version

Summary of OsREG447 (All List)

OrganismOryza sativa  
IDOsREG447  
SequenceACGTCACC  
Annotation  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE MotifTGAC  "A core of TGAC-containing W-box" of, e.g., Amy32b promoter; Binding site of rice WRKY71, a transcriptional repressor of the gibberellin signaling pathway; Parsley WRKY proteins bind specifically to TGAC-containing W box elements within the Pathogenesis-Related Class10 (PR-10) genes (Eulgem et al., 1999); See S000390 (TTGAC), S000442 (TGACT);  
Total Entry Count762  

Entry Sequences (762 entries)

LocusGene modelSequenceDescription
Os01g0138500AK073435GGTGACGTProtein of unknown function DUF789 family protein. 
J023118K18GGTGACGTNONE 
J033039C22GGTGACGTNONE 
Os01g0186900013-032-B12CACGTCACCNONE 
013-069-C11CACGTCACCNONE 
AK105323CACGTCACCNONE 
AK105331CACGTCACCConserved hypothetical protein. 
AK106168CACGTCACCNONE 
J065023I10CACGTCACCNONE 
J065182I03CACGTCACCNONE 
J075116O22CACGTCACCNONE 
J090082G13CACGTCACCNONE 
J100060H12CACGTCACCNONE 
Os01g0212700AK108311CACGTCACCZinc finger, RING-type domain containing protein. 
Os01g0257100J100030B03CGCCACGTCACCNONE 
J100046K16CGCCACGTCACCRapid ALkalinization Factor family protein. 
Os01g0321800AK064712ACGTCACCGas vesicle protein GvpC repeat containing protein. 
J075175N03ACGTCACCNONE 
Os01g0348700009-125-H02GGTGACGTNONE 
009-156-F08GGTGACGTNONE 
009-177-A11GGTGACGTNONE 
009-195-D02GGTGACGTNONE 
013-040-B06GGTGACGTNONE 
013-051-B09GGTGACGTNONE 
AK120842GGTGACGTSimilar to 60S ribosomal protein L23a (L25). 
J013071O22GGTGACGTNONE 
J023022J07GGTGACGTNONE 
J033028J08GGTGACGTNONE 
J033109M11GGTGACGTNONE 
J043022K15GGTGACGTNONE 
J043031N11GGTGACGTNONE 
J053023I10GGTGACGTNONE 
J053045F16GGTGACGTNONE 
J053054F22GGTGACGTNONE 
J053094P15GGTGACGTNONE 
J065048F01GGTGACGTNONE 
J075012F16GGTGACGTNONE 
J075089C09GGTGACGTNONE 
J075179J20GGTGACGTNONE 
J080305E19GGTGACGTNONE 
J080309B21GGTGACGTNONE 
J090017L05GGTGACGTNONE 
J090058B11GGTGACGTNONE 
Os01g0528800AK059305GGTGACGTNONE 
AK068824GGTGACGTSimilar to Cinnamyl alcohol dehydrogenase. 
Os01g0667900013-097-A02GCGGGCCCCCACGGTGACGTCACCNONE 
014-011-C01GCGGGCCCCCACGGTGACGTCACCNONE 
AK105335GCGGGCCCCCACGGTGACGTCACCGlutaredoxin-like, plant II family protein. 
J065156F10GCGGGCCCCCACGGTGACGTCACCNONE 
J065163D22GCGGGCCCCCACGGTGACGTCACCNONE 
J065197J04GCGGGCCCCCACGGTGACGTCACCNONE 
J075122C02GCGGGCCCCCACGGTGACGTCACCNONE 
J100047L16GCGGGCCCCCACGGTGACGTCACCNONE 
Os01g0843700J065093C02CACGTCACCConserved hypothetical protein. 
J065207M23CACGTCACCNONE 
Os01g0848550J065073P06GGTGACGTGConserved hypothetical protein. 
Os01g0866400AB007193CACGTCACCSimilar to Fructose-1,6-bisphosphatase (EC 3.1.3.11) (Fragment). 
AF378183CACGTCACCNONE 
AK070516CACGTCACCNONE 
AK119536CACGTCACCNONE 
J023057C24CACGTCACCNONE 
J023078G07CACGTCACCNONE 
J065015D23CACGTCACCNONE 
J065050J17CACGTCACCNONE 
J065058B03CACGTCACCNONE 
J065119C16CACGTCACCNONE 
J065134N01CACGTCACCNONE 
J065174B10CACGTCACCNONE 
J075046D04CACGTCACCNONE 
J075172N05CACGTCACCNONE 
Os01g0900800009-086-C08CACGTCACCNONE 
AK068254CACGTCACCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK105713CACGTCACCNONE 
J053025O10CACGTCACCNONE 
J065063K24CACGTCACCNONE 
J065167N21CACGTCACCNONE 
J100060A20CACGTCACCNONE 
J100079J03CACGTCACCNONE 
J100087D11CACGTCACCNONE 
J100089K10CACGTCACCNONE 
Os01g0914000AK101364ACGTCACCConserved hypothetical protein. 
