version

Summary of OsREG448 (All List)

OrganismOryza sativa  
IDOsREG448  
SequenceACGTGGCG  
Annotation  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE MotifACGTGKC  Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T;  
Total Entry Count3278  

Entry Sequences (3278 entries)

LocusGene modelSequenceDescription
Os01g0102500011-064-A09ACGTGGCGTGNONE 
015-011-E06ACGTGGCGTGNONE 
016-083-H11ACGTGGCGTGNONE 
AK100002ACGTGGCGTGConserved hypothetical protein. 
J065063K05ACGTGGCGTGNONE 
J065191H24ACGTGGCGTGNONE 
J100079N16ACGTGGCGTGNONE 
Os01g0144100006-118-E08GACGTGGCGNONE 
AK058909GACGTGGCGSimilar to Thylakoid lumenal 15 kDa protein, chloroplast precursor (p15). 
AK068113GACGTGGCGNONE 
AK104051GACGTGGCGNONE 
J065163E12GACGTGGCGNONE 
Os01g0151600AK063435GCCGGCCCGCCACGTGTConserved hypothetical protein. 
J065010E12GCCGGCCCGCCACGTGTNONE 
J065067D06GCCGGCCCGCCACGTGTNONE 
J090043F21GCCGGCCCGCCACGTGTNONE 
Os01g0175100AK071289CGCCACGTGTCCKv1.4 voltage-gated K+ channel family protein. 
J023088B10CGCCACGTGTCCNONE 
J065122H15CGCCACGTGTCCNONE 
J065140B19CGCCACGTGTCCNONE 
J100031E12CGCCACGTGTCCNONE 
J100068J03CGCCACGTGTCCNONE 
J100083E12CGCCACGTGTCCNONE 
Os01g0180300AK120377ACACGTGGCGLipoprotein, type 6 family protein. 
J013071N06ACACGTGGCGNONE 
J023088F12ACACGTGGCGNONE 
J100027H24ACACGTGGCGNONE 
J100053K15ACACGTGGCGNONE 
J100082M15ACACGTGGCGNONE 
Os01g0187700AK101445GCCACGTGGCGConserved hypothetical protein. 
J033039I17GCCACGTGGCGNONE 
Os01g0254000006-037-A11GACGTGGCGNONE 
006-059-H09GACGTGGCGNONE 
006-088-D11GACGTGGCGNONE 
006-112-B06GACGTGGCGNONE 
006-120-E12GACGTGGCGNONE 
AK111904GACGTGGCGNONE 
AK111979GACGTGGCGNONE 
AK119548GACGTGGCGNONE 
AY620417GACGTGGCGSimilar to NTGB2 (Fragment). 
J023112F13GACGTGGCGNONE 
J053066C19GACGTGGCGNONE 
J065006L12GACGTGGCGNONE 
J065019L17GACGTGGCGNONE 
J065081J05GACGTGGCGNONE 
J065085D02GACGTGGCGNONE 
J065203D03GACGTGGCGNONE 
J065210O20GACGTGGCGNONE 
J090062P06GACGTGGCGNONE 
J090063N07GACGTGGCGNONE 
J100061H24GACGTGGCGNONE 
Os01g0257100J100030B03CGCCACGTCACCNONE 
J100046K16CGCCACGTCACCRapid ALkalinization Factor family protein. 
Os01g0266600AK058396CGCCACGTCNONE 
AK069749CGCCACGTCRedoxin domain containing protein. 
J023030N01CGCCACGTCNONE 
J065065E03CGCCACGTCNONE 
J075006N11CGCCACGTCNONE 
J075017G04CGCCACGTCNONE 
J075023L15CGCCACGTCNONE 
J075126F05CGCCACGTCNONE 
Os01g0270100006-096-H09CGCCACGTGTNONE 
009-009-C10CGCCACGTGTNONE 
009-054-E06CGCCACGTGTNONE 
014-085-F09CGCCACGTGTNONE 
AK073275CGCCACGTGTNONE 
AK104155CGCCACGTGTNONE 
AK119511CGCCACGTGTSimilar to Cysteine protease inhibitor. 
J033025K21CGCCACGTGTNONE 
J075065H10CGCCACGTGTNONE 
J075143G10CGCCACGTGTNONE 
J100059J02CGCCACGTGTNONE 
Os01g0314800AF323612ACACGTGGCGLate embryogenesis abundant protein 3 family protein. 
J043003O18ACACGTGGCGNONE 
J065105K07ACACGTGGCGNONE 
J065123H16ACACGTGGCGNONE 
J065198K17ACACGTGGCGNONE 
J100027C20ACACGTGGCGNONE 
Os01g0530500012-044-D12ACGTGGCGNONE 
AK105280ACGTGGCGProtein of unknown function DUF295 family protein. 
J065042N01ACGTGGCGNONE 
Os01g0559000006-032-B11GAGACGTGGCGNONE 
AK061456GAGACGTGGCGProtein of unknown function DUF1000 family protein. 
Os01g0579000AK064700CGCCACGTConserved hypothetical protein. 
J075082F24CGCCACGTNONE 
J075165I24CGCCACGTNONE 
J080309M20CGCCACGTNONE 
Os01g0581300AK066182CGCCACGTGSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015CGCCACGTGNONE 
Os01g0612600004-008-D07GACGTGGCGNONE 
009-057-C09GACGTGGCGNONE 
009-130-C01GACGTGGCGNONE 
AK062906GACGTGGCGNONE 
AK066561GACGTGGCGProtein of unknown function DUF1644 family protein. 
J013065E14GACGTGGCGNONE 
J013073D14GACGTGGCGNONE 
J023014A21GACGTGGCGNONE 
J023073M13GACGTGGCGNONE 
J023079F02GACGTGGCGNONE 
J023083B16GACGTGGCGNONE 
J023090G19GACGTGGCGNONE 
J023095F15GACGTGGCGNONE 
J023119H11GACGTGGCGNONE 
J033040B01GACGTGGCGNONE 
J033044F13GACGTGGCGNONE 
J033081E23GACGTGGCGNONE 
J033121K07GACGTGGCGNONE 
J033124D11GACGTGGCGNONE 
J033131N22GACGTGGCGNONE 
J065179E10GACGTGGCGNONE 
J090020A13GACGTGGCGNONE 
J090045K17GACGTGGCGNONE 
J090047M24GACGTGGCGNONE 
J090064G23GACGTGGCGNONE 
J090084G08GACGTGGCGNONE 
J090086F18GACGTGGCGNONE 
J100032D09GACGTGGCGNONE 
J100037O18GACGTGGCGNONE 
J100042B03GACGTGGCGNONE 
J100061D06GACGTGGCGNONE 
J100061I03GACGTGGCGNONE 
J100063B17GACGTGGCGNONE 
Os01g0627400015-100-E08ACGTGGCGNONE 
AK074025ACGTGGCGSimilar to Cytochrome P450 monooxygenase CYP72A5 (Fragment). 
J033041C10ACGTGGCGNONE 
J033076L02ACGTGGCGNONE 
J053046G11ACGTGGCGNONE 
Os01g0653700011-003-E09CGCCACGTGNONE 
AK073990CGCCACGTGCyclin-like F-box domain containing protein. 
AK120129CGCCACGTGNONE 
J033036F18CGCCACGTGNONE 
J033072D10CGCCACGTGNONE 
J033089B18CGCCACGTGNONE 
J033089J09CGCCACGTGNONE 
J033136J11CGCCACGTGNONE 
J065065E24CGCCACGTGNONE 
J090065L03CGCCACGTGNONE 
Os01g0654400Os01g0654400CGCCACGTConserved hypothetical protein. 
Os01g0662600009-056-E10CGCCACGTNONE 
AK062234CGCCACGTNONE 
AK098887CGCCACGTNONE 
AK099656CGCCACGTNONE 
AK119723CGCCACGTSimilar to NifU-like protein. 
J013001K01CGCCACGTNONE 
J013090F20CGCCACGTNONE 
J013119A14CGCCACGTNONE 
J013121P12CGCCACGTNONE 
J033132I15CGCCACGTNONE 
J075023F22CGCCACGTNONE 
J075023M13CGCCACGTNONE 
J100024D10CGCCACGTNONE 
J100024N01CGCCACGTNONE 
J100026H09CGCCACGTNONE 
J100027H07CGCCACGTNONE 
J100045K07CGCCACGTNONE 
J100057K18CGCCACGTNONE 
J100085C22CGCCACGTNONE 
Os01g0698300AK100582CGCCACGTCZinc finger, BED-type predicted domain containing protein. 
J023105O09CGCCACGTCNONE 
J023119F15CGCCACGTCNONE 
J075007N19CGCCACGTCNONE 
J075010F10CGCCACGTCNONE 
J075032M22CGCCACGTCNONE 
J075038E01CGCCACGTCNONE 
J075064J17CGCCACGTCNONE 
J075109L20CGCCACGTCNONE 
J075131O16CGCCACGTCNONE 
J075176A17CGCCACGTCNONE 
J075178N11CGCCACGTCNONE 
J075181N15CGCCACGTCNONE 
J090060I06CGCCACGTCNONE 
J090097O21CGCCACGTCNONE 
Os01g0743400AK059177CGCCACGTSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114CGCCACGTNONE 
J065070E07CGCCACGTNONE 
J065152G11CGCCACGTNONE 
Os01g0745400AK107872GACGTGGCGSec34-like protein family protein. 
AK107872GACGTGGCGSec34-like protein family protein. 
Os01g0750500006-028-G02CACGTGGCGNONE 
006-105-B02CACGTGGCGNONE 
006-117-D04CACGTGGCGNONE 
013-066-D08CACGTGGCGNONE 
015-058-C06CACGTGGCGNONE 
AK067516CACGTGGCGProtein of unknown function DUF814 domain containing protein. 
AK104228CACGTGGCGNONE 
AK104728CACGTGGCGNONE 
J013056K07CACGTGGCGNONE 
J013073A21CACGTGGCGNONE 
J013112J21CACGTGGCGNONE 
J065034L03CACGTGGCGNONE 
J100026F22CACGTGGCGNONE 
J100073H05CACGTGGCGNONE 
J100084P09CACGTGGCGNONE 
Os01g0763300009-022-H12CGCCACGTNONE 
009-036-F10CGCCACGTNONE 
009-113-G01CGCCACGTNONE 
009-184-E02CGCCACGTNONE 
014-023-A04CGCCACGTNONE 
AK063778CGCCACGTConserved hypothetical protein. 
AK122186CGCCACGTNONE 
J023086N17CGCCACGTNONE 
J033150K13CGCCACGTNONE 
J065001D05CGCCACGTNONE 
J065042H11CGCCACGTNONE 
J065049J22CGCCACGTNONE 
J065077E09CGCCACGTNONE 
J065171I01CGCCACGTNONE 
J090044K23CGCCACGTNONE 
J100063M07CGCCACGTNONE 
Os01g0787400006-097-H03CGCCACGTGTNONE 
AK061223CGCCACGTGTConserved hypothetical protein. 
J065011G11CGCCACGTGTNONE 
J065161F18CGCCACGTGTNONE 
Os01g0816700AK100654GACGTGGCGTGSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase). 
Os01g0817700003-108-A10CACGTGGCGNONE 
AK060836CACGTGGCGNONE 
AK065059CACGTGGCGSimilar to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1) (Phosphoglyceromutase) (BPG-independent PGAM) (PGAM-I). 
J013001J10CACGTGGCGNONE 
J013047D19CACGTGGCGNONE 
J013056K09CACGTGGCGNONE 
J013068P20CACGTGGCGNONE 
J013108G18CACGTGGCGNONE 
J023007N01CACGTGGCGNONE 
J023008A22CACGTGGCGNONE 
J023010B02CACGTGGCGNONE 
J023029O13CACGTGGCGNONE 
J023064F21CACGTGGCGNONE 
J023073E22CACGTGGCGNONE 
J023143E14CACGTGGCGNONE 
J033027N20CACGTGGCGNONE 
J033032G14CACGTGGCGNONE 
J033037E03CACGTGGCGNONE 
J033057N19CACGTGGCGNONE 
J033065E16CACGTGGCGNONE 
J033066B19CACGTGGCGNONE 
J033069G01CACGTGGCGNONE 
J033071B03CACGTGGCGNONE 
J033080C12CACGTGGCGNONE 
J033081K19CACGTGGCGNONE 
J033096B19CACGTGGCGNONE 
J033101E20CACGTGGCGNONE 
J033135L21CACGTGGCGNONE 
J033139I07CACGTGGCGNONE 
J033150A21CACGTGGCGNONE 
J043036J05CACGTGGCGNONE 
J043039D03CACGTGGCGNONE 
J043039F19CACGTGGCGNONE 
J090006K04CACGTGGCGNONE 
J090017G14CACGTGGCGNONE 
J090034E23CACGTGGCGNONE 
J090039D07CACGTGGCGNONE 
J090039I09CACGTGGCGNONE 
J090044F21CACGTGGCGNONE 
J090049J12CACGTGGCGNONE 
J090053A19CACGTGGCGNONE 
J090061E23CACGTGGCGNONE 
J090079K09CACGTGGCGNONE 
J090092F21CACGTGGCGNONE 
J100022E04CACGTGGCGNONE 
J100038I01CACGTGGCGNONE 
J100066C22CACGTGGCGNONE 
J100067C11CACGTGGCGNONE 
J100073F07CACGTGGCGNONE 
J100084I24CACGTGGCGNONE 
Os01g0825700AK070492CACGCCACGTCACSimilar to VHS2 protein (Fragment). 
Os01g0833400006-112-A07CGCCACGTNONE 
AK072813CGCCACGTConserved hypothetical protein. 
AK106052CGCCACGTNONE 
J065195G24CGCCACGTNONE 
Os01g0836400AK068741GACGTGGCGNONE 
AK073540GACGTGGCGSAC3/GANP family protein. 
J023019D11GACGTGGCGNONE 
J023139O22GACGTGGCGNONE 
J033042J20GACGTGGCGNONE 
J033046M18GACGTGGCGNONE 
J033124J09GACGTGGCGNONE 
J090015E05GACGTGGCGNONE 
J090076J09GACGTGGCGNONE 
Os01g0851300AK101770GACGTGGCGTGReticulon family protein. 
J033064I03GACGTGGCGTGNONE 
J100058A05GACGTGGCGTGNONE 
Os01g0851400J065070P10GACGTGGCGMachado-Joseph disease protein MJD family protein. 
J065153F01GACGTGGCGNONE 
Os01g0860700009-026-D05GACGTGGCGNONE 
AK062402GACGTGGCGConserved hypothetical protein. 
Os01g0867900AK061366CACGCCACGTCProtein of unknown function DUF502 family protein. 
AK061366GCCACGTGGCGGACGGCProtein of unknown function DUF502 family protein. 
Os01g0911700012-079-H01CGCCACGTGTGGGCCGCANONE 
012-088-G05CGCCACGTGTGGGCCGCANONE 
012-099-A01CGCCACGTGTGGGCCGCANONE 
015-009-H07CGCCACGTGTGGGCCGCANONE 
015-035-H12CGCCACGTGTGGGCCGCANONE 
016-054-G03CGCCACGTGTGGGCCGCANONE 
AK073805CGCCACGTGTGGGCCGCASimilar to Regulatory protein viviparous-1. 
AK105441CGCCACGTGTGGGCCGCANONE 
J033069I02CGCCACGTGTGGGCCGCANONE 
J033086K01CGCCACGTGTGGGCCGCANONE 
Os01g0913400AK099881CGCCACGTCProtein prenyltransferase domain containing protein. 
Os01g0922100AK110737ACGTGGCGConserved hypothetical protein. 
Os01g0950900AK101121CGCCACGTProtein of unknown function DUF221 domain containing protein. 
AK101121CGCCACGTCProtein of unknown function DUF221 domain containing protein. 
J023036H24CGCCACGTNONE 
J023036H24CGCCACGTCNONE 
J023084G23CGCCACGTNONE 
J023084G23CGCCACGTCNONE 
J033025J04CGCCACGTNONE 
J033025J04CGCCACGTCNONE 
J033139J18CGCCACGTNONE 
J033139J18CGCCACGTCNONE 
J090006A09CGCCACGTNONE 
J090006A09CGCCACGTCNONE 
J090036D02CGCCACGTNONE 
J090036D02CGCCACGTCNONE 
Os01g0965500J075073G20CGCCACGTCNuclear protein SET domain containing protein. 
Os01g0966200009-079-H11ACGTGGCGNONE 
009-124-G10ACGTGGCGNONE 
AK058564ACGTGGCGProtein of unknown function YGGT family protein. 
AK098935ACGTGGCGNONE 
Os01g0967800012-074-C04CGCCACGTNONE 
012-100-F12CGCCACGTNONE 
015-061-F12CGCCACGTNONE 
AK064854CGCCACGTConserved hypothetical protein. 
J013000H07CGCCACGTNONE 
J013050A03CGCCACGTNONE 
J013063M22CGCCACGTNONE 
J013070I04CGCCACGTNONE 
J013075C08CGCCACGTNONE 
J013104B08CGCCACGTNONE 
J013122F05CGCCACGTNONE 
J013151F19CGCCACGTNONE 
J023093A07CGCCACGTNONE 
J023097E21CGCCACGTNONE 
J023108P06CGCCACGTNONE 
J023138O04CGCCACGTNONE 
J033025A05CGCCACGTNONE 
J033060A07CGCCACGTNONE 
J033060M15CGCCACGTNONE 
J033087J19CGCCACGTNONE 
J033094F16CGCCACGTNONE 
J043009J11CGCCACGTNONE 
J043040A12CGCCACGTNONE 
J090002D12CGCCACGTNONE 
J090024D15CGCCACGTNONE 
J090067C12CGCCACGTNONE 
J090079G19CGCCACGTNONE 
J090090N17CGCCACGTNONE 
Os02g0106100AK072245AATGGGCCCGCGCCACGTGSimilar to Fructosyltransferase. 
Os02g0158900AK108324CGCCACGTCSimilar to SNF4. 
Os02g0165500AK060547GACGTGGCGConserved hypothetical protein. 
Os02g0177700AK119941CGCCACGTProtein of unknown function DUF588 family protein. 
Os02g0186500AK068056CGCCACGTGTCCGACCCGCSimilar to Protein kinase-like protein. 
AK099031CGCCACGTGTCCGACCCGCNONE 
J013111A12CGCCACGTGTCCGACCCGCNONE 
J013127K13CGCCACGTGTCCGACCCGCNONE 
J013132O11CGCCACGTGTCCGACCCGCNONE 
J023056A11CGCCACGTGTCCGACCCGCNONE 
J023078M08CGCCACGTGTCCGACCCGCNONE 
J033081F07CGCCACGTGTCCGACCCGCNONE 
J090079E24CGCCACGTGTCCGACCCGCNONE 
J090097I02CGCCACGTGTCCGACCCGCNONE 
Os02g0188000011-003-E06CGCCACGTCNONE 
AK105236CGCCACGTCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os02g0254600014-004-F08GACGTGGCGNONE 
AK063627GACGTGGCGConserved hypothetical protein. 
J065022D02GACGTGGCGNONE 
J065168J03GACGTGGCGNONE 
J065170D03GACGTGGCGNONE 
J080021G21GACGTGGCGNONE 
J080069G24GACGTGGCGNONE 
J080071O10GACGTGGCGNONE 
J080072L02GACGTGGCGNONE 
J080093D22GACGTGGCGNONE 
Os02g0265900006-102-B07CGCCACGTGGGCNONE 
016-087-A02CGCCACGTGGGCNONE 
AK059921CGCCACGTGGGCReticulon family protein. 
AK064290CGCCACGTGGGCNONE 
AK072628CGCCACGTGGGCNONE 
AK104196CGCCACGTGGGCNONE 
J023130B01CGCCACGTGGGCNONE 
J080010O13CGCCACGTGGGCNONE 
J100065C12CGCCACGTGGGCNONE 
J100067M20CGCCACGTGGGCNONE 
J100070I01CGCCACGTGGGCNONE 
Os02g0464700AK107077ACGTGGCGConserved hypothetical protein. 
AK107077GACGTGGCGConserved hypothetical protein. 
Os02g0493300AK069981ACGTGGCGTetratricopeptide-like helical domain containing protein. 
Os02g0506500AK062572CGCCACGTCNONE 
AK062572CGCCACGTCNONE 
AK063549CGCCACGTCNONE 
AK063549CGCCACGTCNONE 
AK101016CGCCACGTCMolybdenum cofactor biosynthesis domain containing protein. 
AK101016CGCCACGTCMolybdenum cofactor biosynthesis domain containing protein. 
AK109318CGCCACGTCNONE 
AK109318CGCCACGTCNONE 
J013000C16CGCCACGTCNONE 
J013000C16CGCCACGTCNONE 
J013155N06CGCCACGTCNONE 
J013155N06CGCCACGTCNONE 
J023067A02CGCCACGTCNONE 
J023067A02CGCCACGTCNONE 
J023149E02CGCCACGTCNONE 
J023149E02CGCCACGTCNONE 
J033033J18CGCCACGTCNONE 
J033033J18CGCCACGTCNONE 
J033051O15CGCCACGTCNONE 
J033051O15CGCCACGTCNONE 
J075034C22CGCCACGTCNONE 
J075034C22CGCCACGTCNONE 
J075054O10CGCCACGTCNONE 
J075054O10CGCCACGTCNONE 
J075108L14CGCCACGTCNONE 
J075108L14CGCCACGTCNONE 
J090043O06CGCCACGTCNONE 
J090043O06CGCCACGTCNONE 
J100024P03CGCCACGTCNONE 
J100024P03CGCCACGTCNONE 
Os02g0509600AK111075CACGTGGCGConserved hypothetical protein. 
