version

Summary of OsREG449 (All List)

OrganismOryza sativa  
IDOsREG449  
SequenceACGTGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
ACGT  bZIP-binding motif, environmental responses  
PLACE MotifACGTSSSC  "ABA responsive element (ABRE)" of wheat Em and rice (O.s.) rab21 genes; Proposed consensus sequence for the repeated motif (Em1a and Em1b) of wheat Em gene; S=C/G;  
Total Entry Count1944  

Entry Sequences (1944 entries)

LocusGene modelSequenceDescription
Os01g0132800AK068422TGCGGCCCACGTPeptidyl-tRNA hydrolase family protein. 
Os01g0138900AK058378CACGTGGGCCCACATGTCAGTGMandelate racemase/muconate lactonizing enzyme family protein. 
Os01g0171200AK107515ACGTGGGCCTTGNONE 
AK109475ACGTGGGCCTTGConserved hypothetical protein. 
Os01g0185300011-055-A05CGTGTGGGGCCCACGTGNONE 
015-007-B11CGTGTGGGGCCCACGTGNONE 
015-062-F05CGTGTGGGGCCCACGTGNONE 
015-078-C11CGTGTGGGGCCCACGTGNONE 
016-068-F07CGTGTGGGGCCCACGTGNONE 
016-074-F08CGTGTGGGGCCCACGTGNONE 
AK065131CGTGTGGGGCCCACGTGTransferase family protein. 
AK098922CGTGTGGGGCCCACGTGNONE 
J013000G12CGTGTGGGGCCCACGTGNONE 
J013001P14CGTGTGGGGCCCACGTGNONE 
J013002O23CGTGTGGGGCCCACGTGNONE 
J013096L23CGTGTGGGGCCCACGTGNONE 
J013097F24CGTGTGGGGCCCACGTGNONE 
J013120N24CGTGTGGGGCCCACGTGNONE 
J023007C15CGTGTGGGGCCCACGTGNONE 
J023119O12CGTGTGGGGCCCACGTGNONE 
J033039O11CGTGTGGGGCCCACGTGNONE 
J033043L11CGTGTGGGGCCCACGTGNONE 
J033061A07CGTGTGGGGCCCACGTGNONE 
J033076M13CGTGTGGGGCCCACGTGNONE 
J033082B04CGTGTGGGGCCCACGTGNONE 
J033143H15CGTGTGGGGCCCACGTGNONE 
J043013A02CGTGTGGGGCCCACGTGNONE 
J043036N21CGTGTGGGGCCCACGTGNONE 
J065013M09CGTGTGGGGCCCACGTGNONE 
J065082E22CGTGTGGGGCCCACGTGNONE 
J065093G01CGTGTGGGGCCCACGTGNONE 
J065120L06CGTGTGGGGCCCACGTGNONE 
J065135D03CGTGTGGGGCCCACGTGNONE 
J065197C10CGTGTGGGGCCCACGTGNONE 
J100024J10CGTGTGGGGCCCACGTGNONE 
J100042M22CGTGTGGGGCCCACGTGNONE 
J100077E12CGTGTGGGGCCCACGTGNONE 
J100084P03CGTGTGGGGCCCACGTGNONE 
Os01g0222700012-011-E01GAGGCCCACGTNONE 
AK068883GAGGCCCACGTNONE 
AK101946GAGGCCCACGTZinc finger, BED-type predicted domain containing protein. 
J033075C16GAGGCCCACGTNONE 
J043013D08GAGGCCCACGTNONE 
J065089G19GAGGCCCACGTNONE 
J065197K19GAGGCCCACGTNONE 
J075161L21GAGGCCCACGTNONE 
Os01g0223900AK101712ACGTGGGCCurculin-like (mannose-binding) lectin domain containing protein. 
J033060M08ACGTGGGCNONE 
Os01g0226400AK102301AGCCCACGTAAA ATPase domain containing protein. 
Os01g0229100006-113-G08ACGTGGGCCGAAANONE 
006-113-G08ACGTGGGCCTCNONE 
011-075-E08ACGTGGGCCGAAANONE 
011-075-E08ACGTGGGCCTCNONE 
AK061285ACGTGGGCCGAAANONE 
AK061285ACGTGGGCCTCNONE 
AK070838ACGTGGGCCGAAATetratricopeptide-like helical domain containing protein. 
AK070838ACGTGGGCCTCTetratricopeptide-like helical domain containing protein. 
J013059F08ACGTGGGCCGAAANONE 
J013059F08ACGTGGGCCTCNONE 
J013059G08ACGTGGGCCGAAANONE 
J013059G08ACGTGGGCCTCNONE 
J013059G09ACGTGGGCCGAAANONE 
J013059G09ACGTGGGCCTCNONE 
J013069M12ACGTGGGCCGAAANONE 
J013069M12ACGTGGGCCTCNONE 
J013105A19ACGTGGGCCGAAANONE 
J013105A19ACGTGGGCCTCNONE 
J013149F07ACGTGGGCCGAAANONE 
J013149F07ACGTGGGCCTCNONE 
J023073J07ACGTGGGCCGAAANONE 
J023073J07ACGTGGGCCTCNONE 
J023130F24ACGTGGGCCGAAANONE 
J023130F24ACGTGGGCCTCNONE 
J023147J08ACGTGGGCCGAAANONE 
J023147J08ACGTGGGCCTCNONE 
J033028F13ACGTGGGCCGAAANONE 
J033028F13ACGTGGGCCTCNONE 
J033115A16ACGTGGGCCGAAANONE 
J033115A16ACGTGGGCCTCNONE 
J033135F02ACGTGGGCCGAAANONE 
J033135F02ACGTGGGCCTCNONE 
J065031G16ACGTGGGCCGAAANONE 
J065031G16ACGTGGGCCTCNONE 
J065058A09ACGTGGGCCGAAANONE 
J065058A09ACGTGGGCCTCNONE 
J065089N15ACGTGGGCCGAAANONE 
J065089N15ACGTGGGCCTCNONE 
J065130I09ACGTGGGCCGAAANONE 
J065130I09ACGTGGGCCTCNONE 
J065191P09ACGTGGGCCGAAANONE 
J065191P09ACGTGGGCCTCNONE 
J065197P14ACGTGGGCCGAAANONE 
J065197P14ACGTGGGCCTCNONE 
J080306D15ACGTGGGCCGAAANONE 
J080306D15ACGTGGGCCTCNONE 
J080308M06ACGTGGGCCGAAANONE 
J080308M06ACGTGGGCCTCNONE 
J080315A03ACGTGGGCCGAAANONE 
J080315A03ACGTGGGCCTCNONE 
J080315N11ACGTGGGCCGAAANONE 
J080315N11ACGTGGGCCTCNONE 
J090046E14ACGTGGGCCGAAANONE 
J090046E14ACGTGGGCCTCNONE 
J090058G09ACGTGGGCCGAAANONE 
J090058G09ACGTGGGCCTCNONE 
J090077H05ACGTGGGCCGAAANONE 
J090077H05ACGTGGGCCTCNONE 
J090087O20ACGTGGGCCGAAANONE 
J090087O20ACGTGGGCCTCNONE 
Os01g0229200AK066024GAGGCCCACGTVHS domain containing protein. 
AK066024TTTCGGCCCACGTVHS domain containing protein. 
