGGCCCACTTGNONE 
013-084-F02TACGGCCCACTTGNONE 
AK061488TACGGCCCACTTGProtein of unknown function DUF579, plant family protein. 
J100036B10TACGGCCCACTTGNONE 
J100058F04TACGGCCCACTTGNONE 
J100065C02TACGGCCCACTTGNONE 
Os04g0654700006-097-D06AATTGGGCCGTCCNONE 
013-016-H01AATTGGGCCGTCCNONE 
AB055495AATTGGGCCGTCCNONE 
AF072849AATTGGGCCGTCCNONE 
AK062107AATTGGGCCGTCCNONE 
AK099088AATTGGGCCGTCCSimilar to COP9 signalosome complex subunit 5b (EC 3.4.-.-) (Signalosome subunit 5b) (Jun activation domain-binding homolog 1). 
J013038I16AATTGGGCCGTCCNONE 
J013038J23AATTGGGCCGTCCNONE 
J013038L17AATTGGGCCGTCCNONE 
J013038N18AATTGGGCCGTCCNONE 
J013038O18AATTGGGCCGTCCNONE 
J013124A09AATTGGGCCGTCCNONE 
J023007N04AATTGGGCCGTCCNONE 
J033023C02AATTGGGCCGTCCNONE 
J033030M18AATTGGGCCGTCCNONE 
J033068I09AATTGGGCCGTCCNONE 
J033100E04AATTGGGCCGTCCNONE 
J065153E19AATTGGGCCGTCCNONE 
J065207I02AATTGGGCCGTCCNONE 
J075007A07AATTGGGCCGTCCNONE 
J075036M04AATTGGGCCGTCCNONE 
J075147I03AATTGGGCCGTCCNONE 
J075197L11AATTGGGCCGTCCNONE 
Os04g0658100AK065495CAACGGCCCAAAAHistone-fold domain containing protein. 
J013021B22CAACGGCCCAAAANONE 
J065054D12CAACGGCCCAAAANONE 
J065135I05CAACGGCCCAAAANONE 
J065198F14CAACGGCCCAAAANONE 
J090027O06CAACGGCCCAAAANONE 
Os04g0658600AK064729CCACGGCCCACGGNONE 
AK064729TACGGCCCATCANONE 
AK119253CCACGGCCCACGGNucleolar, Nop52 family protein. 
AK119253TACGGCCCATCANucleolar, Nop52 family protein. 
J075132J07CCACGGCCCACGGNONE 
J075132J07TACGGCCCATCANONE 
J075157N21CCACGGCCCACGGNONE 
J075157N21TACGGCCCATCANONE 
Os04g0661300AK070723ACAGCCCAACACGGCCCATGGConserved hypothetical protein. 
AK103942ACAGCCCAACACGGCCCATGGNONE 
Os04g0665000009-149-A12CACGGCCCAACNONE 
AK062995CACGGCCCAACCHCH domain containing protein. 
J065017G19CACGGCCCAACNONE 
J080301G12CACGGCCCAACNONE 
Os04g0668700012-043-D01ATCTGGGCCGTCCNONE 
AK065237ATCTGGGCCGTCCPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein. 
J013002G17ATCTGGGCCGTCCNONE 
J013002I02ATCTGGGCCGTCCNONE 
J013059C11ATCTGGGCCGTCCNONE 
J013059D22ATCTGGGCCGTCCNONE 
J013063G18ATCTGGGCCGTCCNONE 
J013088O04ATCTGGGCCGTCCNONE 
J013095K03ATCTGGGCCGTCCNONE 
J013096K15ATCTGGGCCGTCCNONE 
J013100O17ATCTGGGCCGTCCNONE 
J013102F10ATCTGGGCCGTCCNONE 
J013111L07ATCTGGGCCGTCCNONE 
J013127E24ATCTGGGCCGTCCNONE 
J013130A10ATCTGGGCCGTCCNONE 
J013134L13ATCTGGGCCGTCCNONE 
J023109G08ATCTGGGCCGTCCNONE 
J033022E17ATCTGGGCCGTCCNONE 
J033022N13ATCTGGGCCGTCCNONE 
J033026D04ATCTGGGCCGTCCNONE 
J033028M05ATCTGGGCCGTCCNONE 
J033037E04ATCTGGGCCGTCCNONE 
J033042D11ATCTGGGCCGTCCNONE 
J033044N20ATCTGGGCCGTCCNONE 
J033046K11ATCTGGGCCGTCCNONE 
J033046M21ATCTGGGCCGTCCNONE 
J033076E19ATCTGGGCCGTCCNONE 
J033076J24ATCTGGGCCGTCCNONE 
J033086N03ATCTGGGCCGTCCNONE 
J033095F22ATCTGGGCCGTCCNONE 
J033115F17ATCTGGGCCGTCCNONE 
J033117M06ATCTGGGCCGTCCNONE 
J033125D22ATCTGGGCCGTCCNONE 
J033129J10ATCTGGGCCGTCCNONE 
J033145E18ATCTGGGCCGTCCNONE 
J043021F24ATCTGGGCCGTCCNONE 
J053046G14ATCTGGGCCGTCCNONE 
J053090P03ATCTGGGCCGTCCNONE 
J065042N10ATCTGGGCCGTCCNONE 
J065053B13ATCTGGGCCGTCCNONE 
J065085G03ATCTGGGCCGTCCNONE 
J065173J11ATCTGGGCCGTCCNONE 
J090014M14ATCTGGGCCGTCCNONE 
J090027J07ATCTGGGCCGTCCNONE 
J090039E23ATCTGGGCCGTCCNONE 
J090051C15ATCTGGGCCGTCCNONE 
J090055H06ATCTGGGCCGTCCNONE 
J090062L03ATCTGGGCCGTCCNONE 
J100017L21ATCTGGGCCGTCCNONE 
J100024B07ATCTGGGCCGTCCNONE 
J100032G07ATCTGGGCCGTCCNONE 
J100040N09ATCTGGGCCGTCCNONE 
J100062N03ATCTGGGCCGTCCNONE 
J100078E07ATCTGGGCCGTCCNONE 
J100080E14ATCTGGGCCGTCCNONE 
J100084D07ATCTGGGCCGTCCNONE 
Os04g0675400AK068186CCGTGGGCCGTGSimilar to Chaperone protein dnaJ. 
J013029J20CCGTGGGCCGTGNONE 
J013072I16CCGTGGGCCGTGNONE 
J013134H18CCGTGGGCCGTGNONE 
J013159H06CCGTGGGCCGTGNONE 
Os04g0685100AK065262CCGTGGGCCGTCRibosomal biogenesis regulatory protein family protein. 
J013002J24CCGTGGGCCGTCNONE 
J013030M11CCGTGGGCCGTCNONE 
J033139J12CCGTGGGCCGTCNONE 
J065013D12CCGTGGGCCGTCNONE 
J065117J01CCGTGGGCCGTCNONE 
J065143K20CCGTGGGCCGTCNONE 
J065181E12CCGTGGGCCGTCNONE 
J065184A17CCGTGGGCCGTCNONE 
J065193B13CCGTGGGCCGTCNONE 
J065196H01CCGTGGGCCGTCNONE 
J075072G17CCGTGGGCCGTCNONE 
J075077B02CCGTGGGCCGTCNONE 
J075088A06CCGTGGGCCGTCNONE 
J075099H13CCGTGGGCCGTCNONE 
J075111O04CCGTGGGCCGTCNONE 
J075131F20CCGTGGGCCGTCNONE 
J075139K01CCGTGGGCCGTCNONE 
J075194I16CCGTGGGCCGTCNONE 
Os05g0100500AK071466GATCGGACGGCCCAGGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0110500AK060179TACGGCCCAAATNONE 
AK066175TACGGCCCAAATSimilar to RNA helicase (Fragment). 
J013055E22TACGGCCCAAATNONE 
J090056E03TACGGCCCAAATNONE 
Os05g0120800AK066865AAACGGCCCATATConserved hypothetical protein. 
Os05g0121500006-117-B10GACGGCCCAATNONE 
009-059-D04GACGGCCCAATNONE 
J065066C12GACGGCCCAATConserved hypothetical protein. 