J065033B09CACGTGGCGNONE 
J065069L04CACGTGGCGNONE 
J065089H14CACGTGGCGNONE 
J065119J16CACGTGGCGNONE 
J065142J22CACGTGGCGNONE 
J065168B14CACGTGGCGNONE 
J065203L03CACGTGGCGNONE 
J075044C18CACGTGGCGNONE 
J075068D13CACGTGGCGNONE 
J075152O09CACGTGGCGNONE 
Os02g0530100AK058520GACGTGGCGHeavy metal transport/detoxification protein domain containing protein. 
Os02g0531450J065097O14GACGTGGCGHypothetical protein. 
J075155C16GACGTGGCGNONE 
Os02g0534600Os02g0534600ACGTGGCGGTGACGTGGCGConserved hypothetical protein. 
Os02g0538700006-022-A03CGCCACGTNONE 
006-023-F01CGCCACGTNONE 
006-026-B12CGCCACGTNONE 
006-028-B08CGCCACGTNONE 
006-028-H01CGCCACGTNONE 
006-032-F02CGCCACGTNONE 
006-034-E12CGCCACGTNONE 
006-045-E02CGCCACGTNONE 
006-046-E08CGCCACGTNONE 
006-059-B07CGCCACGTNONE 
006-060-E05CGCCACGTNONE 
006-061-D11CGCCACGTNONE 
006-067-G08CGCCACGTNONE 
006-068-F12CGCCACGTNONE 
006-077-B12CGCCACGTNONE 
006-078-E10CGCCACGTNONE 
006-079-A06CGCCACGTNONE 
006-086-B12CGCCACGTNONE 
006-086-E06CGCCACGTNONE 
006-087-F01CGCCACGTNONE 
006-094-D12CGCCACGTNONE 
006-095-A08CGCCACGTNONE 
006-097-B01CGCCACGTNONE 
006-099-D07CGCCACGTNONE 
006-103-A12CGCCACGTNONE 
006-108-D05CGCCACGTNONE 
006-110-F11CGCCACGTNONE 
006-113-E10CGCCACGTNONE 
006-120-F07CGCCACGTNONE 
009-006-C10CGCCACGTNONE 
009-045-F12CGCCACGTNONE 
009-045-G05CGCCACGTNONE 
009-050-A07CGCCACGTNONE 
009-077-D05CGCCACGTNONE 
009-080-G04CGCCACGTNONE 
009-085-F09CGCCACGTNONE 
009-090-A12CGCCACGTNONE 
009-127-B07CGCCACGTNONE 
009-136-B11CGCCACGTNONE 
009-145-C04CGCCACGTNONE 
009-164-G04CGCCACGTNONE 
009-166-F12CGCCACGTNONE 
009-187-D11CGCCACGTNONE 
009-193-B07CGCCACGTNONE 
009-198-H01CGCCACGTNONE 
009-199-C09CGCCACGTNONE 
009-199-E04CGCCACGTNONE 
013-071-G11CGCCACGTNONE 
AK060001CGCCACGTNONE 
AK061396CGCCACGTNONE 
AK065946CGCCACGTNONE 
AK104564CGCCACGTNONE 
AK104600CGCCACGTNONE 
AK109400CGCCACGTNONE 
AK109402CGCCACGTHarpin-induced 1 domain containing protein. 
J013049G21CGCCACGTNONE 
J065140C21CGCCACGTNONE 
J075001F23CGCCACGTNONE 
J075197B13CGCCACGTNONE 
J100024N04CGCCACGTNONE 
Os02g0566000AK059295ATTGGGCCACGTGGCGConserved hypothetical protein. 
J065115K07ATTGGGCCACGTGGCGNONE 
Os02g0577900J065164K11ACGTGGCGConserved hypothetical protein. 
Os02g0578300012-035-D02GCCACGTGGCGNONE 
AK105275GCCACGTGGCGSimilar to Glucosyltransferase (Fragment). 
Os02g0600200009-154-A06ACGTGGCGNONE 
009-154-A06CACGCCACGTNONE 
AK058978ACGTGGCGNONE 
AK058978CACGCCACGTNONE 
AK066974ACGTGGCGIQ calmodulin-binding region domain containing protein. 
AK066974CACGCCACGTIQ calmodulin-binding region domain containing protein. 
Os02g0612600009-058-F12GACGTGGCGNONE 
AK062519GACGTGGCGConserved hypothetical protein. 
Os02g0612650Os02g0612650GACGTGGCGNONE 
Os02g0621600AK071074CGCCACGTNONE 
AK108575CGCCACGTConserved hypothetical protein. 
J023078O20CGCCACGTNONE 
J075025M01CGCCACGTNONE 
J090047L11CGCCACGTNONE 
Os02g0649300014-043-A05CGCCACGTGTNONE 
AK063685CGCCACGTGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0652800AK063448CGCCACGTCMajor facilitator superfamily MFS_1 protein. 
Os02g0658100AK064728ACGTGGCGNONE 
AK064728CGCCACGTCNONE 
Os02g0669100012-068-E10CGCCACGTCNONE 
016-075-F09CGCCACGTCNONE 
AB011367CGCCACGTCNONE 
AK070197CGCCACGTCNONE 
AY587109CGCCACGTCDehydrin family protein. 
AY786415CGCCACGTCNONE 
J023042N13CGCCACGTCNONE 
J023128F01CGCCACGTCNONE 
J065002K05CGCCACGTCNONE 
J090057I09CGCCACGTCNONE 
J090067J23CGCCACGTCNONE 
J090071B04CGCCACGTCNONE 
J100018L23CGCCACGTCNONE 
J100036A11CGCCACGTCNONE 
J100063L18CGCCACGTCNONE 
J100071G02CGCCACGTCNONE 
J100084P19CGCCACGTCNONE 
Os02g0671200J065152N20CGCCACGTCNONE 
J075053E22CGCCACGTCConserved hypothetical protein. 
Os02g0672600AK070286CGCCACGTSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174CGCCACGTNONE 
Os02g0677700AK119947CGCCACGTCNONE 
Os02g0699700AK072471CGCCACGTGSimilar to DNA topoisomerase II. 
Os02g0717900AK069653GGACACGTGGCGMSF1 domain containing protein. 
J023031J12GGACACGTGGCGNONE 
J075195G22GGACACGTGGCGNONE 
J100088O11GGACACGTGGCGNONE 
Os02g0720200AK105451CGCCACGTCNONE 
AK121803CGCCACGTCSimilar to 65kD microtubule associated protein. 
Os02g0727500009-018-G06CGCCACGTNONE 
AK121427CGCCACGTConserved hypothetical protein. 
J023136B21CGCCACGTNONE 
J033044C13CGCCACGTNONE 
J043037O12CGCCACGTNONE 
J053072C14CGCCACGTNONE 
J065008B15CGCCACGTNONE 
J065033I12CGCCACGTNONE 
J065077I18CGCCACGTNONE 
J065149G03CGCCACGTNONE 
J065159H07CGCCACGTNONE 
J065162I17CGCCACGTNONE 
J065168H02CGCCACGTNONE 
J065176N09CGCCACGTNONE 
J065178K23CGCCACGTNONE 
J065216N03CGCCACGTNONE 
J080001G08CGCCACGTNONE 
J080002C09CGCCACGTNONE 
J080007N17CGCCACGTNONE 
J080009B04CGCCACGTNONE 
J080009B17CGCCACGTNONE 
J080011O15CGCCACGTNONE 
J080022B06CGCCACGTNONE 
J080022C13CGCCACGTNONE 
J080024L04CGCCACGTNONE 
J080031G21CGCCACGTNONE 
J080035N14CGCCACGTNONE 
J080036O14CGCCACGTNONE 
J080040P10CGCCACGTNONE 
J080042D03CGCCACGTNONE 
J080042H05CGCCACGTNONE 
J080042I20CGCCACGTNONE 
J080043A01CGCCACGTNONE 
J080043F17CGCCACGTNONE 
J080046I19CGCCACGTNONE 
J080053L20CGCCACGTNONE 
J080055A20CGCCACGTNONE 
J080055F01CGCCACGTNONE 
J080056L02CGCCACGTNONE 
J080058H02CGCCACGTNONE 
J080059F11CGCCACGTNONE 
J080062C03CGCCACGTNONE 
J080064A07CGCCACGTNONE 
J080064K15CGCCACGTNONE 
J080067M17CGCCACGTNONE 
J080067N17CGCCACGTNONE 
J080068G07CGCCACGTNONE 
J080069H15CGCCACGTNONE 
J080069L08CGCCACGTNONE 
J080069L20CGCCACGTNONE 
J080069L21CGCCACGTNONE 
J080069N20CGCCACGTNONE 
J080071N24CGCCACGTNONE 
J080074K17CGCCACGTNONE 
J080076H08CGCCACGTNONE 
J080082F19CGCCACGTNONE 
J080086O16CGCCACGTNONE 
J090025A19CGCCACGTNONE 
J090025M06CGCCACGTNONE 
J090070D02CGCCACGTNONE 
Os02g0728100AK070290ACGTGGCGPeptidase S49, protease IV family protein. 
Os02g0753000AK121015CACGTGGCGSimilar to Trehalose-6-phosphate phosphatase. 
Os02g0754300009-048-D05CGCCACGTGNONE 
AK059012CGCCACGTGNONE 
AK068621CGCCACGTGNONE 
AK099805CGCCACGTGRibosomal protein L29 family protein. 
J065102P04CGCCACGTGNONE 
J065161I03CGCCACGTGNONE 
Os02g0771500006-096-D12GACGTGGCGNONE 
009-011-G02GACGTGGCGNONE 
AK062335GACGTGGCGNONE 
AK106018GACGTGGCGSimilar to Pap1p; poly A polymerase (Eukaryotic type). 
Os02g0774300AK065228GACGTGGCGCCCCACCGCCCAGCCSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os02g0789600AK101046GCCACGTGGCGNONE 
AK112100GCCACGTGGCGSimilar to DEM2. 
Os02g0803900AK106930GCCACGTGGCGCCACGTCSimilar to UDP-glycosyltransferase 91D1. 
Os02g0824400AK121390CGCCACGTGTCCConserved hypothetical protein. 
J023128P21CGCCACGTGTCCNONE 
J053097O16CGCCACGTGTCCNONE 
J065012I02CGCCACGTGTCCNONE 
J065049C06CGCCACGTGTCCNONE 
J065051H02CGCCACGTGTCCNONE 
J065069A13CGCCACGTGTCCNONE 
J065082E04CGCCACGTGTCCNONE 
J065102N09CGCCACGTGTCCNONE 
J065157O10CGCCACGTGTCCNONE 
J065188N23CGCCACGTGTCCNONE 
J065190J11CGCCACGTGTCCNONE 
J065202M09CGCCACGTGTCCNONE 
Os02g0824500AK111296GGACACGTGGCGSimilar to Remorin. 
J065048M11GGACACGTGGCGNONE 
J065081F01GGACACGTGGCGNONE 
Os02g0827900AK099911CGCCACGTCSimilar to Signal peptidase 18 subunit (Fragment). 
Os03g0100050Os03g0100050ACGTGGCGHypothetical protein. 
Os03g0114300AK121970CGCCACGTCACProtein kinase-like domain containing protein. 
Os03g0117900AK108930ACGTGGCGSimilar to Transcription factor. 
Os03g0119900AK058741CGCCACGTChistone H4 [Oryza sativa (japonica cultivar-group)]. 
AK058741CGCCACGTCACCGATCCGhistone H4 [Oryza sativa (japonica cultivar-group)]. 
J065035O07CGCCACGTCNONE 
J065035O07CGCCACGTCACCGATCCGNONE 
J065165C24CGCCACGTCNONE 
J065165C24CGCCACGTCACCGATCCGNONE 
J075039M05CGCCACGTCNONE 
J075039M05CGCCACGTCACCGATCCGNONE 
Os03g0141200AK068968CGCCACGTCACCCGCACGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092CGCCACGTCACCCGCACGCGNONE 
J023003L18CGCCACGTCACCCGCACGCGNONE 
J023022K18CGCCACGTCACCCGCACGCGNONE 
J023107H13CGCCACGTCACCCGCACGCGNONE 
J023107K02CGCCACGTCACCCGCACGCGNONE 
Os03g0144800AK103041CGCCACGTCSimilar to Xyloglucan galactosyltransferase KATAMARI 1 (EC 2.4.1.-) (MURUS3 protein). 
J013043M12CGCCACGTCNONE 
J013043N11CGCCACGTCNONE 
J013093E21CGCCACGTCNONE 
J033030E13CGCCACGTCNONE 
J033044H20CGCCACGTCNONE 
J033084H08CGCCACGTCNONE 
J033117F03CGCCACGTCNONE 
J043005E24CGCCACGTCNONE 
J065218M08CGCCACGTCNONE 
Os03g0184100AK067400CCCCCGCGCCACGTHypothetical protein. 
AK067400CGCCACGTGHypothetical protein. 
J013030J24CCCCCGCGCCACGTNONE 
J013030J24CGCCACGTGNONE 
J013037M23CCCCCGCGCCACGTNONE 
J013037M23CGCCACGTGNONE 
J013106B15CCCCCGCGCCACGTNONE 
J013106B15CGCCACGTGNONE 
J013130H10CCCCCGCGCCACGTNONE 
J013130H10CGCCACGTGNONE 
J013152B03CCCCCGCGCCACGTNONE 
J013152B03CGCCACGTGNONE 
J013157J24CCCCCGCGCCACGTNONE 
J013157J24CGCCACGTGNONE 
J013157K04CCCCCGCGCCACGTNONE 
J013157K04CGCCACGTGNONE 
J033093A19CCCCCGCGCCACGTNONE 
J033093A19CGCCACGTGNONE 
J033106E24CCCCCGCGCCACGTNONE 
J033106E24CGCCACGTGNONE 
J090043G12CCCCCGCGCCACGTNONE 
J090043G12CGCCACGTGNONE 
Os03g0184300AK119613CGCCACGTGGCNONE 
AK120569CGCCACGTGGCGlycosyl transferase, family 8 protein. 
Os03g0218300015-078-G09CACGTGGCGConserved hypothetical protein. 
J090095I10CACGTGGCGNONE 
Os03g0220700J100064H16CGCCACGTCNONE 
J100064H16CGCCACGTCNONE 
Os03g0227800016-033-F09CGCCACGTGNONE 
AK063571CGCCACGTGNONE 
AK103846CGCCACGTGNONE 
J013028J20CGCCACGTGNONE 
J013091I04CGCCACGTGNONE 
J013100P18CGCCACGTGNONE 
J013128L15CGCCACGTGNONE 
J013153M09CGCCACGTGNONE 
J033072J03CGCCACGTGNONE 
J033074L07CGCCACGTGNONE 
J033106H15CGCCACGTGNONE 
J033148J22CGCCACGTGNONE 
J065005B02CGCCACGTGNONE 
J065009M20CGCCACGTGNONE 
J065035E23CGCCACGTGNONE 
J065039E24CGCCACGTGNONE 
J065057P20CGCCACGTGNONE 
J065066E10CGCCACGTGNONE 
J065072G21CGCCACGTGNONE 
J065076N07CGCCACGTGNONE 
J065093G14CGCCACGTGNONE 
J065127K10CGCCACGTGNONE 
J065142O20CGCCACGTGNONE 
J065165O18CGCCACGTGNONE 
J065179O07CGCCACGTGNONE 
J065203E15CGCCACGTGNONE 
J080305J16CGCCACGTGNONE 
J090008C14CGCCACGTGNONE 
J090083E01CGCCACGTGNONE 
J090092B02CGCCACGTGNONE 
J090098O14CGCCACGTGNONE 
J100042A12CGCCACGTGNONE 
J100090K14CGCCACGTGNONE 
Os03g0251500AK101151CGCCACGTCNONE 
AK119298CGCCACGTCSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0251800AK067333CGCCACGTCACSimilar to Possible OmpA family member precursor. 
AK073337CGCCACGTCACNONE 
Os03g0281600AK070260CGCCACGTSimilar to Ca2+-ATPase. 
Os03g0298300AK061180CGCACCGCGCCACGTProtein of unknown function DUF588 family protein. 
AK099089CGCACCGCGCCACGTNONE 
Os03g0300900014-046-H03CACGCCACGTGNONE 
AK064068CACGCCACGTGNONE 
Os03g0303100015-002-B09GACGTGGCGNONE 
015-005-B02GACGTGGCGNONE 
015-017-E10GACGTGGCGNONE 
AK071041GACGTGGCGProtein of unknown function DUF1645 family protein. 
J065140F05GACGTGGCGNONE 
Os03g0305400009-198-D04CGCCACGTGGCNONE 
013-012-C06CGCCACGTGGCNONE 
014-034-D01CGCCACGTGGCNONE 
AK071397CGCCACGTGGCUniversal stress protein (Usp) family protein. 
J023012O22CGCCACGTGGCNONE 
J023097A13CGCCACGTGGCNONE 
J023107P16CGCCACGTGGCNONE 
J023113C14CGCCACGTGGCNONE 
Os03g0308800AK066789GACGTGGCGNONE 
AK068534GACGTGGCGProtein prenyltransferase domain containing protein. 
Os03g0324800AK059868CGCCACGTCNONE 
AK071431CGCCACGTCHypothetical protein. 
Os03g0338600AK066604CGCCACGTCtRNA pseudouridine synthase family protein. 
Os03g0343900009-077-C03TCCACGCCACGTGGCNONE 
AK105813TCCACGCCACGTGGCPhotosystem II protein PsbX family protein. 
J100059N03TCCACGCCACGTGGCNONE 
J100079C20TCCACGCCACGTGGCNONE 
Os03g0370000AK100033CGCCACGTCSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
Os03g0381500AK108125ACGTGGCGConserved hypothetical protein. 
AK108125CGCCACGTGTConserved hypothetical protein. 
Os03g0413000009-180-E02ACGTGGCGNONE 
009-180-E02TCCGTCCGACGTGGCGNONE 
009-188-B06ACGTGGCGNONE 
009-188-B06TCCGTCCGACGTGGCGNONE 
AK060225ACGTGGCGNONE 
AK060225TCCGTCCGACGTGGCGNONE 
AY062181ACGTGGCGSimilar to Potential histone-like transcription factor. 
AY062181TCCGTCCGACGTGGCGSimilar to Potential histone-like transcription factor. 
Os03g0429000AK102768CGCCACGTCProteinase inhibitor I25, cystatin domain containing protein. 
J033107F20CGCCACGTCNONE 
J065042C20CGCCACGTCNONE 
J065106L01CGCCACGTCNONE 
J065142N05CGCCACGTCNONE 
J075112D23CGCCACGTCNONE 
J080001J15CGCCACGTCNONE 
J080005I06CGCCACGTCNONE 
J080011L11CGCCACGTCNONE 
J080011P21CGCCACGTCNONE 
J080024E07CGCCACGTCNONE 
J080029G10CGCCACGTCNONE 
J080039C16CGCCACGTCNONE 
J080039E19CGCCACGTCNONE 
J080045E04CGCCACGTCNONE 
J080063D02CGCCACGTCNONE 
J080063L14CGCCACGTCNONE 
J080077L02CGCCACGTCNONE 
J080077O08CGCCACGTCNONE 
J080078D15CGCCACGTCNONE 
J080079M10CGCCACGTCNONE 
J080085D01CGCCACGTCNONE 
J080089E07CGCCACGTCNONE 
J080089E22CGCCACGTCNONE 
J080097B13CGCCACGTCNONE 
J080302C24CGCCACGTCNONE 
Os03g0439700AK065720CGCCACGTProtein of unknown function DUF1230 family protein. 
J013041G12CGCCACGTNONE 
J065030N09CGCCACGTNONE 
J065084A03CGCCACGTNONE 
J065167B14CGCCACGTNONE 
J100025F06CGCCACGTNONE 
J100032J16CGCCACGTNONE 
J100040L01CGCCACGTNONE 
J100074M13CGCCACGTNONE 
Os03g0581600J065037H09CGCCACGTCNONE 
J065183O12CGCCACGTCNONE 
Os03g0581800009-177-G11CGCCACGTNONE 
AK059201CGCCACGTNONE 
AK121839CGCCACGTHypothetical protein. 
J023022K06CGCCACGTNONE 
J023110K21CGCCACGTNONE 
J033100N18CGCCACGTNONE 
J033120D11CGCCACGTNONE 
J065044P15CGCCACGTNONE 
J065102G22CGCCACGTNONE 
J065149N14CGCCACGTNONE 
J065201L18CGCCACGTNONE 
J065205K10CGCCACGTNONE 
J075035D19CGCCACGTNONE 
J075073E06CGCCACGTNONE 
J075134M11CGCCACGTNONE 
J090004P12CGCCACGTNONE 
J090070H20CGCCACGTNONE 
J090087B04CGCCACGTNONE 
J100028F10CGCCACGTNONE 
J100036M18CGCCACGTNONE 
J100065C24CGCCACGTNONE 
J100080O13CGCCACGTNONE 
Os03g0584300009-018-H09CGCCACGTNONE 
AK105133CGCCACGTProtein of unknown function UPF0136, Transmembrane family protein. 