Os01g0271700J065184P16AGGGCCCACGTNONE 
J075182E21AGGGCCCACGTNONE 
J075191M19AGGGCCCACGTNONE 
J090021E22AGGGCCCACGTNONE 
Os01g0276500006-030-E04ACGTGGGCCGTANONE 
AK061002ACGTGGGCCGTASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)]. 
AK099335ACGTGGGCCGTANONE 
Os01g0303000009-016-A06ACAGCCCACGTGGCNONE 
009-084-B05ACAGCCCACGTGGCNONE 
009-100-E07ACAGCCCACGTGGCNONE 
009-133-B03ACAGCCCACGTGGCNONE 
AK058929ACAGCCCACGTGGCSimilar to CP12 (Fragment). 
AK066266ACAGCCCACGTGGCNONE 
AK102013ACAGCCCACGTGGCNONE 
J065001I21ACAGCCCACGTGGCNONE 
J065025D22ACAGCCCACGTGGCNONE 
J065098M18ACAGCCCACGTGGCNONE 
J065105O22ACAGCCCACGTGGCNONE 
J065121F07ACAGCCCACGTGGCNONE 
J065181F03ACAGCCCACGTGGCNONE 
J075020M03ACAGCCCACGTGGCNONE 
J075028O06ACAGCCCACGTGGCNONE 
J075032F15ACAGCCCACGTGGCNONE 
J075033H07ACAGCCCACGTGGCNONE 
J075062F22ACAGCCCACGTGGCNONE 
J075083P19ACAGCCCACGTGGCNONE 
J075097J16ACAGCCCACGTGGCNONE 
J075099A15ACAGCCCACGTGGCNONE 
J075104P03ACAGCCCACGTGGCNONE 
J075118K12ACAGCCCACGTGGCNONE 
J075125H01ACAGCCCACGTGGCNONE 
J075127K12ACAGCCCACGTGGCNONE 
J075128F24ACAGCCCACGTGGCNONE 
J075151P06ACAGCCCACGTGGCNONE 
J075169K22ACAGCCCACGTGGCNONE 
J075170K24ACAGCCCACGTGGCNONE 
J075182A01ACAGCCCACGTGGCNONE 
J075199H16ACAGCCCACGTGGCNONE 
J080010O12ACAGCCCACGTGGCNONE 
J080013A02ACAGCCCACGTGGCNONE 
J080013F09ACAGCCCACGTGGCNONE 
J080017C19ACAGCCCACGTGGCNONE 
J080017G05ACAGCCCACGTGGCNONE 
J080022L04ACAGCCCACGTGGCNONE 
J080025B17ACAGCCCACGTGGCNONE 
J080029A08ACAGCCCACGTGGCNONE 
J080037C12ACAGCCCACGTGGCNONE 
J080037L14ACAGCCCACGTGGCNONE 
J080037M24ACAGCCCACGTGGCNONE 
J080038M21ACAGCCCACGTGGCNONE 
J080039E06ACAGCCCACGTGGCNONE 
J080039I10ACAGCCCACGTGGCNONE 
J080042H01ACAGCCCACGTGGCNONE 
J080042L18ACAGCCCACGTGGCNONE 
J080042N21ACAGCCCACGTGGCNONE 
J080043E01ACAGCCCACGTGGCNONE 
J080044H05ACAGCCCACGTGGCNONE 
J080047H10ACAGCCCACGTGGCNONE 
J080050H03ACAGCCCACGTGGCNONE 
J080060N21ACAGCCCACGTGGCNONE 
J080061M09ACAGCCCACGTGGCNONE 
J080062D15ACAGCCCACGTGGCNONE 
J080062I18ACAGCCCACGTGGCNONE 
J080063G05ACAGCCCACGTGGCNONE 
J080063H16ACAGCCCACGTGGCNONE 
J080067G16ACAGCCCACGTGGCNONE 
J080067M07ACAGCCCACGTGGCNONE 
J080068M13ACAGCCCACGTGGCNONE 
J080069A19ACAGCCCACGTGGCNONE 
J080069G14ACAGCCCACGTGGCNONE 
J080070F04ACAGCCCACGTGGCNONE 
J080070K15ACAGCCCACGTGGCNONE 
J080072O20ACAGCCCACGTGGCNONE 
J080075L02ACAGCCCACGTGGCNONE 
J080077I10ACAGCCCACGTGGCNONE 
J080077P03ACAGCCCACGTGGCNONE 
J080078F14ACAGCCCACGTGGCNONE 
J080092H15ACAGCCCACGTGGCNONE 
J080097J15ACAGCCCACGTGGCNONE 
J080305C10ACAGCCCACGTGGCNONE 
Os01g0331900013-026-D04GTGTGGGGCCCACGTGGGTCCCANONE 
AK064784GTGTGGGGCCCACGTGGGTCCCANONE 
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GTGTGGGGCCCACGTGGGTCCCANONE 
J033090D07GTGTGGGGCCCACGTGGGTCCCANONE 
J090006L21GTGTGGGGCCCACGTGGGTCCCANONE 
Os01g0337600AK099595ACGTGGGCATPase, F1 complex, gamma subunit family protein. 
AK119468ACGTGGGCNONE 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE 
Os01g0533400AK119447GCCCACGTGTGlycoside hydrolase, family 35 protein. 
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein. 
Os01g0643900AK108288ACGTGGGCOleosin family protein. 
Os01g0673500AK065017GCCCACGTGSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
AK069899GCCCACGTGNONE 
Os01g0678100AK099717ACGTGGGCConserved hypothetical protein. 
Os01g0694800015-093-H11GTGGGACCCACGTGGGCCCCACANONE 
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os01g0701900AK066793GCCCACGTGGCSimilar to Phosphatidylinositol transfer-like protein III. 
Os01g0703300AK069643ACGTGGGCZinc finger, RING-type domain containing protein. 
J023027O19ACGTGGGCNONE 
Os01g0720700J033124M22ACGTGGGCCAGGCCCNONE 
J065006G21ACGTGGGCCAGGCCCNONE 
J065025M24ACGTGGGCCAGGCCCNONE 
J065041J02ACGTGGGCCAGGCCCNONE 
J065044B14ACGTGGGCCAGGCCCNONE 
J065061J06ACGTGGGCCAGGCCCNONE 
J065116L21ACGTGGGCCAGGCCCNONE 
J075030F18ACGTGGGCCAGGCCCNONE 
J075034K17ACGTGGGCCAGGCCCNONE 
J075063I02ACGTGGGCCAGGCCCNONE 
J075110D21ACGTGGGCCAGGCCCSimilar to Serine acetyltransferase. 
J075188L15ACGTGGGCCAGGCCCNONE 
J075197B17ACGTGGGCCAGGCCCNONE 
Os01g0749400AK064990ACGTGGGCCCCNONE 
AK067731ACGTGGGCCCCHAD-superfamily hydrolase subfamily IIB protein. 
AK103775ACGTGGGCCCCNONE 
J023001B06ACGTGGGCCCCNONE 
Os01g0750900AK111087ACGTGGGCCTAConserved hypothetical protein. 
J100042H18ACGTGGGCCTANONE 
J100044L13ACGTGGGCCTANONE 
Os01g0764800AK102809GCGGGCCCACGTGSimilar to Nt-gh3 deduced protein. 
Os01g0767700AK122168CACGTGGGCACGTGGCSimilar to DEIH-box RNA/DNA helicase. 
