version

Summary of OsREG446 (All List)

OrganismOryza sativa  
IDOsREG446  
SequenceACGGCCCG  
Annotation  
PPDB MotifACGGGC  function unknown  
PLACE Motif 
Total Entry Count1225  

Entry Sequences (1225 entries)

LocusGene modelSequenceDescription
Os01g0144600006-037-H02ACCGGGCCGTGGTGATGGGCCCGNONE 
AK061501ACCGGGCCGTGGTGATGGGCCCGConserved hypothetical protein. 
AK102823ACCGGGCCGTGGTGATGGGCCCGNONE 
J033108P10ACCGGGCCGTGGTGATGGGCCCGNONE 
J043026K08ACCGGGCCGTGGTGATGGGCCCGNONE 
J090009H21ACCGGGCCGTGGTGATGGGCCCGNONE 
Os01g0146200J090080H03CGGGCCGTAConserved hypothetical protein. 
Os01g0175100AK071289GACGGCCCGKv1.4 voltage-gated K+ channel family protein. 
J023088B10GACGGCCCGNONE 
J065122H15GACGGCCCGNONE 
J065140B19GACGGCCCGNONE 
J100031E12GACGGCCCGNONE 
J100068J03GACGGCCCGNONE 
J100083E12GACGGCCCGNONE 
Os01g0246100AK120732CACGGCCCGTTProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0286000AK109824AACGGGCCGTAAGTGGGCCGAGSnf7 family protein. 
Os01g0382450J065084M05CACGGCCCGHypothetical protein. 
J065155G18CACGGCCCGNONE 
Os01g0623900J090025M21CCACGGCCCGNONE 
J090082F22CCACGGCCCGNONE 
J090084L02CCACGGCCCGSimilar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa) (PR264 protein). 
Os01g0754000014-081-F07CGGGCCGTGGNONE 
AK063730CGGGCCGTGGConserved hypothetical protein. 
J065219A11CGGGCCGTGGNONE 
J075136N13CGGGCCGTGGNONE 
J100051G01CGGGCCGTGGNONE 
J100053M22CGGGCCGTGGNONE 
Os01g0801000AK064082CACGGCCCGGCCNONE 
AK101426CACGGCCCGGCCSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0853600AK107747AACGGGCCGTANONE 
AK108628AACGGGCCGTANONE 
AK120975AACGGGCCGTAConserved hypothetical protein. 
J023041K02AACGGGCCGTANONE 
Os01g0856900AK107570CGGACGGCCCGGTGlycoside hydrolase, starch-binding domain containing protein. 
J065081B03CGGACGGCCCGGTNONE 
J075028J03CGGACGGCCCGGTNONE 
J075052C05CGGACGGCCCGGTNONE 
J075199J04CGGACGGCCCGGTNONE 
J090052L20CGGACGGCCCGGTNONE 
J090075L24CGGACGGCCCGGTNONE 
Os01g0863166J065007F23AACGGGCCGTGNONE 
J065007F23AACGGGCCGTGNONE 
J065007F23CACGGCCCGGCCNONE 
J065007F23CACGGCCCGTTNONE 
J065007F23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065124H21AACGGGCCGTGConserved hypothetical protein. 
J065124H21AACGGGCCGTGConserved hypothetical protein. 
J065124H21CACGGCCCGGCCConserved hypothetical protein. 
J065124H21CACGGCCCGTTConserved hypothetical protein. 
J065124H21CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
Os01g0866500AK111757CGGGCCGTGGSimilar to Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase) (PPase). 
J023060L20CGGGCCGTGGNONE 
J023143G12CGGGCCGTGGNONE 
Os01g0954400003-009-F12CGGGCCGTCNONE 
012-080-B09CGGGCCGTCNONE 
AK065709CGGGCCGTCSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335CGGGCCGTCNONE 
J013039J02CGGGCCGTCNONE 
J033081E17CGGGCCGTCNONE 
J075058B02CGGGCCGTCNONE 
J075067K19CGGGCCGTCNONE 
J075120E23CGGGCCGTCNONE 
J075147I16CGGGCCGTCNONE 
Os02g0123200016-017-F04AAACGGCCCGGTNONE 
J033057C03AAACGGCCCGGTNONE 
J033087C11AAACGGCCCGGTNONE 
J033108J20AAACGGCCCGGTNONE 
J043015P08AAACGGCCCGGTNONE 
Os02g0190900AK111037GCCCAATTTGGGCCGGGCCGTGPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CACGGCCCGGCCCAAATTGGGCConserved hypothetical protein. 
J075117E23CACGGCCCGGCCCAAATTGGGCNONE 
J075117F23CACGGCCCGGCCCAAATTGGGCNONE 
J075144M12CACGGCCCGGCCCAAATTGGGCNONE 
J075145H10CACGGCCCGGCCCAAATTGGGCNONE 
J075186B15CACGGCCCGGCCCAAATTGGGCNONE 
Os02g0445700011-046-C10AACGGGCCGTGNONE 
011-046-C10CACGGCCCGTTNONE 
011-046-C10CGGGCCGTGNONE 
011-046-C10GCCGGGCCGTGNONE 
Os02g0601800AB060276GACGGCCCGGATCCGACCCGCNONE 
AK099539GACGGCCCGGATCCGACCCGCNONE 
AK101873GACGGCCCGGATCCGACCCGCBromodomain containing protein. 
AK106801GACGGCCCGGATCCGACCCGCNONE 
AK121758GACGGCCCGGATCCGACCCGCNONE 
AK121891GACGGCCCGGATCCGACCCGCNONE 
J013059H01GACGGCCCGGATCCGACCCGCNONE 
J013092F08GACGGCCCGGATCCGACCCGCNONE 
J013146J04GACGGCCCGGATCCGACCCGCNONE 
J023001K12GACGGCCCGGATCCGACCCGCNONE 
J023002H16GACGGCCCGGATCCGACCCGCNONE 
J023013B10GACGGCCCGGATCCGACCCGCNONE 
J023081I22GACGGCCCGGATCCGACCCGCNONE 
J023084K19GACGGCCCGGATCCGACCCGCNONE 
J023150E24GACGGCCCGGATCCGACCCGCNONE 
J033023B18GACGGCCCGGATCCGACCCGCNONE 
J033025F18GACGGCCCGGATCCGACCCGCNONE 
J033048P08GACGGCCCGGATCCGACCCGCNONE 
J033060M24GACGGCCCGGATCCGACCCGCNONE 
J033070G06GACGGCCCGGATCCGACCCGCNONE 
J033088P12GACGGCCCGGATCCGACCCGCNONE 
J033105C13GACGGCCCGGATCCGACCCGCNONE 
J043009N18GACGGCCCGGATCCGACCCGCNONE 
J065103G21GACGGCCCGGATCCGACCCGCNONE 
J075039H15GACGGCCCGGATCCGACCCGCNONE 
J090014K10GACGGCCCGGATCCGACCCGCNONE 
J090022N02GACGGCCCGGATCCGACCCGCNONE 
J090033F18GACGGCCCGGATCCGACCCGCNONE 
J090033I04GACGGCCCGGATCCGACCCGCNONE 
J090041F11GACGGCCCGGATCCGACCCGCNONE 
J090045P20GACGGCCCGGATCCGACCCGCNONE 
J090054B01GACGGCCCGGATCCGACCCGCNONE 
J090055M12GACGGCCCGGATCCGACCCGCNONE 
J090071K09GACGGCCCGGATCCGACCCGCNONE 
J090098O16GACGGCCCGGATCCGACCCGCNONE 
J090099P15GACGGCCCGGATCCGACCCGCNONE 
J100050I16GACGGCCCGGATCCGACCCGCNONE 
Os02g0602300AK065609AACGGGCCGTGNONE 
AK065609AACGGGCCGTGNONE 
AK065609CACGGCCCGNONE 
AK066929AACGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929AACGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929CACGGCCCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08AACGGGCCGTGNONE 
J013092L08AACGGGCCGTGNONE 
J013092L08CACGGCCCGNONE 
J090040I23AACGGGCCGTGNONE 
J090040I23AACGGGCCGTGNONE 
J090040I23CACGGCCCGNONE 
Os02g0605600016-017-B02GATCCGACGGCCCGNONE 
AK066104GATCCGACGGCCCGLUC7 related family protein. 