J065053M11CGCCACGTNONE 
Os03g0592500003-125-D02GACGTGGCGNONE 
006-021-F01GACGTGGCGNONE 
006-025-C12GACGTGGCGNONE 
006-027-A06GACGTGGCGNONE 
006-031-D08GACGTGGCGNONE 
006-031-H05GACGTGGCGNONE 
006-034-A10GACGTGGCGNONE 
006-034-H11GACGTGGCGNONE 
006-035-D10GACGTGGCGNONE 
006-037-H08GACGTGGCGNONE 
006-044-B09GACGTGGCGNONE 
006-044-F02GACGTGGCGNONE 
006-045-B11GACGTGGCGNONE 
006-045-E09GACGTGGCGNONE 
006-046-H12GACGTGGCGNONE 
006-047-D04GACGTGGCGNONE 
006-047-F02GACGTGGCGNONE 
006-050-C12GACGTGGCGNONE 
006-052-B07GACGTGGCGNONE 
006-053-A09GACGTGGCGNONE 
006-057-H02GACGTGGCGNONE 
006-061-G12GACGTGGCGNONE 
006-064-A04GACGTGGCGNONE 
006-067-G10GACGTGGCGNONE 
006-069-F06GACGTGGCGNONE 
006-070-D02GACGTGGCGNONE 
006-076-D11GACGTGGCGNONE 
006-078-B12GACGTGGCGNONE 
006-080-A10GACGTGGCGNONE 
006-082-B04GACGTGGCGNONE 
006-082-C05GACGTGGCGNONE 
006-082-C08GACGTGGCGNONE 
006-085-G08GACGTGGCGNONE 
006-086-E03GACGTGGCGNONE 
006-087-E03GACGTGGCGNONE 
006-088-A07GACGTGGCGNONE 
006-088-H06GACGTGGCGNONE 
006-089-G09GACGTGGCGNONE 
006-092-C03GACGTGGCGNONE 
006-092-C06GACGTGGCGNONE 
006-093-D09GACGTGGCGNONE 
006-097-B08GACGTGGCGNONE 
006-098-B09GACGTGGCGNONE 
006-102-D11GACGTGGCGNONE 
006-103-G02GACGTGGCGNONE 
006-104-A12GACGTGGCGNONE 
006-106-D10GACGTGGCGNONE 
006-108-A08GACGTGGCGNONE 
006-108-A12GACGTGGCGNONE 
006-108-B08GACGTGGCGNONE 
006-110-D07GACGTGGCGNONE 
006-110-D09GACGTGGCGNONE 
006-111-B04GACGTGGCGNONE 
006-111-G11GACGTGGCGNONE 
006-117-A08GACGTGGCGNONE 
006-119-A08GACGTGGCGNONE 
009-005-H11GACGTGGCGNONE 
009-013-A12GACGTGGCGNONE 
009-023-H09GACGTGGCGNONE 
009-056-D04GACGTGGCGNONE 
009-073-F11GACGTGGCGNONE 
009-127-B01GACGTGGCGNONE 
009-175-E01GACGTGGCGNONE 
AF022739GACGTGGCGNONE 
AF061577GACGTGGCGNONE 
AK058315GACGTGGCGNONE 
AK066762GACGTGGCGSimilar to Photosystem II type II chlorophyll a/b binding protein (Fragment). 
D00642GACGTGGCGNONE 
J013075I09GACGTGGCGNONE 
J023115C07GACGTGGCGNONE 
J065024G17GACGTGGCGNONE 
J065051K08GACGTGGCGNONE 
J065137D16GACGTGGCGNONE 
J075057E17GACGTGGCGNONE 
J075096E24GACGTGGCGNONE 
J075105K04GACGTGGCGNONE 
J075125F06GACGTGGCGNONE 
J075132E10GACGTGGCGNONE 
J075149I20GACGTGGCGNONE 
J075151M21GACGTGGCGNONE 
J075160K21GACGTGGCGNONE 
J075187C08GACGTGGCGNONE 
J075187E15GACGTGGCGNONE 
J075194K02GACGTGGCGNONE 
J075194L07GACGTGGCGNONE 
J090008E24GACGTGGCGNONE 
Os03g0596800AK073603ACGTGGCGConserved hypothetical protein. 
J033052N01ACGTGGCGNONE 
Os03g0637600006-046-H01ACGTGGCGNONE 
AK061561ACGTGGCGNONE 
Os03g0656500AK121052CGCCACGTSimilar to K-exchanger-like protein. 
J065195N11CGCCACGTNONE 
J065197F16CGCCACGTNONE 
J075022O03CGCCACGTNONE 
J075056N16CGCCACGTNONE 
J075139P11CGCCACGTNONE 
Os03g0663800011-023-B06CGCCACGTNONE 
011-023-B06GAGACGTGGCGNONE 
011-033-C06CGCCACGTNONE 
011-033-C06GAGACGTGGCGNONE 
012-011-E03CGCCACGTNONE 
012-011-E03GAGACGTGGCGNONE 
012-014-F04CGCCACGTNONE 
012-014-F04GAGACGTGGCGNONE 
012-027-C01CGCCACGTNONE 
012-027-C01GAGACGTGGCGNONE 
012-027-H07CGCCACGTNONE 
012-027-H07GAGACGTGGCGNONE 
012-031-A02CGCCACGTNONE 
012-031-A02GAGACGTGGCGNONE 
012-044-E05CGCCACGTNONE 
012-044-E05GAGACGTGGCGNONE 
012-045-G10CGCCACGTNONE 
012-045-G10GAGACGTGGCGNONE 
012-049-H02CGCCACGTNONE 
012-049-H02GAGACGTGGCGNONE 
012-053-G08CGCCACGTNONE 
012-053-G08GAGACGTGGCGNONE 
012-058-D07CGCCACGTNONE 
012-058-D07GAGACGTGGCGNONE 
012-061-H02CGCCACGTNONE 
012-061-H02GAGACGTGGCGNONE 
012-066-A02CGCCACGTNONE 
012-066-A02GAGACGTGGCGNONE 
012-074-F12CGCCACGTNONE 
012-074-F12GAGACGTGGCGNONE 
012-079-D08CGCCACGTNONE 
012-079-D08GAGACGTGGCGNONE 
012-081-E05CGCCACGTNONE 
012-081-E05GAGACGTGGCGNONE 
012-083-F04CGCCACGTNONE 
012-083-F04GAGACGTGGCGNONE 
012-084-F08CGCCACGTNONE 
012-084-F08GAGACGTGGCGNONE 
012-086-E08CGCCACGTNONE 
012-086-E08GAGACGTGGCGNONE 
012-086-F01CGCCACGTNONE 
012-086-F01GAGACGTGGCGNONE 
012-087-F03CGCCACGTNONE 
012-087-F03GAGACGTGGCGNONE 
012-087-H02CGCCACGTNONE 
012-087-H02GAGACGTGGCGNONE 
012-088-E05CGCCACGTNONE 
012-088-E05GAGACGTGGCGNONE 
012-089-B02CGCCACGTNONE 
012-089-B02GAGACGTGGCGNONE 
014-016-A04CGCCACGTNONE 
014-016-A04GAGACGTGGCGNONE 
AK105347CGCCACGTNONE 
AK105347GAGACGTGGCGNONE 
J075032I06CGCCACGTNONE 
J075032I06GAGACGTGGCGNONE 
J075041O22CGCCACGTNONE 
J075041O22GAGACGTGGCGNONE 
J075093E24CGCCACGTNONE 
J075093E24GAGACGTGGCGNONE 
J075094E06CGCCACGTNONE 
J075094E06GAGACGTGGCGNONE 
U45322CGCCACGTCupin region domain containing protein. 
U45322GAGACGTGGCGCupin region domain containing protein. 
Os03g0683700AK065067CGCCACGTCProtein of unknown function DUF810 family protein. 
Os03g0701600AK071171CGCCACGTGConserved hypothetical protein. 
J013036F14CGCCACGTGNONE 
J075052I22CGCCACGTGNONE 
J100029D11CGCCACGTGNONE 
J100062B19CGCCACGTGNONE 
J100063H01CGCCACGTGNONE 
Os03g0738600AK073529CGCCACGTCSimilar to Lipoxygenase L-2 (EC 1.13.11.12). 
X64396CGCCACGTCNONE 
Os03g0744800AK059983CGCCACGTemp24/gp25L/p24 family protein. 
J065067D01CGCCACGTNONE 
J065122L19CGCCACGTNONE 
J090041I03CGCCACGTNONE 
J100039H03CGCCACGTNONE 
Os03g0745000AK109590CGCCACGTCACCGCACNONE 
AY332465CGCCACGTCACCGCACNONE 
AY344486CGCCACGTCACCGCACNONE 
AY998118CGCCACGTCACCGCACWinged helix repressor DNA-binding domain containing protein. 
Os03g0745600014-030-E09CGCCACGTCGGATCNONE 
J053057E07CGCCACGTCGGATCNONE 
J075044L08CGCCACGTCGGATCNONE 
J075069C24CGCCACGTCGGATCNONE 
J075127J02CGCCACGTCGGATCProtein of unknown function UPF0005 family protein. 
J075180G21CGCCACGTCGGATCNONE 
J075189M22CGCCACGTCGGATCNONE 
J075192P11CGCCACGTCGGATCNONE 
Os03g0770100AK108776ACGTGGCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0784000AK067337CGCCACGTCNONE 
AK100003CGCCACGTCFAD dependent oxidoreductase family protein. 
J013102O14CGCCACGTCNONE 
J013135F18CGCCACGTCNONE 
Os03g0793100AK067897ACGTGGCGGlycosyl transferase, family 43 protein. 
J033125G24ACGTGGCGNONE 
J065132N21ACGTGGCGNONE 
Os03g0793700AK121667CGCCACGTCupin 1 domain containing protein. 
AY098743CGCCACGTNONE 
Os03g0796600003-113-D10CCCGGGCCCAGCGCACCGCCACGTCNONE 
003-113-D10CGCCACGTNONE 
011-076-B12CCCGGGCCCAGCGCACCGCCACGTCNONE 
011-076-B12CGCCACGTNONE 
AK105257CCCGGGCCCAGCGCACCGCCACGTCProtein of unknown function DUF506, plant family protein. 
AK105257CGCCACGTProtein of unknown function DUF506, plant family protein. 
J075105C03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J075105C03CGCCACGTNONE 
J080036O17CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080036O17CGCCACGTNONE 
J080064E16CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080064E16CGCCACGTNONE 
J080069E03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080069E03CGCCACGTNONE 
J080079E23CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080079E23CGCCACGTNONE 
J090036H20CCCGGGCCCAGCGCACCGCCACGTCNONE 
J090036H20CGCCACGTNONE 
J100029L10CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100029L10CGCCACGTNONE 
J100055G09CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100055G09CGCCACGTNONE 
Os03g0815900013-097-G08CGACACGTGGCGNONE 
AK065258CGACACGTGGCGNONE 
AK119756CGACACGTGGCGSimilar to DNA-directed RNA polymerase. 
J013002J17CGACACGTGGCGNONE 
J013074A12CGACACGTGGCGNONE 
J023045C17CGACACGTGGCGNONE 
J033050E21CGACACGTGGCGNONE 
J053094P05CGACACGTGGCGNONE 
J090038F11CGACACGTGGCGNONE 
J090072J01CGACACGTGGCGNONE 
J100026H07CGACACGTGGCGNONE 
J100040O06CGACACGTGGCGNONE 
J100083D07CGACACGTGGCGNONE 
Os03g0818100015-098-A09CACGTGGCGNONE 
AK064366CACGTGGCGNONE 
AK121701CACGTGGCGHistidine acid phosphatase family protein. 
Os03g0850600AK067191AGTTGGGCCGGGACGGCCACGTGGCGConserved hypothetical protein. 
J013095N12AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J065214L06AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J075093J10AGTTGGGCCGGGACGGCCACGTGGCGNONE 
Os03g0854800J090007D13CGCCACGTCACNONE 
J090085N22CGCCACGTCACNONE 
Os04g0173800AK103206CGCCACGTLectin precursor (Agglutinin). 
J033122E14CGCCACGTNONE 
J075001E08CGCCACGTNONE 
J075005H05CGCCACGTNONE 
J075006A12CGCCACGTNONE 
J075026O21CGCCACGTNONE 
J075040I24CGCCACGTNONE 
J075060N11CGCCACGTNONE 
J075069A22CGCCACGTNONE 
J075070A15CGCCACGTNONE 
J075074K06CGCCACGTNONE 
J075078E13CGCCACGTNONE 
J075085O15CGCCACGTNONE 
J075088A22CGCCACGTNONE 
J075094E22CGCCACGTNONE 
J075095E06CGCCACGTNONE 
J075120L07CGCCACGTNONE 
J075138I15CGCCACGTNONE 
J075140I20CGCCACGTNONE 
J075140N11CGCCACGTNONE 
J075142I18CGCCACGTNONE 
J075147F23CGCCACGTNONE 
J075147J18CGCCACGTNONE 
J075155H18CGCCACGTNONE 
J075156J22CGCCACGTNONE 
J075157J02CGCCACGTNONE 
J075167L04CGCCACGTNONE 
J075170H22CGCCACGTNONE 
J075172G01CGCCACGTNONE 
J075180L07CGCCACGTNONE 
J075182B03CGCCACGTNONE 
J075194C19CGCCACGTNONE 
J100063D16CGCCACGTNONE 
M24504CGCCACGTNONE 
Os04g0269900J065139P11CGCCACGTNONE 
J100034P12CGCCACGTNONE 
J100045D21CGCCACGTNONE 
Os04g0382300AK071912CGCCACGTCNONE 
AK101795CGCCACGTCSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0390700AK107261CGCCACGTGTCCGlucose/ribitol dehydrogenase family protein. 
Os04g0414700009-068-G12CGCCACGTCNONE 
009-070-D05CGCCACGTCNONE 
009-141-A08CGCCACGTCNONE 
009-144-A07CGCCACGTCNONE 
009-164-F03CGCCACGTCNONE 
AK058848CGCCACGTCConserved hypothetical protein. 
J013131F19CGCCACGTCNONE 
J013158N18CGCCACGTCNONE 
J023028J24CGCCACGTCNONE 
J023039K24CGCCACGTCNONE 
J065077F17CGCCACGTCNONE 
J065080G08CGCCACGTCNONE 
J065182N04CGCCACGTCNONE 
J065184G24CGCCACGTCNONE 
J065208A07CGCCACGTCNONE 
J065215H12CGCCACGTCNONE 
J075039D21CGCCACGTCNONE 
J075049C05CGCCACGTCNONE 
J075055E15CGCCACGTCNONE 
J075057O12CGCCACGTCNONE 
J075073K23CGCCACGTCNONE 
J075073N15CGCCACGTCNONE 
J075076A15CGCCACGTCNONE 
J075077D02CGCCACGTCNONE 
J075096M18CGCCACGTCNONE 
J075098M24CGCCACGTCNONE 
J075101G13CGCCACGTCNONE 
J075101O07CGCCACGTCNONE 
J075114F04CGCCACGTCNONE 
J075119K17CGCCACGTCNONE 
J075132E19CGCCACGTCNONE 
J075136P20CGCCACGTCNONE 
J075140E11CGCCACGTCNONE 
J075145D03CGCCACGTCNONE 
J075146B08CGCCACGTCNONE 
J075169B13CGCCACGTCNONE 
J075181A18CGCCACGTCNONE 
J075189H21CGCCACGTCNONE 
J075197F20CGCCACGTCNONE 
J075199J08CGCCACGTCNONE 
J080307B22CGCCACGTCNONE 
J090076J18CGCCACGTCNONE 
Os04g0423600AK065331CGCCACGTNuclear protein SET domain containing protein. 
J013000M22CGCCACGTNONE 
J013069D18CGCCACGTNONE 
J023099G24CGCCACGTNONE 
J033041P19CGCCACGTNONE 
Os04g0457000006-027-A09CACGTGGCGNONE 
006-027-D01CACGTGGCGNONE 
006-030-G04CACGTGGCGNONE 
006-038-H12CACGTGGCGNONE 
006-042-E09CACGTGGCGNONE 
006-049-C02CACGTGGCGNONE 
006-049-C09CACGTGGCGNONE 
006-052-C03CACGTGGCGNONE 
006-053-C01CACGTGGCGNONE 
006-054-B08CACGTGGCGNONE 
006-054-G05CACGTGGCGNONE 
006-058-A06CACGTGGCGNONE 
006-059-G07CACGTGGCGNONE 
006-088-F04CACGTGGCGNONE 
006-091-G07CACGTGGCGNONE 
006-093-C04CACGTGGCGNONE 
006-093-H03CACGTGGCGNONE 
006-094-B05CACGTGGCGNONE 
006-097-B05CACGTGGCGNONE 
006-097-E02CACGTGGCGNONE 
006-098-G09CACGTGGCGNONE 
006-099-A11CACGTGGCGNONE 
006-099-B09CACGTGGCGNONE 
006-099-E10CACGTGGCGNONE 
006-111-A07CACGTGGCGNONE 
006-111-H12CACGTGGCGNONE 
006-114-B12CACGTGGCGNONE 
006-115-H03CACGTGGCGNONE 
009-042-G09CACGTGGCGNONE 
009-117-G09CACGTGGCGNONE 
009-121-E02CACGTGGCGNONE 
009-162-H07CACGTGGCGNONE 
011-063-C05CACGTGGCGNONE 
AK066070CACGTGGCGSimilar to Chlorophyll a/b-binding protein CP24, photosystem II (Fragment). 
AK104811CACGTGGCGNONE 
J013055K10CACGTGGCGNONE 
J013072C14CACGTGGCGNONE 
J013091A08CACGTGGCGNONE 
J013123L18CACGTGGCGNONE 
J013129M15CACGTGGCGNONE 
J013135J21CACGTGGCGNONE 
J013170D09CACGTGGCGNONE 
J023107N10CACGTGGCGNONE 
J065142G08CACGTGGCGNONE 
J075023K20CACGTGGCGNONE 
J075119K14CACGTGGCGNONE 
J075134I20CACGTGGCGNONE 
J075161H06CACGTGGCGNONE 
J080014L13CACGTGGCGNONE 
J080026H08CACGTGGCGNONE 
J080070F02CACGTGGCGNONE 
J080070G22CACGTGGCGNONE 
J080093H23CACGTGGCGNONE 
J080305C11CACGTGGCGNONE 
J080305H15CACGTGGCGNONE 
J080317P21CACGTGGCGNONE 
J090023F10CACGTGGCGNONE 
J100061O10CACGTGGCGNONE 
Os04g0466600J065051L19GCCACGTGGCGNONE 
J090042O12GCCACGTGGCGNONE 
Os04g0479000AK106344CGCCACGTCSimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0482300015-088-C07CGCCACGTNONE 
AK064143CGCCACGTBTB domain containing protein. 
J065053L16CGCCACGTNONE 
J065053N15CGCCACGTNONE 
Os04g0510000AK109180GACGTGGCGConserved hypothetical protein. 
Os04g0555700AK069329ACGTGGCGSimilar to Actin-depolymerizing factor (ADF). 
Os04g0556300009-065-A04CGCCACGTNONE 
009-124-C05CGCCACGTNONE 
AK062772CGCCACGTGlutathione peroxidase. 
AY100689CGCCACGTNONE 
J065008N06CGCCACGTNONE 
J065012C13CGCCACGTNONE 
J065017J06CGCCACGTNONE 
J065033M15CGCCACGTNONE 
J065086O21CGCCACGTNONE 
J065102K04CGCCACGTNONE 
J065141D21CGCCACGTNONE 
J065159K20CGCCACGTNONE 
J065164C12CGCCACGTNONE 
J065170F10CGCCACGTNONE 
J065181F20CGCCACGTNONE 
J065205N07CGCCACGTNONE 
J065209N21CGCCACGTNONE 
J075001M12CGCCACGTNONE 
J075007D22CGCCACGTNONE 
J075026H04CGCCACGTNONE 
J075042O08CGCCACGTNONE 
J075044G20CGCCACGTNONE 
J075057D10CGCCACGTNONE 
J075096L23CGCCACGTNONE 
J075104K12CGCCACGTNONE 
J075119H14CGCCACGTNONE 
J075136C14CGCCACGTNONE 
J075172D01CGCCACGTNONE 
J075184M01CGCCACGTNONE 
J075186E06CGCCACGTNONE 
J075192M08CGCCACGTNONE 
J080006D18CGCCACGTNONE 
J080044G16CGCCACGTNONE 
J080087G15CGCCACGTNONE 
J100021I05CGCCACGTNONE 
J100039D10CGCCACGTNONE 
J100073B05CGCCACGTNONE 
J100074M12CGCCACGTNONE 
Os04g0563300AK100487CGCCACGTCyclin-like F-box domain containing protein. 