J075013I12GACGGCCCAATNONE 
J090046D18GACGGCCCAATNONE 
Os05g0122900009-052-C11CCACGGCCCAAATNONE 
009-132-C12CCACGGCCCAAATNONE 
014-091-G03CCACGGCCCAAATNONE 
AB072977CCACGGCCCAAATNONE 
AK071296CCACGGCCCAAATNONE 
AK099375CCACGGCCCAAATNONE 
AK104970CCACGGCCCAAATBLE1 protein. 
J065007I09CCACGGCCCAAATNONE 
J065081H07CCACGGCCCAAATNONE 
J065122B18CCACGGCCCAAATNONE 
J065181G15CCACGGCCCAAATNONE 
J065182J07CCACGGCCCAAATNONE 
J065197D23CCACGGCCCAAATNONE 
J065197G08CCACGGCCCAAATNONE 
J065201H20CCACGGCCCAAATNONE 
J090034E11CCACGGCCCAAATNONE 
J100077M04CCACGGCCCAAATNONE 
Os05g0123400AK069521CACGGCCCATCAConserved hypothetical protein. 
J023022O05CACGGCCCATCANONE 
Os05g0145900006-095-D04CCACGGCCCACGCCCACTCCNONE 
006-104-B04CCACGGCCCACGCCCACTCCNONE 
AK121187CCACGGCCCACGCCCACTCCConserved hypothetical protein. 
J043034M11CCACGGCCCACGCCCACTCCNONE 
J053032K19CCACGGCCCACGCCCACTCCNONE 
J090096F20CCACGGCCCACGCCCACTCCNONE 
Os05g0148300009-031-A08TGTTGGGCCGTTNONE 
AK062421TGTTGGGCCGTTRibosomal protein S27, mitochondrial family protein. 
Os05g0150600011-043-D06TACGGCCCAGATNONE 
AK072977TACGGCCCAGATATP-dependent DNA helicase RecQ family protein. 
AY180331TACGGCCCAGATNONE 
J090053A16TACGGCCCAGATNONE 
Os05g0153400AK108071TAGGCCCAACACGGCCCATGTProtein prenyltransferase domain containing protein. 
Os05g0170000003-129-C04CCGATCCGACGGCCCAGANONE 
AK100216CCGATCCGACGGCCCAGAProtein of unknown function DUF266, plant family protein. 
AK103412CCGATCCGACGGCCCAGANONE 
J023045H21CCGATCCGACGGCCCAGANONE 
J033128G01CCGATCCGACGGCCCAGANONE 
J065017O10CCGATCCGACGGCCCAGANONE 
J065032H11CCGATCCGACGGCCCAGANONE 
J065120G09CCGATCCGACGGCCCAGANONE 
Os05g0184901Os05g0184901CGCGTGGGCCGTASigma factor, regions 3 and 4 domain containing protein. 
Os05g0219800AK102822CACGGCCCAATASimilar to Clone ZZD1128 mRNA sequence. 
Os05g0223200015-037-E09CACGGCCCAAANONE 
AK106308CACGGCCCAAASimilar to Glycine-rich RNA-binding protein GRP2A. 
J065013L17CACGGCCCAAANONE 
J065056N06CACGGCCCAAANONE 
J065080I11CACGGCCCAAANONE 
J065104F11CACGGCCCAAANONE 
J065183L10CACGGCCCAAANONE 
J065185H12CACGGCCCAAANONE 
J065186N17CACGGCCCAAANONE 
Os05g0255600AK073067CACGGCCCATTThioredoxin domain 2 containing protein. 
J033022A04CACGGCCCATTNONE 
J033022B03CACGGCCCATTNONE 
J033116F22CACGGCCCATTNONE 
J065017H13CACGGCCCATTNONE 
J065038G20CACGGCCCATTNONE 
J065076J16CACGGCCCATTNONE 
J065135D06CACGGCCCATTNONE 
J065168P22CACGGCCCATTNONE 
J065188G21CACGGCCCATTNONE 
J065207C14CACGGCCCATTNONE 
J080014C23CACGGCCCATTNONE 
J080018G12CACGGCCCATTNONE 
J080021F03CACGGCCCATTNONE 
J100068C14CACGGCCCATTNONE 
Os05g0256000AK104927TATTGGGCCAGGACGGCCCAACASimilar to TGF-beta receptor-interacting protein 1. 
AK111524TATTGGGCCAGGACGGCCCAACANONE 
J023025D23TATTGGGCCAGGACGGCCCAACANONE 
J033086I23TATTGGGCCAGGACGGCCCAACANONE 
J033087F17TATTGGGCCAGGACGGCCCAACANONE 
J033091C01TATTGGGCCAGGACGGCCCAACANONE 
J090048L01TATTGGGCCAGGACGGCCCAACANONE 
J090087G08TATTGGGCCAGGACGGCCCAACANONE 
J100040G23TATTGGGCCAGGACGGCCCAACANONE 
Os05g0331200AK100884CCACGGCCCACGCSimilar to External rotenone-insensitive NADPH dehydrogenase. 
Os05g0348100006-028-F04ATCGGACGGCCCATGTAGCCCAACTNONE 
009-036-C03ATCGGACGGCCCATGTAGCCCAACTNONE 
009-040-H02ATCGGACGGCCCATGTAGCCCAACTNONE 
009-173-H12ATCGGACGGCCCATGTAGCCCAACTNONE 
AK061434ATCGGACGGCCCATGTAGCCCAACTConserved hypothetical protein. 
J065137N04ATCGGACGGCCCATGTAGCCCAACTNONE 
J065164C10ATCGGACGGCCCATGTAGCCCAACTNONE 
J065210H22ATCGGACGGCCCATGTAGCCCAACTNONE 
Os05g0365500AK072352GACGGCCCAACProtein prenyltransferase domain containing protein. 
J043027P13GACGGCCCAACNONE 
Os05g0379300AK109293GACGGCCCATCTConserved hypothetical protein. 
Os05g0397700AK067298GAGGCCCACTGGGCCGTGSecY protein family protein. 
Os05g0401300009-111-H03CCGTGGGCCGTGGGCCGTGNONE 
AK060678CCGTGGGCCGTGGGCCGTGTwin-arginine translocation pathway signal domain containing protein. 
Os05g0413000AK058277TCTGGGCCGTGMitochodrial transcription termination factor-related family protein. 
Os05g0428600AK106696CCAACGGCCCAGATCACGCCACTGACSimilar to HSP70 precursor. 
Os05g0437800015-045-B10TACGGCCCATATNONE 
AK106328TACGGCCCATATConserved hypothetical protein. 
Os05g0440100015-006-F06TACGGCCCACGCNONE 
015-076-D04TACGGCCCACGCNONE 
AK073094TACGGCCCACGCNONE 
AK102786TACGGCCCACGCHistone deacetylase superfamily protein. 
J033107M16TACGGCCCACGCNONE 
Os05g0445500009-021-C05TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-129-D11TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-147-E04TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-169-C11TCCGGCCCATGGGCCGTGGGCCTCNONE 
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B. 
D21114TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023001K23TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023107J19TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023143J09TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065049D04TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065092I06TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065188H04TCCGGCCCATGGGCCGTGGGCCTCNONE 
Os05g0455600AK060152CACGGCCCAGTAPrenylated rab acceptor PRA1 family protein. 
AK103269CACGGCCCAGTANONE 
AK105995CACGGCCCAGTANONE 
J023109E13CACGGCCCAGTANONE 
J023120K13CACGGCCCAGTANONE 
J033124H03CACGGCCCAGTANONE 
Os05g0458100006-084-A05AGATGGGCCGTGNONE 
006-084-A05AGTGGGCCGTGNONE 
009-091-H05AGATGGGCCGTGNONE 
009-091-H05AGTGGGCCGTGNONE 
AJ557547AGATGGGCCGTGNONE 
AJ557547AGTGGGCCGTGNONE 
AK059467AGATGGGCCGTGNONE 
AK059467AGTGGGCCGTGNONE 
AK061127AGATGGGCCGTGNONE 
AK061127AGTGGGCCGTGNONE 
AK101652AGATGGGCCGTGSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
AK101652AGTGGGCCGTGSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06AGATGGGCCGTGNONE 
J033044K06AGTGGGCCGTGNONE 
J033057B20AGATGGGCCGTGNONE 
J033057B20AGTGGGCCGTGNONE 
J033087A05AGATGGGCCGTGNONE 
J033087A05AGTGGGCCGTGNONE 
J043009C05AGATGGGCCGTGNONE 
J043009C05AGTGGGCCGTGNONE 
J090009E10AGATGGGCCGTGNONE 
J090009E10AGTGGGCCGTGNONE 
Os05g0458400AK069936GATCCGACGGCCCAAACSimilar to AAA-metalloprotease FtsH. 