J013052G16GATCCGACGGCCCGNONE 
J043022E03GATCCGACGGCCCGNONE 
J065105P10GATCCGACGGCCCGNONE 
Os02g0628600J100044L04AACGGCCCGTranscriptional factor B3 family protein. 
Os02g0633400AK073723CACGGCCCGSimilar to 61 kDa protein homolog. 
J100031K17CACGGCCCGNONE 
Os02g0669500AK111117CCACGGCCCGProtein of unknown function DUF241, plant family protein. 
Os02g0672600AK070286GGCCGGGCCGTGSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174GGCCGGGCCGTGNONE 
Os02g0679700AK108178GACGGCCCGGGProtein of unknown function DUF623, plant domain containing protein. 
J075112F23GACGGCCCGGGNONE 
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE 
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein. 
J090039P20CAACGGCCCGGCCCATTTNONE 
Os02g0709300009-054-A02CGGGCCGTCNONE 
AK109446CGGGCCGTCConserved hypothetical protein. 
Os02g0717100014-089-G06TACGGCCCGTTNONE 
AK063741TACGGCCCGTTEsterase/lipase/thioesterase domain containing protein. 
J065052A22TACGGCCCGTTNONE 
Os02g0750500AK101960TACGGCCCGGCCCAATASAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05TACGGCCCGGCCCAATANONE 
J065054F02TACGGCCCGGCCCAATANONE 
J065124N03TACGGCCCGGCCCAATANONE 
J090001H12TACGGCCCGGCCCAATANONE 
J100057J01TACGGCCCGGCCCAATANONE 
J100062F12TACGGCCCGGCCCAATANONE 
Os02g0801900006-113-E02AACGGGCCGTGNONE 
006-113-E02AACGGGCCGTGNONE 
006-113-E02CACGGCCCGGCCNONE 
006-113-E02CACGGCCCGTTNONE 
006-113-E02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109488AACGGGCCGTGNONE 
AK109488AACGGGCCGTGNONE 
AK109488CACGGCCCGGCCNONE 
AK109488CACGGCCCGTTNONE 
AK109488CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109498AACGGGCCGTGConserved hypothetical protein. 
AK109498AACGGGCCGTGConserved hypothetical protein. 
AK109498CACGGCCCGGCCConserved hypothetical protein. 
AK109498CACGGCCCGTTConserved hypothetical protein. 
AK109498CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
J065007D19AACGGGCCGTGNONE 
J065007D19AACGGGCCGTGNONE 
J065007D19CACGGCCCGGCCNONE 
J065007D19CACGGCCCGTTNONE 
J065007D19CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065035G11AACGGGCCGTGNONE 
J065035G11AACGGGCCGTGNONE 
J065035G11CACGGCCCGGCCNONE 
J065035G11CACGGCCCGTTNONE 
J065035G11CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065044E05AACGGGCCGTGNONE 
J065044E05AACGGGCCGTGNONE 
J065044E05CACGGCCCGGCCNONE 
J065044E05CACGGCCCGTTNONE 
J065044E05CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065112N01AACGGGCCGTGNONE 
J065112N01AACGGGCCGTGNONE 
J065112N01CACGGCCCGGCCNONE 
J065112N01CACGGCCCGTTNONE 
J065112N01CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065143B03AACGGGCCGTGNONE 
J065143B03AACGGGCCGTGNONE 
J065143B03CACGGCCCGGCCNONE 
J065143B03CACGGCCCGTTNONE 
J065143B03CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065159A16AACGGGCCGTGNONE 
J065159A16AACGGGCCGTGNONE 
J065159A16CACGGCCCGGCCNONE 
J065159A16CACGGCCCGTTNONE 
J065159A16CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090007K23AACGGGCCGTGNONE 
J090007K23AACGGGCCGTGNONE 
J090007K23CACGGCCCGGCCNONE 
J090007K23CACGGCCCGTTNONE 
J090007K23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090045N09AACGGGCCGTGNONE 
J090045N09AACGGGCCGTGNONE 
J090045N09CACGGCCCGGCCNONE 
J090045N09CACGGCCCGTTNONE 
J090045N09CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090049L20AACGGGCCGTGNONE 
J090049L20AACGGGCCGTGNONE 
J090049L20CACGGCCCGGCCNONE 
J090049L20CACGGCCCGTTNONE 
J090049L20CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein. 
J013047E20CCACGGCCCGGCCCAACTNONE 
J065026F21CCACGGCCCGGCCCAACTNONE 
J065047B03CCACGGCCCGGCCCAACTNONE 
J065054J12CCACGGCCCGGCCCAACTNONE 
J065079M24CCACGGCCCGGCCCAACTNONE 
J065093M07CCACGGCCCGGCCCAACTNONE 
J065153F02CCACGGCCCGGCCCAACTNONE 
J065155E21CCACGGCCCGGCCCAACTNONE 
J065179H15CCACGGCCCGGCCCAACTNONE 
J075019N02CCACGGCCCGGCCCAACTNONE 
J075089E01CCACGGCCCGGCCCAACTNONE 
J090066I18CCACGGCCCGGCCCAACTNONE 
J090087K20CCACGGCCCGGCCCAACTNONE 
J100079F05CCACGGCCCGGCCCAACTNONE 
Os03g0129100003-009-E09CACGGCCCGCACCGCNONE 
AF384030CACGGCCCGCACCGCNONE 
AK098993CACGGCCCGCACCGCSeven transmembrane protein MLO2. 
AK111990CACGGCCCGCACCGCNONE 
J013098A12CACGGCCCGCACCGCNONE 
J023020M16CACGGCCCGCACCGCNONE 
J043001L02CACGGCCCGCACCGCNONE 
Os03g0137500006-040-G01GCCGGGCCGTANONE 
015-054-G04GCCGGGCCGTANONE 
AK060148GCCGGGCCGTANONE 
AK073584GCCGGGCCGTANONE 
AK100231GCCGGGCCGTASimilar to VDAC3.1. 
J013146L24GCCGGGCCGTANONE 
J023022O09GCCGGGCCGTANONE 
J023049J19GCCGGGCCGTANONE 
J023133L05GCCGGGCCGTANONE 
J023143P12GCCGGGCCGTANONE 
J033040B12GCCGGGCCGTANONE 
J033050O14GCCGGGCCGTANONE 
J033066G05GCCGGGCCGTANONE 
J065007J18GCCGGGCCGTANONE 
J100067H13GCCGGGCCGTANONE 
Os03g0143000AK073102AAACGGCCCGTTSAM (and some other nucleotide) binding motif domain containing protein. 
J033051I24AAACGGCCCGTTNONE 
Os03g0145900J013045K15GACGGCCCGNONE 
J013051O08GACGGCCCGNONE 
J065054C08GACGGCCCGNONE 
J075053J16GACGGCCCGNONE 
Os03g0146400AK111974CACGGCCCGTTSimilar to Lethal leaf-spot 1 (Fragment). 
AK111974GCCGGGCCGTGSimilar to Lethal leaf-spot 1 (Fragment). 
AK120554CACGGCCCGTTNONE 
AK120554GCCGGGCCGTGNONE 
J075060J10CACGGCCCGTTNONE 
J075060J10GCCGGGCCGTGNONE 
Os03g0168200AK099530GGACGGCCCGGTConserved hypothetical protein. 
Os03g0183300003-107-A07CACGGCCCGNONE 
003-113-H10CACGGCCCGNONE 
003-118-G01CACGGCCCGNONE 
006-028-A09CACGGCCCGNONE 
006-047-D01CACGGCCCGNONE 
006-052-D04CACGGCCCGNONE 
006-087-H06CACGGCCCGNONE 
006-089-B03CACGGCCCGNONE 
006-092-D08CACGGCCCGNONE 
006-093-E07CACGGCCCGNONE 
009-029-H07CACGGCCCGNONE 
009-067-B05CACGGCCCGNONE 
009-091-F04CACGGCCCGNONE 
009-101-C10CACGGCCCGNONE 
009-113-A06CACGGCCCGNONE 
009-140-E12CACGGCCCGNONE 
009-145-E10CACGGCCCGNONE 
009-196-F02CACGGCCCGNONE 
011-054-E07CACGGCCCGNONE 
012-074-E10CACGGCCCGNONE 
012-076-E11CACGGCCCGNONE 
014-006-C07CACGGCCCGNONE 
014-085-G11CACGGCCCGNONE 
015-049-C04CACGGCCCGNONE 
015-062-E10CACGGCCCGNONE 
016-063-E02CACGGCCCGNONE 
AK058349CACGGCCCGHypothetical protein. 