J023097O18CGCCACGTNONE 
J065100E16CGCCACGTNONE 
J075022C23CGCCACGTNONE 
J075023L18CGCCACGTNONE 
J075040N10CGCCACGTNONE 
J075061L14CGCCACGTNONE 
J075069B15CGCCACGTNONE 
J075106C16CGCCACGTNONE 
J075138P13CGCCACGTNONE 
J075139H18CGCCACGTNONE 
J075139L06CGCCACGTNONE 
J075149B07CGCCACGTNONE 
J075177N21CGCCACGTNONE 
Os04g0583600AK059019CGCCACGTChistone H4 [Oryza sativa (japonica cultivar-group)]. 
J023047G03CGCCACGTCNONE 
J075118B22CGCCACGTCNONE 
J090035A11CGCCACGTCNONE 
J090067I05CGCCACGTCNONE 
J100017K09CGCCACGTCNONE 
Os04g0586100009-190-F11CGCCACGTNONE 
AK063206CGCCACGTProtein of unknown function DUF581 family protein. 
Os04g0591300009-006-D05CGCCACGTGTCNONE 
AK105120CGCCACGTGTCConserved hypothetical protein. 
Os04g0623300AK064902GACGTGGCGSimilar to Flavin-containing monamine oxidase family protein. 
Os04g0627900AK108443CCGTCGGACGGCCGAGATCACGCCACGTCTranslation initiation factor SUI1 domain containing protein. 
J065178D17CCGTCGGACGGCCGAGATCACGCCACGTCNONE 
Os04g0631200013-003-B06GACGTGGCGNONE 
AK059277GACGTGGCGSimilar to Xyloglucan endotransglycosylase (Fragment). 
AK099331GACGTGGCGNONE 
J033024P08GACGTGGCGNONE 
J033041G02GACGTGGCGNONE 
J053075H12GACGTGGCGNONE 
J065016B13GACGTGGCGNONE 
J090075B22GACGTGGCGNONE 
J100084K17GACGTGGCGNONE 
Os04g0657100AK072747CGCCACGTSimilar to Farnesyl diphosphate synthase (Fragment). 
J090072K21CGCCACGTNONE 
Os05g0116100006-049-G01TTGGCCCATGGGCCGCCACGTCNONE 
006-064-F09TTGGCCCATGGGCCGCCACGTCNONE 
006-082-A03TTGGCCCATGGGCCGCCACGTCNONE 
006-092-G06TTGGCCCATGGGCCGCCACGTCNONE 
006-102-F09TTGGCCCATGGGCCGCCACGTCNONE 
AB037970TTGGCCCATGGGCCGCCACGTCNONE 
AK061836TTGGCCCATGGGCCGCCACGTCNONE 
AK070895TTGGCCCATGGGCCGCCACGTCDehydroascorbate reductase. 
AY074786TTGGCCCATGGGCCGCCACGTCNONE 
J013022K21TTGGCCCATGGGCCGCCACGTCNONE 
J013154A03TTGGCCCATGGGCCGCCACGTCNONE 
J023074C02TTGGCCCATGGGCCGCCACGTCNONE 
J023091I19TTGGCCCATGGGCCGCCACGTCNONE 
J023135M05TTGGCCCATGGGCCGCCACGTCNONE 
J065027L11TTGGCCCATGGGCCGCCACGTCNONE 
J065065A08TTGGCCCATGGGCCGCCACGTCNONE 
J065120A08TTGGCCCATGGGCCGCCACGTCNONE 
J065174A05TTGGCCCATGGGCCGCCACGTCNONE 
J065184O22TTGGCCCATGGGCCGCCACGTCNONE 
J065191D07TTGGCCCATGGGCCGCCACGTCNONE 
J065209D04TTGGCCCATGGGCCGCCACGTCNONE 
J075014F11TTGGCCCATGGGCCGCCACGTCNONE 
J075036D03TTGGCCCATGGGCCGCCACGTCNONE 
J075157D23TTGGCCCATGGGCCGCCACGTCNONE 
J080007F15TTGGCCCATGGGCCGCCACGTCNONE 
J080008N12TTGGCCCATGGGCCGCCACGTCNONE 
J080010F22TTGGCCCATGGGCCGCCACGTCNONE 
J080011C19TTGGCCCATGGGCCGCCACGTCNONE 
J080011F12TTGGCCCATGGGCCGCCACGTCNONE 
J080012E11TTGGCCCATGGGCCGCCACGTCNONE 
J080015B12TTGGCCCATGGGCCGCCACGTCNONE 
J080015O16TTGGCCCATGGGCCGCCACGTCNONE 
J080016G24TTGGCCCATGGGCCGCCACGTCNONE 
J080016K13TTGGCCCATGGGCCGCCACGTCNONE 
J080018A02TTGGCCCATGGGCCGCCACGTCNONE 
J080018H03TTGGCCCATGGGCCGCCACGTCNONE 
J080022M01TTGGCCCATGGGCCGCCACGTCNONE 
J080023D20TTGGCCCATGGGCCGCCACGTCNONE 
J080023I01TTGGCCCATGGGCCGCCACGTCNONE 
J080023J05TTGGCCCATGGGCCGCCACGTCNONE 
J080024A09TTGGCCCATGGGCCGCCACGTCNONE 
J080024I09TTGGCCCATGGGCCGCCACGTCNONE 
J080025A10TTGGCCCATGGGCCGCCACGTCNONE 
J080025G04TTGGCCCATGGGCCGCCACGTCNONE 
J080027D21TTGGCCCATGGGCCGCCACGTCNONE 
J080029M05TTGGCCCATGGGCCGCCACGTCNONE 
J080030J01TTGGCCCATGGGCCGCCACGTCNONE 
J080034D10TTGGCCCATGGGCCGCCACGTCNONE 
J080036F18TTGGCCCATGGGCCGCCACGTCNONE 
J080038N11TTGGCCCATGGGCCGCCACGTCNONE 
J080039B07TTGGCCCATGGGCCGCCACGTCNONE 
J080039E01TTGGCCCATGGGCCGCCACGTCNONE 
J080039K11TTGGCCCATGGGCCGCCACGTCNONE 
J080040B09TTGGCCCATGGGCCGCCACGTCNONE 
J080040G11TTGGCCCATGGGCCGCCACGTCNONE 
J080041H08TTGGCCCATGGGCCGCCACGTCNONE 
J080041H19TTGGCCCATGGGCCGCCACGTCNONE 
J080041O20TTGGCCCATGGGCCGCCACGTCNONE 
J080042C15TTGGCCCATGGGCCGCCACGTCNONE 
J080043C16TTGGCCCATGGGCCGCCACGTCNONE 
J080043F18TTGGCCCATGGGCCGCCACGTCNONE 
J080044B17TTGGCCCATGGGCCGCCACGTCNONE 
J080044N10TTGGCCCATGGGCCGCCACGTCNONE 
J080044O07TTGGCCCATGGGCCGCCACGTCNONE 
J080045H15TTGGCCCATGGGCCGCCACGTCNONE 
J080045I03TTGGCCCATGGGCCGCCACGTCNONE 
J080046A05TTGGCCCATGGGCCGCCACGTCNONE 
J080048I06TTGGCCCATGGGCCGCCACGTCNONE 
J080049L04TTGGCCCATGGGCCGCCACGTCNONE 
J080049M09TTGGCCCATGGGCCGCCACGTCNONE 
J080050G11TTGGCCCATGGGCCGCCACGTCNONE 
J080051G20TTGGCCCATGGGCCGCCACGTCNONE 
J080053C09TTGGCCCATGGGCCGCCACGTCNONE 
J080053I05TTGGCCCATGGGCCGCCACGTCNONE 
J080053P18TTGGCCCATGGGCCGCCACGTCNONE 
J080054K10TTGGCCCATGGGCCGCCACGTCNONE 
J080054P14TTGGCCCATGGGCCGCCACGTCNONE 
J080057L05TTGGCCCATGGGCCGCCACGTCNONE 
J080062K11TTGGCCCATGGGCCGCCACGTCNONE 
J080063C19TTGGCCCATGGGCCGCCACGTCNONE 
J080065B03TTGGCCCATGGGCCGCCACGTCNONE 
J080066E15TTGGCCCATGGGCCGCCACGTCNONE 
J080066H05TTGGCCCATGGGCCGCCACGTCNONE 
J080066I05TTGGCCCATGGGCCGCCACGTCNONE 
J080068O11TTGGCCCATGGGCCGCCACGTCNONE 
J080070L22TTGGCCCATGGGCCGCCACGTCNONE 
J080071I12TTGGCCCATGGGCCGCCACGTCNONE 
J080071N20TTGGCCCATGGGCCGCCACGTCNONE 
J080072D10TTGGCCCATGGGCCGCCACGTCNONE 
J080072I10TTGGCCCATGGGCCGCCACGTCNONE 
J080074G03TTGGCCCATGGGCCGCCACGTCNONE 
J080076E23TTGGCCCATGGGCCGCCACGTCNONE 
J080076N03TTGGCCCATGGGCCGCCACGTCNONE 
J080077N23TTGGCCCATGGGCCGCCACGTCNONE 
J080084B13TTGGCCCATGGGCCGCCACGTCNONE 
J080084F07TTGGCCCATGGGCCGCCACGTCNONE 
J080085J15TTGGCCCATGGGCCGCCACGTCNONE 
J080085P20TTGGCCCATGGGCCGCCACGTCNONE 
J080090F21TTGGCCCATGGGCCGCCACGTCNONE 
J080093H16TTGGCCCATGGGCCGCCACGTCNONE 
J080093J01TTGGCCCATGGGCCGCCACGTCNONE 
J080093L04TTGGCCCATGGGCCGCCACGTCNONE 
J080097E24TTGGCCCATGGGCCGCCACGTCNONE 
J090012G04TTGGCCCATGGGCCGCCACGTCNONE 
J090054K05TTGGCCCATGGGCCGCCACGTCNONE 
Os05g0134200AK067074CGCCACGTGTCCSimilar to Protein phosphatase-2C. 
Os05g0140800AK110652CGCCACGTCSimilar to Dormancy related protein (Fragment). 
J075019K14CGCCACGTCNONE 
J075020O11CGCCACGTCNONE 
J075028P06CGCCACGTCNONE 
J075050A16CGCCACGTCNONE 
J075051F18CGCCACGTCNONE 
J075085K03CGCCACGTCNONE 
J075112P22CGCCACGTCNONE 
J075118I09CGCCACGTCNONE 
J075144H09CGCCACGTCNONE 
J075166I07CGCCACGTCNONE 
J075191J02CGCCACGTCNONE 
J075195I23CGCCACGTCNONE 
Os05g0170200013-081-D01CGCCACGTCNONE 
013-083-D05CGCCACGTCNONE 
AK063609CGCCACGTCNONE 
AK063611CGCCACGTCConserved hypothetical protein. 
AY594285CGCCACGTCNONE 
J100032N15CGCCACGTCNONE 
Os05g0176700009-076-A09CGCCACGTGTCCNONE 
009-147-H06CGCCACGTGTCCNONE 
009-161-C02CGCCACGTGTCCNONE 
AK071729CGCCACGTGTCCConserved hypothetical protein. 
J023110H11CGCCACGTGTCCNONE 
J075092I23CGCCACGTGTCCNONE 
J100038P12CGCCACGTGTCCNONE 
J100039J21CGCCACGTGTCCNONE 
J100039M13CGCCACGTGTCCNONE 
J100084A22CGCCACGTGTCCNONE 
Os05g0193800AK058865CGCCACGTCNONE 
AK067940CGCCACGTCConserved hypothetical protein. 
J065043K19CGCCACGTCNONE 
J065095O10CGCCACGTCNONE 
J065095O12CGCCACGTCNONE 
J080002K02CGCCACGTCNONE 
J080012L17CGCCACGTCNONE 
J080013J02CGCCACGTCNONE 
J080013O11CGCCACGTCNONE 
J080020A17CGCCACGTCNONE 
J080028E18CGCCACGTCNONE 
J080036P11CGCCACGTCNONE 
J080042E10CGCCACGTCNONE 
J080042L10CGCCACGTCNONE 
J080047B11CGCCACGTCNONE 
J080048N05CGCCACGTCNONE 
J080057E20CGCCACGTCNONE 
J080057K13CGCCACGTCNONE 
J080058L03CGCCACGTCNONE 
J080063H07CGCCACGTCNONE 
J080066L23CGCCACGTCNONE 
J080069G22CGCCACGTCNONE 
J080072E12CGCCACGTCNONE 
J080076D06CGCCACGTCNONE 
J080077A22CGCCACGTCNONE 
J080081A01CGCCACGTCNONE 
J080090M13CGCCACGTCNONE 
J080093G07CGCCACGTCNONE 
J080094O20CGCCACGTCNONE 
J080097F13CGCCACGTCNONE 
Os05g0215700AK107771GACGTGGCGNONE 
AK119724GACGTGGCGConserved hypothetical protein. 
J065013E03GACGTGGCGNONE 
J065157J11GACGTGGCGNONE 
J065166M22GACGTGGCGNONE 
Os05g0220900AK109172CGCCACGTNONE 
AK109456CGCCACGTPrefoldin domain containing protein. 
Os05g0312500AK069307CCCACGTGGCGReticulon family protein. 
J023075D16CCCACGTGGCGNONE 
J023097K08CCCACGTGGCGNONE 
Os05g0372400AK068781CGCCACGTCLipase, class 3 family protein. 
Os05g0372900AK072757CGCCACGTConserved hypothetical protein. 
J023031F10CGCCACGTNONE 
J023142H17CGCCACGTNONE 
Os05g0377000Os05g0377000CGCCACGTCSimilar to Acyl carrier protein (ACP). 
Os05g0392801J090025K15ACGTGGCGConserved hypothetical protein. 
J090053E06ACGTGGCGNONE 
Os05g0423500015-048-C11CGCCACGTCNONE 
AK066000CGCCACGTCProtein kinase-like domain containing protein. 
J013049L02CGCCACGTCNONE 
Os05g0423701J100057H19CCCACGTGGCGGlycoside hydrolase, family 9 protein. 
Os05g0466600009-088-F09CACGCCACGTCNONE 
009-105-C11CACGCCACGTCNONE 
009-156-C06CACGCCACGTCNONE 
AK119240CACGCCACGTChistone H4 [Oryza sativa (japonica cultivar-group)]. 
Os05g0481800AK100952ACGTGGCGProtein prenyltransferase domain containing protein. 
AK110987ACGTGGCGNONE 
Os05g0490200016-097-B03CGCCACGTGTCCNONE 
AK101147CGCCACGTGTCCProtein of unknown function DUF1692 domain containing protein. 
AK105601CGCCACGTGTCCNONE 
J033026P06CGCCACGTGTCCNONE 
Os05g0499800016-065-G04GTCGCGCGCCACGTCNONE 
AK064392GTCGCGCGCCACGTCNONE 
AK103146GTCGCGCGCCACGTCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J023075J11GTCGCGCGCCACGTCNONE 
J033120I02GTCGCGCGCCACGTCNONE 
Os05g0501300006-075-B11CGCCACGTGGCGNONE 
006-083-H08CGCCACGTGGCGNONE 
AK059889CGCCACGTGGCGSimilar to Flavoprotein wrbA (Trp repressor binding protein). 
J043030K02CGCCACGTGGCGNONE 
Os05g0514300AK061747ACGTGGCGSimilar to Tubby-like protein 3. 
AK098851ACGTGGCGNONE 
Os05g0519700014-100-B04CGCCACGTGGCNONE 
AF332981CGCCACGTGGCNONE 
AK100903CGCCACGTGGCNONE 
AK105433CGCCACGTGGCHeat shock protein 101. 
Os05g0519800AK069435GCCACGTGGCGProtein of unknown function DUF28 family protein. 
J023024L22GCCACGTGGCGNONE 
Os05g0521700AK070182ATTGGGCCACGTGGCGConserved hypothetical protein. 
J013170O04ATTGGGCCACGTGGCGNONE 
J023045H17ATTGGGCCACGTGGCGNONE 
Os05g0529300AK102648CGCCACGTCACCSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06GGTGACGTGGCGNONE 
AK063846GGTGACGTGGCGConserved hypothetical protein. 
AK122038GGTGACGTGGCGNONE 
J033113C01GGTGACGTGGCGNONE 
Os05g0539400AK068572CGCCACGTCACTCCACGCCGlycoside hydrolase, family 35 protein. 
J013063P08CGCCACGTCACTCCACGCCNONE 
J013110N24CGCCACGTCACTCCACGCCNONE 
J013156K22CGCCACGTCACTCCACGCCNONE 
J043038A08CGCCACGTCACTCCACGCCNONE 
J090004K18CGCCACGTCACTCCACGCCNONE 
J090085F03CGCCACGTCACTCCACGCCNONE 
Os05g0566800AK065748CGCCACGTCCold acclimation protein COR413-TM1. 
AY181210CGCCACGTCNONE 
Os05g0568600009-024-B09CGCCACGTGTCGNONE 
AK063781CGCCACGTGTCGProtein of unknown function DUF1645 family protein. 
J080049H14CGCCACGTGTCGNONE 
J080062M08CGCCACGTGTCGNONE 
J080064I07CGCCACGTGTCGNONE 
J080068A12CGCCACGTGTCGNONE 
J080086J10CGCCACGTGTCGNONE 
Os05g0571600Os05g0571600GACGTGGCGConserved hypothetical protein. 
Os05g0586600AB096011GCCCACGTGGCGPlastid sigma factor SIG5. 
AB096071GCCCACGTGGCGNONE 
AK105697GCCCACGTGGCGNONE 
Os05g0592800AK067627CGCGTCGCCACGTGTCCACGCCSimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2). 
AK070388CGCGTCGCCACGTGTCCACGCCNONE 
AK104323CGCGTCGCCACGTGTCCACGCCNONE 
Os06g0102600J065187I04CGCCACGTHypothetical protein. 
Os06g0114700AK061552ACGTGGCGTGProtein of unknown function DUF1218 family protein. 
AK098848ACGTGGCGTGNONE 
AK122142ACGTGGCGTGNONE 
J013000D16ACGTGGCGTGNONE 
Os06g0130800014-002-A12CGCCACGTGTNONE 
AK069863CGCCACGTGTHistone H5 family protein. 
J023037L12CGCCACGTGTNONE 
J065013F22CGCCACGTGTNONE 
J065021C09CGCCACGTGTNONE 
J065065E23CGCCACGTGTNONE 
J065066L24CGCCACGTGTNONE 
J065093N06CGCCACGTGTNONE 
J065135B12CGCCACGTGTNONE 
J065142J19CGCCACGTGTNONE 
J065163M21CGCCACGTGTNONE 
J065167K01CGCCACGTGTNONE 
J065178F24CGCCACGTGTNONE 
J065179A22CGCCACGTGTNONE 
J065196O19CGCCACGTGTNONE 
J075041I03CGCCACGTGTNONE 
J075071E18CGCCACGTGTNONE 
J075071F17CGCCACGTGTNONE 
J075125K04CGCCACGTGTNONE 
J075141I12CGCCACGTGTNONE 
J075142M02CGCCACGTGTNONE 
J075150G22CGCCACGTGTNONE 
J075151J04CGCCACGTGTNONE 
J075195A03CGCCACGTGTNONE 
J080023G18CGCCACGTGTNONE 
J080076P03CGCCACGTGTNONE 
J090051F21CGCCACGTGTNONE 
J090082L05CGCCACGTGTNONE 
U74296CGCCACGTGTNONE 
Os06g0134800014-049-H04CGCCACGTCTCTCCCCCACGCGTNONE 
AK063692CGCCACGTCTCTCCCCCACGCGTGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0163300006-112-F11CGCCACGTGGCNONE 
006-115-G04CGCCACGTGGCNONE 
012-079-D09CGCCACGTGGCNONE 
AK058295CGCCACGTGGCHarpin-induced 1 domain containing protein. 
AK060328CGCCACGTGGCNONE 
AK073824CGCCACGTGGCNONE 
AK106071CGCCACGTGGCNONE 
J023025D10CGCCACGTGGCNONE 
J033070N04CGCCACGTGGCNONE 
J065016B01CGCCACGTGGCNONE 
J065030K12CGCCACGTGGCNONE 
J065076I03CGCCACGTGGCNONE 
J065084L24CGCCACGTGGCNONE 
J065179O03CGCCACGTGGCNONE 
J090025I06CGCCACGTGGCNONE 
Os06g0171700AK103771GTGACGTGGCGTGCdk-activating kinase assembly factor (MAT1) family protein. 
J033143J20GTGACGTGGCGTGNONE 
Os06g0217700009-074-A04CGCCACGTNONE 
AK062617CGCCACGTConserved hypothetical protein. 
Os06g0220800AK059876CGCCACGTNONE 
AY739306CGCCACGTThioredoxin domain 2 containing protein. 
J075093C09CGCCACGTNONE 
J100026J18CGCCACGTNONE 
J100041O16CGCCACGTNONE 
J100089K16CGCCACGTNONE 
Os06g0258000AK107483CGCCACGTGSimilar to Typical P-type R2R3 Myb protein (Fragment). 
Os06g0258900AK067794CGCCACGTCKetose-bisphosphate aldolase, class-II family protein. 
AK099384CGCCACGTCNONE 
Os06g0275500AK111743CACGTGGCGCCACGTCSimilar to Polycomb protein EZ1 (Enhancer of zeste protein 1). 
Os06g0286228AK069113CGCCACGTCCupredoxin domain containing protein. 
Os06g0593100AK060274CACGCCACGTCACCSimilar to UDP-galactose/UDP-glucose transporter. 