Os05g0480700AK100850AACTGGGCCGTCCSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11AACTGGGCCGTCCNONE 
Os05g0481600009-067-H08CACGGCCCATCCAAGGCCCAGANONE 
009-067-H08TACGGCCCATTANONE 
009-085-H10CACGGCCCATCCAAGGCCCAGANONE 
009-085-H10TACGGCCCATTANONE 
009-147-F04CACGGCCCATCCAAGGCCCAGANONE 
009-147-F04TACGGCCCATTANONE 
AK063820CACGGCCCATCCAAGGCCCAGAConserved hypothetical protein. 
AK063820TACGGCCCATTAConserved hypothetical protein. 
AK121540CACGGCCCATCCAAGGCCCAGANONE 
AK121540TACGGCCCATTANONE 
J023027H12CACGGCCCATCCAAGGCCCAGANONE 
J023027H12TACGGCCCATTANONE 
J033031M01CACGGCCCATCCAAGGCCCAGANONE 
J033031M01TACGGCCCATTANONE 
J053031M02CACGGCCCATCCAAGGCCCAGANONE 
J053031M02TACGGCCCATTANONE 
Os05g0490000011-076-C07CTTGGGCCGTANONE 
015-026-D07CTTGGGCCGTANONE 
015-074-A08CTTGGGCCGTANONE 
AK064335CTTGGGCCGTANONE 
AK101340CTTGGGCCGTAKrr1 family protein. 
J033034J18CTTGGGCCGTANONE 
Os05g0495100AK108028CCTGGGCCGTGGConserved hypothetical protein. 
Os05g0501300006-075-B11ATCTGGGCCGTTGNONE 
006-083-H08ATCTGGGCCGTTGNONE 
AK059889ATCTGGGCCGTTGSimilar to Flavoprotein wrbA (Trp repressor binding protein). 
J043030K02ATCTGGGCCGTTGNONE 
Os05g0520200006-031-F07TACGGCCCACTGGCCCATTANONE 
AK061451TACGGCCCACTGGCCCATTAThioredoxin-related domain containing protein. 
AK099433TACGGCCCACTGGCCCATTANONE 
Os05g0537200AK121713GGCCGTGGGCCGTGGSimilar to Myosin XI (Fragment). 
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein. 
Os05g0559900AK067197ACATGGGCCGTCtRNA-binding arm domain containing protein. 
J013074C15ACATGGGCCGTCNONE 
J013098O16ACATGGGCCGTCNONE 
J033030M01ACATGGGCCGTCNONE 
J090058H12ACATGGGCCGTCNONE 
J090075M06ACATGGGCCGTCNONE 
Os05g0565000AK102673GAAGCCCACGGCCCATTASimilar to 60S ribosomal protein L18a-1. 
AK102673TACGGCCCAACTSimilar to 60S ribosomal protein L18a-1. 
J033102C12GAAGCCCACGGCCCATTANONE 
J033102C12TACGGCCCAACTNONE 
J033124C13GAAGCCCACGGCCCATTANONE 
J033124C13TACGGCCCAACTNONE 
J043003L04GAAGCCCACGGCCCATTANONE 
J043003L04TACGGCCCAACTNONE 
J043006N08GAAGCCCACGGCCCATTANONE 
J043006N08TACGGCCCAACTNONE 
Os05g0566800AK065748GGTGGGCCGTGCold acclimation protein COR413-TM1. 
AK065748TCGTGGGCCGTCCold acclimation protein COR413-TM1. 
AY181210GGTGGGCCGTGNONE 
AY181210TCGTGGGCCGTCNONE 
Os05g0568600009-024-B09TTATGGGCCGTANONE 
AK063781TTATGGGCCGTAProtein of unknown function DUF1645 family protein. 
J080049H14TTATGGGCCGTANONE 
J080062M08TTATGGGCCGTANONE 
J080064I07TTATGGGCCGTANONE 
J080068A12TTATGGGCCGTANONE 
J080086J10TTATGGGCCGTANONE 
Os05g0577200AK069756TGATGGGCCGTGGCarboxylesterase, type B family protein. 
Os05g0587400AK102121GACGGCCCATAAPrefoldin domain containing protein. 
J033084N12GACGGCCCATAANONE 
Os05g0589000AK061980GACGGCCCAAACGCGGAGAGNONE 
AK099181GACGGCCCAAACGCGGAGAGConserved hypothetical protein. 
Os05g0592800AK067627CAACGGCCCAGASimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2). 
AK070388CAACGGCCCAGANONE 
AK104323CAACGGCCCAGANONE 
Os05g0597100011-044-C10GGACGGCCCAGCNONE 
AF255711GGACGGCCCAGCNONE 
AK072845GGACGGCCCAGCSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16GGACGGCCCAGCNONE 
J023135M22GGACGGCCCAGCNONE 
J023141B21GGACGGCCCAGCNONE 
J023142J09GGACGGCCCAGCNONE 
J033025E09GGACGGCCCAGCNONE 
J033111A20GGACGGCCCAGCNONE 
J033126I01GGACGGCCCAGCNONE 
Os06g0104000AK068490ACTGGGCCGTTConserved hypothetical protein. 
Os06g0105900AK072638CCATGGGCCGTCCGConserved hypothetical protein. 
Os06g0116800AK058985CACGGCCCAATASimilar to GFA2. 
AK120746CACGGCCCAATANONE 
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein. 
Os06g0147600AK107817TTATGGGCCGTAConserved hypothetical protein. 
Os06g0152400AK064640ATCCGACGGCCCAGATSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase). 
AK064640ATCTGGGCCGTCCSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase). 
J075086I24ATCCGACGGCCCAGATNONE 
J075086I24ATCTGGGCCGTCCNONE 
J075127E23ATCCGACGGCCCAGATNONE 
J075127E23ATCTGGGCCGTCCNONE 
J075157B19ATCCGACGGCCCAGATNONE 
J075157B19ATCTGGGCCGTCCNONE 
J090038E06ATCCGACGGCCCAGATNONE 
J090038E06ATCTGGGCCGTCCNONE 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0214300AK108107TACGGCCCAACTEsterase/lipase/thioesterase domain containing protein. 
Os06g0219600AK060429CAACGGCCCACAGCCCACGGSimilar to Poly(A)-binding protein II-like. 
AK099019CAACGGCCCACAGCCCACGGNONE 
J013118A14CAACGGCCCACAGCCCACGGNONE 
Os06g0225200005-009-B07AAATGGGCCGTTNONE 
AK067095AAATGGGCCGTTMitochodrial transcription termination factor-related family protein. 
AK104692AAATGGGCCGTTNONE 
J013096A05AAATGGGCCGTTNONE 
J090092C03AAATGGGCCGTTNONE 
Os06g0306600006-117-A07ACATGGGCCGTANONE 
AK070763ACATGGGCCGTAEsterase/lipase/thioesterase domain containing protein. 
AK099262ACATGGGCCGTANONE 
AK106075ACATGGGCCGTANONE 
Os06g0326400AK065052CCAACGGCCCAGATCTCTCCGCNONE 
AK121116CCAACGGCCCAGATCTCTCCGCPyrophosphate-dependent phosphofructokinase PfpB family protein. 
J013107E23CCAACGGCCCAGATCTCTCCGCNONE 
J013129K13CCAACGGCCCAGATCTCTCCGCNONE 
J023010F22CCAACGGCCCAGATCTCTCCGCNONE 
J023120K19CCAACGGCCCAGATCTCTCCGCNONE 
Os06g0498500AK099764TACGGCCCACTNONE 
AK103794TACGGCCCACTNucleolar complex-associated family protein. 