J080302O10ACGTCACCNONE 
J080305G04ACGTCACCNONE 
J080316B11ACGTCACCNONE 
J090049A14ACGTCACCNONE 
J090066O10ACGTCACCNONE 
Os02g0127900AK102783GGTGACGTHypothetical protein. 
AK102783GGTGACGTGGCHypothetical protein. 
J065042F15GGTGACGTNONE 
J065042F15GGTGACGTGGCNONE 
J075005J10GGTGACGTNONE 
J075005J10GGTGACGTGGCNONE 
J075038F02GGTGACGTNONE 
J075038F02GGTGACGTGGCNONE 
J075048K10GGTGACGTNONE 
J075048K10GGTGACGTGGCNONE 
J075064D21GGTGACGTNONE 
J075064D21GGTGACGTGGCNONE 
J075074M07GGTGACGTNONE 
J075074M07GGTGACGTGGCNONE 
J075078D20GGTGACGTNONE 
J075078D20GGTGACGTGGCNONE 
J075109P15GGTGACGTNONE 
J075109P15GGTGACGTGGCNONE 
J075115K24GGTGACGTNONE 
J075115K24GGTGACGTGGCNONE 
J075135G01GGTGACGTNONE 
J075135G01GGTGACGTGGCNONE 
J075156B07GGTGACGTNONE 
J075156B07GGTGACGTGGCNONE 
Os02g0307800006-080-C10GGTGACGTGNONE 
006-116-A02GGTGACGTGNONE 
AK061868GGTGACGTGNONE 
AK065304GGTGACGTGConserved hypothetical protein. 
Os02g0326700AK064977GGTGACGTGRhomboid-like protein family protein. 
Os02g0468200AK103767CACGTCACCProtein of unknown function DUF652 family protein. 
J033071N12CACGTCACCNONE 
J033143I02CACGTCACCNONE 
J100019J22CACGTCACCNONE 
J100075O13CACGTCACCNONE 
Os02g0522700012-086-C03GCCACGTCACCNONE 
Os02g0534600Os02g0534600ACGTGGCGGTGACGTGGCGConserved hypothetical protein. 
Os02g0551600009-174-H09GCCACGTCACCNONE 
AK063102GCCACGTCACCConserved hypothetical protein. 
Os02g0575000AK121198ACGTCACCConserved hypothetical protein. 
AK121198ACGTCACCConserved hypothetical protein. 
J023087D21ACGTCACCNONE 
J023087D21ACGTCACCNONE 
J065029M04ACGTCACCNONE 
J065029M04ACGTCACCNONE 
J065173G10ACGTCACCNONE 
J065173G10ACGTCACCNONE 
J065188I20ACGTCACCNONE 
J065188I20ACGTCACCNONE 
J065197H16ACGTCACCNONE 
J065197H16ACGTCACCNONE 
J100057F16ACGTCACCNONE 
J100057F16ACGTCACCNONE 
J100077G04ACGTCACCNONE 
J100077G04ACGTCACCNONE 
Os02g0582400006-091-G09GGTGACGTGNONE 
AK070989GGTGACGTGConserved hypothetical protein. 
J023075I23GGTGACGTGNONE 
J080021H07GGTGACGTGNONE 
J080068A03GGTGACGTGNONE 
J080089B13GGTGACGTGNONE 
J080093G22GGTGACGTGNONE 
Os02g0754700AK066904GGTGACGTSimilar to Histidyl-tRNA synthetase (EC 6.1.1.21). 
AK099136GGTGACGTNONE 
Os02g0803600AK064750ACGTCACCLongin-like domain containing protein. 
Os03g0113000009-007-C03ACGTCACCNONE 
AK058286ACGTCACCProtein kinase-like domain containing protein. 
AK071309ACGTCACCNONE 
AK104314ACGTCACCNONE 
Os03g0119900AK058741CGCCACGTCACCGATCCGhistone H4 [Oryza sativa (japonica cultivar-group)]. 
J065035O07CGCCACGTCACCGATCCGNONE 
J065165C24CGCCACGTCACCGATCCGNONE 
J075039M05CGCCACGTCACCGATCCGNONE 
Os03g0141200AK068968CGCCACGTCACCCGCACGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092CGCCACGTCACCCGCACGCGNONE 
J023003L18CGCCACGTCACCCGCACGCGNONE 
J023022K18CGCCACGTCACCCGCACGCGNONE 
J023107H13CGCCACGTCACCCGCACGCGNONE 
J023107K02CGCCACGTCACCCGCACGCGNONE 
Os03g0161200AK066932GGTGACGTGTCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0215800AK071308CACGTCACCPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
Os03g0288700AK110718GGACACGTCACCAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0634000014-034-A03CACGTCACCNONE 
AK063673CACGTCACCSimilar to THA4. 
Os03g0667100012-045-B01ACGTCACCNONE 
AK065363ACGTCACCBTB domain containing protein. 
AK065952ACGTCACCNONE 
J013045I05ACGTCACCNONE 
J013129F20ACGTCACCNONE 
Os03g0745000AK109590CGCCACGTCACCGCACNONE 
AY332465CGCCACGTCACCGCACNONE 
AY344486CGCCACGTCACCGCACNONE 
AY998118CGCCACGTCACCGCACWinged helix repressor DNA-binding domain containing protein. 