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE 
Os01g0835500AK100241GCCCACGTGTCCSimilar to Respiratory burst oxidase protein. 
Os01g0836400AK073540ACGTGGGCCCCASAC3/GANP family protein. 
J023019D11ACGTGGGCCCCANONE 
J023139O22ACGTGGGCCCCANONE 
J033042J20ACGTGGGCCCCANONE 
J033046M18ACGTGGGCCCCANONE 
J033124J09ACGTGGGCCCCANONE 
J090015E05ACGTGGGCCCCANONE 
J090076J09ACGTGGGCCCCANONE 
Os01g0840900014-051-F06GTGGGACCCACGTGGGCCCCACCNONE 
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein. 
Os01g0868300AB004461GCCCACGTSimilar to DNA polymerase alpha catalytic subunit (EC 2.7.7.7). 
Os01g0872100AK099405GCCCACGTTGF-beta receptor, type I/II extracellular region family protein. 
J013001K17GCCCACGTNONE 
Os01g0874700011-001-F02ACGTGGGCCCCACCNONE 
012-048-H01ACGTGGGCCCCACCNONE 
012-094-B02ACGTGGGCCCCACCNONE 
AK073077ACGTGGGCCCCACCNONE 
AK105447ACGTGGGCCCCACCNONE 
AK121856ACGTGGGCCCCACCemp24/gp25L/p24 family protein. 
J100026G07ACGTGGGCCCCACCNONE 
J100030F07ACGTGGGCCCCACCNONE 
J100066J18ACGTGGGCCCCACCNONE 
J100077G12ACGTGGGCCCCACCNONE 
J100081K23ACGTGGGCCCCACCNONE 
Os01g0889000AK103621ACGTGGGCTTetratricopeptide-like helical domain containing protein. 
Os01g0918200009-034-H02GGGGCCCACGTNONE 
AK062434GGGGCCCACGTSimilar to Ubiquitin-like protein SMT3. 
AK103092GGGGCCCACGTNONE 
J065093P18GGGGCCCACGTNONE 
J065137C15GGGGCCCACGTNONE 
J065156G01GGGGCCCACGTNONE 
J065206H16GGGGCCCACGTNONE 
J065209D03GGGGCCCACGTNONE 
J075073K05GGGGCCCACGTNONE 
J075099B17GGGGCCCACGTNONE 
J075166N04GGGGCCCACGTNONE 
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CCCGGGCCCACGTGTCNONE 
J013109E03CCCGGGCCCACGTGTCNONE 
J023081J12CCCGGGCCCACGTGTCNONE 
J023091E24CCCGGGCCCACGTGTCNONE 
J033022A01CCCGGGCCCACGTGTCNONE 
J033074C13CCCGGGCCCACGTGTCNONE 
J065199E03CCCGGGCCCACGTGTCNONE 
J075172O04CCCGGGCCCACGTGTCNONE 
J090007G18CCCGGGCCCACGTGTCNONE 
J090052B17CCCGGGCCCACGTGTCNONE 
J090074H01CCCGGGCCCACGTGTCNONE 
J100043J09CCCGGGCCCACGTGTCNONE 
J100059J05CCCGGGCCCACGTGTCNONE 
Os01g0924000004-020-C09ACGTGGGCCGGANONE 
004-020-C09AGCCCACGTNONE 
005-014-A06ACGTGGGCCGGANONE 
005-014-A06AGCCCACGTNONE 
009-085-G12ACGTGGGCCGGANONE 
009-085-G12AGCCCACGTNONE 
009-123-A08ACGTGGGCCGGANONE 
009-123-A08AGCCCACGTNONE 
009-134-A05ACGTGGGCCGGANONE 
009-134-A05AGCCCACGTNONE 
009-137-F06ACGTGGGCCGGANONE 
009-137-F06AGCCCACGTNONE 
016-016-B08ACGTGGGCCGGANONE 
016-016-B08AGCCCACGTNONE 
AF050674ACGTGGGCCGGANONE 
AF050674AGCCCACGTNONE 
AK061690ACGTGGGCCGGASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK061690AGCCCACGTSimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797ACGTGGGCCGGANONE 
AK120797AGCCCACGTNONE 
J013040A15ACGTGGGCCGGANONE 
J013040A15AGCCCACGTNONE 
J013104L20ACGTGGGCCGGANONE 
J013104L20AGCCCACGTNONE 
J013127E12ACGTGGGCCGGANONE 
J013127E12AGCCCACGTNONE 
J013158O05ACGTGGGCCGGANONE 
J013158O05AGCCCACGTNONE 
J023012E09ACGTGGGCCGGANONE 
J023012E09AGCCCACGTNONE 
J023126L23ACGTGGGCCGGANONE 
J023126L23AGCCCACGTNONE 
J023143B03ACGTGGGCCGGANONE 
J023143B03AGCCCACGTNONE 
J065005B16ACGTGGGCCGGANONE 
J065005B16AGCCCACGTNONE 
J065101J15ACGTGGGCCGGANONE 
J065101J15AGCCCACGTNONE 
J065105K16ACGTGGGCCGGANONE 
J065105K16AGCCCACGTNONE 
J065155K16ACGTGGGCCGGANONE 
J065155K16AGCCCACGTNONE 
J065171M17ACGTGGGCCGGANONE 
J065171M17AGCCCACGTNONE 
J065182F07ACGTGGGCCGGANONE 
J065182F07AGCCCACGTNONE 
J065187D10ACGTGGGCCGGANONE 
J065187D10AGCCCACGTNONE 
J065194I24ACGTGGGCCGGANONE 
J065194I24AGCCCACGTNONE 
J065207E24ACGTGGGCCGGANONE 
J065207E24AGCCCACGTNONE 
J075001C24ACGTGGGCCGGANONE 
J075001C24AGCCCACGTNONE 
J075090O10ACGTGGGCCGGANONE 
J075090O10AGCCCACGTNONE 
J075095H17ACGTGGGCCGGANONE 
J075095H17AGCCCACGTNONE 
J075109M24ACGTGGGCCGGANONE 
J075109M24AGCCCACGTNONE 
J075123C18ACGTGGGCCGGANONE 
J075123C18AGCCCACGTNONE 
J075148G22ACGTGGGCCGGANONE 
J075148G22AGCCCACGTNONE 
J090009B09ACGTGGGCCGGANONE 
J090009B09AGCCCACGTNONE 
J090075K17ACGTGGGCCGGANONE 
J090075K17AGCCCACGTNONE 
J090081H23ACGTGGGCCGGANONE 
J090081H23AGCCCACGTNONE 
J090097H21ACGTGGGCCGGANONE 
J090097H21AGCCCACGTNONE 
J100063P14ACGTGGGCCGGANONE 
J100063P14AGCCCACGTNONE 
Os01g0935700AK069403AAAGCCCACGTSimilar to Cytochrome c1 (Fragment). 
AK073125AAAGCCCACGTNONE 
J023013M20AAAGCCCACGTNONE 
Os01g0964000AK073599ACACGTGGGCSimilar to VAMP-like protein YKT61 (AtYKT61) (Geranylgeranylated protein 1) (AtGP1). 
AK104012ACACGTGGGCNONE 
AK104190ACACGTGGGCNONE 
Os02g0110200009-041-B07ATGGCCCACGTNONE 
AK100012ATGGCCCACGTNONE 
AK105694ATGGCCCACGTSimilar to Hydroperoxide lyase. 