AK121899TACGGCCCACTNONE 
Os06g0547900AK100950TACGGCCCATCASimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665TACGGCCCATCANONE 
J023139I22TACGGCCCATCANONE 
J090066J10TACGGCCCATCANONE 
Y13437TACGGCCCATCANONE 
Os06g0555500016-056-B08AAATGGGCCGTANONE 
AK102375AAATGGGCCGTANONE 
AK106546AAATGGGCCGTAInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08AAATGGGCCGTANONE 
J033091P04AAATGGGCCGTANONE 
J090082P16AAATGGGCCGTANONE 
Os06g0560400AK103575TACGGCCCAAANONE 
AK108074TACGGCCCAAAProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0562700AK109753GACGGCCCACGTConserved hypothetical protein. 
Os06g0567000009-166-G12ATCCAACGGCCCACGGGNONE 
AK121337ATCCAACGGCCCACGGGProtein of unknown function UPF0197 family protein. 
J013122F01ATCCAACGGCCCACGGGNONE 
J023080N12ATCCAACGGCCCACGGGNONE 
J023120F03ATCCAACGGCCCACGGGNONE 
J065013B18ATCCAACGGCCCACGGGNONE 
J065039P21ATCCAACGGCCCACGGGNONE 
J065089E06ATCCAACGGCCCACGGGNONE 
J065095N19ATCCAACGGCCCACGGGNONE 
J065119H03ATCCAACGGCCCACGGGNONE 
J065121D18ATCCAACGGCCCACGGGNONE 
J065149G04ATCCAACGGCCCACGGGNONE 
J075012J04ATCCAACGGCCCACGGGNONE 
J075021G13ATCCAACGGCCCACGGGNONE 
J075106I23ATCCAACGGCCCACGGGNONE 
J075107F19ATCCAACGGCCCACGGGNONE 
J075152J22ATCCAACGGCCCACGGGNONE 
J075186J20ATCCAACGGCCCACGGGNONE 
J075188F16ATCCAACGGCCCACGGGNONE 
J080001G06ATCCAACGGCCCACGGGNONE 
J080002O09ATCCAACGGCCCACGGGNONE 
J080006E10ATCCAACGGCCCACGGGNONE 
J080006F24ATCCAACGGCCCACGGGNONE 
J080012L07ATCCAACGGCCCACGGGNONE 
J080016A10ATCCAACGGCCCACGGGNONE 
J080017D11ATCCAACGGCCCACGGGNONE 
J080017I04ATCCAACGGCCCACGGGNONE 
J080017I10ATCCAACGGCCCACGGGNONE 
J080020P06ATCCAACGGCCCACGGGNONE 
J080024A20ATCCAACGGCCCACGGGNONE 
J080027B10ATCCAACGGCCCACGGGNONE 
J080027E03ATCCAACGGCCCACGGGNONE 
J080027I01ATCCAACGGCCCACGGGNONE 
J080027K20ATCCAACGGCCCACGGGNONE 
J080041L12ATCCAACGGCCCACGGGNONE 
J080043D21ATCCAACGGCCCACGGGNONE 
J080044K11ATCCAACGGCCCACGGGNONE 
J080048I08ATCCAACGGCCCACGGGNONE 
J080049M12ATCCAACGGCCCACGGGNONE 
J080050C14ATCCAACGGCCCACGGGNONE 
J080050N21ATCCAACGGCCCACGGGNONE 
J080053F04ATCCAACGGCCCACGGGNONE 
J080054O16ATCCAACGGCCCACGGGNONE 
J080058O21ATCCAACGGCCCACGGGNONE 
J080059M11ATCCAACGGCCCACGGGNONE 
J080061A11ATCCAACGGCCCACGGGNONE 
J080063B15ATCCAACGGCCCACGGGNONE 
J080063F22ATCCAACGGCCCACGGGNONE 
J080066M18ATCCAACGGCCCACGGGNONE 
J080068D12ATCCAACGGCCCACGGGNONE 
J080070D22ATCCAACGGCCCACGGGNONE 
J080071B06ATCCAACGGCCCACGGGNONE 
J080072B17ATCCAACGGCCCACGGGNONE 
J080081O04ATCCAACGGCCCACGGGNONE 
J080089H05ATCCAACGGCCCACGGGNONE 
J080093K13ATCCAACGGCCCACGGGNONE 
J080095I05ATCCAACGGCCCACGGGNONE 
J080097F19ATCCAACGGCCCACGGGNONE 
J080304C03ATCCAACGGCCCACGGGNONE 
J080304H11ATCCAACGGCCCACGGGNONE 
J080308M21ATCCAACGGCCCACGGGNONE 
J080313O15ATCCAACGGCCCACGGGNONE 
J090020N23ATCCAACGGCCCACGGGNONE 
J100023C12ATCCAACGGCCCACGGGNONE 
Os06g0592500AK119729CAACGGCCCAAAASimilar to Ethylene-responsive transcriptional coactivator. 
AK122052CAACGGCCCAAAANONE 
Os06g0593100AK060274AACGGCCCATGASimilar to UDP-galactose/UDP-glucose transporter. 
AK071175AACGGCCCATGANONE 
Os06g0598900AK100386TACGGCCCAGCCCAACASimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05TACGGCCCAGCCCAACANONE 
J090043L20TACGGCCCAGCCCAACANONE 
Os06g0647100009-005-F12CACGGCCCACCTNONE 
009-113-D11CACGGCCCACCTNONE 
009-132-D09CACGGCCCACCTNONE 
009-147-G06CACGGCCCACCTNONE 
AK066837CACGGCCCACCTSimilar to 50S ribosomal protein L35, chloroplast precursor (CL35). 
J065073M03CACGGCCCACCTNONE 
Os06g0656800AK109762ATCTGGGCCGTABeta-Ig-H3/fasciclin domain containing protein. 
Os06g0664400Os06g0664400ATCCAACGGCCCAGAHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os06g0667400AK065424GACGGCCCAGATConserved hypothetical protein. 
AK065580GACGGCCCAGATNONE 
Os06g0673500J100018J12GACGGCCCATGTNONE 
J100072F13GACGGCCCATGTSimilar to Ubiquitin. 
Os06g0673800AK066054TACGGCCCAAATHypothetical protein. 
Os06g0683200AK060024CTTGGGCCGTASimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432CTTGGGCCGTANONE 
J023002B12CTTGGGCCGTANONE 
J023054E10CTTGGGCCGTANONE 
J023123F19CTTGGGCCGTANONE 
J065035K13CTTGGGCCGTANONE 
J065129P09CTTGGGCCGTANONE 
J065184B14CTTGGGCCGTANONE 
Os06g0690600AK107925GACGGCCCAACTConserved hypothetical protein. 
Os06g0702800009-039-E05GGACGGCCCATGANONE 
AK073948GGACGGCCCATGAHypothetical protein. 
J023108K23GGACGGCCCATGANONE 
J033072H04GGACGGCCCATGANONE 
J065008G05GGACGGCCCATGANONE 
J065128J12GGACGGCCCATGANONE 
J065131A01GGACGGCCCATGANONE 
J065173B12GGACGGCCCATGANONE 
Os06g0709100006-057-D06GCTGGGCCGTCNONE 
011-040-A08GCTGGGCCGTCNONE 
016-044-A01GCTGGGCCGTCNONE 
AK059732GCTGGGCCGTCNONE 
AK070881GCTGGGCCGTCCyclin-like F-box domain containing protein. 
AK103683GCTGGGCCGTCNONE 
J065026P10GCTGGGCCGTCNONE 
J090017L13GCTGGGCCGTCNONE 
Os06g0726800AK070518GATCCGACGGCCCAGATG2/mitotic-specific cyclin 2 (B-like cyclin) (CycOs2). 
J023055K12GATCCGACGGCCCAGATNONE 
J053032B13GATCCGACGGCCCAGATNONE 
X82036GATCCGACGGCCCAGATNONE 
Os07g0105300AK107419CACGGCCCATAConserved hypothetical protein. 
AK107419CACGGCCCATTTConserved hypothetical protein. 
AK109521CACGGCCCATANONE 
AK109521CACGGCCCATTTNONE 
Os07g0114550J090025L18AACGGCCCATGTHypothetical protein. 
Os07g0142900003-001-H01ATTTGGGCCGTCCNONE 
AK060737ATTTGGGCCGTCCAldo/keto reductase family protein. 
AK064848ATTTGGGCCGTCCNONE 
Os07g0146600J075074M15CACGGCCCAACAConserved hypothetical protein. 