AK071175CACGCCACGTCACCNONE 
Os06g0602400AK106474ACGTGGCGSimilar to DEAD-box protein 3, X-chromosomal (DEAD-box RNA helicase DEAD3) (mDEAD3) (Embryonic RNA helicase) (D1PAS1 related sequence 2). 
Os06g0604400AK072121CGCCACGTCSimilar to Phospholipase D. 
Os06g0621300AK068751ACGTGGCGConserved hypothetical protein. 
J013159I20ACGTGGCGNONE 
Os06g0634600011-029-F10CGCCACGTCNONE 
011-029-F10CGCCACGTCNONE 
011-057-B11CGCCACGTCNONE 
011-057-B11CGCCACGTCNONE 
AK122074CGCCACGTCProtein of unknown function FAF1 domain containing protein. 
AK122074CGCCACGTCProtein of unknown function FAF1 domain containing protein. 
J033118C24CGCCACGTCNONE 
J033118C24CGCCACGTCNONE 
J033132A01CGCCACGTCNONE 
J033132A01CGCCACGTCNONE 
J065059I05CGCCACGTCNONE 
J065059I05CGCCACGTCNONE 
J100069I04CGCCACGTCNONE 
J100069I04CGCCACGTCNONE 
Os06g0647900AK073750CGCCACGTGConserved hypothetical protein. 
J033029K17CGCCACGTGNONE 
J033070L21CGCCACGTGNONE 
Os06g0688100AK063450CGCCACGTGTCNONE 
AK101144CGCCACGTGTCRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0698300AK071637CGCCACGTGProtein phosphatase 2C family protein. 
AK071637CGCCACGTGProtein phosphatase 2C family protein. 
J023098M15CGCCACGTGNONE 
J023098M15CGCCACGTGNONE 
J023101G03CGCCACGTGNONE 
J023101G03CGCCACGTGNONE 
J023139A04CGCCACGTGNONE 
J023139A04CGCCACGTGNONE 
Os06g0704700AK120907CGCCACGTCCACGCCTCNmrA-like family protein. 
AY224493CGCCACGTCCACGCCTCNONE 
Os06g0712800AK121236CGCCACGTCACCSimilar to Ankyrin-like protein. 
Os06g0716700AB037681CACGTGGCGSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AB037681CGCCACGTGTCCGGCCCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385CACGTGGCGNONE 
AK063385CGCCACGTGTCCGGCCCNONE 
AK102478CACGTGGCGNONE 
AK102478CGCCACGTGTCCGGCCCNONE 
J013030D18CACGTGGCGNONE 
J013030D18CGCCACGTGTCCGGCCCNONE 
J090091L06CACGTGGCGNONE 
J090091L06CGCCACGTGTCCGGCCCNONE 
Os06g0728700AK111637GACGTGGCGHomeodomain-like containing protein. 
AK119632GACGTGGCGNONE 
J075015J02GACGTGGCGNONE 
J075016L14GACGTGGCGNONE 
J075078O03GACGTGGCGNONE 
J075098O14GACGTGGCGNONE 
J075171L20GACGTGGCGNONE 
Os07g0124100014-015-G11ACACGTGGCGNONE 
AJ276693ACACGTGGCGPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647ACACGTGGCGNONE 
Os07g0138100AK059496ACGTGGCGPleckstrin homology-type domain containing protein. 
Os07g0152900009-034-G07CGCCACGTCNONE 
AK062189CGCCACGTCNONE 
AK062433CGCCACGTCNONE 
AK103933CGCCACGTCNONE 
AK120929CGCCACGTCSimilar to Glycolate oxidase (EC 1.1.3.15) (Fragment). 
J013039G04CGCCACGTCNONE 
J013046B19CGCCACGTCNONE 
J013118P12CGCCACGTCNONE 
J013124C14CGCCACGTCNONE 
J013129M06CGCCACGTCNONE 
J013154C03CGCCACGTCNONE 
J013157J12CGCCACGTCNONE 
J013157N21CGCCACGTCNONE 
J023050B06CGCCACGTCNONE 
J065124L23CGCCACGTCNONE 
J065157G04CGCCACGTCNONE 
J065157L13CGCCACGTCNONE 
J065214I21CGCCACGTCNONE 
J080004P17CGCCACGTCNONE 
J080009G20CGCCACGTCNONE 
J080010G21CGCCACGTCNONE 
J080013C05CGCCACGTCNONE 
J080013D14CGCCACGTCNONE 
J080015N16CGCCACGTCNONE 
J080020D13CGCCACGTCNONE 
J080020K23CGCCACGTCNONE 
J080028D21CGCCACGTCNONE 
J080029N23CGCCACGTCNONE 
J080032E20CGCCACGTCNONE 
J080033K16CGCCACGTCNONE 
J080035G12CGCCACGTCNONE 
J080035G23CGCCACGTCNONE 
J080061H23CGCCACGTCNONE 
J080063J06CGCCACGTCNONE 
J080064J09CGCCACGTCNONE 
J080067O13CGCCACGTCNONE 
J080070F23CGCCACGTCNONE 
J080076N06CGCCACGTCNONE 
J080077L15CGCCACGTCNONE 
J080081L01CGCCACGTCNONE 
J080083F16CGCCACGTCNONE 
J080089F16CGCCACGTCNONE 
J080089G06CGCCACGTCNONE 
J080089L14CGCCACGTCNONE 
J080093A07CGCCACGTCNONE 
J080093A11CGCCACGTCNONE 
J080093N16CGCCACGTCNONE 
J080094C09CGCCACGTCNONE 
J080301E18CGCCACGTCNONE 
J080301K03CGCCACGTCNONE 
J080304I22CGCCACGTCNONE 
J080304M17CGCCACGTCNONE 
J080319A12CGCCACGTCNONE 
J090080A21CGCCACGTCNONE 
J100055D23CGCCACGTCNONE 
J100057F17CGCCACGTCNONE 
Os07g0171100AF272978CGCCACGTNONE 
AK062132CGCCACGTNONE 
AK066475CGCCACGTTetratricopeptide-like helical domain containing protein. 
J013068C23CGCCACGTNONE 
Os07g0181500AK072431CGCCACGTCACCProtein of unknown function DUF506, plant family protein. 
Os07g0246200012-046-B07CACGTGGCGNONE 
AB021259CACGTGGCGNONE 
AK065341CACGTGGCGSimilar to Calreticulin (Fragment). 
AK099348CACGTGGCGNONE 
AK104328CACGTGGCGNONE 
AK104826CACGTGGCGNONE 
J013000E04CACGTGGCGNONE 
J013093M19CACGTGGCGNONE 
J013108J08CACGTGGCGNONE 
J013118G03CACGTGGCGNONE 
J013121I07CACGTGGCGNONE 
J013153K07CACGTGGCGNONE 
J023028N07CACGTGGCGNONE 
J023034F12CACGTGGCGNONE 
J023043J11CACGTGGCGNONE 
J023087A03CACGTGGCGNONE 
J023099N05CACGTGGCGNONE 
J023105B02CACGTGGCGNONE 
J023110H02CACGTGGCGNONE 
J023112E15CACGTGGCGNONE 
J023132C20CACGTGGCGNONE 
J023134G12CACGTGGCGNONE 
J023138O12CACGTGGCGNONE 
J033031E05CACGTGGCGNONE 
J033032C03CACGTGGCGNONE 
J033039K10CACGTGGCGNONE 
J033050P09CACGTGGCGNONE 
J033074D03CACGTGGCGNONE 
J033075G14CACGTGGCGNONE 
J033075I23CACGTGGCGNONE 
J033081H23CACGTGGCGNONE 
J033087N08CACGTGGCGNONE 
J033110B03CACGTGGCGNONE 
J033148H22CACGTGGCGNONE 
J043027F13CACGTGGCGNONE 
J043031H01CACGTGGCGNONE 
J080003O10CACGTGGCGNONE 
J080022D10CACGTGGCGNONE 
J080029I12CACGTGGCGNONE 
J080034A09CACGTGGCGNONE 
J080035H20CACGTGGCGNONE 
J080049C10CACGTGGCGNONE 
J080053G14CACGTGGCGNONE 
J080055J22CACGTGGCGNONE 
J080058J04CACGTGGCGNONE 
J080069E14CACGTGGCGNONE 
J080069M23CACGTGGCGNONE 
J080072E19CACGTGGCGNONE 
J080072I03CACGTGGCGNONE 
J080075B13CACGTGGCGNONE 
J080078I11CACGTGGCGNONE 
J080081F16CACGTGGCGNONE 
J080088O10CACGTGGCGNONE 
J080089G18CACGTGGCGNONE 
J090009C10CACGTGGCGNONE 
J090022D23CACGTGGCGNONE 
J090023A15CACGTGGCGNONE 
J090024M10CACGTGGCGNONE 
J090038F24CACGTGGCGNONE 
J090039O13CACGTGGCGNONE 
J090040N12CACGTGGCGNONE 
J090054I18CACGTGGCGNONE 
J090061C16CACGTGGCGNONE 
J090063H23CACGTGGCGNONE 
J090067F21CACGTGGCGNONE 
J090075A01CACGTGGCGNONE 
J090076K11CACGTGGCGNONE 
J090078L11CACGTGGCGNONE 
J090079P03CACGTGGCGNONE 
J090087D23CACGTGGCGNONE 
J090087G22CACGTGGCGNONE 
J090089F03CACGTGGCGNONE 
J090092A04CACGTGGCGNONE 
J100024L17CACGTGGCGNONE 
J100031P13CACGTGGCGNONE 
J100032H05CACGTGGCGNONE 
J100036P03CACGTGGCGNONE 
J100038L07CACGTGGCGNONE 
J100043I20CACGTGGCGNONE 
J100069A21CACGTGGCGNONE 
J100078G06CACGTGGCGNONE 
J100081J24CACGTGGCGNONE 
J100081N04CACGTGGCGNONE 
J100084K16CACGTGGCGNONE 
J100085O06CACGTGGCGNONE 
J100088L13CACGTGGCGNONE 
J100090O21CACGTGGCGNONE 
Os07g0258400AK121534CGCCACGTNONE 
L41217CGCCACGTNONE 
S81897CGCCACGTOsNramp1 (Integral membrane protein). 
Os07g0272800AK107279CGCCACGTCHypothetical protein. 
J065124H15CGCCACGTCNONE 
Os07g0295000AK071844CACGCCACGTMitochondrial substrate carrier family protein. 
AK099295CACGCCACGTNONE 
Os07g0406800AK064087CGCCACGTGTNONE 
AK101812CGCCACGTGTEukaryotic-type DNA primase, large subunit family protein. 
Os07g0407350J065005B03ACACGTGGCGTGNONE 
J065058G23ACACGTGGCGTGNONE 
J065144A11ACACGTGGCGTGNONE 
J065175J02ACACGTGGCGTGConserved hypothetical protein. 
Os07g0435100AB037153CGCCACGTNONE 
AK061383CGCCACGTSimilar to 26S proteasome subunit RPN12. 
AK061408CGCCACGTNONE 
AK101316CGCCACGTNONE 
J023133D07CGCCACGTNONE 
J023136B17CGCCACGTNONE 
J033065M08CGCCACGTNONE 
J033070F05CGCCACGTNONE 
J033070L20CGCCACGTNONE 
J033108J15CGCCACGTNONE 
J053080M19CGCCACGTNONE 
J053091B15CGCCACGTNONE 
J065067J03CGCCACGTNONE 
J065102C02CGCCACGTNONE 
J065135H09CGCCACGTNONE 
J080302K03CGCCACGTNONE 
J090059J11CGCCACGTNONE 
J090074G14CGCCACGTNONE 
J100025F20CGCCACGTNONE 
J100028L08CGCCACGTNONE 
J100049L14CGCCACGTNONE 
J100054O07CGCCACGTNONE 
Os07g0450000009-033-A08CGCCACGTCNONE 
AK063789CGCCACGTCNONE 
AK121702CGCCACGTCSimilar to 60S ribosomal protein L44. 
J033073H17CGCCACGTCNONE 
J065006A02CGCCACGTCNONE 
J065009C05CGCCACGTCNONE 
J065028M04CGCCACGTCNONE 
J065070D07CGCCACGTCNONE 
J065072H17CGCCACGTCNONE 
J065114J23CGCCACGTCNONE 
J065127A02CGCCACGTCNONE 
J065146L07CGCCACGTCNONE 
J065213H17CGCCACGTCNONE 
J065214B07CGCCACGTCNONE 
J100045B16CGCCACGTCNONE 
Os07g0474300AK108961CGCCACGTGTCCGGGCCCCConserved hypothetical protein. 
Os07g0529000011-012-E06ACGTGGCGNONE 
011-054-G04ACGTGGCGNONE 
016-094-D08ACGTGGCGNONE 
AK063353ACGTGGCGSimilar to Isocitrate lyase (Fragment). 
AK103744ACGTGGCGNONE 
J065022H24ACGTGGCGNONE 
J065040B11ACGTGGCGNONE 
J065053J07ACGTGGCGNONE 
J065057K21ACGTGGCGNONE 
J065063M16ACGTGGCGNONE 
J065073G06ACGTGGCGNONE 
J065158H07ACGTGGCGNONE 
J065159C23ACGTGGCGNONE 
J065184F18ACGTGGCGNONE 
J065184K08ACGTGGCGNONE 
J065192A11ACGTGGCGNONE 
J065199L23ACGTGGCGNONE 
J065212K16ACGTGGCGNONE 
J075002I18ACGTGGCGNONE 
J075055G16ACGTGGCGNONE 
J075112H09ACGTGGCGNONE 
J075199I10ACGTGGCGNONE 
Os07g0544800009-021-C02GGTCCACGTGGCGNONE 
009-170-G02GGTCCACGTGGCGNONE 
009-178-H12GGTCCACGTGGCGNONE 
AK069170GGTCCACGTGGCGSimilar to Oxygen-evolving enhancer protein 3-2, chloroplast precursor (OEE3) (16 kDa subunit of oxygen evolving system of photosystem II) (OEC 16 kDa subunit) (Ferredoxin-NADP reductase binding protein) (BP). 
AK099127GGTCCACGTGGCGNONE 
J065088D21GGTCCACGTGGCGNONE 
J065106G19GGTCCACGTGGCGNONE 
J065156I24GGTCCACGTGGCGNONE 
J065162C10GGTCCACGTGGCGNONE 
J065211G14GGTCCACGTGGCGNONE 
J075003F05GGTCCACGTGGCGNONE 
J075046I10GGTCCACGTGGCGNONE 
J075055M11GGTCCACGTGGCGNONE 
J075074I12GGTCCACGTGGCGNONE 
J075088B06GGTCCACGTGGCGNONE 
J075091K13GGTCCACGTGGCGNONE 
J075093I10GGTCCACGTGGCGNONE 
J075097M09GGTCCACGTGGCGNONE 
J075106H11GGTCCACGTGGCGNONE 
J075121C22GGTCCACGTGGCGNONE 
J075145F05GGTCCACGTGGCGNONE 
J075173H16GGTCCACGTGGCGNONE 
J075190L07GGTCCACGTGGCGNONE 
J100063N21GGTCCACGTGGCGNONE 
J100073C24GGTCCACGTGGCGNONE 
J100085E01GGTCCACGTGGCGNONE 
J100088I23GGTCCACGTGGCGNONE 
Os07g0545400009-136-E03CGCCACGTCACCGATCCGNONE 
013-015-G08CGCCACGTCACCGATCCGNONE 
AK059228CGCCACGTCACCGATCCGNONE 
J065040D09CGCCACGTCACCGATCCGNONE 
J065051C19CGCCACGTCACCGATCCGNONE 
J065139B05CGCCACGTCACCGATCCGNONE 
J065160E20CGCCACGTCACCGATCCGNONE 
J065207I17CGCCACGTCACCGATCCGNONE 
J080319M24CGCCACGTCACCGATCCGNONE 
Os07g0558500AK064914GGACACGTGGCGInositol phosphatase-like protein. 
AY224446GGACACGTGGCGNONE 
J013000M13GGACACGTGGCGNONE 
Os07g0564400Os07g0564400CGCCACGTNucleic acid-binding, OB-fold domain containing protein. 
Os07g0568300AK067784GACGTGGCGNONE 
AK067895GACGTGGCGSimilar to ZF protein (Fragment). 