Os03g0802500005-009-E09ACGTCACCNONE 
016-058-E03ACGTCACCNONE 
AK070731ACGTCACCAAA ATPase domain containing protein. 
AK099212ACGTCACCNONE 
AK104696ACGTCACCNONE 
J013050J10ACGTCACCNONE 
J023061A01ACGTCACCNONE 
J023088E08ACGTCACCNONE 
J033084A02ACGTCACCNONE 
J090015G11ACGTCACCNONE 
J090075G22ACGTCACCNONE 
J100067G24ACGTCACCNONE 
Os03g0810800006-060-G12GGTGACGTGGCNONE 
006-063-F08GGTGACGTGGCNONE 
006-102-H09GGTGACGTGGCNONE 
AK060010GGTGACGTGGCSimilar to Short-chain alcohol dehydrogenase. 
AK070201GGTGACGTGGCNONE 
AK105938GGTGACGTGGCNONE 
J023042C15GGTGACGTGGCNONE 
J053075K10GGTGACGTGGCNONE 
J065061E08GGTGACGTGGCNONE 
J065079B21GGTGACGTGGCNONE 
J065082F07GGTGACGTGGCNONE 
J065128H02GGTGACGTGGCNONE 
J065195C03GGTGACGTGGCNONE 
J090038F07GGTGACGTGGCNONE 
J090048P14GGTGACGTGGCNONE 
J090052C07GGTGACGTGGCNONE 
J090089M12GGTGACGTGGCNONE 
J090097F20GGTGACGTGGCNONE 
J100037H03GGTGACGTGGCNONE 
J100038K01GGTGACGTGGCNONE 
Os03g0812200011-060-G11ACGTCACCNONE 
012-035-D04ACGTCACCNONE 
AK060419ACGTCACCNONE 
AK067585ACGTCACCZinc finger, RING-type domain containing protein. 
J013111A16ACGTCACCNONE 
J013169G17ACGTCACCNONE 
J023088G08ACGTCACCNONE 
J023106G03ACGTCACCNONE 
J033038K23ACGTCACCNONE 
J033118H11ACGTCACCNONE 
J090003M07ACGTCACCNONE 
J090031L06ACGTCACCNONE 
J090045B19ACGTCACCNONE 
J090058P14ACGTCACCNONE 
J100028C22ACGTCACCNONE 
J100041B04ACGTCACCNONE 
J100042B08ACGTCACCNONE 
J100061F10ACGTCACCNONE 
Os03g0818100015-098-A09GGTGACGTGTCACTNONE 
AK064366GGTGACGTGTCACTNONE 
AK121701GGTGACGTGTCACTHistidine acid phosphatase family protein. 
Os03g0825700AK067902CACGTCACCSimilar to Defective in exine formation. 
Os03g0829600AK071298GGTGACGTNONE 
AK119707GGTGACGTConserved hypothetical protein. 
J023084A07GGTGACGTNONE 
Os04g0286400009-144-C10GCCACGTCACCNONE 
AK062974GCCACGTCACCHypothetical protein. 
Os04g0447400AK070858CACGTCACCSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09CACGTCACCNONE 
J023003G16CACGTCACCNONE 
J023006F16CACGTCACCNONE 
J023008D10CACGTCACCNONE 
J023010A01CACGTCACCNONE 
J023012M16CACGTCACCNONE 
J023023H17CACGTCACCNONE 
J023029B12CACGTCACCNONE 
J023030F09CACGTCACCNONE 
J023034K03CACGTCACCNONE 
J023045A16CACGTCACCNONE 
J023048I04CACGTCACCNONE 
J023056C09CACGTCACCNONE 
J023056F05CACGTCACCNONE 
J023058B21CACGTCACCNONE 
J023058N06CACGTCACCNONE 
J023059F03CACGTCACCNONE 
J023059M19CACGTCACCNONE 
J023060P05CACGTCACCNONE 
J023062D07CACGTCACCNONE 
J023063F16CACGTCACCNONE 
J023068K15CACGTCACCNONE 
J023069L04CACGTCACCNONE 
J023075I24CACGTCACCNONE 
J023086H01CACGTCACCNONE 
J023086I24CACGTCACCNONE 
J023091M08CACGTCACCNONE 
J023095A07CACGTCACCNONE 
J023110K06CACGTCACCNONE 
J023113D07CACGTCACCNONE 
J023126J05CACGTCACCNONE 
J023140F04CACGTCACCNONE 
J023141N19CACGTCACCNONE 
Os04g0447500AK064090GGTGACGTGSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247). 
Os04g0564700AK111806CACGTCACCQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os04g0565500006-022-C06ACGTCACCNONE 
AK058888ACGTCACCAmino acid/polyamine transporter II family protein. 