Os02g0119400AK060055TTGGCCCACGTGTCCNONE 
AK102774TTGGCCCACGTGTCCSimilar to Syntaxin 52 (AtSYP52). 
J033107H09TTGGCCCACGTGTCCNONE 
J075175F09TTGGCCCACGTGTCCNONE 
J090011H05TTGGCCCACGTGTCCNONE 
J090091O05TTGGCCCACGTGTCCNONE 
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein. 
J043024M20GCGGCCCACGTGTCAGTGGNONE 
Os02g0208200J023104K09TCCGGCCCACGTNONE 
J033080L20TCCGGCCCACGTNONE 
J033105D08TCCGGCCCACGTNONE 
J090079N16TCCGGCCCACGTNONE 
Os02g0208900003-126-D10ACAGCCCACGTNONE 
AK066171ACAGCCCACGTNONE 
AK070031ACAGCCCACGTNONE 
AK121183ACAGCCCACGTSimilar to ZIGA2 protein (Fragment). 
J013031N09ACAGCCCACGTNONE 
J013045O19ACAGCCCACGTNONE 
J023102A14ACAGCCCACGTNONE 
J023145E14ACAGCCCACGTNONE 
J033033E15ACAGCCCACGTNONE 
J033041H19ACAGCCCACGTNONE 
J033050E09ACAGCCCACGTNONE 
J065191H21ACAGCCCACGTNONE 
J065193C21ACAGCCCACGTNONE 
J075068F07ACAGCCCACGTNONE 
Os02g0219900004-018-E11ATCGGACGGCCCACGTNONE 
AK060915ATCGGACGGCCCACGTNONE 
AK099194ATCGGACGGCCCACGTNONE 
AK104206ATCGGACGGCCCACGTNONE 
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07ATCGGACGGCCCACGTNONE 
Os02g0265900006-102-B07CGCCACGTGGGCNONE 
016-087-A02CGCCACGTGGGCNONE 
AK059921CGCCACGTGGGCReticulon family protein. 
AK064290CGCCACGTGGGCNONE 
AK072628CGCCACGTGGGCNONE 
AK104196CGCCACGTGGGCNONE 
J023130B01CGCCACGTGGGCNONE 
J080010O13CGCCACGTGGGCNONE 
J100065C12CGCCACGTGGGCNONE 
J100067M20CGCCACGTGGGCNONE 
J100070I01CGCCACGTGGGCNONE 
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein. 
Os02g0304800Os02g0304800TGGGGCCCACGTGProtein prenyltransferase domain containing protein. 
Os02g0327500AK069802GCCCACGTCTCProtein of unknown function DUF266, plant family protein. 
J065186I04GCCCACGTCTCNONE 
Os02g0502500011-068-G11GCTGGGCCCACGTGTCNONE 
AK100111GCTGGGCCCACGTGTCNONE 
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein. 
J013074C19GCTGGGCCCACGTGTCNONE 
J013153K16GCTGGGCCCACGTGTCNONE 
J023078O21GCTGGGCCCACGTGTCNONE 
J033127M18GCTGGGCCCACGTGTCNONE 
J043038D17GCTGGGCCCACGTGTCNONE 
J065090L08GCTGGGCCCACGTGTCNONE 
J065110P16GCTGGGCCCACGTGTCNONE 
J065163C03GCTGGGCCCACGTGTCNONE 
J065213D23GCTGGGCCCACGTGTCNONE 
J090010M14GCTGGGCCCACGTGTCNONE 
J090016E02GCTGGGCCCACGTGTCNONE 
J090044J20GCTGGGCCCACGTGTCNONE 
J090091M16GCTGGGCCCACGTGTCNONE 
J090099I23GCTGGGCCCACGTGTCNONE 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
Os02g0562700006-035-C05GCCGGCCCACGTCGGCCCATCANONE 
AB110167GCCGGCCCACGTCGGCCCATCANONE 
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC 1.1.1.61). 
AK104168GCCGGCCCACGTCGGCCCATCANONE 
AK109435GCCGGCCCACGTCGGCCCATCANONE 
AY224558GCCGGCCCACGTCGGCCCATCANONE 
J023013M13GCCGGCCCACGTCGGCCCATCANONE 
J023059I08GCCGGCCCACGTCGGCCCATCANONE 
J023084C06GCCGGCCCACGTCGGCCCATCANONE 
J023114G06GCCGGCCCACGTCGGCCCATCANONE 
J023142A09GCCGGCCCACGTCGGCCCATCANONE 
J033026E14GCCGGCCCACGTCGGCCCATCANONE 
J053042M10GCCGGCCCACGTCGGCCCATCANONE 
J053082K21GCCGGCCCACGTCGGCCCATCANONE 
J065105J15GCCGGCCCACGTCGGCCCATCANONE 
J065150F02GCCGGCCCACGTCGGCCCATCANONE 
J075177H05GCCGGCCCACGTCGGCCCATCANONE 
J080040B16GCCGGCCCACGTCGGCCCATCANONE 
J090077J10GCCGGCCCACGTCGGCCCATCANONE 
Os02g0602300AK065609GCCGGCCCACGTGNONE 
AK066929GCCGGCCCACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GCCGGCCCACGTGNONE 
J090040I23GCCGGCCCACGTGNONE 
Os02g0610700014-008-A03TAAGCCCACGTAGGCCCAAACNONE 
AK059205TAAGCCCACGTAGGCCCAAACConserved hypothetical protein. 
AK100281TAAGCCCACGTAGGCCCAAACNONE 
J023074H03TAAGCCCACGTAGGCCCAAACNONE 
J065002J16TAAGCCCACGTAGGCCCAAACNONE 
J065032I20TAAGCCCACGTAGGCCCAAACNONE 
J065076A07TAAGCCCACGTAGGCCCAAACNONE 
J065142O21TAAGCCCACGTAGGCCCAAACNONE 
J065203A03TAAGCCCACGTAGGCCCAAACNONE 
J075017F24TAAGCCCACGTAGGCCCAAACNONE 
J075017G24TAAGCCCACGTAGGCCCAAACNONE 
Os02g0661900006-030-G12ACGTGGGCNONE 
AK061447ACGTGGGCSimilar to Vesicle-associated membrane protein-associated protein B/C (VAMP- associated protein B/C) (VAMP-B/VAMP-C) (VAP-B/VAP-C). Splice isoform 2. 
AK068742ACGTGGGCNONE 
J075046K13ACGTGGGCNONE 
J075139O08ACGTGGGCNONE 
J075149I16ACGTGGGCNONE 
Os02g0677300006-102-D12GCGGCCCACGTNONE 
AK060550GCGGCCCACGTNONE 
AK106041GCGGCCCACGTSimilar to CRT/DRE binding factor 1. 
Os02g0744700AF395537GACACGTGGGCCCCACACNONE 
AJ308110GACACGTGGGCCCCACACNONE 
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0755600014-024-D06TGTGGGCCCACGTGNONE 
015-039-F09TGTGGGCCCACGTGNONE 
AK064105TGTGGGCCCACGTGNONE 
AK106639TGTGGGCCCACGTGSimilar to UDP-glucuronosyltransferase. 
Os02g0771200011-006-B07CCCGGCCCACGTNONE 
AK066823CCCGGCCCACGTConserved hypothetical protein. 