AK105922CACGGCCCGNONE 
AK106163CACGGCCCGNONE 
AK119553CACGGCCCGNONE 
AY831395CACGGCCCGNONE 
Os03g0192400009-081-A03TACGGCCCGGTNONE 
009-159-B02TACGGCCCGGTNONE 
AK070573TACGGCCCGGTGRIM-19 family protein. 
J023056B01TACGGCCCGGTNONE 
J023075G06TACGGCCCGGTNONE 
J033048K16TACGGCCCGGTNONE 
J033048L16TACGGCCCGGTNONE 
J053031H23TACGGCCCGGTNONE 
J065002H14TACGGCCCGGTNONE 
J065006G22TACGGCCCGGTNONE 
J065032G13TACGGCCCGGTNONE 
J065056A09TACGGCCCGGTNONE 
J065078I01TACGGCCCGGTNONE 
J065095G01TACGGCCCGGTNONE 
J065095I18TACGGCCCGGTNONE 
J065134M18TACGGCCCGGTNONE 
J065158P07TACGGCCCGGTNONE 
J065165K17TACGGCCCGGTNONE 
J065181J12TACGGCCCGGTNONE 
J065189N09TACGGCCCGGTNONE 
J065200D13TACGGCCCGGTNONE 
J065202H20TACGGCCCGGTNONE 
J065215K20TACGGCCCGGTNONE 
J075049N19TACGGCCCGGTNONE 
J075147J16TACGGCCCGGTNONE 
J090081E19TACGGCCCGGTNONE 
J100017C16TACGGCCCGGTNONE 
J100039M16TACGGCCCGGTNONE 
J100043E23TACGGCCCGGTNONE 
J100063L12TACGGCCCGGTNONE 
J100079F22TACGGCCCGGTNONE 
Os03g0205500Os03g0205500CGGGCCGTCCCytochrome b5 domain containing protein. 
Os03g0213600AK100407AAACGGCCCGConserved hypothetical protein. 
Os03g0248600AK073611CCAACGGCCCGGCSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK099342CCAACGGCCCGGCNONE 
AK104877CCAACGGCCCGGCNONE 
J013026L10CCAACGGCCCGGCNONE 
J013055P12CCAACGGCCCGGCNONE 
J023091A14CCAACGGCCCGGCNONE 
J033034G07CCAACGGCCCGGCNONE 
J033048H19CCAACGGCCCGGCNONE 
J033128D07CCAACGGCCCGGCNONE 
J065060L24CCAACGGCCCGGCNONE 
J065176A19CCAACGGCCCGGCNONE 
J090018K08CCAACGGCCCGGCNONE 
J090023C03CCAACGGCCCGGCNONE 
Os03g0250400AK121385CGGGCCGTAPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J023108J02CGGGCCGTANONE 
J023127J05CGGGCCGTANONE 
J023128E15CGGGCCGTANONE 
J075058L21CGGGCCGTANONE 
Os03g0265300011-009-B11CACGGCCCGNONE 
AK101498CACGGCCCGMitochondrial substrate carrier family protein. 
J043024D03CACGGCCCGNONE 
J065096I09CACGGCCCGNONE 
J100071C08CACGGCCCGNONE 
Os03g0278200AK103544AAACGGCCCGNAD-dependent epimerase/dehydratase family protein. 
Os03g0278900006-049-H12TACGGCCCGTTNONE 
006-082-A07TACGGCCCGTTNONE 
009-169-C04TACGGCCCGTTNONE 
AK066019TACGGCCCGTTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TACGGCCCGTTNONE 
AY224460TACGGCCCGTTNONE 
J065021K17TACGGCCCGTTNONE 
J065141H24TACGGCCCGTTNONE 
J065142J20TACGGCCCGTTNONE 
J065152J03TACGGCCCGTTNONE 
J065163A13TACGGCCCGTTNONE 
J065191I21TACGGCCCGTTNONE 
J065193K12TACGGCCCGTTNONE 
J075003D01TACGGCCCGTTNONE 
J075017D24TACGGCCCGTTNONE 
J075060F20TACGGCCCGTTNONE 
J075154C11TACGGCCCGTTNONE 
J075173F04TACGGCCCGTTNONE 
Os03g0284000Os03g0284000CACGGCCCGGCCConserved hypothetical protein. 
Os03g0284000CACGTGGGCCGGAACGGCCCGConserved hypothetical protein. 
Os03g0312300AK111364GACGGCCCGGCProtein of unknown function DUF26 domain containing protein. 
Os03g0445700AK071624CCGATCCGACGGCCCGSimilar to LOB domain protein 39. 
J023106M18CCGATCCGACGGCCCGNONE 
J065178J05CCGATCCGACGGCCCGNONE 
J065196F10CCGATCCGACGGCCCGNONE 
Os03g0656900AK066416GACGGCCCGNusB/RsmB/TIM44 domain containing protein. 
J065157L23GACGGCCCGNONE 
J065166P22GACGGCCCGNONE 
Os03g0736700AK060219CCACGGCCCGNONE 
Os03g0746000AK073682GACGGCCCGCAConserved hypothetical protein. 
AK111472GACGGCCCGCANONE 
J090083F05GACGGCCCGCANONE 
Os03g0758800AJ252135AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AJ312906AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AK060387AAAAGCCCATCCCACGGCCCGCTCTCCGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J023109G09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J033038B14AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J043013C09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J053096E21AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065026B08AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065062B16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065066E03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065091J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065164A06AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075014I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075117N07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075142M03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075175D04AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075188M01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075199I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090010J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090025O16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090041H05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090078P07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100031K10AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100055F23AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100064G05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080C24AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080O07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100090F01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
Os03g0807200011-031-F07CGGGCCGTGNONE 
011-031-F07GTTTGGGCCGGGCCGTCNONE 
AK063932CGGGCCGTGNONE 
AK063932GTTTGGGCCGGGCCGTCNONE 
AK103496CGGGCCGTGProtein of unknown function DUF1639 family protein. 
AK103496GTTTGGGCCGGGCCGTCProtein of unknown function DUF1639 family protein. 