AK071118ACGTCACCNONE 
AK105902ACGTCACCNONE 
J023052I22ACGTCACCNONE 
J023082L01ACGTCACCNONE 
J023112P14ACGTCACCNONE 
J065043O12ACGTCACCNONE 
J065045B08ACGTCACCNONE 
J065059N01ACGTCACCNONE 
J065073A04ACGTCACCNONE 
J065078K06ACGTCACCNONE 
J065124J08ACGTCACCNONE 
J065140G16ACGTCACCNONE 
J065185E13ACGTCACCNONE 
J065197N09ACGTCACCNONE 
J100024A03ACGTCACCNONE 
J100042E11ACGTCACCNONE 
J100069L15ACGTCACCNONE 
J100078K13ACGTCACCNONE 
Os04g0643100014-026-F09ACGTCACCNONE 
AK067501ACGTCACCSimilar to Vacuolar ATP synthase subunit D (EC 3.6.3.14) (V-ATPase D subunit) (Vacuolar proton pump D subunit). 
AK106989ACGTCACCNONE 
J013110H12ACGTCACCNONE 
J090089E23ACGTCACCNONE 
J100033G14ACGTCACCNONE 
J100033L15ACGTCACCNONE 
J100041J24ACGTCACCNONE 
J100041M14ACGTCACCNONE 
J100057A03ACGTCACCNONE 
J100059C11ACGTCACCNONE 
J100072B15ACGTCACCNONE 
J100073N24ACGTCACCNONE 
Os05g0145100AK107957CACGTCACCConserved hypothetical protein. 
Os05g0171900012-005-F08GGTGACGTGNONE 
012-048-G09GGTGACGTGNONE 
013-046-A07GGTGACGTGNONE 
013-050-D10GGTGACGTGNONE 
014-003-G04GGTGACGTGNONE 
014-008-G10GGTGACGTGNONE 
014-011-E07GGTGACGTGNONE 
014-011-F11GGTGACGTGNONE 
014-019-C02GGTGACGTGNONE 
014-037-G03GGTGACGTGNONE 
014-043-G06GGTGACGTGNONE 
014-045-A05GGTGACGTGNONE 
014-047-C07GGTGACGTGNONE 
014-052-F03GGTGACGTGNONE 
014-088-G07GGTGACGTGNONE 
014-090-B11GGTGACGTGNONE 
015-010-A06GGTGACGTGNONE 
015-013-B11GGTGACGTGNONE 
015-026-A04GGTGACGTGNONE 
015-041-G01GGTGACGTGNONE 
015-046-D06GGTGACGTGNONE 
015-050-B07GGTGACGTGNONE 
015-053-C03GGTGACGTGNONE 
015-056-C04GGTGACGTGNONE 
015-057-B04GGTGACGTGNONE 
015-075-C12GGTGACGTGNONE 
015-079-F04GGTGACGTGNONE 
016-025-F02GGTGACGTGNONE 
016-030-B10GGTGACGTGNONE 
016-034-B03GGTGACGTGNONE 
016-034-E04GGTGACGTGNONE 
016-035-B07GGTGACGTGNONE 
016-035-D10GGTGACGTGNONE 
016-039-C06GGTGACGTGNONE 
016-042-D01GGTGACGTGNONE 
016-043-C02GGTGACGTGNONE 
016-044-B01GGTGACGTGNONE 
016-045-G06GGTGACGTGNONE 
016-049-G07GGTGACGTGNONE 
016-052-C10GGTGACGTGNONE 
016-070-D03GGTGACGTGNONE 
016-077-H10GGTGACGTGNONE 
016-082-F02GGTGACGTGNONE 
016-087-D04GGTGACGTGNONE 
016-093-B05GGTGACGTGNONE 
016-093-F06GGTGACGTGNONE 
AK069814GGTGACGTGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
AK106348GGTGACGTGNONE 
AK119584GGTGACGTGNONE 
AK119669GGTGACGTGNONE 
J013074J12GGTGACGTGNONE 
J023031G07GGTGACGTGNONE 
J023072P16GGTGACGTGNONE 
J023105N07GGTGACGTGNONE 
J053023E11GGTGACGTGNONE 
J053025H06GGTGACGTGNONE 
J053029G08GGTGACGTGNONE 
J053051L10GGTGACGTGNONE 
J065011P09GGTGACGTGNONE 
J065022O05GGTGACGTGNONE 
J065071D04GGTGACGTGNONE 
J065100B07GGTGACGTGNONE 
J065104O10GGTGACGTGNONE 
J065154H19GGTGACGTGNONE 
J065183D19GGTGACGTGNONE 
J065185I07GGTGACGTGNONE 
J065205O17GGTGACGTGNONE 
J075022N11GGTGACGTGNONE 
J100033M17GGTGACGTGNONE 
Os05g0344200006-022-E04CACGTCACCNONE 
006-080-D01CACGTCACCNONE 
009-021-D03CACGTCACCNONE 
009-026-A10CACGTCACCNONE 
009-054-B12CACGTCACCNONE 
009-059-H03CACGTCACCNONE 
009-077-C02CACGTCACCNONE 
009-095-H12CACGTCACCNONE 
009-106-B08CACGTCACCNONE 
009-138-D10CACGTCACCNONE 
009-140-G06CACGTCACCNONE 
009-146-E09CACGTCACCNONE 
009-161-F04CACGTCACCNONE 
009-176-F05CACGTCACCNONE 
013-047-C03CACGTCACCNONE 
013-052-E07CACGTCACCNONE 
013-054-G04CACGTCACCNONE 
013-095-D10CACGTCACCNONE 
014-003-D06CACGTCACCNONE 
014-020-C09CACGTCACCNONE 
014-043-E01CACGTCACCNONE 
014-080-G09CACGTCACCNONE 
014-081-H05CACGTCACCNONE 
AK060058CACGTCACCConserved hypothetical protein. 