AK071059CCCGGCCCACGTNONE 
J013075K03CCCGGCCCACGTNONE 
Os02g0776800AB042415ACGTGGGCCGAGNONE 
AK072308ACGTGGGCCGAGReplication protein A 70kDa. 
AK101212ACGTGGGCCGAGNONE 
J033031B02ACGTGGGCCGAGNONE 
J090004E18ACGTGGGCCGAGNONE 
J090084C24ACGTGGGCCGAGNONE 
Os02g0780800J090080O19ACGTGGGCCGTGGNONE 
J090091I06ACGTGGGCCGTGGNONE 
Os02g0799300AK064917GCCACGTGGGCAGCCCAACAConserved hypothetical protein. 
Os02g0802400J065054M13GAAGCCCACGTNONE 
J065061I04GAAGCCCACGTNONE 
J065112M15GAAGCCCACGTEF-Hand type domain containing protein. 
J100050L24GAAGCCCACGTNONE 
J100059D20GAAGCCCACGTNONE 
Os02g0815300AK061607ACGTGGGCTConserved hypothetical protein. 
J075088I01ACGTGGGCTNONE 
Os03g0127000AK068479TAGGCCCAGCAAAGCCCACGTConserved hypothetical protein. 
J013152D10TAGGCCCAGCAAAGCCCACGTNONE 
J075167I20TAGGCCCAGCAAAGCCCACGTNONE 
J090067O04TAGGCCCAGCAAAGCCCACGTNONE 
Os03g0129100003-009-E09GCCCACGTNONE 
AF384030GCCCACGTNONE 
AK098993GCCCACGTSeven transmembrane protein MLO2. 
AK111990GCCCACGTNONE 
J013098A12GCCCACGTNONE 
J023020M16GCCCACGTNONE 
J043001L02GCCCACGTNONE 
Os03g0137500006-040-G01ACAGCCCACGTNONE 
015-054-G04ACAGCCCACGTNONE 
AK060148ACAGCCCACGTNONE 
AK073584ACAGCCCACGTNONE 
AK100231ACAGCCCACGTSimilar to VDAC3.1. 
J013146L24ACAGCCCACGTNONE 
J023022O09ACAGCCCACGTNONE 
J023049J19ACAGCCCACGTNONE 
J023133L05ACAGCCCACGTNONE 
J023143P12ACAGCCCACGTNONE 
J033040B12ACAGCCCACGTNONE 
J033050O14ACAGCCCACGTNONE 
J033066G05ACAGCCCACGTNONE 
J065007J18ACAGCCCACGTNONE 
J100067H13ACAGCCCACGTNONE 
Os03g0156500011-075-F02CGGGCCCACGTGNONE 
012-077-G10CGGGCCCACGTGNONE 
AK103466CGGGCCCACGTGLupus La protein family protein. 
J013088H17CGGGCCCACGTGNONE 
J013135G21CGGGCCCACGTGNONE 
J033050E10CGGGCCCACGTGNONE 
J033050J01CGGGCCCACGTGNONE 
J033129N23CGGGCCCACGTGNONE 
J065085L16CGGGCCCACGTGNONE 
J065101B19CGGGCCCACGTGNONE 
J065167N03CGGGCCCACGTGNONE 
J090009O21CGGGCCCACGTGNONE 
J090049D11CGGGCCCACGTGNONE 
J100017F23CGGGCCCACGTGNONE 
J100040E12CGGGCCCACGTGNONE 
J100055O18CGGGCCCACGTGNONE 
J100061K08CGGGCCCACGTGNONE 
J100072M05CGGGCCCACGTGNONE 
J100077B08CGGGCCCACGTGNONE 
J100086G03CGGGCCCACGTGNONE 
Os03g0159600AK106743GCCCACGTSimilar to Rab28 protein. 
J075041K15GCCCACGTNONE 
J075051E03GCCCACGTNONE 
J075055P19GCCCACGTNONE 
J075096D01GCCCACGTNONE 
Os03g0189400AK067720TCAGCCCACGTSimilar to Alcohol dehydrogenase ADH. 
J043012M09TCAGCCCACGTNONE 
J043026L22TCAGCCCACGTNONE 
J075115C06TCAGCCCACGTNONE 
J100056M03TCAGCCCACGTNONE 
J100064I05TCAGCCCACGTNONE 
Os03g0193225012-084-B12TCAGGCCCACGTNONE 
AK069459TCAGGCCCACGTFrigida-like family protein. 
J023019D20TCAGGCCCACGTNONE 
Os03g0210400AK065966ACGTGGGCCGCProtein prenyltransferase domain containing protein. 
Os03g0243300013-024-B05GGACGGACGTGGGCCGAANONE 
AB010740GGACGGACGTGGGCCGAANONE 
AB037151GGACGGACGTGGGCCGAASimilar to 26S proteasome non-ATPase regulatory subunit 4 (26S proteasome regulatory subunit S5A) (Multiubiquitin chain binding protein). 
AK073601GGACGGACGTGGGCCGAANONE 
J023010M13GGACGGACGTGGGCCGAANONE 
J023030M11GGACGGACGTGGGCCGAANONE 
J023066I02GGACGGACGTGGGCCGAANONE 
J023080H21GGACGGACGTGGGCCGAANONE 
J023123O15GGACGGACGTGGGCCGAANONE 
J033029N24GGACGGACGTGGGCCGAANONE 
J033031G18GGACGGACGTGGGCCGAANONE 
J033046D23GGACGGACGTGGGCCGAANONE 
J033046P11GGACGGACGTGGGCCGAANONE 
J033079C14GGACGGACGTGGGCCGAANONE 
J033125G12GGACGGACGTGGGCCGAANONE 
J033133I21GGACGGACGTGGGCCGAANONE 
J033141F22GGACGGACGTGGGCCGAANONE 
J065035O21GGACGGACGTGGGCCGAANONE 
J090008P15GGACGGACGTGGGCCGAANONE 
J090033F15GGACGGACGTGGGCCGAANONE 
J090059A16GGACGGACGTGGGCCGAANONE 
J090080N01GGACGGACGTGGGCCGAANONE 
J100022C16GGACGGACGTGGGCCGAANONE 
J100023K05GGACGGACGTGGGCCGAANONE 
J100043B19GGACGGACGTGGGCCGAANONE 
J100046G11GGACGGACGTGGGCCGAANONE 
J100049L11GGACGGACGTGGGCCGAANONE 
J100054M01GGACGGACGTGGGCCGAANONE 
J100068G15GGACGGACGTGGGCCGAANONE 
J100085A18GGACGGACGTGGGCCGAANONE 
Os03g0243350J065025D24TTCGGCCCACGTCCGTCCNONE 
J065046A15TTCGGCCCACGTCCGTCCHypothetical protein. 
J065064E08TTCGGCCCACGTCCGTCCNONE 
Os03g0270200012-009-A03TCGGCCCACGTNONE 
AK066896TCGGCCCACGTNONE 
AK102826TCGGCCCACGTSplicing factor PWI domain containing protein. 