J075120F11CACGGCCCAACANONE 
J075170L13CACGGCCCAACANONE 
J080302A21CACGGCCCAACANONE 
J080304J04CACGGCCCAACANONE 
J080308I12CACGGCCCAACANONE 
J080312F11CACGGCCCAACANONE 
J080315M22CACGGCCCAACANONE 
Os07g0158300006-049-G04TACGGCCCATTANONE 
AK099188TACGGCCCATTANONE 
AK104773TACGGCCCATTANONE 
J013106F16TACGGCCCATTANONE 
J013123H22TACGGCCCATTANONE 
J023029J02TACGGCCCATTANONE 
J023029J03TACGGCCCATTANONE 
J033138N08TACGGCCCATTANONE 
J075011F05TACGGCCCATTANONE 
J075022F10TACGGCCCATTANONE 
J075071L13TACGGCCCATTANONE 
J075094B08TACGGCCCATTANONE 
J075119B21TACGGCCCATTANONE 
J075140L02TACGGCCCATTANONE 
J075199O21TACGGCCCATTANONE 
J080001I17TACGGCCCATTANONE 
J080005M04TACGGCCCATTANONE 
J080011P17TACGGCCCATTANONE 
J080026B14TACGGCCCATTANONE 
J080026C12TACGGCCCATTANONE 
J080030N16TACGGCCCATTANONE 
J080035K23TACGGCCCATTANONE 
J080039J22TACGGCCCATTANONE 
J080045D04TACGGCCCATTANONE 
J080050C06TACGGCCCATTANONE 
J080050K14TACGGCCCATTANONE 
J080051I09TACGGCCCATTANONE 
J080053F18TACGGCCCATTANONE 
J080053G10TACGGCCCATTANONE 
J080055F05TACGGCCCATTANONE 
J080057E22TACGGCCCATTANONE 
J080058F17TACGGCCCATTANONE 
J080063C18TACGGCCCATTANONE 
J080065E02TACGGCCCATTANONE 
J080066E06TACGGCCCATTANONE 
J080067O05TACGGCCCATTANONE 
J080068N15TACGGCCCATTANONE 
J080071O04TACGGCCCATTANONE 
J080074A20TACGGCCCATTANONE 
J080074E14TACGGCCCATTANONE 
J080074L05TACGGCCCATTANONE 
J080075E08TACGGCCCATTANONE 
J080075H07TACGGCCCATTANONE 
J080077D04TACGGCCCATTANONE 
J080077N15TACGGCCCATTANONE 
J080078A07TACGGCCCATTANONE 
J080079H22TACGGCCCATTANONE 
J080080F20TACGGCCCATTANONE 
J080080M22TACGGCCCATTANONE 
J080081K09TACGGCCCATTANONE 
J080081L04TACGGCCCATTANONE 
J080090K09TACGGCCCATTANONE 
J080093O13TACGGCCCATTANONE 
J080094A18TACGGCCCATTANONE 
J080094E10TACGGCCCATTANONE 
J080094H06TACGGCCCATTANONE 
J080096I21TACGGCCCATTANONE 
J100081A19TACGGCCCATTANONE 
Os07g0160300AK065685TCTGGGCCGTGConserved hypothetical protein. 
J013020G13TCTGGGCCGTGNONE 
J013024B14TCTGGGCCGTGNONE 
J013040D10TCTGGGCCGTGNONE 
J043024N02TCTGGGCCGTGNONE 
J065063E19TCTGGGCCGTGNONE 
J065200G01TCTGGGCCGTGNONE 
J090098A05TCTGGGCCGTGNONE 
J100089M23TCTGGGCCGTGNONE 
Os07g0164500J013094M18GGCTGGGCCGTGNONE 
J013153L05GGCTGGGCCGTGNONE 
J023011J18GGCTGGGCCGTGNONE 
J023106H21GGCTGGGCCGTGNONE 
J033105F10GGCTGGGCCGTGNONE 
J065210M20GGCTGGGCCGTGSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05GGCTGGGCCGTGNONE 
J090061C13GGCTGGGCCGTGNONE 
J090074K15GGCTGGGCCGTGNONE 
Os07g0169600006-027-F04AGATGGGCCGTTGNONE 
006-043-C10AGATGGGCCGTTGNONE 
006-070-A04AGATGGGCCGTTGNONE 
006-081-F03AGATGGGCCGTTGNONE 
006-104-F02AGATGGGCCGTTGNONE 
012-006-D12AGATGGGCCGTTGNONE 
AK060318AGATGGGCCGTTGNONE 
AK121818AGATGGGCCGTTG2OG-Fe(II) oxygenase domain containing protein. 
J023065K01AGATGGGCCGTTGNONE 
J023086G17AGATGGGCCGTTGNONE 
J023093G16AGATGGGCCGTTGNONE 
J033024N04AGATGGGCCGTTGNONE 
J033099A15AGATGGGCCGTTGNONE 
J033107B14AGATGGGCCGTTGNONE 
J043026F14AGATGGGCCGTTGNONE 
J065043P20AGATGGGCCGTTGNONE 
J075118L16AGATGGGCCGTTGNONE 
J075162M22AGATGGGCCGTTGNONE 
J080004K13AGATGGGCCGTTGNONE 
J080024D10AGATGGGCCGTTGNONE 
J080037C21AGATGGGCCGTTGNONE 
J080039M17AGATGGGCCGTTGNONE 
J080040A03AGATGGGCCGTTGNONE 
J080044A07AGATGGGCCGTTGNONE 
J080045I07AGATGGGCCGTTGNONE 
J080052L06AGATGGGCCGTTGNONE 
J080053A20AGATGGGCCGTTGNONE 
J080060L15AGATGGGCCGTTGNONE 
J080060N22AGATGGGCCGTTGNONE 
J080062L23AGATGGGCCGTTGNONE 
J080069B19AGATGGGCCGTTGNONE 
J080086K15AGATGGGCCGTTGNONE 
J080089H16AGATGGGCCGTTGNONE 
J080089I23AGATGGGCCGTTGNONE 
J080094P07AGATGGGCCGTTGNONE 
J090032L18AGATGGGCCGTTGNONE 
J100044E09AGATGGGCCGTTGNONE 
J100045O03AGATGGGCCGTTGNONE 
J100066B11AGATGGGCCGTTGNONE 
J100069J24AGATGGGCCGTTGNONE 
Os07g0180900006-055-B11GACGGCCCATCTNONE 
006-103-F09GACGGCCCATCTNONE 
011-009-E03GACGGCCCATCTNONE 
011-035-H08GACGGCCCATCTNONE 
014-043-F08GACGGCCCATCTNONE 
AK060711GACGGCCCATCTRibosomal protein L4/L1e family protein. 
AK060963GACGGCCCATCTNONE 
AK104447GACGGCCCATCTNONE 
AK104504GACGGCCCATCTNONE 
AK104629GACGGCCCATCTNONE 
J023003P15GACGGCCCATCTNONE 
J023075H14GACGGCCCATCTNONE 
J033101N17GACGGCCCATCTNONE 
J033132M11GACGGCCCATCTNONE 
J065081C24GACGGCCCATCTNONE 
J080004L10GACGGCCCATCTNONE 
J080009H21GACGGCCCATCTNONE 
J080013F01GACGGCCCATCTNONE 
J080022K24GACGGCCCATCTNONE 
J080023C22GACGGCCCATCTNONE 
J080024M16GACGGCCCATCTNONE 
J080026K06GACGGCCCATCTNONE 
J080030J23GACGGCCCATCTNONE 
J080030L05GACGGCCCATCTNONE 
J080031G03GACGGCCCATCTNONE 
J080033C03GACGGCCCATCTNONE 
J080033D02GACGGCCCATCTNONE 
J080035A11GACGGCCCATCTNONE 
J080035A14GACGGCCCATCTNONE 
J080039E08GACGGCCCATCTNONE 
J080040L15GACGGCCCATCTNONE 
J080040M03GACGGCCCATCTNONE 
J080041L21GACGGCCCATCTNONE 
J080043E09GACGGCCCATCTNONE 
J080048B14GACGGCCCATCTNONE 
J080048O09GACGGCCCATCTNONE 
J080051H01GACGGCCCATCTNONE 
J080052H06GACGGCCCATCTNONE 
J080065K05GACGGCCCATCTNONE 
J080066D10GACGGCCCATCTNONE 
J080066E23GACGGCCCATCTNONE 
J080069F10GACGGCCCATCTNONE 
J080074M06GACGGCCCATCTNONE 
J080075D13GACGGCCCATCTNONE 
J080076G02GACGGCCCATCTNONE 
J080082G15GACGGCCCATCTNONE 
J080082K06GACGGCCCATCTNONE 
J080082P12GACGGCCCATCTNONE 
J080085F01GACGGCCCATCTNONE 
J080090H22GACGGCCCATCTNONE 
J080092D07GACGGCCCATCTNONE 
J080094M03GACGGCCCATCTNONE 
J080094O10GACGGCCCATCTNONE 
J090008I06GACGGCCCATCTNONE 
J100058N20GACGGCCCATCTNONE 
J100060M07GACGGCCCATCTNONE 
J100062M08GACGGCCCATCTNONE 
J100064L07GACGGCCCATCTNONE 
J100073H16GACGGCCCATCTNONE 
J100074C10GACGGCCCATCTNONE 
J100075N06GACGGCCCATCTNONE 
J100087P11GACGGCCCATCTNONE 
J100088B13GACGGCCCATCTNONE 
J100088J16GACGGCCCATCTNONE 
J100088L17GACGGCCCATCTNONE 
J100088O12GACGGCCCATCTNONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0190900012-063-F11TCTGGGCCGTTTGGGCCGAANONE 
AK073533TCTGGGCCGTTTGGGCCGAASMAD/FHA domain containing protein. 