AK098850CACGTCACCNONE 
AK104716CACGTCACCNONE 
AK119727CACGTCACCNONE 
J013000G04CACGTCACCNONE 
J013155L11CACGTCACCNONE 
J033138J22CACGTCACCNONE 
J065112E22CACGTCACCNONE 
J065124M06CACGTCACCNONE 
J065130M01CACGTCACCNONE 
J065137I03CACGTCACCNONE 
J065157O12CACGTCACCNONE 
J065171B12CACGTCACCNONE 
J075003O16CACGTCACCNONE 
J075026G12CACGTCACCNONE 
J075032K07CACGTCACCNONE 
J075070I11CACGTCACCNONE 
J075093K06CACGTCACCNONE 
J075148C12CACGTCACCNONE 
J075148L08CACGTCACCNONE 
J075152G13CACGTCACCNONE 
J075177G07CACGTCACCNONE 
J100026I09CACGTCACCNONE 
J100083L11CACGTCACCNONE 
J100086F04CACGTCACCNONE 
Os05g0368700AK064686ACGTCACCSimilar to Subtilisin-like protease (Fragment). 
Os05g0386900AK071425GGTGACGTNONE 
AK073634GGTGACGTReticulon family protein. 
Os05g0391000AK109555ACGTCACCConserved hypothetical protein. 
Os05g0506000AF031609CACGTCACCNONE 
AK062012CACGTCACCNONE 
AK098900CACGTCACCNONE 
AK122090CACGTCACCSimilar to MS5-like protein (Fragment). 
J013002B13CACGTCACCNONE 
J023149G13CACGTCACCNONE 
J033123O20CACGTCACCNONE 
J080315O17CACGTCACCNONE 
Os05g0508500009-110-H08CACGTCACCNONE 
009-135-B09CACGTCACCNONE 
009-165-D10CACGTCACCNONE 
AB053294CACGTCACCNONE 
AK059385CACGTCACCNONE 
AK106758CACGTCACCSimilar to Thioredoxin H. 
J013121L08CACGTCACCNONE 
J023069L24CACGTCACCNONE 
J023146O17CACGTCACCNONE 
J043030D01CACGTCACCNONE 
J065084D15CACGTCACCNONE 
J090046E10CACGTCACCNONE 
J090078J10CACGTCACCNONE 
Os05g0529300AK102648CGCCACGTCACCSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06GGTGACGTCACCNONE 
009-126-H06GGTGACGTGGCGNONE 
AK063846GGTGACGTCACCConserved hypothetical protein. 
AK063846GGTGACGTGGCGConserved hypothetical protein. 
AK122038GGTGACGTCACCNONE 
AK122038GGTGACGTGGCGNONE 
J033113C01GGTGACGTCACCNONE 
J033113C01GGTGACGTGGCGNONE 
Os05g0540100AB021666CACGTCACCNONE 
AK060623CACGTCACCNONE 
AK103819CACGTCACCFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0566400AK061645GCCACGTCACCNONE 
AK099472GCCACGTCACCNONE 
AK100389GCCACGTCACCSimilar to Blast and wounding induced mitogen-activated protein kinase. 
Os06g0113900AK067430ACGTCACCNONE 
AK102259ACGTCACCNONE 
AK120464ACGTCACCConserved hypothetical protein. 
J065144I06ACGTCACCNONE 
Os06g0156700AK107226GGTGACGTLipolytic enzyme, G-D-S-L family protein. 
J075021O05GGTGACGTNONE 
J075023M12GGTGACGTNONE 
J075041C14GGTGACGTNONE 
J075041C19GGTGACGTNONE 
J075064F08GGTGACGTNONE 
J075116I03GGTGACGTNONE 
J075123I02GGTGACGTNONE 
Os06g0229800AB115915ACGTCACCNONE 
AB115916ACGTCACCNONE 
AB115917ACGTCACCNONE 
AB115918ACGTCACCNONE 
AF419099ACGTCACCSimilar to Starch synthase IIA. 
AK101978ACGTCACCNONE 
Os06g0593100AK060274CACGCCACGTCACCSimilar to UDP-galactose/UDP-glucose transporter. 
AK071175CACGCCACGTCACCNONE 
Os06g0598800011-079-A05GGTGACGTGNONE 
014-040-G10GGTGACGTGNONE 
AK101377GGTGACGTGSimilar to Fatty acid elongase 1-like protein. 