J013042L05TCGGCCCACGTNONE 
J013091L22TCGGCCCACGTNONE 
J013096P13TCGGCCCACGTNONE 
J013118M15TCGGCCCACGTNONE 
J013151N20TCGGCCCACGTNONE 
J033061D07TCGGCCCACGTNONE 
J033086L04TCGGCCCACGTNONE 
J033099J11TCGGCCCACGTNONE 
J033109C10TCGGCCCACGTNONE 
J033116F13TCGGCCCACGTNONE 
J065019F13TCGGCCCACGTNONE 
J065089O14TCGGCCCACGTNONE 
J065158D07TCGGCCCACGTNONE 
J065160G19TCGGCCCACGTNONE 
J065168N10TCGGCCCACGTNONE 
J065208E17TCGGCCCACGTNONE 
J075001A15TCGGCCCACGTNONE 
J075010G15TCGGCCCACGTNONE 
J075016L23TCGGCCCACGTNONE 
J075019A06TCGGCCCACGTNONE 
J075023B13TCGGCCCACGTNONE 
J075032P15TCGGCCCACGTNONE 
J075045F05TCGGCCCACGTNONE 
J075053O13TCGGCCCACGTNONE 
J075057P06TCGGCCCACGTNONE 
J075061C19TCGGCCCACGTNONE 
J075078B10TCGGCCCACGTNONE 
J075086A20TCGGCCCACGTNONE 
J075127A16TCGGCCCACGTNONE 
J075128E07TCGGCCCACGTNONE 
J075129C06TCGGCCCACGTNONE 
J075130M14TCGGCCCACGTNONE 
J075136H13TCGGCCCACGTNONE 
J075149M17TCGGCCCACGTNONE 
J075156L08TCGGCCCACGTNONE 
J075160P12TCGGCCCACGTNONE 
J075164J01TCGGCCCACGTNONE 
J075173N05TCGGCCCACGTNONE 
J075177O03TCGGCCCACGTNONE 
J075188K11TCGGCCCACGTNONE 
J090009A02TCGGCCCACGTNONE 
J090019O12TCGGCCCACGTNONE 
J090065H05TCGGCCCACGTNONE 
J090067E24TCGGCCCACGTNONE 
J090080C03TCGGCCCACGTNONE 
J090090A04TCGGCCCACGTNONE 
J090098D13TCGGCCCACGTNONE 
J100060D03TCGGCCCACGTNONE 
J100062D05TCGGCCCACGTNONE 
J100074A08TCGGCCCACGTNONE 
Os03g0280400009-125-G04GCCCACGTGNONE 
AK063845GCCCACGTGConserved hypothetical protein 1589, plant family protein. 
Os03g0284000Os03g0284000CACGTGGGCCGGAACGGCCCGConserved hypothetical protein. 
Os03g0292800012-077-B05GCCCACGTNONE 
AK069970GCCCACGTSimilar to Ran binding protein 1 homolog. 
J065138F22GCCCACGTNONE 
Os03g0295800006-107-F02CACGTGGGCCCAACTNONE 
AK106050CACGTGGGCCCAACTNONE 
Os03g0302700006-099-F12TCCGGCCCACGTNONE 
AK112010TCCGGCCCACGTZinc finger, RING-type domain containing protein. 
AK121656TCCGGCCCACGTNONE 
J075090A19TCCGGCCCACGTNONE 
J075148M06TCCGGCCCACGTNONE 
Os03g0308000016-023-H09CGACACGTGGGCCCAACANONE 
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CGACACGTGGGCCCAACANONE 
J023043K04CGACACGTGGGCCCAACANONE 
J023083I20CGACACGTGGGCCCAACANONE 
J033068F22CGACACGTGGGCCCAACANONE 
J033125P21CGACACGTGGGCCCAACANONE 
J065207A22CGACACGTGGGCCCAACANONE 
J100018D20CGACACGTGGGCCCAACANONE 
J100026L17CGACACGTGGGCCCAACANONE 
J100055D14CGACACGTGGGCCCAACANONE 
J100060P03CGACACGTGGGCCCAACANONE 
J100078A20CGACACGTGGGCCCAACANONE 
Os03g0310800009-126-C10CACGTGGGCCACNONE 
009-156-D02CACGTGGGCCACNONE 
AK058663CACGTGGGCCACNONE 
AK099476CACGTGGGCCACSimilar to Hypersensitive reaction associated Ca2+-binding protein. 
J065084G15CACGTGGGCCACNONE 
J075046C12CACGTGGGCCACNONE 
J075058D24CACGTGGGCCACNONE 
J075151M03CACGTGGGCCACNONE 
J075151M04CACGTGGGCCACNONE 
J075153I20CACGTGGGCCACNONE 
J075167J05CACGTGGGCCACNONE 
J075179G06CACGTGGGCCACNONE 
J100025I19CACGTGGGCCACNONE 
J100025L21CACGTGGGCCACNONE 
J100029C06CACGTGGGCCACNONE 
J100068E24CACGTGGGCCACNONE 
J100070F10CACGTGGGCCACNONE 
J100083H23CACGTGGGCCACNONE 
J100089H10CACGTGGGCCACNONE 
Os03g0312500AK106657CCCACGTGGGCCCCASimilar to Inhibitor of apoptosis-like protein. 
AK109328CCCACGTGGGCCCCANONE 
Os03g0337600AF119232ACGTGGGCCGANONE 
AK070859ACGTGGGCCGASimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18ACGTGGGCCGANONE 
J013147M17ACGTGGGCCGANONE 
J065083M01ACGTGGGCCGANONE 
J065199H24ACGTGGGCCGANONE 
Os03g0340500012-007-F10CACGTGGGCCATNONE 
AK099406CACGTGGGCCATNONE 
AK102158CACGTGGGCCATSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13CACGTGGGCCATNONE 
J013063E02CACGTGGGCCATNONE 
J013063I02CACGTGGGCCATNONE 
J013157O07CACGTGGGCCATNONE 
J023131N05CACGTGGGCCATNONE 
J033033P05CACGTGGGCCATNONE 
J033040N16CACGTGGGCCATNONE 
J033044M19CACGTGGGCCATNONE 
J033086F24CACGTGGGCCATNONE 
J033097H01CACGTGGGCCATNONE 
J033106C22CACGTGGGCCATNONE 
J033128M13CACGTGGGCCATNONE 
J033133I15CACGTGGGCCATNONE 
J043027A21CACGTGGGCCATNONE 
J090028A09CACGTGGGCCATNONE 
J090053D06CACGTGGGCCATNONE 
J090083O17CACGTGGGCCATNONE 
J090099H10CACGTGGGCCATNONE 
J100036M05CACGTGGGCCATNONE 
Os03g0342900006-032-D01CACGTGGGCCTCNONE 
006-033-E10CACGTGGGCCTCNONE 
006-051-G06CACGTGGGCCTCNONE 
006-053-E05CACGTGGGCCTCNONE 
006-056-B05CACGTGGGCCTCNONE 
006-058-F04CACGTGGGCCTCNONE 
006-059-E05CACGTGGGCCTCNONE 
006-060-F10CACGTGGGCCTCNONE 
006-104-D12CACGTGGGCCTCNONE 
009-129-C12CACGTGGGCCTCNONE 
AK060136CACGTGGGCCTCNONE 
AK060980CACGTGGGCCTCNONE 
AK064815CACGTGGGCCTCDormancyauxin associated family protein. 