J033131A04CGGGCCGTGNONE 
J033131A04GTTTGGGCCGGGCCGTCNONE 
J065109O03CGGGCCGTGNONE 
J065109O03GTTTGGGCCGGGCCGTCNONE 
J080001M11CGGGCCGTGNONE 
J080001M11GTTTGGGCCGGGCCGTCNONE 
J080002H18CGGGCCGTGNONE 
J080002H18GTTTGGGCCGGGCCGTCNONE 
J080005I08CGGGCCGTGNONE 
J080005I08GTTTGGGCCGGGCCGTCNONE 
J080006B05CGGGCCGTGNONE 
J080006B05GTTTGGGCCGGGCCGTCNONE 
J080006D17CGGGCCGTGNONE 
J080006D17GTTTGGGCCGGGCCGTCNONE 
J080007M19CGGGCCGTGNONE 
J080007M19GTTTGGGCCGGGCCGTCNONE 
J080011E07CGGGCCGTGNONE 
J080011E07GTTTGGGCCGGGCCGTCNONE 
J080012H06CGGGCCGTGNONE 
J080012H06GTTTGGGCCGGGCCGTCNONE 
J080014D08CGGGCCGTGNONE 
J080014D08GTTTGGGCCGGGCCGTCNONE 
J080017D06CGGGCCGTGNONE 
J080017D06GTTTGGGCCGGGCCGTCNONE 
J080017K17CGGGCCGTGNONE 
J080017K17GTTTGGGCCGGGCCGTCNONE 
J080020B17CGGGCCGTGNONE 
J080020B17GTTTGGGCCGGGCCGTCNONE 
J080021O05CGGGCCGTGNONE 
J080021O05GTTTGGGCCGGGCCGTCNONE 
J080021O15CGGGCCGTGNONE 
J080021O15GTTTGGGCCGGGCCGTCNONE 
J080023I18CGGGCCGTGNONE 
J080023I18GTTTGGGCCGGGCCGTCNONE 
J080025A21CGGGCCGTGNONE 
J080025A21GTTTGGGCCGGGCCGTCNONE 
J080027P22CGGGCCGTGNONE 
J080027P22GTTTGGGCCGGGCCGTCNONE 
J080028M22CGGGCCGTGNONE 
J080028M22GTTTGGGCCGGGCCGTCNONE 
J080029B09CGGGCCGTGNONE 
J080029B09GTTTGGGCCGGGCCGTCNONE 
J080029M07CGGGCCGTGNONE 
J080029M07GTTTGGGCCGGGCCGTCNONE 
J080029M17CGGGCCGTGNONE 
J080029M17GTTTGGGCCGGGCCGTCNONE 
J080030H23CGGGCCGTGNONE 
J080030H23GTTTGGGCCGGGCCGTCNONE 
J080030K16CGGGCCGTGNONE 
J080030K16GTTTGGGCCGGGCCGTCNONE 
J080030L19CGGGCCGTGNONE 
J080030L19GTTTGGGCCGGGCCGTCNONE 
J080031A12CGGGCCGTGNONE 
J080031A12GTTTGGGCCGGGCCGTCNONE 
J080031N21CGGGCCGTGNONE 
J080031N21GTTTGGGCCGGGCCGTCNONE 
J080032G05CGGGCCGTGNONE 
J080032G05GTTTGGGCCGGGCCGTCNONE 
J080032P20CGGGCCGTGNONE 
J080032P20GTTTGGGCCGGGCCGTCNONE 
J080033H20CGGGCCGTGNONE 
J080033H20GTTTGGGCCGGGCCGTCNONE 
J080034H22CGGGCCGTGNONE 
J080034H22GTTTGGGCCGGGCCGTCNONE 
J080034J03CGGGCCGTGNONE 
J080034J03GTTTGGGCCGGGCCGTCNONE 
J080034J16CGGGCCGTGNONE 
J080034J16GTTTGGGCCGGGCCGTCNONE 
J080034N01CGGGCCGTGNONE 
J080034N01GTTTGGGCCGGGCCGTCNONE 
J080035K20CGGGCCGTGNONE 
J080035K20GTTTGGGCCGGGCCGTCNONE 
J080036I04CGGGCCGTGNONE 
J080036I04GTTTGGGCCGGGCCGTCNONE 
J080036I19CGGGCCGTGNONE 
J080036I19GTTTGGGCCGGGCCGTCNONE 
J080036O21CGGGCCGTGNONE 
J080036O21GTTTGGGCCGGGCCGTCNONE 
J080038D06CGGGCCGTGNONE 
J080038D06GTTTGGGCCGGGCCGTCNONE 
J080039J15CGGGCCGTGNONE 
J080039J15GTTTGGGCCGGGCCGTCNONE 
J080039P18CGGGCCGTGNONE 
J080039P18GTTTGGGCCGGGCCGTCNONE 
J080041H20CGGGCCGTGNONE 
J080041H20GTTTGGGCCGGGCCGTCNONE 
J080041M11CGGGCCGTGNONE 
J080041M11GTTTGGGCCGGGCCGTCNONE 
J080042F14CGGGCCGTGNONE 
J080042F14GTTTGGGCCGGGCCGTCNONE 
J080043G10CGGGCCGTGNONE 
J080043G10GTTTGGGCCGGGCCGTCNONE 
J080043J02CGGGCCGTGNONE 
J080043J02GTTTGGGCCGGGCCGTCNONE 
J080044C19CGGGCCGTGNONE 
J080044C19GTTTGGGCCGGGCCGTCNONE 
J080044G11CGGGCCGTGNONE 
J080044G11GTTTGGGCCGGGCCGTCNONE 
J080045M03CGGGCCGTGNONE 
J080045M03GTTTGGGCCGGGCCGTCNONE 
J080045N07CGGGCCGTGNONE 
J080045N07GTTTGGGCCGGGCCGTCNONE 
J080047K14CGGGCCGTGNONE 
J080047K14GTTTGGGCCGGGCCGTCNONE 
J080049I21CGGGCCGTGNONE 
J080049I21GTTTGGGCCGGGCCGTCNONE 
J080050A06CGGGCCGTGNONE 
J080050A06GTTTGGGCCGGGCCGTCNONE 
J080050I16CGGGCCGTGNONE 
J080050I16GTTTGGGCCGGGCCGTCNONE 
J080050N16CGGGCCGTGNONE 
J080050N16GTTTGGGCCGGGCCGTCNONE 
J080052C23CGGGCCGTGNONE 
J080052C23GTTTGGGCCGGGCCGTCNONE 
J080052D18CGGGCCGTGNONE 
J080052D18GTTTGGGCCGGGCCGTCNONE 
J080052F20CGGGCCGTGNONE 
J080052F20GTTTGGGCCGGGCCGTCNONE 
J080052F23CGGGCCGTGNONE 
J080052F23GTTTGGGCCGGGCCGTCNONE 
J080053M03CGGGCCGTGNONE 
J080053M03GTTTGGGCCGGGCCGTCNONE 
J080054G13CGGGCCGTGNONE 
J080054G13GTTTGGGCCGGGCCGTCNONE 
J080054H12CGGGCCGTGNONE 
J080054H12GTTTGGGCCGGGCCGTCNONE 
J080055N03CGGGCCGTGNONE 
J080055N03GTTTGGGCCGGGCCGTCNONE 
J080056E07CGGGCCGTGNONE 
J080056E07GTTTGGGCCGGGCCGTCNONE 
J080057L04CGGGCCGTGNONE 
J080057L04GTTTGGGCCGGGCCGTCNONE 
J080063O19CGGGCCGTGNONE 
J080063O19GTTTGGGCCGGGCCGTCNONE 
J080064E21CGGGCCGTGNONE 
J080064E21GTTTGGGCCGGGCCGTCNONE 
J080065D18CGGGCCGTGNONE 
J080065D18GTTTGGGCCGGGCCGTCNONE 
J080065F18CGGGCCGTGNONE 
J080065F18GTTTGGGCCGGGCCGTCNONE 
J080065H14CGGGCCGTGNONE 
J080065H14GTTTGGGCCGGGCCGTCNONE 
J080065K15CGGGCCGTGNONE 
J080065K15GTTTGGGCCGGGCCGTCNONE 
J080065M24CGGGCCGTGNONE 
J080065M24GTTTGGGCCGGGCCGTCNONE 
J080066B18CGGGCCGTGNONE 
J080066B18GTTTGGGCCGGGCCGTCNONE 
J080066B19CGGGCCGTGNONE 
J080066B19GTTTGGGCCGGGCCGTCNONE 
J080071H19CGGGCCGTGNONE 
J080071H19GTTTGGGCCGGGCCGTCNONE 
J080072E18CGGGCCGTGNONE 
J080072E18GTTTGGGCCGGGCCGTCNONE 
J080074K21CGGGCCGTGNONE 
J080074K21GTTTGGGCCGGGCCGTCNONE 
J080075B06CGGGCCGTGNONE 
J080075B06GTTTGGGCCGGGCCGTCNONE 
J080076H07CGGGCCGTGNONE 
J080076H07GTTTGGGCCGGGCCGTCNONE 
J080079D16CGGGCCGTGNONE 
J080079D16GTTTGGGCCGGGCCGTCNONE 
J080082B20CGGGCCGTGNONE 
J080082B20GTTTGGGCCGGGCCGTCNONE 
J080084N16CGGGCCGTGNONE 
J080084N16GTTTGGGCCGGGCCGTCNONE 
J080085L07CGGGCCGTGNONE 
J080085L07GTTTGGGCCGGGCCGTCNONE 
J080086L04CGGGCCGTGNONE 
J080086L04GTTTGGGCCGGGCCGTCNONE 
J080086M07CGGGCCGTGNONE 
J080086M07GTTTGGGCCGGGCCGTCNONE 
J080087D02CGGGCCGTGNONE 
J080087D02GTTTGGGCCGGGCCGTCNONE 
J080087D15CGGGCCGTGNONE 
J080087D15GTTTGGGCCGGGCCGTCNONE 
J080087J19CGGGCCGTGNONE 
J080087J19GTTTGGGCCGGGCCGTCNONE 
J080088G20CGGGCCGTGNONE 
J080088G20GTTTGGGCCGGGCCGTCNONE 
J080092M15CGGGCCGTGNONE 
J080092M15GTTTGGGCCGGGCCGTCNONE 
J080093O10CGGGCCGTGNONE 
J080093O10GTTTGGGCCGGGCCGTCNONE 
J080095L09CGGGCCGTGNONE 
J080095L09GTTTGGGCCGGGCCGTCNONE 
J080096A18CGGGCCGTGNONE 
J080096A18GTTTGGGCCGGGCCGTCNONE 
J080097C03CGGGCCGTGNONE 
J080097C03GTTTGGGCCGGGCCGTCNONE 
J090019J07CGGGCCGTGNONE 
J090019J07GTTTGGGCCGGGCCGTCNONE 
J090024N12CGGGCCGTGNONE 
J090024N12GTTTGGGCCGGGCCGTCNONE 
J090049I09CGGGCCGTGNONE 
J090049I09GTTTGGGCCGGGCCGTCNONE 
Os03g0822700005-010-E01GACGGCCCGGCCCNONE 
006-088-H12GACGGCCCGGCCCNONE 
AK061682GACGGCCCGGCCCNONE 
AK101448GACGGCCCGGCCCArmadillo-like helical domain containing protein. 