J013022A17GGTGACGTGNONE 
J023011B05GGTGACGTGNONE 
J023104L12GGTGACGTGNONE 
J033033O20GGTGACGTGNONE 
J033036C04GGTGACGTGNONE 
J065060C17GGTGACGTGNONE 
J075009D16GGTGACGTGNONE 
J075123K20GGTGACGTGNONE 
J075191A14GGTGACGTGNONE 
J090038I01GGTGACGTGNONE 
Os06g0636700AK058562CACGTCACCLipolytic enzyme, G-D-S-L family protein. 
Os06g0683800AK110639CACGTCACGTCACCConserved hypothetical protein. 
Os06g0712800AK121236CGCCACGTCACCSimilar to Ankyrin-like protein. 
Os06g0725900AK061771CACGTCACCNONE 
AK065019CACGTCACCSimilar to Cell division protein ftsH homolog, chloroplast precursor (EC 3.4.24.-) (DS9). 
Os07g0115300006-039-C05CACGTCACCNONE 
AK061511CACGTCACCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
Os07g0139400AB096864ACGTCACCNONE 
AK065558ACGTCACCUDP-glucose 4-epimerase family protein. 
AK099140ACGTCACCNONE 
AK099183ACGTCACCNONE 
J013033B01ACGTCACCNONE 
J013157B14ACGTCACCNONE 
J023052E04ACGTCACCNONE 
J023086K05ACGTCACCNONE 
J023099C15ACGTCACCNONE 
J033025C08ACGTCACCNONE 
J033072I24ACGTCACCNONE 
J043020I04ACGTCACCNONE 
J090039I21ACGTCACCNONE 
J090078P20ACGTCACCNONE 
J090084C18ACGTCACCNONE 
J100024F07ACGTCACCNONE 
J100054D22ACGTCACCNONE 
J100062O08ACGTCACCNONE 
Os07g0168600AK068262CACGTCACCSimilar to 3-glucanase. 
AK105668CACGTCACCNONE 
Os07g0181000AK066918GCCACGTCACCNONE 
AK070512GCCACGTCACCSimilar to Pyruvate kinase isozyme A, chloroplast precursor (EC 2.7.1.40). 
Os07g0181500AK072431CGCCACGTCACCProtein of unknown function DUF506, plant family protein. 
Os07g0209100AK120944GGACACGTCACCSimilar to Seed imbibition protein (Fragment). 
Os07g0238700AK067680ACGTCACCNONE 
AK101492ACGTCACCSimilar to Glutamate dehydrogenase (EC 1.4.1.3) (GDH). 
J013114K24ACGTCACCNONE 
J033042P14ACGTCACCNONE 
J065021G13ACGTCACCNONE 
J065121C20ACGTCACCNONE 
J065124D06ACGTCACCNONE 
J065157D02ACGTCACCNONE 
J065157K12ACGTCACCNONE 
J065212K07ACGTCACCNONE 
J080301G13ACGTCACCNONE 
J080308E14ACGTCACCNONE 
J080311J11ACGTCACCNONE 
J080313O06ACGTCACCNONE 
Os07g0241500AK107239ACGTCACCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK107239CACGTCACCGACACGTGGGGCCCACCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J065065I20ACGTCACCNONE 
J065065I20CACGTCACCGACACGTGGGGCCCACCCNONE 
J065158P15ACGTCACCNONE 
J065158P15CACGTCACCGACACGTGGGGCCCACCCNONE 
J065167J16ACGTCACCNONE 
J065167J16CACGTCACCGACACGTGGGGCCCACCCNONE 
J065183I01ACGTCACCNONE 
J065183I01CACGTCACCGACACGTGGGGCCCACCCNONE 
J065187L18ACGTCACCNONE 
J065187L18CACGTCACCGACACGTGGGGCCCACCCNONE 
J065205J10ACGTCACCNONE 
J065205J10CACGTCACCGACACGTGGGGCCCACCCNONE 
Os07g0258400AK121534CACGTCACCNONE 
L41217CACGTCACCNONE 
S81897CACGTCACCOsNramp1 (Integral membrane protein). 
Os07g0451300AK111468ACGTCACCCytochrome P450 family protein. 
Os07g0490300AK068288GGTGACGTSimilar to Preproacrosin. 
J013149P03GGTGACGTNONE 
J065039L14GGTGACGTNONE 
J100024A06GGTGACGTNONE 
Os07g0545400009-136-E03CGCCACGTCACCGATCCGNONE 
013-015-G08CGCCACGTCACCGATCCGNONE 
AK059228CGCCACGTCACCGATCCGNONE 
J065040D09CGCCACGTCACCGATCCGNONE 
J065051C19CGCCACGTCACCGATCCGNONE 
J065139B05CGCCACGTCACCGATCCGNONE 
J065160E20CGCCACGTCACCGATCCGNONE 
J065207I17CGCCACGTCACCGATCCGNONE 
J080319M24CGCCACGTCACCGATCCGNONE 
Os07g0557500AK101830CACGTCACCZinc finger, RING-type domain containing protein. 
J013075M04CACGTCACCNONE 
J033068I24CACGTCACCNONE 
Os08g0117100AK099630ACGTCACCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013058B07ACGTCACCNONE 
Os08g0128200AK120428GCCACGTCACCConserved hypothetical protein. 