AK104244CACGTGGGCCTCNONE 
AK104391CACGTGGGCCTCNONE 
AK104590CACGTGGGCCTCNONE 
AK104744CACGTGGGCCTCNONE 
AK106100CACGTGGGCCTCNONE 
J013000E10CACGTGGGCCTCNONE 
J075027O22CACGTGGGCCTCNONE 
J075052J03CACGTGGGCCTCNONE 
J075066E15CACGTGGGCCTCNONE 
J075095C17CACGTGGGCCTCNONE 
J075118N05CACGTGGGCCTCNONE 
J075187K22CACGTGGGCCTCNONE 
J090026L04CACGTGGGCCTCNONE 
J090059G16CACGTGGGCCTCNONE 
J100055P20CACGTGGGCCTCNONE 
J100062A10CACGTGGGCCTCNONE 
J100068G20CACGTGGGCCTCNONE 
Os03g0344100009-166-F10ACGTGGGCCTTNONE 
AK061903ACGTGGGCCTTNONE 
AK065547ACGTGGGCCTTSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24ACGTGGGCCTTNONE 
J033087C06ACGTGGGCCTTNONE 
J053073I09ACGTGGGCCTTNONE 
J065189D11ACGTGGGCCTTNONE 
J090032B15ACGTGGGCCTTNONE 
Os03g0387100AB026559ATCGGACGGCCCACGTGNONE 
AF022735ATCGGACGGCCCACGTGNONE 
AK058567ATCGGACGGCCCACGTGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195ATCGGACGGCCCACGTGNONE 
J033030J15ATCGGACGGCCCACGTGNONE 
J033102N16ATCGGACGGCCCACGTGNONE 
J065056E08ATCGGACGGCCCACGTGNONE 
J065112M11ATCGGACGGCCCACGTGNONE 
J065170H07ATCGGACGGCCCACGTGNONE 
J075003P17ATCGGACGGCCCACGTGNONE 
J075074D06ATCGGACGGCCCACGTGNONE 
J075127F20ATCGGACGGCCCACGTGNONE 
J075129I01ATCGGACGGCCCACGTGNONE 
J075178A10ATCGGACGGCCCACGTGNONE 
J090071P12ATCGGACGGCCCACGTGNONE 
J100090D18ATCGGACGGCCCACGTGNONE 
Os03g0411000AK072079GCCCACGTApoptosis inhibitory 5 family protein. 
AK120207GCCCACGTNONE 
J013038J18GCCCACGTNONE 
J013063P09GCCCACGTNONE 
J013118N09GCCCACGTNONE 
J033022P08GCCCACGTNONE 
J033043E22GCCCACGTNONE 
J033094K23GCCCACGTNONE 
J033118J19GCCCACGTNONE 
J043010M20GCCCACGTNONE 
J065006E09GCCCACGTNONE 
J065011M01GCCCACGTNONE 
J065044F22GCCCACGTNONE 
J065131F15GCCCACGTNONE 
J065147G04GCCCACGTNONE 
J065154C20GCCCACGTNONE 
J065158H17GCCCACGTNONE 
J090011G09GCCCACGTNONE 
J090030I09GCCCACGTNONE 
Os03g0415500AK108435GCCCACGTMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12GCCCACGTNONE 
Os03g0421400J075194I21AAAGCCCACGTNONE 
Os03g0581600J065037H09GGTCCACGTGGGCCCCACACNONE 
J065183O12GGTCCACGTGGGCCCCACACNONE 
Os03g0606200009-030-E09TCTGGCCCACGTGNONE 
009-076-H10TCTGGCCCACGTGNONE 
009-122-H12TCTGGCCCACGTGNONE 
009-153-F09TCTGGCCCACGTGNONE 
AB055076TCTGGCCCACGTGMitochondrial ATP synthase 6 KD subunit. 
AK072384TCTGGCCCACGTGNONE 
AK107928TCTGGCCCACGTGNONE 
J023078E13TCTGGCCCACGTGNONE 
J053031N01TCTGGCCCACGTGNONE 
J053046K19TCTGGCCCACGTGNONE 
J053062P07TCTGGCCCACGTGNONE 
J053091C23TCTGGCCCACGTGNONE 
J053099N19TCTGGCCCACGTGNONE 
J065005E06TCTGGCCCACGTGNONE 
J065030N03TCTGGCCCACGTGNONE 
J065138O21TCTGGCCCACGTGNONE 
J065159K03TCTGGCCCACGTGNONE 
J075030M08TCTGGCCCACGTGNONE 
J080006E23TCTGGCCCACGTGNONE 
J080010D10TCTGGCCCACGTGNONE 
J080016N17TCTGGCCCACGTGNONE 
J080024N09TCTGGCCCACGTGNONE 
J080028E23TCTGGCCCACGTGNONE 
J080035I11TCTGGCCCACGTGNONE 
J080038D15TCTGGCCCACGTGNONE 
J080040H08TCTGGCCCACGTGNONE 
J080043L04TCTGGCCCACGTGNONE 
J080047C06TCTGGCCCACGTGNONE 
J080061G04TCTGGCCCACGTGNONE 
J080066E10TCTGGCCCACGTGNONE 
J080067P03TCTGGCCCACGTGNONE 
J080082D07TCTGGCCCACGTGNONE 
J080089M13TCTGGCCCACGTGNONE 
J080094O09TCTGGCCCACGTGNONE 
J080095C24TCTGGCCCACGTGNONE 
J080309E21TCTGGCCCACGTGNONE 
J090016G15TCTGGCCCACGTGNONE 
J090031C20TCTGGCCCACGTGNONE 
J090033A15TCTGGCCCACGTGNONE 
J090037L07TCTGGCCCACGTGNONE 
J090038I10TCTGGCCCACGTGNONE 
J090072P19TCTGGCCCACGTGNONE 
J100040J02TCTGGCCCACGTGNONE 
J100047N05TCTGGCCCACGTGNONE 
J100048M10TCTGGCCCACGTGNONE 
J100076C02TCTGGCCCACGTGNONE 
J100077G23TCTGGCCCACGTGNONE 
J100080O08TCTGGCCCACGTGNONE 
J100085C06TCTGGCCCACGTGNONE 
J100085F16TCTGGCCCACGTGNONE 
Os03g0633900AK059181ACGTGGGCCCCACASingle-strand binding protein family protein. 
AK068169ACGTGGGCCCCACANONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0746600AK069559ACGTGGGCCACWD40-like domain containing protein. 
J023141K22ACGTGGGCCACNONE 
Os03g0758500016-015-D02CACGTGGGCCCCNONE 
AK059403CACGTGGGCCCCNONE 
AK102002CACGTGGGCCCCPlastocyanin-like domain containing protein. 
J033079N03CACGTGGGCCCCNONE 
J065012M05CACGTGGGCCCCNONE 
J065045H19CACGTGGGCCCCNONE 
J065050J08CACGTGGGCCCCNONE 
J075189D02CACGTGGGCCCCNONE 
J090018L03CACGTGGGCCCCNONE 
J100043O22CACGTGGGCCCCNONE 
J100088G17CACGTGGGCCCCNONE 
Os03g0761200011-038-H02GAGGCCCACGTNONE 
015-055-D12GAGGCCCACGTNONE 
016-032-B01GAGGCCCACGTNONE 
AK064205GAGGCCCACGTNONE 
AK101534GAGGCCCACGTAnkyrin repeat containing protein. 
J075033L23GAGGCCCACGTNONE 
J075046K09GAGGCCCACGTNONE 
J075134K18GAGGCCCACGTNONE 
J075157I10GAGGCCCACGTNONE 
Os03g0770100AK108776CACGTGGGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0793100AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein. 