J023091N05GACGGCCCGGCCCNONE 
Os03g0831100AK103115AACGGCCCGGCCArmadillo-like helical domain containing protein. 
J033119F15AACGGCCCGGCCNONE 
J065011M19AACGGCCCGGCCNONE 
J075019I08AACGGCCCGGCCNONE 
J075047A01AACGGCCCGGCCNONE 
J075096P21AACGGCCCGGCCNONE 
J075121I05AACGGCCCGGCCNONE 
J075121I07AACGGCCCGGCCNONE 
J090063F13AACGGCCCGGCCNONE 
J090068F16AACGGCCCGGCCNONE 
J090094E14AACGGCCCGGCCNONE 
Os03g0846400AK067706CGGGCCGTGCCCGGCCCNONE 
AK067706GCTGGGCCGTGTCTGGGCCGGGCCGTGNONE 
AK070549CGGGCCGTGCCCGGCCCPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK070549GCTGGGCCGTGTCTGGGCCGGGCCGTGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os04g0208400AK069629AACGGGCCGTGCyclin-like F-box domain containing protein. 
AK069629CACGGCCCGCyclin-like F-box domain containing protein. 
Os04g0461100009-136-H10ATCTGGGCCGGGCCGTTTNONE 
009-147-H12ATCTGGGCCGGGCCGTTTNONE 
AK068022ATCTGGGCCGGGCCGTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24ATCTGGGCCGGGCCGTTTNONE 
J065019D10ATCTGGGCCGGGCCGTTTNONE 
J065168O21ATCTGGGCCGGGCCGTTTNONE 
J075051G06ATCTGGGCCGGGCCGTTTNONE 
J075148G11ATCTGGGCCGGGCCGTTTNONE 
Os04g0462900006-094-A02CACGGCCCGTTNONE 
006-097-F05CACGGCCCGTTNONE 
009-129-A10CACGGCCCGTTNONE 
015-042-F07CACGGCCCGTTNONE 
AK058481CACGGCCCGTTNONE 
AK059483CACGGCCCGTTNONE 
AK061324CACGGCCCGTTNONE 
AK099100CACGGCCCGTTNONE 
AK102579CACGGCCCGTTNONE 
AK106322CACGGCCCGTTSimilar to Prohibitin. 
J065059J20CACGGCCCGTTNONE 
J065085I02CACGGCCCGTTNONE 
J065118N23CACGGCCCGTTNONE 
J065208K24CACGGCCCGTTNONE 
J075053B14CACGGCCCGTTNONE 
J075097M22CACGGCCCGTTNONE 
J075184B07CACGGCCCGTTNONE 
J075194A15CACGGCCCGTTNONE 
J080315G03CACGGCCCGTTNONE 
J090088H19CACGGCCCGTTNONE 
Os04g0614500AK100259CACGGCCCGAminotransferase class-III family protein. 
Os04g0626400006-050-B09AACGGCCCGCANONE 
006-072-C12AACGGCCCGCANONE 
006-092-C11AACGGCCCGCANONE 
AK059851AACGGCCCGCACalycin-like family protein. 
AK100069AACGGCCCGCANONE 
AK104062AACGGCCCGCANONE 
AK104663AACGGCCCGCANONE 
Os04g0635800006-033-E07CACGGCCCGTTNONE 
011-067-A08CACGGCCCGTTNONE 
AK060110CACGGCCCGTTNONE 
AK099507CACGGCCCGTTGCN5-related N-acetyltransferase domain containing protein. 
AK104741CACGGCCCGTTNONE 
AK120021CACGGCCCGTTNONE 
J013029B17CACGGCCCGTTNONE 
J013134M07CACGGCCCGTTNONE 
J013149N18CACGGCCCGTTNONE 
J013153L10CACGGCCCGTTNONE 
J033131F08CACGGCCCGTTNONE 
J043010E02CACGGCCCGTTNONE 
J065031J05CACGGCCCGTTNONE 
J065031J06CACGGCCCGTTNONE 
J075030K04CACGGCCCGTTNONE 
J075178K05CACGGCCCGTTNONE 
J080001B10CACGGCCCGTTNONE 
J080003N19CACGGCCCGTTNONE 
J080005F20CACGGCCCGTTNONE 
J080005G16CACGGCCCGTTNONE 
J080007N02CACGGCCCGTTNONE 
J080009J04CACGGCCCGTTNONE 
J080017D04CACGGCCCGTTNONE 
J080020M22CACGGCCCGTTNONE 
J080021A15CACGGCCCGTTNONE 
J080021F21CACGGCCCGTTNONE 
J080023P05CACGGCCCGTTNONE 
J080024P22CACGGCCCGTTNONE 
J080027C20CACGGCCCGTTNONE 
J080029K03CACGGCCCGTTNONE 
J080035M18CACGGCCCGTTNONE 
J080039F22CACGGCCCGTTNONE 
J080039J03CACGGCCCGTTNONE 
J080039L03CACGGCCCGTTNONE 
J080039P14CACGGCCCGTTNONE 
J080042E12CACGGCCCGTTNONE 
J080047D19CACGGCCCGTTNONE 
J080047M21CACGGCCCGTTNONE 
J080049N03CACGGCCCGTTNONE 
J080056J12CACGGCCCGTTNONE 
J080060B10CACGGCCCGTTNONE 
J080062K08CACGGCCCGTTNONE 
J080064L07CACGGCCCGTTNONE 
J080069C15CACGGCCCGTTNONE 
J080074H06CACGGCCCGTTNONE 
J080086O14CACGGCCCGTTNONE 
J080090C20CACGGCCCGTTNONE 
J080090L14CACGGCCCGTTNONE 
J080095G08CACGGCCCGTTNONE 
J080097C07CACGGCCCGTTNONE 
J090011F03CACGGCCCGTTNONE 
J090082O17CACGGCCCGTTNONE 
Os04g0670400012-048-A10CGGGCCGTANONE 
012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099CGGGCCGTAOvarian tumour, otubain domain containing protein. 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06CGGGCCGTANONE 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03CGGGCCGTANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TACGGCCCGCysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os05g0156200AK071622TCCGGGCCGTTConserved hypothetical protein. 
J023099E19TCCGGGCCGTTNONE 
J090025C09TCCGGGCCGTTNONE 
J090071K23TCCGGGCCGTTNONE 
Os05g0405400J090016P17CACGGCCCGGTNONE 
Os05g0413000AK058277TACGGCCCGMitochodrial transcription termination factor-related family protein. 
Os05g0430200J090095K16ATCCGACGGCCCGNONE 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
Os05g0524400AK063963CACGGCCCGCANONE 
AK072857CACGGCCCGCAPhosphofructokinase family protein. 
Os05g0548100AK060333CACGGCCCGGTConserved hypothetical protein. 
AK060333CGGGCCGTGCCGGCCCConserved hypothetical protein. 
AK100682CACGGCCCGGTNONE 
AK100682CGGGCCGTGCCGGCCCNONE 
J013151E01CACGGCCCGGTNONE 
J013151E01CGGGCCGTGCCGGCCCNONE 
J023113L22CACGGCCCGGTNONE 
J023113L22CGGGCCGTGCCGGCCCNONE 
J043027A19CACGGCCCGGTNONE 
J043027A19CGGGCCGTGCCGGCCCNONE 
J075093E06CACGGCCCGGTNONE 
J075093E06CGGGCCGTGCCGGCCCNONE 
J090060D15CACGGCCCGGTNONE 
J090060D15CGGGCCGTGCCGGCCCNONE 
J090082J03CACGGCCCGGTNONE 
J090082J03CGGGCCGTGCCGGCCCNONE 
J100050E01CACGGCCCGGTNONE 
J100050E01CGGGCCGTGCCGGCCCNONE 
Os05g0567500AK073046CGGGCCGTTGNONE 
AK073046TTATGGGCCCAGATCACGGCCCGNONE 
AK121133CGGGCCGTTGDNA glycosylase family protein. 