J013119M01GACGTGGCGNONE 
J013120B09GACGTGGCGNONE 
J013123G12GACGTGGCGNONE 
J023012C12GACGTGGCGNONE 
J023020G17GACGTGGCGNONE 
J023037E23GACGTGGCGNONE 
J033076I01GACGTGGCGNONE 
J033108A07GACGTGGCGNONE 
J033138J02GACGTGGCGNONE 
J075033L09GACGTGGCGNONE 
J075049E02GACGTGGCGNONE 
J075060N23GACGTGGCGNONE 
J075094H13GACGTGGCGNONE 
J075179L18GACGTGGCGNONE 
J080005P09GACGTGGCGNONE 
J080044J03GACGTGGCGNONE 
J080062G20GACGTGGCGNONE 
J080063L23GACGTGGCGNONE 
J080065B16GACGTGGCGNONE 
J080071K09GACGTGGCGNONE 
J080089C23GACGTGGCGNONE 
J090008P21GACGTGGCGNONE 
J090046B22GACGTGGCGNONE 
J090094C19GACGTGGCGNONE 
J090096B19GACGTGGCGNONE 
J100060G03GACGTGGCGNONE 
J100082D16GACGTGGCGNONE 
Os07g0577600006-021-H11CGCCACGTCNONE 
006-022-B11CGCCACGTCNONE 
006-022-D10CGCCACGTCNONE 
006-022-E02CGCCACGTCNONE 
006-022-F03CGCCACGTCNONE 
006-023-C11CGCCACGTCNONE 
006-024-C10CGCCACGTCNONE 
006-024-C12CGCCACGTCNONE 
006-024-G12CGCCACGTCNONE 
006-026-C04CGCCACGTCNONE 
006-026-E05CGCCACGTCNONE 
006-026-E11CGCCACGTCNONE 
006-026-F09CGCCACGTCNONE 
006-026-H05CGCCACGTCNONE 
006-027-D03CGCCACGTCNONE 
006-028-C04CGCCACGTCNONE 
006-029-G10CGCCACGTCNONE 
006-030-A11CGCCACGTCNONE 
006-030-D12CGCCACGTCNONE 
006-031-G05CGCCACGTCNONE 
006-032-H06CGCCACGTCNONE 
006-033-A02CGCCACGTCNONE 
006-033-A06CGCCACGTCNONE 
006-034-B10CGCCACGTCNONE 
006-034-F07CGCCACGTCNONE 
006-035-A08CGCCACGTCNONE 
006-035-F07CGCCACGTCNONE 
006-036-A04CGCCACGTCNONE 
006-036-B04CGCCACGTCNONE 
006-037-D02CGCCACGTCNONE 
006-037-F12CGCCACGTCNONE 
006-037-H12CGCCACGTCNONE 
006-040-G12CGCCACGTCNONE 
006-040-H03CGCCACGTCNONE 
006-040-H06CGCCACGTCNONE 
006-042-B12CGCCACGTCNONE 
006-042-H10CGCCACGTCNONE 
006-044-G09CGCCACGTCNONE 
006-045-C04CGCCACGTCNONE 
006-046-B10CGCCACGTCNONE 
006-047-A05CGCCACGTCNONE 
006-048-D05CGCCACGTCNONE 
006-049-A08CGCCACGTCNONE 
006-050-C07CGCCACGTCNONE 
006-050-H10CGCCACGTCNONE 
006-051-G03CGCCACGTCNONE 
006-052-A01CGCCACGTCNONE 
006-052-A05CGCCACGTCNONE 
006-052-B03CGCCACGTCNONE 
006-052-D10CGCCACGTCNONE 
006-054-D03CGCCACGTCNONE 
006-055-A12CGCCACGTCNONE 
006-055-C05CGCCACGTCNONE 
006-055-F05CGCCACGTCNONE 
006-055-H10CGCCACGTCNONE 
006-056-A02CGCCACGTCNONE 
006-056-D07CGCCACGTCNONE 
006-057-A03CGCCACGTCNONE 
006-057-B06CGCCACGTCNONE 
006-057-H08CGCCACGTCNONE 
006-058-C04CGCCACGTCNONE 
006-058-F06CGCCACGTCNONE 
006-059-C10CGCCACGTCNONE 
006-059-G08CGCCACGTCNONE 
006-060-E10CGCCACGTCNONE 
006-061-B10CGCCACGTCNONE 
006-062-A05CGCCACGTCNONE 
006-062-B04CGCCACGTCNONE 
006-063-A04CGCCACGTCNONE 
006-063-D01CGCCACGTCNONE 
006-063-G12CGCCACGTCNONE 
006-064-D12CGCCACGTCNONE 
006-066-A03CGCCACGTCNONE 
006-066-C03CGCCACGTCNONE 
006-067-A03CGCCACGTCNONE 
006-067-G07CGCCACGTCNONE 
006-068-A06CGCCACGTCNONE 
006-069-D04CGCCACGTCNONE 
006-069-G05CGCCACGTCNONE 
006-070-H08CGCCACGTCNONE 
006-071-A05CGCCACGTCNONE 
006-071-H11CGCCACGTCNONE 
006-072-A07CGCCACGTCNONE 
006-072-B02CGCCACGTCNONE 
006-072-D11CGCCACGTCNONE 
006-072-H12CGCCACGTCNONE 
006-075-G06CGCCACGTCNONE 
006-077-B09CGCCACGTCNONE 
006-078-D01CGCCACGTCNONE 
006-078-D02CGCCACGTCNONE 
006-078-E05CGCCACGTCNONE 
006-078-G07CGCCACGTCNONE 
006-079-C03CGCCACGTCNONE 
006-079-F12CGCCACGTCNONE 
006-079-H01CGCCACGTCNONE 
006-080-D04CGCCACGTCNONE 
006-080-H04CGCCACGTCNONE 
006-081-A10CGCCACGTCNONE 
006-082-G02CGCCACGTCNONE 
006-082-H07CGCCACGTCNONE 
006-083-B03CGCCACGTCNONE 
006-085-A09CGCCACGTCNONE 
006-085-A12CGCCACGTCNONE 
006-085-F07CGCCACGTCNONE 
006-086-B11CGCCACGTCNONE 
006-086-D01CGCCACGTCNONE 
006-086-G04CGCCACGTCNONE 
006-087-E04CGCCACGTCNONE 
006-087-G09CGCCACGTCNONE 
006-088-E11CGCCACGTCNONE 
006-088-G10CGCCACGTCNONE 
006-088-H01CGCCACGTCNONE 
006-089-B04CGCCACGTCNONE 
006-089-D05CGCCACGTCNONE 
006-089-F07CGCCACGTCNONE 
006-089-H07CGCCACGTCNONE 
006-090-B06CGCCACGTCNONE 
006-090-H05CGCCACGTCNONE 
006-091-E11CGCCACGTCNONE 
006-092-H01CGCCACGTCNONE 
006-093-B08CGCCACGTCNONE 
006-093-C07CGCCACGTCNONE 
006-093-F02CGCCACGTCNONE 
006-093-G05CGCCACGTCNONE 
006-093-G06CGCCACGTCNONE 
006-094-D10CGCCACGTCNONE 
006-094-H07CGCCACGTCNONE 
006-095-G03CGCCACGTCNONE 
006-096-A06CGCCACGTCNONE 
006-096-E03CGCCACGTCNONE 
006-097-B03CGCCACGTCNONE 
006-097-D03CGCCACGTCNONE 
006-098-B07CGCCACGTCNONE 
006-098-G05CGCCACGTCNONE 
006-099-F05CGCCACGTCNONE 
006-100-H10CGCCACGTCNONE 
006-100-H12CGCCACGTCNONE 
006-101-A06CGCCACGTCNONE 
006-101-A08CGCCACGTCNONE 
006-101-A12CGCCACGTCNONE 
006-101-D04CGCCACGTCNONE 
006-101-G07CGCCACGTCNONE 
006-102-B12CGCCACGTCNONE 
006-102-E09CGCCACGTCNONE 
006-102-F02CGCCACGTCNONE 
006-103-D09CGCCACGTCNONE 
006-105-D05CGCCACGTCNONE 
006-105-D08CGCCACGTCNONE 
006-106-C07CGCCACGTCNONE 
006-106-F12CGCCACGTCNONE 
006-107-D01CGCCACGTCNONE 
006-109-C05CGCCACGTCNONE 
006-109-C08CGCCACGTCNONE 
006-109-D02CGCCACGTCNONE 
006-111-F03CGCCACGTCNONE 
006-112-C12CGCCACGTCNONE 
006-112-D08CGCCACGTCNONE 
006-113-A01CGCCACGTCNONE 
006-113-B03CGCCACGTCNONE 
006-113-C11CGCCACGTCNONE 
006-113-E07CGCCACGTCNONE 
006-113-F08CGCCACGTCNONE 
006-114-D08CGCCACGTCNONE 
006-114-H08CGCCACGTCNONE 
006-115-A08CGCCACGTCNONE 
006-115-A09CGCCACGTCNONE 
006-115-G05CGCCACGTCNONE 
006-117-B06CGCCACGTCNONE 
006-117-B09CGCCACGTCNONE 
006-117-F11CGCCACGTCNONE 
006-117-G10CGCCACGTCNONE 
006-117-H08CGCCACGTCNONE 
006-118-C06CGCCACGTCNONE 
006-118-G11CGCCACGTCNONE 
006-119-H03CGCCACGTCNONE 
006-120-D01CGCCACGTCNONE 
006-120-D12CGCCACGTCNONE 
006-120-H04CGCCACGTCNONE 
009-022-E12CGCCACGTCNONE 
009-044-H02CGCCACGTCNONE 
009-074-B08CGCCACGTCNONE 
009-145-B08CGCCACGTCNONE 
009-156-D09CGCCACGTCNONE 
009-163-F03CGCCACGTCNONE 
009-193-G03CGCCACGTCNONE 
AF010321CGCCACGTCNONE 
AK060987CGCCACGTCNONE 
AK070051CGCCACGTCNONE 
AK103966CGCCACGTCNONE 
AK104016CGCCACGTCNONE 
AK104127CGCCACGTCNONE 
AK104177CGCCACGTCNONE 
AK104283CGCCACGTCNONE 
AK104608CGCCACGTCNONE 
AK104651CGCCACGTCNONE 
AK119176CGCCACGTCSimilar to Type II chlorophyll a/b binding protein from photosystem I precursor. 
J065013J05CGCCACGTCNONE 
J065129D23CGCCACGTCNONE 
J065138E06CGCCACGTCNONE 
J065179N22CGCCACGTCNONE 
J065192A07CGCCACGTCNONE 
J065208G16CGCCACGTCNONE 
J075013K01CGCCACGTCNONE 
J075017B12CGCCACGTCNONE 
J075018O17CGCCACGTCNONE 
J075023H05CGCCACGTCNONE 
J075053L02CGCCACGTCNONE 
J075067I01CGCCACGTCNONE 
J075083D19CGCCACGTCNONE 
J075083G03CGCCACGTCNONE 
J075084F12CGCCACGTCNONE 
J075088K18CGCCACGTCNONE 
J075094A18CGCCACGTCNONE 
J075094I22CGCCACGTCNONE 
J075097E17CGCCACGTCNONE 
J075098I24CGCCACGTCNONE 
J075110K19CGCCACGTCNONE 
J075118G21CGCCACGTCNONE 
J075118J20CGCCACGTCNONE 
J075120G14CGCCACGTCNONE 
J075120H20CGCCACGTCNONE 
J075127H23CGCCACGTCNONE 
J075139M03CGCCACGTCNONE 
J075142E17CGCCACGTCNONE 
J075149N17CGCCACGTCNONE 
J075152A20CGCCACGTCNONE 
J075157N22CGCCACGTCNONE 
J075159K21CGCCACGTCNONE 
J075173B20CGCCACGTCNONE 
J075192N20CGCCACGTCNONE 
J075196A07CGCCACGTCNONE 
J075199N04CGCCACGTCNONE 
J080005P10CGCCACGTCNONE 
J080025I24CGCCACGTCNONE 
J080064D09CGCCACGTCNONE 
J080064N24CGCCACGTCNONE 
J080068B02CGCCACGTCNONE 
J080097K04CGCCACGTCNONE 
J080097K19CGCCACGTCNONE 
J080097N20CGCCACGTCNONE 
J100055P07CGCCACGTCNONE 
Os07g0591400Os07g0591400GACGTGGCGNONE 
Os07g0607800012-042-C02CGCCACGTCNONE 
015-097-B06CGCCACGTCNONE 
AK069010CGCCACGTCNONE 
J013170I18CGCCACGTCNONE 
J090036G23CGCCACGTCNONE 
Os07g0620800AK063671CGCCACGTCTCCyclin-like domain containing protein. 
Os07g0622700AK107120CACGTGGCGEpoxide hydrolase family protein. 
AK107120CGCCACGTCEpoxide hydrolase family protein. 
Os07g0625800AK073694CGCCACGTGNONE 
AK103419CGCCACGTGPlant lipid transfer protein/Par allergen family protein. 
Os07g0633400AK071894CGCCACGTGTIQ calmodulin-binding region domain containing protein. 
Os07g0637100AK111132CGCCACGTHeat shock protein DnaJ, N-terminal domain containing protein. 
Os07g0673100AK060100CGCCACGTCNONE 
AK103678CGCCACGTCRibosomal protein S8E family protein. 
AK104794CGCCACGTCNONE 
Os07g0673900J080092A21CGCCACGTNONE 
Os07g0674100AB183706CGCCACGTGGCGUDP-glucuronic acid decarboxylase. 
AK099614CGCCACGTGGCGNONE 
J013050E02CGCCACGTGGCGNONE 
J065162F06CGCCACGTGGCGNONE 
J065180F10CGCCACGTGGCGNONE 
J090049F09CGCCACGTGGCGNONE 
J100064L11CGCCACGTGGCGNONE 
Os07g0683200013-007-C05CGCCACGTCACNONE 
013-065-B12CGCCACGTCACNONE 
AK068606CGCCACGTCACSimilar to OsNAC6 protein. 
J013157G23CGCCACGTCACNONE 
J065027I23CGCCACGTCACNONE 
J065030M02CGCCACGTCACNONE 
J065056J02CGCCACGTCACNONE 
J065124H04CGCCACGTCACNONE 
J065142K03CGCCACGTCACNONE 
J065142M16CGCCACGTCACNONE 
J065201J05CGCCACGTCACNONE 
J065215H19CGCCACGTCACNONE 
J075195N15CGCCACGTCACNONE 
J090073O17CGCCACGTCACNONE 
J100069P10CGCCACGTCACNONE 
Os07g0692050J065164I07GCCACGTGGCGConserved hypothetical protein. 
Os08g0104600005-006-A07CGCCACGTGGCNONE 
006-083-A08CGCCACGTGGCNONE 
009-022-C08CGCCACGTGGCNONE 
009-027-A01CGCCACGTGGCNONE 
009-030-E07CGCCACGTGGCNONE 
009-042-H08CGCCACGTGGCNONE 
009-048-E08CGCCACGTGGCNONE 
009-051-F07CGCCACGTGGCNONE 
009-051-H06CGCCACGTGGCNONE 
009-054-E02CGCCACGTGGCNONE 
009-084-D01CGCCACGTGGCNONE 
009-089-A03CGCCACGTGGCNONE 
009-105-H12CGCCACGTGGCNONE 
009-109-D02CGCCACGTGGCNONE 
009-110-H12CGCCACGTGGCNONE 
009-117-A05CGCCACGTGGCNONE 
009-117-C08CGCCACGTGGCNONE 
009-118-F09CGCCACGTGGCNONE 
009-119-E03CGCCACGTGGCNONE 
009-122-G10CGCCACGTGGCNONE 
009-125-H06CGCCACGTGGCNONE 
009-126-A06CGCCACGTGGCNONE 
009-127-H02CGCCACGTGGCNONE 
009-128-B09CGCCACGTGGCNONE 
009-129-B09CGCCACGTGGCNONE 
009-130-D05CGCCACGTGGCNONE 
009-130-D08CGCCACGTGGCNONE 
009-139-D08CGCCACGTGGCNONE 
009-149-D07CGCCACGTGGCNONE 
009-150-C04CGCCACGTGGCNONE 
009-154-E03CGCCACGTGGCNONE 
009-155-C06CGCCACGTGGCNONE 
009-165-B08CGCCACGTGGCNONE 
009-167-C06CGCCACGTGGCNONE 
009-181-H11CGCCACGTGGCNONE 
009-191-F03CGCCACGTGGCNONE 
009-192-C06CGCCACGTGGCNONE 
009-195-F03CGCCACGTGGCNONE 
009-196-G08CGCCACGTGGCNONE 
009-197-D08CGCCACGTGGCNONE 
014-052-E10CGCCACGTGGCNONE 
AF010320CGCCACGTGGCNONE 
AK061654CGCCACGTGGCNONE 
AK119206CGCCACGTGGCNONE 
AK119709CGCCACGTGGCNONE 
AK120393CGCCACGTGGCFerredoxin I, chloroplast precursor (Anti-disease protein 1). 
AY072818CGCCACGTGGCNONE 
D30763CGCCACGTGGCNONE 
J013043A04CGCCACGTGGCNONE 
J013058K06CGCCACGTGGCNONE 
J013059G01CGCCACGTGGCNONE 
J013067N20CGCCACGTGGCNONE 
J013074D04CGCCACGTGGCNONE 
J013075A06CGCCACGTGGCNONE 
J013093N12CGCCACGTGGCNONE 
J013094P22CGCCACGTGGCNONE 
J013119N05CGCCACGTGGCNONE 
J013120G18CGCCACGTGGCNONE 
J013129G02CGCCACGTGGCNONE 
J013129P10CGCCACGTGGCNONE 
J013159F22CGCCACGTGGCNONE 
J013160D20CGCCACGTGGCNONE 
J013160E23CGCCACGTGGCNONE 
J023034F18CGCCACGTGGCNONE 
J023048F04CGCCACGTGGCNONE 
J023048O08CGCCACGTGGCNONE 
J023049B18CGCCACGTGGCNONE 
J023061A17CGCCACGTGGCNONE 
J023072A03CGCCACGTGGCNONE 
J023085A16CGCCACGTGGCNONE 
J023087L09CGCCACGTGGCNONE 
J043012O13CGCCACGTGGCNONE 
J065038A14CGCCACGTGGCNONE 
J065187M18CGCCACGTGGCNONE 
J065205M17CGCCACGTGGCNONE 
J080301G10CGCCACGTGGCNONE 
J080311I12CGCCACGTGGCNONE 
J080311O19CGCCACGTGGCNONE 
J080312C16CGCCACGTGGCNONE 
J080317L04CGCCACGTGGCNONE 
J090027H09CGCCACGTGGCNONE 
J090053F07CGCCACGTGGCNONE 
J090055C23CGCCACGTGGCNONE 
J090071A18CGCCACGTGGCNONE 
J090084O10CGCCACGTGGCNONE 
J090091C23CGCCACGTGGCNONE 
J090093J04CGCCACGTGGCNONE 
J100061N06CGCCACGTGGCNONE 
J100070P06CGCCACGTGGCNONE 
J100074K15CGCCACGTGGCNONE 
Os08g0128200AK120428CACGCCACGTGTCCConserved hypothetical protein. 
Os08g0138500AK102951CACGTGGCGCCACGTSimilar to Helix-loop-helix-like protein (Fragment). 
AY224458CACGTGGCGCCACGTNONE 
J033115D14CACGTGGCGCCACGTNONE 
J065013F04CACGTGGCGCCACGTNONE 
J065050P11CACGTGGCGCCACGTNONE 
J065063K18CACGTGGCGCCACGTNONE 
J090054H10CACGTGGCGCCACGTNONE 
J100083F11CACGTGGCGCCACGTNONE 
Os08g0155100AK069865CGCCACGTCACGCCTCGCCCMajor sperm protein domain containing protein. 
AK104886CGCCACGTCACGCCTCGCCCNONE 
J013089M01CGCCACGTCACGCCTCGCCCNONE 
J023037M15CGCCACGTCACGCCTCGCCCNONE 
J033068E03CGCCACGTCACGCCTCGCCCNONE 
J090021P19CGCCACGTCACGCCTCGCCCNONE 
Os08g0183900J043001P15CGCCACGTGGCNONE 
J065080M03CGCCACGTGGCNONE 
J065215I09CGCCACGTGGCNAD-dependent epimerase/dehydratase family protein. 
Os08g0192800AK059490CGCCACGTGTCGNONE 
AK101678CGCCACGTGTCGNONE 
AK120613CGCCACGTGTCGBromodomain containing protein. 
J080039B22CGCCACGTGTCGNONE 
J080039I23CGCCACGTGTCGNONE 
J080074D19CGCCACGTGTCGNONE 
J080086N13CGCCACGTGTCGNONE 
Os08g0200300005-007-C01CGCCACGTGGCGNONE 
009-041-H05CGCCACGTGGCGNONE 
009-055-G10CGCCACGTGGCGNONE 
009-101-E05CGCCACGTGGCGNONE 
009-110-H11CGCCACGTGGCGNONE 
009-114-D06CGCCACGTGGCGNONE 
009-116-B08CGCCACGTGGCGNONE 
009-117-G06CGCCACGTGGCGNONE 
009-125-H04CGCCACGTGGCGNONE 
009-131-H10CGCCACGTGGCGNONE 
009-136-F02CGCCACGTGGCGNONE 
009-144-C04CGCCACGTGGCGNONE 
009-149-E10CGCCACGTGGCGNONE 
009-166-E04CGCCACGTGGCGNONE 
009-189-G08CGCCACGTGGCGNONE 
AK105055CGCCACGTGGCGNONE 
AK121083CGCCACGTGGCGSimilar to Photosystem II 10 kDa polypeptide (Fragment). 