Os08g0203800J065195H23GGTGACGTNONE 
J075146H03GGTGACGTNONE 
Os08g0237000003-111-F01ACGTCACCNONE 
006-022-H07ACGTCACCNONE 
006-028-G01ACGTCACCNONE 
006-032-D10ACGTCACCNONE 
006-039-F08ACGTCACCNONE 
006-039-H01ACGTCACCNONE 
006-051-E01ACGTCACCNONE 
006-053-E11ACGTCACCNONE 
006-055-E09ACGTCACCNONE 
006-061-H02ACGTCACCNONE 
006-062-G07ACGTCACCNONE 
006-074-D07ACGTCACCNONE 
006-074-F11ACGTCACCNONE 
006-076-F03ACGTCACCNONE 
006-080-G01ACGTCACCNONE 
006-081-A03ACGTCACCNONE 
006-084-F05ACGTCACCNONE 
006-085-B08ACGTCACCNONE 
006-089-C03ACGTCACCNONE 
006-090-B12ACGTCACCNONE 
006-092-D04ACGTCACCNONE 
006-095-E05ACGTCACCNONE 
006-100-C12ACGTCACCNONE 
006-109-C03ACGTCACCNONE 
006-114-E09ACGTCACCNONE 
009-033-G02ACGTCACCNONE 
009-189-F09ACGTCACCNONE 
009-200-A08ACGTCACCNONE 
009-200-D07ACGTCACCNONE 
AB110604ACGTCACCXyloglucan endotransglycosylase/hydrolase protein 8 precursor (EC 2.4.1.207) (End-xyloglucan transferase) (OsXTH8) (OsXRT5). 
AK060654ACGTCACCNONE 
AK104451ACGTCACCNONE 
Os08g0299200009-120-G12GCCACGTCACCNONE 
J075096F13GCCACGTCACCAdenylate cyclase domain containing protein. 
Os08g0484700J065041E01GGTGACGTGHomeodomain-like containing protein. 
Os08g0510300AK072472CACGTCACCK+ potassium transporter family protein. 
J023020L12CACGTCACCNONE 
J023112D01CACGTCACCNONE 
J023113B06CACGTCACCNONE 
J023119J10CACGTCACCNONE 
Os08g0523600009-189-E05GGTGACGTGNONE 
AK063901GGTGACGTGSimilar to CTV.22. 
Os08g0535400004-001-H10CACGTCACCNONE 
AK071527CACGTCACCZinc finger, DHHC-type domain containing protein. 
J023107B02CACGTCACCNONE 
Os08g0536300AF358777CACGTCACCNONE 
AK099722CACGTCACCSimilar to Hd1. 
J100054G13CACGTCACCNONE 
Os08g0553800006-058-A04GGTGACGTGNONE 
006-061-F09GGTGACGTGNONE 
AK065711GGTGACGTGNONE 
AK066697GGTGACGTGNmrA-like family protein. 
AK073638GGTGACGTGNONE 
AK104428GGTGACGTGNONE 
AK105897GGTGACGTGNONE 
J075001A06GGTGACGTGNONE 
J075041H20GGTGACGTGNONE 
J075123J24GGTGACGTGNONE 
Os09g0394300AK105580GGTGACGTGGCGGlycoside hydrolase, family 9 protein. 
J100046E13GGTGACGTGGCGNONE 
J100049L10GGTGACGTGGCGNONE 
J100074H21GGTGACGTGGCGNONE 
J100090G03GGTGACGTGGCGNONE 
Os09g0433000009-198-H02ACGTCACCNONE 
AK063243ACGTCACCNONE 
Os09g0457900AK067195CACGTCACCTCGGCCCCACGSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
J013098P10CACGTCACCTCGGCCCCACGNONE 
Os09g0465600AB107218GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
AK068061GACAGGTGGGTCCCACGTGGTGACGTGGCSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509GACAGGTGGGTCCCACGTGGTGACGTGGCNONE 
Os09g0480600AK107853CACGTCACCGAGCCGHypothetical protein. 