AK121133TTATGGGCCCAGATCACGGCCCGDNA glycosylase family protein. 
J023075P20CGGGCCGTTGNONE 
J023075P20TTATGGGCCCAGATCACGGCCCGNONE 
Os05g0571400009-019-B04GACGGCCCGGCCCAGTTNONE 
009-043-H02GACGGCCCGGCCCAGTTNONE 
AK062369GACGGCCCGGCCCAGTTConserved hypothetical protein. 
Os05g0594100006-034-F04TCCGGGCCGTTGNONE 
006-061-A02TCCGGGCCGTTGNONE 
009-081-E02TCCGGGCCGTTGNONE 
AK060122TCCGGGCCGTTGNONE 
AK106130TCCGGGCCGTTGSimilar to GDA2 protein. 
J023010C07TCCGGGCCGTTGNONE 
J023098J20TCCGGGCCGTTGNONE 
J023117G22TCCGGGCCGTTGNONE 
J023127J08TCCGGGCCGTTGNONE 
J033117G03TCCGGGCCGTTGNONE 
J033124I03TCCGGGCCGTTGNONE 
J043015K15TCCGGGCCGTTGNONE 
Os06g0104000AK068490GCCACGTGCCACGGCCCGGCCCGGCCCATGAConserved hypothetical protein. 
Os06g0107800009-133-F03TCCGGGCCGTTGGATNONE 
AK062921TCCGGGCCGTTGGATSimilar to RAV-like protein. 
Os06g0136000AK060303AACGGGCCGTGSimilar to Hypersensitive-induced reaction protein 4. 
AK102678AACGGGCCGTGNONE 
J075185K19AACGGGCCGTGNONE 
J090028C16AACGGGCCGTGNONE 
J090099N12AACGGGCCGTGNONE 
J100070O10AACGGGCCGTGNONE 
Os06g0140100011-063-A02TCCAACGGCCCGTTNONE 
011-063-A02TGTTGGGCCGGGCCGTGNONE 
AK063371TCCAACGGCCCGTTLeucine carboxyl methyltransferase family protein. 
AK063371TGTTGGGCCGGGCCGTGLeucine carboxyl methyltransferase family protein. 
Os06g0150600011-051-F03GGCCGGGCCGTANONE 
AK063346GGCCGGGCCGTATransferase family protein. 
Os06g0246500AK105105CCCGGGCCGTGSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0308300AK059211CACGGCCCGNONE 
AK101549CACGGCCCGNONE 
AK102553CACGGCCCGSimilar to 65kD microtubule associated protein. 
J090014G18CACGGCCCGNONE 
J090082B01CACGGCCCGNONE 
Os06g0338900016-067-B02ACCGGGCCGTGNONE 
AK100837ACCGGGCCGTGNucleotidyl transferase domain containing protein. 
J013058L01ACCGGGCCGTGNONE 
J013135N01ACCGGGCCGTGNONE 
J023123E15ACCGGGCCGTGNONE 
J033051J01ACCGGGCCGTGNONE 
J090002O21ACCGGGCCGTGNONE 
J090013F06ACCGGGCCGTGNONE 
J090056F16ACCGGGCCGTGNONE 
J090081G13ACCGGGCCGTGNONE 
J090090P21ACCGGGCCGTGNONE 
J100039F05ACCGGGCCGTGNONE 
J100059J03ACCGGGCCGTGNONE 
Os06g0506600009-119-E12GACGGCCCGCANONE 
J023086A18GACGGCCCGCANONE 
J033036I02GACGGCCCGCANONE 
J033125C16GACGGCCCGCANONE 
J065013I11GACGGCCCGCANONE 
J065026O21GACGGCCCGCANONE 
J065060H10GACGGCCCGCANONE 
J065067A15GACGGCCCGCANONE 
J065068F07GACGGCCCGCANONE 
J065085N06GACGGCCCGCANONE 
J065108N10GACGGCCCGCANONE 
J065161O11GACGGCCCGCANONE 
J065185J15GACGGCCCGCANONE 
J065191H18GACGGCCCGCANONE 
J065199J09GACGGCCCGCANONE 
J075005G03GACGGCCCGCANONE 
J075018C16GACGGCCCGCANONE 
J075061K20GACGGCCCGCANONE 
J075069J06GACGGCCCGCANONE 
J075075H19GACGGCCCGCANONE 
J075076D20GACGGCCCGCANONE 
J075078D16GACGGCCCGCANONE 
J075100J19GACGGCCCGCANONE 
J075110M11GACGGCCCGCANONE 
J075157N05GACGGCCCGCANONE 
J075171F20GACGGCCCGCANONE 
J075177G08GACGGCCCGCANONE 
J075179G08GACGGCCCGCANONE 
Os06g0585200016-065-C02AACGGCCCGTGGGCCGCANONE 
016-065-C02AACGGGCCGTGNONE 
016-065-C02AACGGGCCGTGNONE 
016-065-C02CACGGCCCGGCCNONE 
016-065-C02CACGGCCCGTTNONE 
016-065-C02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
016-065-C02GCCGGGCCGGGCCGTGNONE 
AK068592AACGGCCCGTGGGCCGCANONE 
AK068592AACGGGCCGTGNONE 
AK068592AACGGGCCGTGNONE 
AK068592CACGGCCCGGCCNONE 
AK068592CACGGCCCGTTNONE 
AK068592CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK068592GCCGGGCCGGGCCGTGNONE 
AK073844AACGGCCCGTGGGCCGCANONE 
AK073844AACGGGCCGTGNONE 
AK073844AACGGGCCGTGNONE 
AK073844CACGGCCCGGCCNONE 
AK073844CACGGCCCGTTNONE 
AK073844CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK073844GCCGGGCCGGGCCGTGNONE 
AK106549AACGGCCCGTGGGCCGCAConserved hypothetical protein. 
AK106549AACGGGCCGTGConserved hypothetical protein. 
AK106549AACGGGCCGTGConserved hypothetical protein. 
AK106549CACGGCCCGGCCConserved hypothetical protein. 
AK106549CACGGCCCGTTConserved hypothetical protein. 
AK106549CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCConserved hypothetical protein. 
AK106549GCCGGGCCGGGCCGTGConserved hypothetical protein. 
J013154A14AACGGCCCGTGGGCCGCANONE 
J013154A14AACGGGCCGTGNONE 
J013154A14AACGGGCCGTGNONE 
J013154A14CACGGCCCGGCCNONE 
J013154A14CACGGCCCGTTNONE 
J013154A14CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J013154A14GCCGGGCCGGGCCGTGNONE 
J100049K24AACGGCCCGTGGGCCGCANONE 
J100049K24AACGGGCCGTGNONE 
J100049K24AACGGGCCGTGNONE 
J100049K24CACGGCCCGGCCNONE 
J100049K24CACGGCCCGTTNONE 
J100049K24CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100049K24GCCGGGCCGGGCCGTGNONE 
J100059C18AACGGCCCGTGGGCCGCANONE 
J100059C18AACGGGCCGTGNONE 
J100059C18AACGGGCCGTGNONE 
J100059C18CACGGCCCGGCCNONE 
J100059C18CACGGCCCGTTNONE 
J100059C18CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100059C18GCCGGGCCGGGCCGTGNONE 
J100082N13AACGGCCCGTGGGCCGCANONE 
J100082N13AACGGGCCGTGNONE 
J100082N13AACGGGCCGTGNONE 
J100082N13CACGGCCCGGCCNONE 
J100082N13CACGGCCCGTTNONE 
J100082N13CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100082N13GCCGGGCCGGGCCGTGNONE 
Os06g0590301J033139K16CACGGCCCGGTNONE 
J065011M13CACGGCCCGGTNONE 
J065027D20CACGGCCCGGTNONE 
J065039O05CACGGCCCGGTGlucose/ribitol dehydrogenase family protein. 