J013051F20CGCCACGTGGCGNONE 
J013060E15CGCCACGTGGCGNONE 
J013070F24CGCCACGTGGCGNONE 
J013071K15CGCCACGTGGCGNONE 
J013091E11CGCCACGTGGCGNONE 
J013134L03CGCCACGTGGCGNONE 
J023063I15CGCCACGTGGCGNONE 
J023084E22CGCCACGTGGCGNONE 
J023084J06CGCCACGTGGCGNONE 
J033090D12CGCCACGTGGCGNONE 
J065001D08CGCCACGTGGCGNONE 
J065007K04CGCCACGTGGCGNONE 
J065040H06CGCCACGTGGCGNONE 
J065078N14CGCCACGTGGCGNONE 
J065093B19CGCCACGTGGCGNONE 
J065103D10CGCCACGTGGCGNONE 
J065107E16CGCCACGTGGCGNONE 
J065116E01CGCCACGTGGCGNONE 
J065129B10CGCCACGTGGCGNONE 
J065132F08CGCCACGTGGCGNONE 
J065135M15CGCCACGTGGCGNONE 
J065149C13CGCCACGTGGCGNONE 
J065155H23CGCCACGTGGCGNONE 
J065162P16CGCCACGTGGCGNONE 
J065169P09CGCCACGTGGCGNONE 
J065176B09CGCCACGTGGCGNONE 
J065187F07CGCCACGTGGCGNONE 
J065194H08CGCCACGTGGCGNONE 
J065197G22CGCCACGTGGCGNONE 
J065208D12CGCCACGTGGCGNONE 
J065210B17CGCCACGTGGCGNONE 
J065219D24CGCCACGTGGCGNONE 
J075009C14CGCCACGTGGCGNONE 
J075009O22CGCCACGTGGCGNONE 
J075012J06CGCCACGTGGCGNONE 
J075014G03CGCCACGTGGCGNONE 
J075015A03CGCCACGTGGCGNONE 
J075022B09CGCCACGTGGCGNONE 
J075023H11CGCCACGTGGCGNONE 
J075025J07CGCCACGTGGCGNONE 
J075026K15CGCCACGTGGCGNONE 
J075029D06CGCCACGTGGCGNONE 
J075038G19CGCCACGTGGCGNONE 
J075041N03CGCCACGTGGCGNONE 
J075048P22CGCCACGTGGCGNONE 
J075051J23CGCCACGTGGCGNONE 
J075051L15CGCCACGTGGCGNONE 
J075052P04CGCCACGTGGCGNONE 
J075058O21CGCCACGTGGCGNONE 
J075062E03CGCCACGTGGCGNONE 
J075063K18CGCCACGTGGCGNONE 
J075064K01CGCCACGTGGCGNONE 
J075067B03CGCCACGTGGCGNONE 
J075070I20CGCCACGTGGCGNONE 
J075071J04CGCCACGTGGCGNONE 
J075074F17CGCCACGTGGCGNONE 
J075076H02CGCCACGTGGCGNONE 
J075080E17CGCCACGTGGCGNONE 
J075081F04CGCCACGTGGCGNONE 
J075086K17CGCCACGTGGCGNONE 
J075090I07CGCCACGTGGCGNONE 
J075092F21CGCCACGTGGCGNONE 
J075096P11CGCCACGTGGCGNONE 
J075099K15CGCCACGTGGCGNONE 
J075102M12CGCCACGTGGCGNONE 
J075105B03CGCCACGTGGCGNONE 
J075110I07CGCCACGTGGCGNONE 
J075111C15CGCCACGTGGCGNONE 
J075111M09CGCCACGTGGCGNONE 
J075114I06CGCCACGTGGCGNONE 
J075115E15CGCCACGTGGCGNONE 
J075123K17CGCCACGTGGCGNONE 
J075125B03CGCCACGTGGCGNONE 
J075126A12CGCCACGTGGCGNONE 
J075129L20CGCCACGTGGCGNONE 
J075130B11CGCCACGTGGCGNONE 
J075137J12CGCCACGTGGCGNONE 
J075141G10CGCCACGTGGCGNONE 
J075141I06CGCCACGTGGCGNONE 
J075143A22CGCCACGTGGCGNONE 
J075148E07CGCCACGTGGCGNONE 
J075158D09CGCCACGTGGCGNONE 
J075168G18CGCCACGTGGCGNONE 
J075169K08CGCCACGTGGCGNONE 
J075170A10CGCCACGTGGCGNONE 
J075170E18CGCCACGTGGCGNONE 
J075179C15CGCCACGTGGCGNONE 
J075180L24CGCCACGTGGCGNONE 
J075181A22CGCCACGTGGCGNONE 
J075185C20CGCCACGTGGCGNONE 
J075191B07CGCCACGTGGCGNONE 
J075192D03CGCCACGTGGCGNONE 
J075192L04CGCCACGTGGCGNONE 
J075193G10CGCCACGTGGCGNONE 
J075193M18CGCCACGTGGCGNONE 
J075198F05CGCCACGTGGCGNONE 
J080001F14CGCCACGTGGCGNONE 
J080001J20CGCCACGTGGCGNONE 
J080002N10CGCCACGTGGCGNONE 
J080003I15CGCCACGTGGCGNONE 
J080004H05CGCCACGTGGCGNONE 
J080006J08CGCCACGTGGCGNONE 
J080007D08CGCCACGTGGCGNONE 
J080008B21CGCCACGTGGCGNONE 
J080009P16CGCCACGTGGCGNONE 
J080010F24CGCCACGTGGCGNONE 
J080011F18CGCCACGTGGCGNONE 
J080012J03CGCCACGTGGCGNONE 
J080013B21CGCCACGTGGCGNONE 
J080013N24CGCCACGTGGCGNONE 
J080017D22CGCCACGTGGCGNONE 
J080017E04CGCCACGTGGCGNONE 
J080018G06CGCCACGTGGCGNONE 
J080020M24CGCCACGTGGCGNONE 
J080021C22CGCCACGTGGCGNONE 
J080021E21CGCCACGTGGCGNONE 
J080021G12CGCCACGTGGCGNONE 
J080021N20CGCCACGTGGCGNONE 
J080022B02CGCCACGTGGCGNONE 
J080022D19CGCCACGTGGCGNONE 
J080024J07CGCCACGTGGCGNONE 
J080026M20CGCCACGTGGCGNONE 
J080028D11CGCCACGTGGCGNONE 
J080029E08CGCCACGTGGCGNONE 
J080030F06CGCCACGTGGCGNONE 
J080030J09CGCCACGTGGCGNONE 
J080032F19CGCCACGTGGCGNONE 
J080032L09CGCCACGTGGCGNONE 
J080032O15CGCCACGTGGCGNONE 
J080034J07CGCCACGTGGCGNONE 
J080035A04CGCCACGTGGCGNONE 
J080035A12CGCCACGTGGCGNONE 
J080037P21CGCCACGTGGCGNONE 
J080040F18CGCCACGTGGCGNONE 
J080040N13CGCCACGTGGCGNONE 
J080040P12CGCCACGTGGCGNONE 
J080041E09CGCCACGTGGCGNONE 
J080044A04CGCCACGTGGCGNONE 
J080044F21CGCCACGTGGCGNONE 
J080044P20CGCCACGTGGCGNONE 
J080045N06CGCCACGTGGCGNONE 
J080046H12CGCCACGTGGCGNONE 
J080047A12CGCCACGTGGCGNONE 
J080047O03CGCCACGTGGCGNONE 
J080047O20CGCCACGTGGCGNONE 
J080048G24CGCCACGTGGCGNONE 
J080049H08CGCCACGTGGCGNONE 
J080050G23CGCCACGTGGCGNONE 
J080050P05CGCCACGTGGCGNONE 
J080052J24CGCCACGTGGCGNONE 
J080056N20CGCCACGTGGCGNONE 
J080056O04CGCCACGTGGCGNONE 
J080058D10CGCCACGTGGCGNONE 
J080058G13CGCCACGTGGCGNONE 
J080059H10CGCCACGTGGCGNONE 
J080062G11CGCCACGTGGCGNONE 
J080064A12CGCCACGTGGCGNONE 
J080064E18CGCCACGTGGCGNONE 
J080064O19CGCCACGTGGCGNONE 
J080065F09CGCCACGTGGCGNONE 
J080065P22CGCCACGTGGCGNONE 
J080067A17CGCCACGTGGCGNONE 
J080067E09CGCCACGTGGCGNONE 
J080069M22CGCCACGTGGCGNONE 
J080070E21CGCCACGTGGCGNONE 
J080070K18CGCCACGTGGCGNONE 
J080071L21CGCCACGTGGCGNONE 
J080071P04CGCCACGTGGCGNONE 
J080072M02CGCCACGTGGCGNONE 
J080075K15CGCCACGTGGCGNONE 
J080075K19CGCCACGTGGCGNONE 
J080076L03CGCCACGTGGCGNONE 
J080079L23CGCCACGTGGCGNONE 
J080080O08CGCCACGTGGCGNONE 
J080081H06CGCCACGTGGCGNONE 
J080082L22CGCCACGTGGCGNONE 
J080083N23CGCCACGTGGCGNONE 
J080084J09CGCCACGTGGCGNONE 
J080085B01CGCCACGTGGCGNONE 
J080087M23CGCCACGTGGCGNONE 
J080088P08CGCCACGTGGCGNONE 
J080090A20CGCCACGTGGCGNONE 
J080092J18CGCCACGTGGCGNONE 
J080095G03CGCCACGTGGCGNONE 
J080097C14CGCCACGTGGCGNONE 
J080097P20CGCCACGTGGCGNONE 
J080301E13CGCCACGTGGCGNONE 
J080301G11CGCCACGTGGCGNONE 
J080301I11CGCCACGTGGCGNONE 
J080301O21CGCCACGTGGCGNONE 
J080302L09CGCCACGTGGCGNONE 
J080303E17CGCCACGTGGCGNONE 
J080304C05CGCCACGTGGCGNONE 
J080305E22CGCCACGTGGCGNONE 
J080305F22CGCCACGTGGCGNONE 
J080307B14CGCCACGTGGCGNONE 
J080310B22CGCCACGTGGCGNONE 
J080310J02CGCCACGTGGCGNONE 
J080312N01CGCCACGTGGCGNONE 
J080313I10CGCCACGTGGCGNONE 
J080315K16CGCCACGTGGCGNONE 
J080317B08CGCCACGTGGCGNONE 
J080317H10CGCCACGTGGCGNONE 
J080317M14CGCCACGTGGCGNONE 
J080317P17CGCCACGTGGCGNONE 
J080319M22CGCCACGTGGCGNONE 
J090052E23CGCCACGTGGCGNONE 
J090071I04CGCCACGTGGCGNONE 
J100045L08CGCCACGTGGCGNONE 
J100068N19CGCCACGTGGCGNONE 
U86018CGCCACGTGGCGNONE 
Os08g0205700009-047-A11CGCCACGTGNONE 
009-167-C10CGCCACGTGNONE 
014-088-E02CGCCACGTGNONE 
J065029D05CGCCACGTGNONE 
J065096A14CGCCACGTGNONE 
J065118E14CGCCACGTGNONE 
J065186J24CGCCACGTGNONE 
J065199O09CGCCACGTGNONE 
J100060I06CGCCACGTGNONE 
Os08g0206600AK064336CGCCACGTCAICARFT/IMPCHase bienzyme family protein. 
AK102764CGCCACGTCNONE 
Os08g0207500AB126089CACGCCACGTNONE 
AK105258CACGCCACGTSimilar to Zinc transporter ZIP1 (Fragment). 
Os08g0267900AK107040CGCCACGTCConserved hypothetical protein. 
Os08g0301500AK101676ACGTGGCGSimilar to Sucrose-phosphate synthase 2 (EC 2.4.1.14) (Fragment). 
Os08g0360100AK066365CCTGTCAGCGCCACGTCRS1/YhbY domain containing protein. 
Os08g0398700AK120068ACACGTGGCGPeptidase M1, membrane alanine aminopeptidase family protein. 
Os08g0416100AK070406CGCCACGTCGGATDEAD/DEAH box helicase, N-terminal domain containing protein. 
AY644647CGCCACGTCGGATNONE 
Os08g0439900AK110628CGCCACGTCMitochondrial glycoprotein family protein. 
J065118D13CGCCACGTCNONE 
Os08g0461800012-071-E12CGCCACGTCNONE 
AK066516CGCCACGTCNONE 
AK067364CGCCACGTCConserved hypothetical protein. 
AK098966CGCCACGTCNONE 
Os08g0469600009-080-H09ACGTGGCGNONE 
009-080-H09GACGTGGCGNONE 
AK062647ACGTGGCGConserved hypothetical protein. 
AK062647GACGTGGCGConserved hypothetical protein. 
Os08g0475100AK105839CGCCACGTEsterase/lipase/thioesterase domain containing protein. 
Os08g0481500J065054C23CGCCACGTCConserved hypothetical protein. 
J065218E06CGCCACGTCNONE 
Os08g0520000012-098-B03CGCCACGTCNONE 
015-016-E04CGCCACGTCNONE 
AK063556CGCCACGTCMitochondrial substrate carrier family protein. 
Os08g0521600AK108208CGCCACGTGTCCSimilar to Dehydration responsive element binding protein 2C (DREB2C protein). 
Os08g0549300009-008-F01CGCCACGTGGGCCCCACCNONE 
009-033-G10CGCCACGTGGGCCCCACCNONE 
AK120938CGCCACGTGGGCCCCACCSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420CGCCACGTGGGCCCCACCNONE 
J023037A21CGCCACGTGGGCCCCACCNONE 
J023066D20CGCCACGTGGGCCCCACCNONE 
J033099K13CGCCACGTGGGCCCCACCNONE 
J065116C14CGCCACGTGGGCCCCACCNONE 
J075009K15CGCCACGTGGGCCCCACCNONE 
J075071P13CGCCACGTGGGCCCCACCNONE 
J075080D18CGCCACGTGGGCCCCACCNONE 
J075124F24CGCCACGTGGGCCCCACCNONE 
J075198F23CGCCACGTGGGCCCCACCNONE 
J080006B15CGCCACGTGGGCCCCACCNONE 
J090078H13CGCCACGTGGGCCCCACCNONE 
J090089J09CGCCACGTGGGCCCCACCNONE 
J100017A03CGCCACGTGGGCCCCACCNONE 
J100023G03CGCCACGTGGGCCCCACCNONE 
Os08g0553800006-058-A04GACGTGGCGNONE 
006-061-F09GACGTGGCGNONE 
AK065711GACGTGGCGNONE 
AK066697GACGTGGCGNmrA-like family protein. 
AK073638GACGTGGCGNONE 
AK104428GACGTGGCGNONE 
AK105897GACGTGGCGNONE 
J075001A06GACGTGGCGNONE 
J075041H20GACGTGGCGNONE 
J075123J24GACGTGGCGNONE 
Os08g0558000J080005K14CGCCACGTGGCGNONE 
Os08g0565200AK108143CACGCCACGTCPathogenesis-related transcriptional factor and ERF domain containing protein. 
AK108143GCCACGTGGCGPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os09g0240200AB001887CGCCACGTZinc finger, CONSTANS-type domain containing protein. 
Os09g0243200AK107718ACACGTGGCGZinc finger, RING-type domain containing protein. 
Os09g0296800AK066997CGCCACGTGTCCGTCCCACCChlorophyll A-B binding protein family protein. 
Os09g0307800AK060843CGCCACGTNuclear protein SET domain containing protein. 
Os09g0325700011-041-G03ACGTGGCGNONE 
AK063334ACGTGGCGSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24ACGTGGCGNONE 
Os09g0394300AK105580GGTGACGTGGCGGlycoside hydrolase, family 9 protein. 
J100046E13GGTGACGTGGCGNONE 
J100049L10GGTGACGTGGCGNONE 
J100074H21GGTGACGTGGCGNONE 
J100090G03GGTGACGTGGCGNONE 
Os09g0401200AK063980CGCCACGTCSimilar to HSP associated protein like. 
Os09g0403000AK111051CGCCACGTConserved hypothetical protein. 
Os09g0433000AK069858CACGTGGCGGlycosyl transferase, family 31 protein. 
Os09g0434600AK069042ACGTGGCGConserved hypothetical protein. 
AK071264ACGTGGCGNONE 
J023079H14ACGTGGCGNONE 
J023082P06ACGTGGCGNONE 
J023083M07ACGTGGCGNONE 
J023089M10ACGTGGCGNONE 
J023145P18ACGTGGCGNONE 
Os09g0444700AK120833CGCCACGTCMitochondrial substrate carrier family protein. 
J100039B19CGCCACGTCNONE 
Os09g0447900AK111436CGCCACGTCConserved hypothetical protein. 
Os09g0451500AK062254GACGTGGCGThioredoxin domain 2 containing protein. 
AK072941GACGTGGCGNONE 
Os09g0456100AK072474CGCCACGTCRemorin, C-terminal region domain containing protein. 
J023121I15CGCCACGTCNONE 
J033057H08CGCCACGTCNONE 
Os09g0456200015-025-E01CTCGCGCGCCACGTNONE 
AK065873CTCGCGCGCCACGTSimilar to BZIP transcription factor ABI5. 
J013049N23CTCGCGCGCCACGTNONE 
J033128E10CTCGCGCGCCACGTNONE 
Os09g0476100AK099938CGCCACGTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0481200005-016-B10CGCCACGTCACCNONE 
009-011-E05CGCCACGTCACCNONE 
009-045-E02CGCCACGTCACCNONE 
009-049-A02CGCCACGTCACCNONE 
009-055-H07CGCCACGTCACCNONE 
009-067-E08CGCCACGTCACCNONE 
009-068-G08CGCCACGTCACCNONE 
009-076-E11CGCCACGTCACCNONE 
009-077-E02CGCCACGTCACCNONE 
009-085-H03CGCCACGTCACCNONE 
009-088-C06CGCCACGTCACCNONE 
009-088-D07CGCCACGTCACCNONE 
009-098-A03CGCCACGTCACCNONE 
009-100-B03CGCCACGTCACCNONE 
009-105-H04CGCCACGTCACCNONE 
009-108-D08CGCCACGTCACCNONE 
009-110-E02CGCCACGTCACCNONE 
009-114-F08CGCCACGTCACCNONE 
009-118-A09CGCCACGTCACCNONE 
009-118-C10CGCCACGTCACCNONE 
009-120-F08CGCCACGTCACCNONE 
009-123-B07CGCCACGTCACCNONE 
009-126-F11CGCCACGTCACCNONE 
009-131-D02CGCCACGTCACCNONE 
009-132-F11CGCCACGTCACCNONE 
009-133-H07CGCCACGTCACCNONE 
009-134-B03CGCCACGTCACCNONE 
009-135-D08CGCCACGTCACCNONE 
009-138-E07CGCCACGTCACCNONE 
009-138-G03CGCCACGTCACCNONE 
009-140-E05CGCCACGTCACCNONE 
009-143-B06CGCCACGTCACCNONE 
009-144-D01CGCCACGTCACCNONE 
009-147-D09CGCCACGTCACCNONE 
009-149-C09CGCCACGTCACCNONE 
009-150-F10CGCCACGTCACCNONE 
009-151-E10CGCCACGTCACCNONE 
009-151-H10CGCCACGTCACCNONE 
009-154-A08CGCCACGTCACCNONE 
009-154-D03CGCCACGTCACCNONE 
009-155-B09CGCCACGTCACCNONE 
009-163-E08CGCCACGTCACCNONE 
009-163-G11CGCCACGTCACCNONE 
009-165-B06CGCCACGTCACCNONE 
009-165-C12CGCCACGTCACCNONE 
009-165-H07CGCCACGTCACCNONE 
009-167-D02CGCCACGTCACCNONE 
009-175-F08CGCCACGTCACCNONE 
009-177-H04CGCCACGTCACCNONE 
009-177-H08CGCCACGTCACCNONE 
009-178-B09CGCCACGTCACCNONE 
009-184-E07CGCCACGTCACCNONE 
009-186-F09CGCCACGTCACCNONE 
009-188-H01CGCCACGTCACCNONE 
009-191-G10CGCCACGTCACCNONE 
009-192-C08CGCCACGTCACCNONE 
009-192-D06CGCCACGTCACCNONE 
009-195-H11CGCCACGTCACCNONE 
009-197-C06CGCCACGTCACCNONE 
AK061695CGCCACGTCACCNONE 
AK098847CGCCACGTCACCSimilar to Photosystem I reaction center subunit V (PSI-G) (Photosystem I 9 kDa protein) (Fragment). 
J013000C21CGCCACGTCACCNONE 
J065026J24CGCCACGTCACCNONE 
J065038L06CGCCACGTCACCNONE 
J065059E08CGCCACGTCACCNONE 
J065059N21CGCCACGTCACCNONE 
J065066H14CGCCACGTCACCNONE 
J065112H14CGCCACGTCACCNONE 
J065152I16CGCCACGTCACCNONE 
J065152L16CGCCACGTCACCNONE 
J065179N13CGCCACGTCACCNONE 
J065198E01CGCCACGTCACCNONE 
J075002I24CGCCACGTCACCNONE 
J075021G08CGCCACGTCACCNONE 
J075023N02CGCCACGTCACCNONE 
J075031C09CGCCACGTCACCNONE 
J075032G16CGCCACGTCACCNONE 
J075083F07CGCCACGTCACCNONE 
J075086P19CGCCACGTCACCNONE 
J075094D01CGCCACGTCACCNONE 
J075127I02CGCCACGTCACCNONE 
J075176I18CGCCACGTCACCNONE 
J100029F21CGCCACGTCACCNONE 
J100031P15CGCCACGTCACCNONE 
J100049C10CGCCACGTCACCNONE 
J100089B21CGCCACGTCACCNONE 
Os09g0484900AK067836GACGTGGCGSodium/sulphate symporter family protein. 
AK105756GACGTGGCGNONE 
Os09g0512900006-066-A10CGCCACGTNONE 
AK061814CGCCACGTConserved hypothetical protein. 
AK066925CGCCACGTNONE 
AK104595CGCCACGTNONE 
J013092F14CGCCACGTNONE 
J023148N20CGCCACGTNONE 
J033131F06CGCCACGTNONE 
J053025L20CGCCACGTNONE 
J075003B20CGCCACGTNONE 
J075019N18CGCCACGTNONE 
J075032D10CGCCACGTNONE 
J075037G14CGCCACGTNONE 
J075098D24CGCCACGTNONE 
J075106M13CGCCACGTNONE 
J075122N14CGCCACGTNONE 
J075146E22CGCCACGTNONE 
J075187E06CGCCACGTNONE 
J075198I17CGCCACGTNONE 
J090023O05CGCCACGTNONE 
J100040E10CGCCACGTNONE 
J100080P12CGCCACGTNONE 
J100088B06CGCCACGTNONE 
Os09g0516300AK065222CGCCACGTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0535000AK058712GACGTGGCGSimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488GACGTGGCGNONE 
AK069832GACGTGGCGNONE 
J100065D20GACGTGGCGNONE 
Os09g0539100AK071977CGCCACGTCSimilar to 3-dehydroquinate synthase-like protein. 
AK098959CGCCACGTCNONE 
Os09g0551600005-020-H08CGGATCGGTGACGTGGCGNONE 
006-043-E02CGGATCGGTGACGTGGCGNONE 
013-043-F03CGGATCGGTGACGTGGCGNONE 
AK066658CGGATCGGTGACGTGGCGSimilar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101). 
J013071N11CGGATCGGTGACGTGGCGNONE 
J065177J20CGGATCGGTGACGTGGCGNONE 
J075041D06CGGATCGGTGACGTGGCGNONE 
J075199H24CGGATCGGTGACGTGGCGNONE 
J080001G07CGGATCGGTGACGTGGCGNONE 
J080024A12CGGATCGGTGACGTGGCGNONE 
J080025B15CGGATCGGTGACGTGGCGNONE 
J090017G07CGGATCGGTGACGTGGCGNONE 
J090050G23CGGATCGGTGACGTGGCGNONE 
J090083G11CGGATCGGTGACGTGGCGNONE 
Os09g0553200003-101-F12CGCCACGTGTCCNONE 
003-125-E09CGCCACGTGTCCNONE 
011-031-H12CGCCACGTGTCCNONE 
012-033-A01CGCCACGTGTCCNONE 
015-046-H04CGCCACGTGTCCNONE 
015-056-F04CGCCACGTGTCCNONE 
016-029-H06CGCCACGTGTCCNONE 
016-080-D05CGCCACGTGTCCNONE 
AB062606CGCCACGTGTCCNONE 
AK065780CGCCACGTGTCCSimilar to UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) (UDP-glucose pyrophosphorylase) (UDPGP) (UGPase). 