Os09g0481200005-016-B10CGCCACGTCACCNONE 
009-011-E05CGCCACGTCACCNONE 
009-045-E02CGCCACGTCACCNONE 
009-049-A02CGCCACGTCACCNONE 
009-055-H07CGCCACGTCACCNONE 
009-067-E08CGCCACGTCACCNONE 
009-068-G08CGCCACGTCACCNONE 
009-076-E11CGCCACGTCACCNONE 
009-077-E02CGCCACGTCACCNONE 
009-085-H03CGCCACGTCACCNONE 
009-088-C06CGCCACGTCACCNONE 
009-088-D07CGCCACGTCACCNONE 
009-098-A03CGCCACGTCACCNONE 
009-100-B03CGCCACGTCACCNONE 
009-105-H04CGCCACGTCACCNONE 
009-108-D08CGCCACGTCACCNONE 
009-110-E02CGCCACGTCACCNONE 
009-114-F08CGCCACGTCACCNONE 
009-118-A09CGCCACGTCACCNONE 
009-118-C10CGCCACGTCACCNONE 
009-120-F08CGCCACGTCACCNONE 
009-123-B07CGCCACGTCACCNONE 
009-126-F11CGCCACGTCACCNONE 
009-131-D02CGCCACGTCACCNONE 
009-132-F11CGCCACGTCACCNONE 
009-133-H07CGCCACGTCACCNONE 
009-134-B03CGCCACGTCACCNONE 
009-135-D08CGCCACGTCACCNONE 
009-138-E07CGCCACGTCACCNONE 
009-138-G03CGCCACGTCACCNONE 
009-140-E05CGCCACGTCACCNONE 
009-143-B06CGCCACGTCACCNONE 
009-144-D01CGCCACGTCACCNONE 
009-147-D09CGCCACGTCACCNONE 
009-149-C09CGCCACGTCACCNONE 
009-150-F10CGCCACGTCACCNONE 
009-151-E10CGCCACGTCACCNONE 
009-151-H10CGCCACGTCACCNONE 
009-154-A08CGCCACGTCACCNONE 
009-154-D03CGCCACGTCACCNONE 
009-155-B09CGCCACGTCACCNONE 
009-163-E08CGCCACGTCACCNONE 
009-163-G11CGCCACGTCACCNONE 
009-165-B06CGCCACGTCACCNONE 
009-165-C12CGCCACGTCACCNONE 
009-165-H07CGCCACGTCACCNONE 
009-167-D02CGCCACGTCACCNONE 
009-175-F08CGCCACGTCACCNONE 
009-177-H04CGCCACGTCACCNONE 
009-177-H08CGCCACGTCACCNONE 
009-178-B09CGCCACGTCACCNONE 
009-184-E07CGCCACGTCACCNONE 
009-186-F09CGCCACGTCACCNONE 
009-188-H01CGCCACGTCACCNONE 
009-191-G10CGCCACGTCACCNONE 
009-192-C08CGCCACGTCACCNONE 
009-192-D06CGCCACGTCACCNONE 
009-195-H11CGCCACGTCACCNONE 
009-197-C06CGCCACGTCACCNONE 
AK061695CGCCACGTCACCNONE 
AK098847CGCCACGTCACCSimilar to Photosystem I reaction center subunit V (PSI-G) (Photosystem I 9 kDa protein) (Fragment). 
J013000C21CGCCACGTCACCNONE 
J065026J24CGCCACGTCACCNONE 
J065038L06CGCCACGTCACCNONE 
J065059E08CGCCACGTCACCNONE 
J065059N21CGCCACGTCACCNONE 
J065066H14CGCCACGTCACCNONE 
J065112H14CGCCACGTCACCNONE 
J065152I16CGCCACGTCACCNONE 
J065152L16CGCCACGTCACCNONE 
J065179N13CGCCACGTCACCNONE 
J065198E01CGCCACGTCACCNONE 
J075002I24CGCCACGTCACCNONE 
J075021G08CGCCACGTCACCNONE 
J075023N02CGCCACGTCACCNONE 
J075031C09CGCCACGTCACCNONE 
J075032G16CGCCACGTCACCNONE 
J075083F07CGCCACGTCACCNONE 
J075086P19CGCCACGTCACCNONE 
J075094D01CGCCACGTCACCNONE 
J075127I02CGCCACGTCACCNONE 
J075176I18CGCCACGTCACCNONE 
J100029F21CGCCACGTCACCNONE 
J100031P15CGCCACGTCACCNONE 
J100049C10CGCCACGTCACCNONE 
J100089B21CGCCACGTCACCNONE 
Os09g0551600005-020-H08CGGATCGGTGACGTGGCGNONE 
006-043-E02CGGATCGGTGACGTGGCGNONE 
013-043-F03CGGATCGGTGACGTGGCGNONE 
AK066658CGGATCGGTGACGTGGCGSimilar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101). 
J013071N11CGGATCGGTGACGTGGCGNONE 
J065177J20CGGATCGGTGACGTGGCGNONE 
J075041D06CGGATCGGTGACGTGGCGNONE 
J075199H24CGGATCGGTGACGTGGCGNONE 
J080001G07CGGATCGGTGACGTGGCGNONE 
J080024A12CGGATCGGTGACGTGGCGNONE 
J080025B15CGGATCGGTGACGTGGCGNONE 
J090017G07CGGATCGGTGACGTGGCGNONE 
J090050G23CGGATCGGTGACGTGGCGNONE 
J090083G11CGGATCGGTGACGTGGCGNONE 
Os11g0111000AK111408ACGTCACCConserved hypothetical protein. 
Os11g0139400AK107562CACGTCACCProtein of unknown function DUF250 domain containing protein. 
Os11g0536900J100027G18GCCACGTCACCConserved hypothetical protein. 
J100073G12GCCACGTCACCNONE 
Os12g0507600009-155-B05ACGTCACCNONE 
AK070613ACGTCACCConserved hypothetical protein. 
J023063G03ACGTCACCNONE 
Os12g0626400AK063967CACGTCACCSimilar to Phytoene synthase 1, chloroplast precursor (EC 2.5.1.-) (Fruit ripening specific protein pTOM5). 
AK073290CACGTCACCNONE 
AY452768CACGTCACCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.