J065051O10CACGGCCCGGTNONE 
J065128I21CACGGCCCGGTNONE 
J065163P10CACGGCCCGGTNONE 
J065169H02CACGGCCCGGTNONE 
Os06g0607800012-010-G03CAACGGCCCGNONE 
AB070254CAACGGCCCGNONE 
AK063158CAACGGCCCGSimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695CAACGGCCCGNONE 
J013074G13CAACGGCCCGNONE 
J090015C16CAACGGCCCGNONE 
J090069H10CAACGGCCCGNONE 
Os06g0656300006-034-G12CACGGCCCGGTNONE 
006-056-B10CACGGCCCGGTNONE 
006-089-A09CACGGCCCGGTNONE 
006-104-H10CACGGCCCGGTNONE 
006-108-G10CACGGCCCGGTNONE 
006-111-C10CACGGCCCGGTNONE 
006-113-G11CACGGCCCGGTNONE 
006-119-H10CACGGCCCGGTNONE 
009-033-E11CACGGCCCGGTNONE 
009-106-C06CACGGCCCGGTNONE 
009-160-F06CACGGCCCGGTNONE 
AK060123CACGGCCCGGTNONE 
AK060127CACGGCCCGGTProtein of unknown function DUF588 family protein. 
AK104184CACGGCCCGGTNONE 
J065042D07CACGGCCCGGTNONE 
J075029H23CACGGCCCGGTNONE 
J075151L06CACGGCCCGGTNONE 
J090027A16CACGGCCCGGTNONE 
Os06g0670100AK102577TACGGCCCGGTHypothetical protein. 
Os06g0693000AK064280TCTGGGCCGGGCCGTGProtein kinase-like domain containing protein. 
Os07g0101500AK059667CGGGCCGTCCNONE 
AK071749CGGGCCGTCCSimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
J023112L07CGGGCCGTCCNONE 
J065050F03CGGGCCGTCCNONE 
J090015C05CGGGCCGTCCNONE 
J090045C11CGGGCCGTCCNONE 
Os07g0124600AK073437GATCCGACGGCCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24GATCCGACGGCCCGGANONE 
J033136G07GATCCGACGGCCCGGANONE 
J065092I12GATCCGACGGCCCGGANONE 
J065132F04GATCCGACGGCCCGGANONE 
J065143I11GATCCGACGGCCCGGANONE 
Os07g0158900AK064980CACGGCCCGTTCyclin-like F-box domain containing protein. 
AK064980GCCGGGCCGTGCyclin-like F-box domain containing protein. 
Os07g0301200AB110202AACGGGCCGTGNONE 
AB110202CACGGCCCGNONE 
AK073463AACGGGCCGTGSimilar to RNA helicase (Fragment). 
AK073463CACGGCCCGSimilar to RNA helicase (Fragment). 
Os07g0408100AK108466GCCGGGCCGTGNONE 
AK111780GCCGGGCCGTGWD40-like domain containing protein. 
Os07g0496200AK064866CACGGCCCGGCCNONE 
AK065801CACGGCCCGGCCSimilar to NAD-dependent malic enzyme 62 kDa isoform, mitochondrial precursor (EC 1.1.1.39) (NAD-ME). 
Os07g0555400AK070977CACGGCCCGConserved hypothetical protein. 
Os07g0574800006-097-G09CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
013-077-E02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
014-010-B04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK067721CCAGCCCAGCCCAGCCCACGGGCCGTGGTubulin alpha-1 chain. 
AK069140CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK104900CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013037J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013045O05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013056A21CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013119N24CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036H19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036K16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023067J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023075H08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023084K13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023097O10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033093K22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033105L08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J065219H05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075010N07CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075130I08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090014E16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090025K17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090030L19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090035J05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090036B17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090037A15CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090064C17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090069L18CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090073N11CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090077F23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090099F02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100029N06CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100056I04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100061A13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062B10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062J17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072F22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072J22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100076C03CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
X91808CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Z11931CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Os07g0589000AK069813CCGATCCGACGGCCCGLateral organ boundaries, LOB domain containing protein. 
J023030F23CCGATCCGACGGCCCGNONE 
J065165H21CCGATCCGACGGCCCGNONE 
J065193G01CCGATCCGACGGCCCGNONE 
J075093F03CCGATCCGACGGCCCGNONE 
Os07g0598100AK068136CACGGCCCGSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
Os08g0195400006-057-E04CACGGCCCGGTNONE 
006-057-E04CGGGCCGTGNONE 
006-057-E04GGGCCGGCCCGGCACGGCCCGNONE 
006-060-B10CACGGCCCGGTNONE 
006-060-B10CGGGCCGTGNONE 
006-060-B10GGGCCGGCCCGGCACGGCCCGNONE 
AK070464CACGGCCCGGTConserved hypothetical protein. 
AK070464CGGGCCGTGConserved hypothetical protein. 
AK070464GGGCCGGCCCGGCACGGCCCGConserved hypothetical protein. 
AK104389CACGGCCCGGTNONE 
AK104389CGGGCCGTGNONE 
AK104389GGGCCGGCCCGGCACGGCCCGNONE 
AK106140CACGGCCCGGTNONE 
AK106140CGGGCCGTGNONE 
AK106140GGGCCGGCCCGGCACGGCCCGNONE 
J023013G08CACGGCCCGGTNONE 
J023013G08CGGGCCGTGNONE 
J023013G08GGGCCGGCCCGGCACGGCCCGNONE 
J023054K19CACGGCCCGGTNONE 
J023054K19CGGGCCGTGNONE 
J023054K19GGGCCGGCCCGGCACGGCCCGNONE 
J023089D18CACGGCCCGGTNONE 
J023089D18CGGGCCGTGNONE 
J023089D18GGGCCGGCCCGGCACGGCCCGNONE 
J023092K05CACGGCCCGGTNONE 
J023092K05CGGGCCGTGNONE 
J023092K05GGGCCGGCCCGGCACGGCCCGNONE 
J033025A08CACGGCCCGGTNONE 
J033025A08CGGGCCGTGNONE 
J033025A08GGGCCGGCCCGGCACGGCCCGNONE 
J033067P12CACGGCCCGGTNONE 
J033067P12CGGGCCGTGNONE 
J033067P12GGGCCGGCCCGGCACGGCCCGNONE 
J033098A10CACGGCCCGGTNONE 
J033098A10CGGGCCGTGNONE 
J033098A10GGGCCGGCCCGGCACGGCCCGNONE 
J065219L04CACGGCCCGGTNONE 
J065219L04CGGGCCGTGNONE 
J065219L04GGGCCGGCCCGGCACGGCCCGNONE 
J090021P06CACGGCCCGGTNONE 
J090021P06CGGGCCGTGNONE 
J090021P06GGGCCGGCCCGGCACGGCCCGNONE 
J090062M05CACGGCCCGGTNONE 
J090062M05CGGGCCGTGNONE 
J090062M05GGGCCGGCCCGGCACGGCCCGNONE 
J090079F15CACGGCCCGGTNONE 
J090079F15CGGGCCGTGNONE 
J090079F15GGGCCGGCCCGGCACGGCCCGNONE 
J100041H19CACGGCCCGGTNONE 
J100041H19CGGGCCGTGNONE 
J100041H19GGGCCGGCCCGGCACGGCCCGNONE 
Os08g0224200AK101331CGGACGGCCCGGTSimilar to Ythdf2-prov protein. 
AK101331CGGGCCGTGCCGGCCCSimilar to Ythdf2-prov protein. 
Os08g0230000014-096-F01CCGTGGGCCGGGCCGTCGGGCCGTANONE 
AK067127CCGTGGGCCGGGCCGTCGGGCCGTAConserved hypothetical protein. 
J013096C05CCGTGGGCCGGGCCGTCGGGCCGTANONE 
J100032D12CCGTGGGCCGGGCCGTCGGGCCGTANONE 
Os08g0328300AK102227CACGGCCCGTTNONE 
AK102227CGGGCCGTGNONE 
AK102227GCCGGGCCGTGNONE 
AK105392CACGGCCCGTTENT domain containing protein. 
AK105392CGGGCCGTGENT domain containing protein. 
AK105392GCCGGGCCGTGENT domain containing protein. 
Os08g0425000AK105302GCCGGGCCGTCCConserved hypothetical protein. 
Os08g0433200013-023-E07TACGGCCCGGCCCAAANONE 
AK099471TACGGCCCGGCCCAAAConserved hypothetical protein. 