AK103930CGCCACGTGTCCNONE 
AK104344CGCCACGTGTCCNONE 
AK119197CGCCACGTGTCCNONE 
AK119232CGCCACGTGTCCNONE 
J013039M01CGCCACGTGTCCNONE 
J013043M01CGCCACGTGTCCNONE 
J013064F03CGCCACGTGTCCNONE 
J013066K19CGCCACGTGTCCNONE 
J013092G12CGCCACGTGTCCNONE 
J013123P09CGCCACGTGTCCNONE 
J013155F01CGCCACGTGTCCNONE 
J013158J12CGCCACGTGTCCNONE 
J013159H14CGCCACGTGTCCNONE 
J013169C10CGCCACGTGTCCNONE 
J013170L23CGCCACGTGTCCNONE 
J023010J18CGCCACGTGTCCNONE 
J023019E23CGCCACGTGTCCNONE 
J023045B14CGCCACGTGTCCNONE 
J023082K24CGCCACGTGTCCNONE 
J023086G04CGCCACGTGTCCNONE 
J023090N09CGCCACGTGTCCNONE 
J023113C08CGCCACGTGTCCNONE 
J023125H18CGCCACGTGTCCNONE 
J033034M08CGCCACGTGTCCNONE 
J033035K03CGCCACGTGTCCNONE 
J033039D15CGCCACGTGTCCNONE 
J033045P18CGCCACGTGTCCNONE 
J033058P08CGCCACGTGTCCNONE 
J033061D16CGCCACGTGTCCNONE 
J033070F14CGCCACGTGTCCNONE 
J033086F23CGCCACGTGTCCNONE 
J033095C05CGCCACGTGTCCNONE 
J033114H22CGCCACGTGTCCNONE 
J033133M20CGCCACGTGTCCNONE 
J043026G01CGCCACGTGTCCNONE 
J043037F17CGCCACGTGTCCNONE 
J065120K17CGCCACGTGTCCNONE 
J065123O07CGCCACGTGTCCNONE 
J080305H06CGCCACGTGTCCNONE 
J090001F11CGCCACGTGTCCNONE 
J090020C17CGCCACGTGTCCNONE 
J090043A19CGCCACGTGTCCNONE 
J090051J17CGCCACGTGTCCNONE 
J090068K06CGCCACGTGTCCNONE 
J090075P19CGCCACGTGTCCNONE 
J100036G10CGCCACGTGTCCNONE 
J100084F02CGCCACGTGTCCNONE 
Os11g0116400AK059833ACGTGGCGSimilar to Elongation factor P (EF-P). 
Os11g0180000006-025-E11CGCCACGTGTCGNONE 
006-044-A07CGCCACGTGTCGNONE 
AK060077CGCCACGTGTCGPlant disease resistance response protein family protein. 
Os11g0229100AK105557GACGTGGCGConserved hypothetical protein. 
AK105557GACGTGGCGConserved hypothetical protein. 
Os11g0256200AK107906CGCCACGTCProtein of unknown function DUF842, eukaryotic family protein. 
J065007J01CGCCACGTCNONE 
J065167G22CGCCACGTCNONE 
J075001G14CGCCACGTCNONE 
J075121L13CGCCACGTCNONE 
Os11g0291500AK108558ACACGTGGCGTGSimilar to Beta-D-xylosidase. 
Os11g0297800AK109882GCCACGTGGCGSimilar to Beta-D-xylosidase. 
Os11g0303800AK068654CCACGGCCGCCACGTConserved hypothetical protein. 
J075084L14CCACGGCCGCCACGTNONE 
Os11g0447300AK108044CGCCACGTCGTP-binding protein, HSR1-related domain containing protein. 
Os11g0453900AK109096ACGTGGCGDehydrin RAB 16D. 
Os11g0454000AK071366ACGTGGCGDehydrin RAB 16C. 
J075179D17ACGTGGCGNONE 
Os11g0454300009-010-F05ACGTGGCGNONE 
011-073-B07ACGTGGCGNONE 
011-089-D03ACGTGGCGNONE 
012-041-B07ACGTGGCGNONE 
012-042-D12ACGTGGCGNONE 
012-046-G11ACGTGGCGNONE 
012-072-D10ACGTGGCGNONE 
012-090-F06ACGTGGCGNONE 
013-009-A10ACGTGGCGNONE 
013-096-B03ACGTGGCGNONE 
014-002-F10ACGTGGCGNONE 
014-006-A10ACGTGGCGNONE 
014-006-C05ACGTGGCGNONE 
014-006-E01ACGTGGCGNONE 
014-006-H04ACGTGGCGNONE 
014-009-D05ACGTGGCGNONE 
014-010-D07ACGTGGCGNONE 
014-012-A10ACGTGGCGNONE 
014-013-F08ACGTGGCGNONE 
014-014-D01ACGTGGCGNONE 
014-016-D07ACGTGGCGNONE 
014-020-F09ACGTGGCGNONE 
014-023-C07ACGTGGCGNONE 
014-024-A03ACGTGGCGNONE 
014-025-D11ACGTGGCGNONE 
014-027-D02ACGTGGCGNONE 
014-030-F11ACGTGGCGNONE 
014-032-H06ACGTGGCGNONE 
014-034-D06ACGTGGCGNONE 
014-037-E04ACGTGGCGNONE 
014-038-C02ACGTGGCGNONE 
014-041-B08ACGTGGCGNONE 
014-044-A10ACGTGGCGNONE 
014-045-C11ACGTGGCGNONE 
014-046-B04ACGTGGCGNONE 
014-047-D01ACGTGGCGNONE 
014-053-C03ACGTGGCGNONE 
014-053-C09ACGTGGCGNONE 
014-072-D09ACGTGGCGNONE 
014-073-D09ACGTGGCGNONE 
014-073-F01ACGTGGCGNONE 
014-081-B04ACGTGGCGNONE 
014-081-G07ACGTGGCGNONE 
014-084-C10ACGTGGCGNONE 
014-084-F03ACGTGGCGNONE 
014-085-D08ACGTGGCGNONE 
014-087-H10ACGTGGCGNONE 
014-095-E02ACGTGGCGNONE 
014-095-G07ACGTGGCGNONE 
AK121952ACGTGGCGSimilar to Water-stress inducible protein RAB21. 
J033107K14ACGTGGCGNONE 
J065021B08ACGTGGCGNONE 
J065059D24ACGTGGCGNONE 
J065066D13ACGTGGCGNONE 
J065070K11ACGTGGCGNONE 
J065081I18ACGTGGCGNONE 
J065120F19ACGTGGCGNONE 
J065186M13ACGTGGCGNONE 
J075031E22ACGTGGCGNONE 
J075046F04ACGTGGCGNONE 
J075069L13ACGTGGCGNONE 
J075097G09ACGTGGCGNONE 
J075099C23ACGTGGCGNONE 
J075149N21ACGTGGCGNONE 
J075150G23ACGTGGCGNONE 
J075170K09ACGTGGCGNONE 
J075173A09ACGTGGCGNONE 
J075177C21ACGTGGCGNONE 
Os11g0501000AK109615CGCCACGTGTCConserved hypothetical protein. 
Os11g0533400014-020-B08CGCCACGTGTCNONE 
AK063652CGCCACGTGTCConserved hypothetical protein. 
Os11g0550900015-031-H10CGCCACGTNONE 
AK106291CGCCACGTConserved hypothetical protein. 
Os11g0616200AK069189TCTCGGCCGCCACGTConserved hypothetical protein. 
J023004N19TCTCGGCCGCCACGTNONE 
Os11g0652600J065013C09CGCCACGTNONE 
J065014D21CGCCACGTConserved hypothetical protein. 
J065027P08CGCCACGTNONE 
J065029L24CGCCACGTNONE 
J065102M02CGCCACGTNONE 
J065104G24CGCCACGTNONE 
J065139D12CGCCACGTNONE 
J065140N17CGCCACGTNONE 
Os11g0660700014-077-B05CGCCACGTCNONE 
AK063723CGCCACGTCConserved hypothetical protein. 
J080302H08CGCCACGTCNONE 
J080303C05CGCCACGTCNONE 
J080306B05CGCCACGTCNONE 
J080310K22CGCCACGTCNONE 
Os11g0707000003-106-C01CGCCACGTGTNONE 
003-130-G06CGCCACGTGTNONE 
005-012-E05CGCCACGTGTNONE 
006-021-F04CGCCACGTGTNONE 
006-031-E07CGCCACGTGTNONE 
006-035-C03CGCCACGTGTNONE 
006-038-D10CGCCACGTGTNONE 
006-043-A10CGCCACGTGTNONE 
006-043-G08CGCCACGTGTNONE 
006-046-C03CGCCACGTGTNONE 
006-055-G09CGCCACGTGTNONE 
006-085-A03CGCCACGTGTNONE 
006-118-E05CGCCACGTGTNONE 
AB034698CGCCACGTGTNONE 
AB034748CGCCACGTGTNONE 
AB110180CGCCACGTGTNONE 
AK060841CGCCACGTGTNONE 
AK060847CGCCACGTGTNONE 
AK064986CGCCACGTGTNONE 
AK104332CGCCACGTGTSimilar to Ribulose-bisphosphate carboxylase activase (EC 6.3.4.-) (Fragments). 
AK119513CGCCACGTGTNONE 
J013001C24CGCCACGTGTNONE 
J013024I02CGCCACGTGTNONE 
J013044O11CGCCACGTGTNONE 
J013048O10CGCCACGTGTNONE 
J013051A08CGCCACGTGTNONE 
J013055H23CGCCACGTGTNONE 
J013070N15CGCCACGTGTNONE 
J013074C16CGCCACGTGTNONE 
J013096P16CGCCACGTGTNONE 
J013109A14CGCCACGTGTNONE 
J013112C07CGCCACGTGTNONE 
J013112N16CGCCACGTGTNONE 
J013123B03CGCCACGTGTNONE 
J013128G01CGCCACGTGTNONE 
J013132L17CGCCACGTGTNONE 
J013158I17CGCCACGTGTNONE 
J013159L01CGCCACGTGTNONE 
J023001H04CGCCACGTGTNONE 
J023004L05CGCCACGTGTNONE 
J023013G12CGCCACGTGTNONE 
J023020K06CGCCACGTGTNONE 
J023031J19CGCCACGTGTNONE 
J023034A05CGCCACGTGTNONE 
J023034E21CGCCACGTGTNONE 
J023041M12CGCCACGTGTNONE 
J023041P06CGCCACGTGTNONE 
J023044C04CGCCACGTGTNONE 
J023047H01CGCCACGTGTNONE 
J023048D08CGCCACGTGTNONE 
J023052H08CGCCACGTGTNONE 
J023054D24CGCCACGTGTNONE 
J023063G11CGCCACGTGTNONE 
J023068O21CGCCACGTGTNONE 
J023074C13CGCCACGTGTNONE 
J023078O06CGCCACGTGTNONE 
J023089K10CGCCACGTGTNONE 
J023100O05CGCCACGTGTNONE 
J023107N16CGCCACGTGTNONE 
J023120L08CGCCACGTGTNONE 
J023123N23CGCCACGTGTNONE 
J023127M10CGCCACGTGTNONE 
J023128C22CGCCACGTGTNONE 
J023129C04CGCCACGTGTNONE 
J023146H08CGCCACGTGTNONE 
J053063N05CGCCACGTGTNONE 
J053066F02CGCCACGTGTNONE 
J053066N18CGCCACGTGTNONE 
J053076G01CGCCACGTGTNONE 
J065012O05CGCCACGTGTNONE 
J065035L06CGCCACGTGTNONE 
J065037M01CGCCACGTGTNONE 
J065045N23CGCCACGTGTNONE 
J065058F09CGCCACGTGTNONE 
J065072E14CGCCACGTGTNONE 
J065073I20CGCCACGTGTNONE 
J065076B05CGCCACGTGTNONE 
J065093B09CGCCACGTGTNONE 
J065117A22CGCCACGTGTNONE 
J065149J21CGCCACGTGTNONE 
J065155M04CGCCACGTGTNONE 
J065161J21CGCCACGTGTNONE 
J065163H19CGCCACGTGTNONE 
J065192A15CGCCACGTGTNONE 
J065211L18CGCCACGTGTNONE 
J075001K13CGCCACGTGTNONE 
J075002J24CGCCACGTGTNONE 
J075004N18CGCCACGTGTNONE 
J075025H21CGCCACGTGTNONE 
J075028F20CGCCACGTGTNONE 
J075039F23CGCCACGTGTNONE 
J075043M08CGCCACGTGTNONE 
J075057D02CGCCACGTGTNONE 
J075059I01CGCCACGTGTNONE 
J075069P10CGCCACGTGTNONE 
J075073D08CGCCACGTGTNONE 
J075084I17CGCCACGTGTNONE 
J075089I04CGCCACGTGTNONE 
J075093O18CGCCACGTGTNONE 
J075097N13CGCCACGTGTNONE 
J075114B02CGCCACGTGTNONE 
J075123E10CGCCACGTGTNONE 
J075128C19CGCCACGTGTNONE 
J075135F05CGCCACGTGTNONE 
J075136A04CGCCACGTGTNONE 
J075141B05CGCCACGTGTNONE 
J075169H18CGCCACGTGTNONE 
J075183L14CGCCACGTGTNONE 
J075191N03CGCCACGTGTNONE 
J080001C11CGCCACGTGTNONE 
J080004F18CGCCACGTGTNONE 
J080004H21CGCCACGTGTNONE 
J080004O09CGCCACGTGTNONE 
J080005J02CGCCACGTGTNONE 
J080006I03CGCCACGTGTNONE 
J080006J17CGCCACGTGTNONE 
J080009I09CGCCACGTGTNONE 
J080010I06CGCCACGTGTNONE 
J080011A17CGCCACGTGTNONE 
J080014N22CGCCACGTGTNONE 
J080016E24CGCCACGTGTNONE 
J080016P08CGCCACGTGTNONE 
J080017G22CGCCACGTGTNONE 
J080017P09CGCCACGTGTNONE 
J080018D23CGCCACGTGTNONE 
J080018E15CGCCACGTGTNONE 
J080020K04CGCCACGTGTNONE 
J080024P09CGCCACGTGTNONE 
J080025G15CGCCACGTGTNONE 
J080025N11CGCCACGTGTNONE 
J080026H10CGCCACGTGTNONE 
J080026N06CGCCACGTGTNONE 
J080027C07CGCCACGTGTNONE 
J080027M21CGCCACGTGTNONE 
J080028I03CGCCACGTGTNONE 
J080028K11CGCCACGTGTNONE 
J080029B19CGCCACGTGTNONE 
J080029G14CGCCACGTGTNONE 
J080029G20CGCCACGTGTNONE 
J080030A16CGCCACGTGTNONE 
J080031C05CGCCACGTGTNONE 
J080033M16CGCCACGTGTNONE 
J080034C24CGCCACGTGTNONE 
J080034F11CGCCACGTGTNONE 
J080036B03CGCCACGTGTNONE 
J080036C14CGCCACGTGTNONE 
J080037C01CGCCACGTGTNONE 
J080038M20CGCCACGTGTNONE 
J080039K03CGCCACGTGTNONE 
J080040M24CGCCACGTGTNONE 
J080040P19CGCCACGTGTNONE 
J080042L24CGCCACGTGTNONE 
J080042O06CGCCACGTGTNONE 
J080043A22CGCCACGTGTNONE 
J080043N19CGCCACGTGTNONE 
J080044A18CGCCACGTGTNONE 
J080044P14CGCCACGTGTNONE 
J080045K12CGCCACGTGTNONE 
J080045N16CGCCACGTGTNONE 
J080047A16CGCCACGTGTNONE 
J080047B09CGCCACGTGTNONE 
J080047E08CGCCACGTGTNONE 
J080047G06CGCCACGTGTNONE 
J080048H04CGCCACGTGTNONE 
J080049B17CGCCACGTGTNONE 
J080049D05CGCCACGTGTNONE 
J080049G23CGCCACGTGTNONE 
J080050D03CGCCACGTGTNONE 
J080050J24CGCCACGTGTNONE 
J080050O20CGCCACGTGTNONE 
J080052E24CGCCACGTGTNONE 
J080052K11CGCCACGTGTNONE 
J080053B04CGCCACGTGTNONE 
J080053D20CGCCACGTGTNONE 
J080053E16CGCCACGTGTNONE 
J080054H20CGCCACGTGTNONE 
J080054H22CGCCACGTGTNONE 
J080054N24CGCCACGTGTNONE 
J080055H08CGCCACGTGTNONE 
J080056H08CGCCACGTGTNONE 
J080056H12CGCCACGTGTNONE 
J080057N11CGCCACGTGTNONE 
J080058D08CGCCACGTGTNONE 
J080058D21CGCCACGTGTNONE 
J080058E10CGCCACGTGTNONE 
J080060J10CGCCACGTGTNONE 
J080061O04CGCCACGTGTNONE 
J080065M18CGCCACGTGTNONE 
J080066D15CGCCACGTGTNONE 
J080067E22CGCCACGTGTNONE 
J080067N20CGCCACGTGTNONE 
J080068F02CGCCACGTGTNONE 
J080069G20CGCCACGTGTNONE 
J080069O13CGCCACGTGTNONE 
J080070I20CGCCACGTGTNONE 
J080071H11CGCCACGTGTNONE 
J080071H17CGCCACGTGTNONE 
J080071O18CGCCACGTGTNONE 
J080077G14CGCCACGTGTNONE 
J080077H17CGCCACGTGTNONE 
J080078B18CGCCACGTGTNONE 
J080078D24CGCCACGTGTNONE 
J080079H02CGCCACGTGTNONE 
J080079J02CGCCACGTGTNONE 
J080081O20CGCCACGTGTNONE 
J080082E02CGCCACGTGTNONE 
J080082N12CGCCACGTGTNONE 
J080084E18CGCCACGTGTNONE 
J080085P08CGCCACGTGTNONE 
J080086B21CGCCACGTGTNONE 
J080086L10CGCCACGTGTNONE 
J080086L18CGCCACGTGTNONE 
J080087D12CGCCACGTGTNONE 
J080087E24CGCCACGTGTNONE 
J080087G12CGCCACGTGTNONE 
J080088J22CGCCACGTGTNONE 
J080090C18CGCCACGTGTNONE 
J080090L02CGCCACGTGTNONE 
J080092N05CGCCACGTGTNONE 
J080092P20CGCCACGTGTNONE 
J080094D15CGCCACGTGTNONE 
J080095A11CGCCACGTGTNONE 
J080095K13CGCCACGTGTNONE 
J080096L16CGCCACGTGTNONE 
J080097F16CGCCACGTGTNONE 
J080305J21CGCCACGTGTNONE 
J080308I22CGCCACGTGTNONE 
J080310E21CGCCACGTGTNONE 
J080310G09CGCCACGTGTNONE 
J090032M14CGCCACGTGTNONE 
J090045I12CGCCACGTGTNONE 
J090076M15CGCCACGTGTNONE 
J090088C17CGCCACGTGTNONE 
J090094B06CGCCACGTGTNONE 
U74321CGCCACGTGTNONE 
Os12g0206700AK071313CGCCACGTGConserved hypothetical protein. 
J065179M24CGCCACGTGNONE 
Os12g0239300006-023-C01GACGTGGCGNONE 
006-024-A12GACGTGGCGNONE 
006-040-H11GACGTGGCGNONE 
006-068-E04GACGTGGCGNONE 
006-089-G07GACGTGGCGNONE 
006-109-H12GACGTGGCGNONE 
012-068-A12GACGTGGCGNONE 
013-031-E05GACGTGGCGNONE 
013-036-C05GACGTGGCGNONE 
013-040-D05GACGTGGCGNONE 
013-051-B07GACGTGGCGNONE 
013-095-C07GACGTGGCGNONE 
AK067904GACGTGGCGConserved hypothetical protein. 
AK109345GACGTGGCGNONE 
J013122E13GACGTGGCGNONE 
J013123H01GACGTGGCGNONE 
J013146H22GACGTGGCGNONE 
J023067C13GACGTGGCGNONE 
J023142F15GACGTGGCGNONE 
J033108D06GACGTGGCGNONE 
J033123M11GACGTGGCGNONE 
J065179L24GACGTGGCGNONE 
J100024G03GACGTGGCGNONE 
J100030G23GACGTGGCGNONE 
Os12g0242500J065129F10CGCCACGTGTNONE 
J090032G12CGCCACGTGTConserved hypothetical protein. 
Os12g0406200004-006-C10CGCCACGTNONE 
AK071037CGCCACGTSimilar to 40S ribosomal protein S3a (CYC07 protein). 
Os12g0437800AK063833CGCCACGTGSimilar to MPI. 
AK121693CGCCACGTGNONE 
AY878693CGCCACGTGNONE 
J065021K01CGCCACGTGNONE 
J065027K12CGCCACGTGNONE 
J065031I22CGCCACGTGNONE 
J065031L17CGCCACGTGNONE 
J065056K14CGCCACGTGNONE 
J065083J01CGCCACGTGNONE 
J065095J18CGCCACGTGNONE 
J065096N19CGCCACGTGNONE 
J065098F20CGCCACGTGNONE 
J065131F07CGCCACGTGNONE 
J065135H05CGCCACGTGNONE 
J065137E03CGCCACGTGNONE 
J065141F13CGCCACGTGNONE 
J065152E02CGCCACGTGNONE 
J065159J20CGCCACGTGNONE 
J065174J02CGCCACGTGNONE 
J065175I19CGCCACGTGNONE 
J065189P13CGCCACGTGNONE 
J065198J01CGCCACGTGNONE 
J065205F13CGCCACGTGNONE 
J065216A18CGCCACGTGNONE 
J100026N16CGCCACGTGNONE 
J100032E21CGCCACGTGNONE 
J100061K15CGCCACGTGNONE 
J100087B09CGCCACGTGNONE 
Os12g0443700AK069541CACGTGGCGSimilar to Glu-prolyl-tRNA aminoacyl synthetase (Fragment). 
AK104881CACGTGGCGNONE 
Os12g0501900AK108423CACGTGGCGConserved hypothetical protein. 
Os12g0577900015-034-E07CGCCACGTGNONE 
AK106299CGCCACGTGProtein prenyltransferase domain containing protein. 
Os12g0604800AK073324CGCCACGTCTetratricopeptide-like helical domain containing protein. 
AK073324CGCCACGTCTetratricopeptide-like helical domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.