J013110O09TCTGGGCCGTTTGGGCCGAANONE 
J033041I12TCTGGGCCGTTTGGGCCGAANONE 
J033046D05TCTGGGCCGTTTGGGCCGAANONE 
J033101K24TCTGGGCCGTTTGGGCCGAANONE 
J090009F10TCTGGGCCGTTTGGGCCGAANONE 
J090095B17TCTGGGCCGTTTGGGCCGAANONE 
Os07g0191000AK071379TTCGGCCCAAACGGCCCAGAInositol monophosphatase family protein. 
AK103440TTCGGCCCAAACGGCCCAGANONE 
Os07g0209000AK059111GATCGGACGGCCCAGATSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK099319GATCGGACGGCCCAGATNONE 
Os07g0213600AK107696CACGGCCCATTAPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J100067F09CACGGCCCATTANONE 
J100082J05CACGGCCCATTANONE 
Os07g0222800009-072-E05AAACGGCCCAGCNONE 
AK060442AAACGGCCCAGCNONE 
AK100823AAACGGCCCAGCAcyl carrier protein-like protein. 
AK103131AAACGGCCCAGCNONE 
AY224456AAACGGCCCAGCNONE 
J075026H13AAACGGCCCAGCNONE 
J075142G06AAACGGCCCAGCNONE 
J100033K08AAACGGCCCAGCNONE 
Os07g0224000009-060-E01GACGGCCCACTNONE 
J065042D20GACGGCCCACTNONE 
J065127D14GACGGCCCACTNONE 
J065176C24GACGGCCCACTNONE 
J065188M12GACGGCCCACTNONE 
J065194L14GACGGCCCACTNONE 
J075060P09GACGGCCCACTNONE 
J075134C14GACGGCCCACTRibosomal protein L24E family protein. 
J075192M12GACGGCCCACTNONE 
J100032N01GACGGCCCACTNONE 
Os07g0245100J023048C16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J023110L14CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053023B18CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053031L17CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065035I22CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065043D21CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065072L16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065214I23CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
Os07g0301200AB110202AGTGGGCCGTGNONE 
AB110202CTTGGGCCGTGCTTGGGCCGTGGNONE 
AB110202GCCGGCCCGGCACGGCCCAGCNONE 
AK073463AGTGGGCCGTGSimilar to RNA helicase (Fragment). 
AK073463CTTGGGCCGTGCTTGGGCCGTGGSimilar to RNA helicase (Fragment). 
AK073463GCCGGCCCGGCACGGCCCAGCSimilar to RNA helicase (Fragment). 
Os07g0546700009-110-H10TACTGGGCCGTCNONE 
AK058262TACTGGGCCGTCNONE 
J065154I05TACTGGGCCGTCNONE 
J065175P09TACTGGGCCGTCNONE 
J065187F11TACTGGGCCGTCNONE 
J075114K16TACTGGGCCGTCNONE 
J090031L21TACTGGGCCGTCNONE 
U86017TACTGGGCCGTCSimilar to 60S ribosomal protein L38. 
Os07g0555400AK070977CTTGGGCCGTGCTTGGGCTGAConserved hypothetical protein. 
Os07g0563700AK121078GGACGGCCCAGATIKI3 family protein. 
Os07g0565600AK071983CCTGGGCCGTTSimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481CCTGGGCCGTTNONE 
Os07g0570700AK065242AAACGGCCCATTARibosome recycling factor family protein. 
J013002I12AAACGGCCCATTANONE 
Os07g0586700AK102792CACGGCCCAAACCCAGCCCAAAAConserved hypothetical protein. 
Os07g0589400AK072501CACGGCCCACGCGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617CACGGCCCACGCGNONE 
AK104756CACGGCCCACGCGNONE 
Os07g0598100AK068136GTATGGGCCTGGGCCGTASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
Os07g0606900011-039-F09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
011-058-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-014-C08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-062-H02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-067-G01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-029-A08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-039-H09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-044-A09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-047-G10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-065-C04GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-067-C10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-078-H10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-084-A06GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-050-F01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-F04GGTGGGCCCCACCTGTCGGTGGGCCGTGGHeavy metal transport/detoxification protein domain containing protein. 
016-062-C02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J065170E01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J075122G11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
Os07g0607200AK065746CCAAGCCCACGGCCCAACCProtein of unknown function DUF751 family protein. 
J065037B15CCAAGCCCACGGCCCAACCNONE 
J065042E20CCAAGCCCACGGCCCAACCNONE 
J065161I08CCAAGCCCACGGCCCAACCNONE 
Os07g0611700AK109158CGCGTGCGCACGGCCCATGPeptidase C1A, papain family protein. 
Os07g0611800Os07g0611800CGCGTGCGCACGGCCCATGNONE 
Os07g0623300AK070292GACGGCCCACASimilar to Splicing factor SC35. 
J023050C05GACGGCCCACANONE 
J090025O12GACGGCCCACANONE 
Os07g0626300AK100052CCATGGGCCACGGCCCATGTConserved hypothetical protein. 
Os07g0641700009-030-F09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
014-030-D10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AF009413AAATGGGCCGTGGAGGTGGGCCGGTSimilar to 10 kDa chaperonin (Protein CPN10) (Protein groES). 
AK059154AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK119728AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK122129AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023057A19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023143P09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J033132M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065039D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065062M22AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065071L10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065088N13AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065115D21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065187D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011B03AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075029J17AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075038J07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075065A18AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075083P05AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075101G24AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075127E19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075161K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075175D23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090044M07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065G16AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065J11AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090097M02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090099D02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100056A20AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100063M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
Os07g0656400011-061-F11CAACGGCCCATAConserved hypothetical protein. 
011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
Os07g0668200AK059051CAACGGCCCATCANONE 
AK101682CAACGGCCCATCAConserved hypothetical protein. 
AK102839CAACGGCCCATCANONE 
Os07g0674100AB183706AACGGCCCACGGUDP-glucuronic acid decarboxylase. 
AK099614AACGGCCCACGGNONE 
J013050E02AACGGCCCACGGNONE 
J065162F06AACGGCCCACGGNONE 
J065180F10AACGGCCCACGGNONE 
J090049F09AACGGCCCACGGNONE 
J100064L11AACGGCCCACGGNONE 
Os07g0681500AK103662GATCGGACGGCCCAGATNONE 
AK121650GATCGGACGGCCCAGATAnkyrin repeat containing protein. 
Os07g0686500AK119424CCCGTGGGCCGTGGProtein of unknown function DUF630 domain containing protein. 
J065064P13CCCGTGGGCCGTGGNONE 
J065070L21CCCGTGGGCCGTGGNONE 
J065196A06CCCGTGGGCCGTGGNONE 
J065216M14CCCGTGGGCCGTGGNONE 
Os07g0688100AK101635ATATGGGCCGTAProtein prenyltransferase domain containing protein. 