J013024A05TACGGCCCGGCCCAAANONE 
J013065N03TACGGCCCGGCCCAAANONE 
J023111A21TACGGCCCGGCCCAAANONE 
J065035F10TACGGCCCGGCCCAAANONE 
J065083H01TACGGCCCGGCCCAAANONE 
J065159E03TACGGCCCGGCCCAAANONE 
J065186A03TACGGCCCGGCCCAAANONE 
J075032B02TACGGCCCGGCCCAAANONE 
J075038L14TACGGCCCGGCCCAAANONE 
J075047N21TACGGCCCGGCCCAAANONE 
J075076H05TACGGCCCGGCCCAAANONE 
J075110C08TACGGCCCGGCCCAAANONE 
J090096K17TACGGCCCGGCCCAAANONE 
Os08g0525600AK103172TCCGGGCCGTTSimilar to Peptidylprolyl isomerase; FK506-binding protein. 
Os08g0535400004-001-H10CGGGCCGTTNONE 
AK071527CGGGCCGTTZinc finger, DHHC-type domain containing protein. 
J023107B02CGGGCCGTTNONE 
Os08g0554000AK111661AGATGGGCCGGGCCGTAWD-40 repeat containing protein. 
AK112044AGATGGGCCGGGCCGTANONE 
J013039N12AGATGGGCCGGGCCGTANONE 
J013134D02AGATGGGCCGGGCCGTANONE 
J013153B06AGATGGGCCGGGCCGTANONE 
J033044L16AGATGGGCCGGGCCGTANONE 
J033073P14AGATGGGCCGGGCCGTANONE 
Os09g0325700011-041-G03GGACGGCCCGGANONE 
AK063334GGACGGCCCGGASimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24GGACGGCCCGGANONE 
Os09g0424600AK073882TCCGGGCCGTGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0432300J080031G07TACGGCCCGConserved hypothetical protein. 
Os09g0454900011-052-B02AAACGGCCCGNONE 
016-025-D09AAACGGCCCGNONE 
AK102152AAACGGCCCGCurculin-like (mannose-binding) lectin domain containing protein. 
J033086D22AAACGGCCCGNONE 
Os09g0461800009-087-C07CGGGCCGTTTNONE 
AK062676CGGGCCGTTTEsterase/lipase/thioesterase domain containing protein. 
Os09g0472900009-179-B12CACGGCCCGNONE 
AK063132CACGGCCCGSimilar to Blight-associated protein p12 precursor. 
J065022E01CACGGCCCGNONE 
J065034L01CACGGCCCGNONE 
J065073P13CACGGCCCGNONE 
J065079I12CACGGCCCGNONE 
J065144L22CACGGCCCGNONE 
J065180K05CACGGCCCGNONE 
J100063O18CACGGCCCGNONE 
Os09g0516600AK070780AGGTGGGCCCCACGGCCCGNONE 
AK103563AGGTGGGCCCCACGGCCCGNONE 
AY054407AGGTGGGCCCCACGGCCCGGlyoxalase II. 
J013058P06AGGTGGGCCCCACGGCCCGNONE 
J013093G04AGGTGGGCCCCACGGCCCGNONE 
J023007G05AGGTGGGCCCCACGGCCCGNONE 
J023091A08AGGTGGGCCCCACGGCCCGNONE 
J023136K23AGGTGGGCCCCACGGCCCGNONE 
J023138D20AGGTGGGCCCCACGGCCCGNONE 
J033022N20AGGTGGGCCCCACGGCCCGNONE 
J033065N15AGGTGGGCCCCACGGCCCGNONE 
J033109L23AGGTGGGCCCCACGGCCCGNONE 
J053073C08AGGTGGGCCCCACGGCCCGNONE 
J075094J24AGGTGGGCCCCACGGCCCGNONE 
J075106P21AGGTGGGCCCCACGGCCCGNONE 
Os09g0559800AK071542CGGGCCGTTSimilar to Transporter-like protein. 
J013063N24CGGGCCGTTNONE 
Os11g0206300016-010-D02CGGGCCGTTGGATNONE 
AK064170CGGGCCGTTGGATMitochodrial transcription termination factor-related family protein. 
Os11g0219400AK069850CACGGCCCGGTAnkyrin repeat containing protein. 
AK099123CACGGCCCGGTNONE 
J023143G18CACGGCCCGGTNONE 
Os11g0286800AK072702GACGGCCCGTerpene synthase family protein. 
AK100763GACGGCCCGNONE 
AK107355GACGGCCCGNONE 
J013026O22GACGGCCCGNONE 
J013065A14GACGGCCCGNONE 
J013129G22GACGGCCCGNONE 
J023119J04GACGGCCCGNONE 
Os11g0615700AB026561AACGGCCCGNONE 
AK059521AACGGCCCGNONE 
AK103487AACGGCCCGProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14AACGGCCCGNONE 
J065044A11AACGGCCCGNONE 
J065090I02AACGGCCCGNONE 
J065104I09AACGGCCCGNONE 
J065187J10AACGGCCCGNONE 
J075024E07AACGGCCCGNONE 
J075025O13AACGGCCCGNONE 
J090062N12AACGGCCCGNONE 
J090087G06AACGGCCCGNONE 
J090098K11AACGGCCCGNONE 
Os11g0660000AK066709CACGGCCCGTTSodium/calcium exchanger membrane region domain containing protein. 
AK066709CGGGCCGTGSodium/calcium exchanger membrane region domain containing protein. 
AK066709CGGGCCGTGSodium/calcium exchanger membrane region domain containing protein. 
AK066709GCCGGGCCGTGSodium/calcium exchanger membrane region domain containing protein. 
J013074O18CACGGCCCGTTNONE 
J013074O18CGGGCCGTGNONE 
J013074O18CGGGCCGTGNONE 
J013074O18GCCGGGCCGTGNONE 
J023081H12CACGGCCCGTTNONE 
J023081H12CGGGCCGTGNONE 
J023081H12CGGGCCGTGNONE 
J023081H12GCCGGGCCGTGNONE 
J065072E24CACGGCCCGTTNONE 
J065072E24CGGGCCGTGNONE 
J065072E24CGGGCCGTGNONE 
J065072E24GCCGGGCCGTGNONE 
J065186K08CACGGCCCGTTNONE 
J065186K08CGGGCCGTGNONE 
J065186K08CGGGCCGTGNONE 
J065186K08GCCGGGCCGTGNONE 
J075079E19CACGGCCCGTTNONE 
J075079E19CGGGCCGTGNONE 
J075079E19CGGGCCGTGNONE 
J075079E19GCCGGGCCGTGNONE 
J075093J05CACGGCCCGTTNONE 
J075093J05CGGGCCGTGNONE 
J075093J05CGGGCCGTGNONE 
J075093J05GCCGGGCCGTGNONE 
J075124I21CACGGCCCGTTNONE 
J075124I21CGGGCCGTGNONE 
J075124I21CGGGCCGTGNONE 
J075124I21GCCGGGCCGTGNONE 
J075187F09CACGGCCCGTTNONE 
J075187F09CGGGCCGTGNONE 
J075187F09CGGGCCGTGNONE 
J075187F09GCCGGGCCGTGNONE 
J090037O16CACGGCCCGTTNONE 
J090037O16CGGGCCGTGNONE 
J090037O16CGGGCCGTGNONE 
J090037O16GCCGGGCCGTGNONE 
Os12g0111600009-151-A07GACGGCCCGNONE 
AK119685GACGGCCCGNONE 
AK120264GACGGCCCGHypoxia induced protein conserved region family protein. 
J013047D01GACGGCCCGNONE 
J023111D22GACGGCCCGNONE 
J023128C07GACGGCCCGNONE 
J065170J03GACGGCCCGNONE 
J065198L01GACGGCCCGNONE 
J100037I18GACGGCCCGNONE 
J100073O19GACGGCCCGNONE 
Os12g0141400AK071576AAACGGCCCGHypothetical protein. 
J023105A17AAACGGCCCGNONE 
Os12g0145700AK071391CACGGCCCGPyruvate kinase family protein. 
J023013N02CACGGCCCGNONE 
J033085D15CACGGCCCGNONE 
J043021I09CACGGCCCGNONE 
J100055L05CACGGCCCGNONE 
Os12g0557800AK121691AACGGGCCGTGProtein prenyltransferase domain containing protein. 
J013095M03AACGGGCCGTGNONE 
J033071H11AACGGGCCGTGNONE 
J065101B02AACGGGCCGTGNONE 
Os12g0614300J100063C15CGGGCCGTTGConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.