AK101635ATATGGGCCGTCProtein prenyltransferase domain containing protein. 
J033055B02ATATGGGCCGTANONE 
J033055B02ATATGGGCCGTCNONE 
J090013O08ATATGGGCCGTANONE 
J090013O08ATATGGGCCGTCNONE 
J090074A17ATATGGGCCGTANONE 
J090074A17ATATGGGCCGTCNONE 
Os07g0693100AB111050CCGTGGGCCGTANONE 
AK100433CCGTGGGCCGTASimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC). 
J023054O07CCGTGGGCCGTANONE 
J023088C24CCGTGGGCCGTANONE 
J023088I11CCGTGGGCCGTANONE 
Os08g0116500009-007-E05CACGGCCCACCNONE 
009-074-C07CACGGCCCACCNONE 
009-098-A07CACGGCCCACCNONE 
009-100-C03CACGGCCCACCNONE 
009-136-E04CACGGCCCACCNONE 
009-138-B08CACGGCCCACCNONE 
009-144-B06CACGGCCCACCNONE 
009-184-E04CACGGCCCACCNONE 
009-189-F01CACGGCCCACCNONE 
013-006-E05CACGGCCCACCNONE 
013-015-C10CACGGCCCACCNONE 
013-019-F09CACGGCCCACCNONE 
013-020-C01CACGGCCCACCNONE 
013-021-F05CACGGCCCACCNONE 
013-035-D08CACGGCCCACCNONE 
013-038-C09CACGGCCCACCNONE 
013-054-B07CACGGCCCACCNONE 
013-061-G10CACGGCCCACCNONE 
013-074-B01CACGGCCCACCNONE 
013-079-B06CACGGCCCACCNONE 
013-099-B09CACGGCCCACCNONE 
013-099-G11CACGGCCCACCNONE 
014-023-F04CACGGCCCACCNONE 
014-032-C07CACGGCCCACCNONE 
014-045-E02CACGGCCCACCNONE 
014-085-C02CACGGCCCACCNONE 
014-087-F04CACGGCCCACCNONE 
014-089-C04CACGGCCCACCNONE 
014-090-E01CACGGCCCACCNONE 
014-094-G11CACGGCCCACCNONE 
014-097-B07CACGGCCCACCNONE 
015-024-A12CACGGCCCACCNONE 
015-032-C06CACGGCCCACCNONE 
016-053-E09CACGGCCCACCNONE 
016-081-F10CACGGCCCACCNONE 
AK058240CACGGCCCACCSimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09CACGGCCCACCNONE 
J023107O19CACGGCCCACCNONE 
J053029K21CACGGCCCACCNONE 
J053073P11CACGGCCCACCNONE 
J053074B04CACGGCCCACCNONE 
J053078M14CACGGCCCACCNONE 
J065001E12CACGGCCCACCNONE 
J065006J12CACGGCCCACCNONE 
J065015C06CACGGCCCACCNONE 
J065025D13CACGGCCCACCNONE 
J065029A04CACGGCCCACCNONE 
J065031D23CACGGCCCACCNONE 
J065032E24CACGGCCCACCNONE 
J065034P16CACGGCCCACCNONE 
J065043B04CACGGCCCACCNONE 
J065044A15CACGGCCCACCNONE 
J065062D18CACGGCCCACCNONE 
J065079G13CACGGCCCACCNONE 
J065080A19CACGGCCCACCNONE 
J065080A20CACGGCCCACCNONE 
J065089N19CACGGCCCACCNONE 
J065111O07CACGGCCCACCNONE 
J065115N15CACGGCCCACCNONE 
J065131A04CACGGCCCACCNONE 
J065138H02CACGGCCCACCNONE 
J065139K10CACGGCCCACCNONE 
J065144A02CACGGCCCACCNONE 
J065155J17CACGGCCCACCNONE 
J065159D18CACGGCCCACCNONE 
J065159I18CACGGCCCACCNONE 
J065167H12CACGGCCCACCNONE 
J065174C22CACGGCCCACCNONE 
J065184A05CACGGCCCACCNONE 
J065188M15CACGGCCCACCNONE 
J065191D23CACGGCCCACCNONE 
J065203C07CACGGCCCACCNONE 
J065207C23CACGGCCCACCNONE 
J065207L16CACGGCCCACCNONE 
J065212F01CACGGCCCACCNONE 
J065212F05CACGGCCCACCNONE 
J075037B07CACGGCCCACCNONE 
J075042F15CACGGCCCACCNONE 
J075059J03CACGGCCCACCNONE 
J075068M18CACGGCCCACCNONE 
J075079E13CACGGCCCACCNONE 
J075081F12CACGGCCCACCNONE 
J075083I05CACGGCCCACCNONE 
J075123K23CACGGCCCACCNONE 
J075142F16CACGGCCCACCNONE 
J075156N03CACGGCCCACCNONE 
J075162K05CACGGCCCACCNONE 
J075171E08CACGGCCCACCNONE 
J075177N03CACGGCCCACCNONE 
J075182K17CACGGCCCACCNONE 
J075186K02CACGGCCCACCNONE 
J075191K05CACGGCCCACCNONE 
J080011E10CACGGCCCACCNONE 
J080016M21CACGGCCCACCNONE 
J080017A17CACGGCCCACCNONE 
J080031O09CACGGCCCACCNONE 
J080039G21CACGGCCCACCNONE 
J080041B01CACGGCCCACCNONE 
J080050G20CACGGCCCACCNONE 
J080054A12CACGGCCCACCNONE 
J080058O08CACGGCCCACCNONE 
J080061N04CACGGCCCACCNONE 
J080064L23CACGGCCCACCNONE 
J080064P05CACGGCCCACCNONE 
J080069I17CACGGCCCACCNONE 
J080070E07CACGGCCCACCNONE 
J080071B20CACGGCCCACCNONE 
J080074L08CACGGCCCACCNONE 
J080076N08CACGGCCCACCNONE 
J080081A14CACGGCCCACCNONE 
J080081J17CACGGCCCACCNONE 
J080085N14CACGGCCCACCNONE 
J080090B09CACGGCCCACCNONE 
J080097L11CACGGCCCACCNONE 
J080306H13CACGGCCCACCNONE 
J080307H13CACGGCCCACCNONE 
J080311F12CACGGCCCACCNONE 
J080316L23CACGGCCCACCNONE 
J080318H02CACGGCCCACCNONE 
J090016L15CACGGCCCACCNONE 
J090019I02CACGGCCCACCNONE 
J090031G21CACGGCCCACCNONE 
J090066C15CACGGCCCACCNONE 
J100032I02CACGGCCCACCNONE 
J100032N07CACGGCCCACCNONE 
J100032N16CACGGCCCACCNONE 
J100041P21CACGGCCCACCNONE 
J100048M04CACGGCCCACCNONE 
J100048M14CACGGCCCACCNONE 
J100063B08CACGGCCCACCNONE 
J100088E20CACGGCCCACCNONE 
J100090I08CACGGCCCACCNONE 
Os08g0117400006-086-A09GACGGCCCACCANONE 
006-103-C02GACGGCCCACCANONE 
AK059891GACGGCCCACCASimilar to Calmodulin 1 (Fragment). 
AK103863GACGGCCCACCANONE 
AY224521GACGGCCCACCANONE 
J033149E23GACGGCCCACCANONE 
J065062E05GACGGCCCACCANONE 
J065083O05GACGGCCCACCANONE 
J065116D14GACGGCCCACCANONE 
J065158F16GACGGCCCACCANONE 
J065179N16GACGGCCCACCANONE 
J065206N23GACGGCCCACCANONE 
Os08g0120000006-042-E02AAACGGCCCAACANONE 
006-051-F06AAACGGCCCAACANONE 
006-052-G03AAACGGCCCAACANONE 
006-095-B11AAACGGCCCAACANONE 
AB017427AAACGGCCCAACANONE 
AB017428AAACGGCCCAACANONE 
AK059789AAACGGCCCAACANONE 
AK059815AAACGGCCCAACASuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077AAACGGCCCAACANONE 
AK102607AAACGGCCCAACANONE 
AK104303AAACGGCCCAACANONE 
AK104304AAACGGCCCAACANONE 
AK104421AAACGGCCCAACANONE 
D10414AAACGGCCCAACANONE 
J013170D08AAACGGCCCAACANONE 
J023086D16AAACGGCCCAACANONE 
J033099B04AAACGGCCCAACANONE 
J065042P05AAACGGCCCAACANONE 
J065144E22AAACGGCCCAACANONE 
J065162J20AAACGGCCCAACANONE 
J065196N13AAACGGCCCAACANONE 
J090013B11AAACGGCCCAACANONE 
Os08g0133000006-050-B01AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
006-068-G03AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK061574AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
J065108C24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075075K24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075092A19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J100061O19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
Os08g0143500006-072-G06TTTTGGGCCGTTNONE 
016-053-H02TTTTGGGCCGTTNONE 
AK061094TTTTGGGCCGTTNONE 
AK071122TTTTGGGCCGTTGlycosyl transferase, family 14 protein. 
J023081E17TTTTGGGCCGTTNONE 
J023106O18TTTTGGGCCGTTNONE 
J043001N22TTTTGGGCCGTTNONE 
J065062D05TTTTGGGCCGTTNONE 
J065099M15TTTTGGGCCGTTNONE 
J065180K12TTTTGGGCCGTTNONE 
J090045L23TTTTGGGCCGTTNONE 
J100088K05TTTTGGGCCGTTNONE 
Os08g0162500AK121633GACGGCCCACCTGTConserved hypothetical protein. 
J033105E19GACGGCCCACCTGTNONE 
J080012K11GACGGCCCACCTGTNONE 
J080041I12GACGGCCCACCTGTNONE 
J080049G05GACGGCCCACCTGTNONE 
J080050P09GACGGCCCACCTGTNONE 
J080051A10GACGGCCCACCTGTNONE 
J080054G05GACGGCCCACCTGTNONE 
J080058M08GACGGCCCACCTGTNONE 
J080064N23GACGGCCCACCTGTNONE 
J080072L15GACGGCCCACCTGTNONE 
J080096H09GACGGCCCACCTGTNONE 
J100079I08GACGGCCCACCTGTNONE 
Os08g0175200AK072367TACGGCCCAGATProtein of unknown function DUF292, eukaryotic domain containing protein. 
J013149H16TACGGCCCAGATNONE 
J023075K04TACGGCCCAGATNONE 
J023082L15TACGGCCCAGATNONE 
J043015G07TACGGCCCAGATNONE 
J065052L17TACGGCCCAGATNONE 
J065202P07TACGGCCCAGATNONE 
J075061D17TACGGCCCAGATNONE 
J100088P13TACGGCCCAGATNONE 
Os08g0178100AK101717AATTGGGCCACGGCCCATGAPep3/Vps18/deep orange domain containing protein. 
Os08g0191900AK067587CTTGGGCCGTGProtein prenyltransferase domain containing protein. 
AK099016CTTGGGCCGTGNONE 
J013032I08CTTGGGCCGTGNONE 
J013050I24CTTGGGCCGTGNONE 
J013128E05CTTGGGCCGTGNONE 
Os08g0192800AK059490ATCTGGGCCGTCCGATCNONE 
AK101678ATCTGGGCCGTCCGATCNONE 
AK120613ATCTGGGCCGTCCGATCBromodomain containing protein. 
J080039B22ATCTGGGCCGTCCGATCNONE 
J080039I23ATCTGGGCCGTCCGATCNONE 
J080074D19ATCTGGGCCGTCCGATCNONE 
J080086N13ATCTGGGCCGTCCGATCNONE 
Os08g0195400006-057-E04CCTGGGCCGTGNONE 
006-057-E04CGATGGGCCGTCNONE 
006-060-B10CCTGGGCCGTGNONE 
006-060-B10CGATGGGCCGTCNONE 
AK070464CCTGGGCCGTGConserved hypothetical protein. 
AK070464CGATGGGCCGTCConserved hypothetical protein. 
AK104389CCTGGGCCGTGNONE 
AK104389CGATGGGCCGTCNONE 
AK106140CCTGGGCCGTGNONE 
AK106140CGATGGGCCGTCNONE 
J023013G08CCTGGGCCGTGNONE 
J023013G08CGATGGGCCGTCNONE 
J023054K19CCTGGGCCGTGNONE 
J023054K19CGATGGGCCGTCNONE 
J023089D18CCTGGGCCGTGNONE 
J023089D18CGATGGGCCGTCNONE 
J023092K05CCTGGGCCGTGNONE 
J023092K05CGATGGGCCGTCNONE 
J033025A08CCTGGGCCGTGNONE 
J033025A08CGATGGGCCGTCNONE 
J033067P12CCTGGGCCGTGNONE 
J033067P12CGATGGGCCGTCNONE 
J033098A10CCTGGGCCGTGNONE 
J033098A10CGATGGGCCGTCNONE 
J065219L04CCTGGGCCGTGNONE 
J065219L04CGATGGGCCGTCNONE 
J090021P06CCTGGGCCGTGNONE 
J090021P06CGATGGGCCGTCNONE 
J090062M05CCTGGGCCGTGNONE 
J090062M05CGATGGGCCGTCNONE 
J090079F15CCTGGGCCGTGNONE 
J090079F15CGATGGGCCGTCNONE 
J100041H19CCTGGGCCGTGNONE 
J100041H19CGATGGGCCGTCNONE 
Os08g0224200AK101331GGCCGGGCCTGGGCCGTGSimilar to Ythdf2-prov protein. 
AK101331TGTTGGGCCGTGCCTGGGCCGTGSimilar to Ythdf2-prov protein. 
Os08g0243600AB110183CACGGCCCAAAANONE 
AK101443CACGGCCCAAAAHaloacid dehalogenase-like hydrolase domain containing protein. 
Os08g0243900011-052-H03GTTTGGGCCGTGNONE 
AK102707GTTTGGGCCGTGNONE 
AK121452GTTTGGGCCGTGMu2 adaptin subunit (AP50) of AP2 domain containing protein. 
J023142L20GTTTGGGCCGTGNONE 
J065168E04GTTTGGGCCGTGNONE 
Os08g0302000AK106760AAACGGCCCAACSimilar to Peroxidase 40 precursor (EC 1.11.1.7) (Atperox P40). 
Os08g0412100AK072641AAATGGGCCGTCDisease resistance protein family protein. 
AK072641TACGGCCCAGCDisease resistance protein family protein. 
Os08g0414300AK072217ATCCGACGGCCCAGATConserved hypothetical protein. 
J065039C07ATCCGACGGCCCAGATNONE 
J065098N11ATCCGACGGCCCAGATNONE 
J065120J15ATCCGACGGCCCAGATNONE 
J075076H12ATCCGACGGCCCAGATNONE 
J075101N16ATCCGACGGCCCAGATNONE 
J080010A07ATCCGACGGCCCAGATNONE 
J080023C16ATCCGACGGCCCAGATNONE 
J080027G22ATCCGACGGCCCAGATNONE 
J080053D02ATCCGACGGCCCAGATNONE 
J080065E17ATCCGACGGCCCAGATNONE 
J080068C15ATCCGACGGCCCAGATNONE 
J090061J10ATCCGACGGCCCAGATNONE 
Os08g0414600AK101578GGTTGGGCCGTGSoluble quinoprotein glucose dehydrogenase domain containing protein. 
AK101579GGTTGGGCCGTGNONE 
Os08g0427900AK103217GGGCTGGGCCGTASimilar to Hin19 (Fragment). 
AK109208GGGCTGGGCCGTANONE 
J080005C08GGGCTGGGCCGTANONE 
J080010B10GGGCTGGGCCGTANONE 
J080013C21GGGCTGGGCCGTANONE 
J080022L12GGGCTGGGCCGTANONE 
J080029C08GGGCTGGGCCGTANONE 
J080029G09GGGCTGGGCCGTANONE 
J080035L14GGGCTGGGCCGTANONE 
J080040M20GGGCTGGGCCGTANONE 
J080043M18GGGCTGGGCCGTANONE 
J080045K15GGGCTGGGCCGTANONE 
J080048I17GGGCTGGGCCGTANONE 
J080051P16GGGCTGGGCCGTANONE 
J080053L16GGGCTGGGCCGTANONE 
J080059P14GGGCTGGGCCGTANONE 
J080063E13GGGCTGGGCCGTANONE 
J080075N18GGGCTGGGCCGTA