J033125G24GTGGGACCCACGTGGGCCCCACANONE 
J065132N21GTGGGACCCACGTGGGCCCCACANONE 
Os03g0796800J065024O22CACGTGGGCCCCATCCAConserved hypothetical protein. 
J065024O22GCCACGTGGGCCCGGGConserved hypothetical protein. 
Os03g0797600006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
Os03g0798600AK121716GGCCGGGCCGGAACACGTGGGCCTASimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18GGCCGGGCCGGAACACGTGGGCCTANONE 
J033079G18GGCCGGGCCGGAACACGTGGGCCTANONE 
J043038B19GGCCGGGCCGGAACACGTGGGCCTANONE 
J065091E15GGCCGGGCCGGAACACGTGGGCCTANONE 
J065092P10GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189F18GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189L12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075021B11GGCCGGGCCGGAACACGTGGGCCTANONE 
J075022L15GGCCGGGCCGGAACACGTGGGCCTANONE 
J075046G12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075080H15GGCCGGGCCGGAACACGTGGGCCTANONE 
J090045H01GGCCGGGCCGGAACACGTGGGCCTANONE 
J090077H16GGCCGGGCCGGAACACGTGGGCCTANONE 
J090083D22GGCCGGGCCGGAACACGTGGGCCTANONE 
J100021D24GGCCGGGCCGGAACACGTGGGCCTANONE 
J100023G04GGCCGGGCCGGAACACGTGGGCCTANONE 
J100049J23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100075K23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100077G22GGCCGGGCCGGAACACGTGGGCCTANONE 
Os03g0799100AK058959ACACGTGGGCCCTNONE 
AK102772ACACGTGGGCCCTSimilar to WAVE-DAMPENED2. 
J023093D03ACACGTGGGCCCTNONE 
J033099D22ACACGTGGGCCCTNONE 
J090054G18ACACGTGGGCCCTNONE 
J100031H24ACACGTGGGCCCTNONE 
J100065H09ACACGTGGGCCCTNONE 
J100082G10ACACGTGGGCCCTNONE 
Os03g0843700AK070364ACACGTGGGCCTAFAR1 domain containing protein. 
J013146A20ACACGTGGGCCTANONE 
J023050I08ACACGTGGGCCTANONE 
J033058E14ACACGTGGGCCTANONE 
J033111G20ACACGTGGGCCTANONE 
J033141H24ACACGTGGGCCTANONE 
J065021K13ACACGTGGGCCTANONE 
J065082M21ACACGTGGGCCTANONE 
J075106L22ACACGTGGGCCTANONE 
J075150L05ACACGTGGGCCTANONE 
J075172H24ACACGTGGGCCTANONE 
J075199F06ACACGTGGGCCTANONE 
Os04g0115400015-048-B05ACGTGGGCCGAANONE 
AK070523ACGTGGGCCGAAD111/G-patch domain containing protein. 
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein. 
AK072577CCGTGGGCCGCACGTGGGCTTTTNONE 
AK099773CCGTGGGCCGCACGTGGGCTTTTNONE 
J013030L03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013042D23CCGTGGGCCGCACGTGGGCTTTTNONE 
J013050E17CCGTGGGCCGCACGTGGGCTTTTNONE 
J013051J21CCGTGGGCCGCACGTGGGCTTTTNONE 
J013055L09CCGTGGGCCGCACGTGGGCTTTTNONE 
J013064A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013095E06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013111A06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013118K01CCGTGGGCCGCACGTGGGCTTTTNONE 
J013119A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013134F07CCGTGGGCCGCACGTGGGCTTTTNONE 
J033132N23CCGTGGGCCGCACGTGGGCTTTTNONE 
Os04g0208400AK069629CACGTGGGCCGGCCyclin-like F-box domain containing protein. 
AK069629CCAGCCCACGTGCyclin-like F-box domain containing protein. 
Os04g0244800009-066-G06GCCCACGTGTCNONE 
011-024-D02GCCCACGTGTCNONE 
AK121488GCCCACGTGTCHeavy metal transport/detoxification protein domain containing protein. 
J023095P14GCCCACGTGTCNONE 
J023150J09GCCCACGTGTCNONE 
J053097G24GCCCACGTGTCNONE 
J065001K24GCCCACGTGTCNONE 
J065009O13GCCCACGTGTCNONE 
J065076M12GCCCACGTGTCNONE 
J065081I15GCCCACGTGTCNONE 
J065105E10GCCCACGTGTCNONE 
J065106G04GCCCACGTGTCNONE 
J065123I12GCCCACGTGTCNONE 
J065137H16GCCCACGTGTCNONE 
J065151I11GCCCACGTGTCNONE 
J065164H06GCCCACGTGTCNONE 
J065173J07GCCCACGTGTCNONE 
J065196F02GCCCACGTGTCNONE 
J065198I17GCCCACGTGTCNONE 
J065206I11GCCCACGTGTCNONE 
J065216J02GCCCACGTGTCNONE 
J075076D10GCCCACGTGTCNONE 
J075098F06GCCCACGTGTCNONE 
J075115A20GCCCACGTGTCNONE 
J075184H05GCCCACGTGTCNONE 
J075193E17GCCCACGTGTCNONE 
J090014L09GCCCACGTGTCNONE 
J090015H16GCCCACGTGTCNONE 
J090024M04GCCCACGTGTCNONE 
J090062K08GCCCACGTGTCNONE 
J090082I08GCCCACGTGTCNONE 
Os04g0436800015-053-A06ACGTGGGCCTGANONE 
AK101115ACGTGGGCCTGAProtein prenyltransferase domain containing protein. 
J033025G14ACGTGGGCCTGANONE 
J033073N23ACGTGGGCCTGANONE 
J033097L19ACGTGGGCCTGANONE 
Os04g0479300AK106088AGCCCACGTGTConserved hypothetical protein. 
Os04g0510900012-083-A10GCCCACGTNONE 
014-002-F04GCCCACGTNONE 
AK063625GCCCACGTSimilar to Embryo-specific protein 1 (ATS1). 
J065136I20GCCCACGTNONE 
J065144F23GCCCACGTNONE 
J065153D08GCCCACGTNONE 
J065178A02GCCCACGTNONE 
J065178B01GCCCACGTNONE 
J065195M21GCCCACGTNONE 
Os04g0558700AK110633GCCCACGTConserved hypothetical protein. 
Os04g0564600009-038-A02CCCGGCCCATAAGGCCCACGTNONE 
AK105145CCCGGCCCATAAGGCCCACGTNONE 
AK120614CCCGGCCCATAAGGCCCACGTSimilar to HMG1 protein. 
J013102D16CCCGGCCCATAAGGCCCACGTNONE 
J013151P06CCCGGCCCATAAGGCCCACGTNONE 
J033082C11CCCGGCCCATAAGGCCCACGTNONE 
J065073N13CCCGGCCCATAAGGCCCACGTNONE 
J065142E11CCCGGCCCATAAGGCCCACGTNONE 
J065187I19CCCGGCCCATAAGGCCCACGTNONE 
J065204K02CCCGGCCCATAAGGCCCACGTNONE 
J090089P22CCCGGCCCATAAGGCCCACGTNONE 
J100060B16CCCGGCCCATAAGGCCCACGTNONE 
Os04g0565500006-022-C06CCAGGCCCACGTNONE 
AK058888CCAGGCCCACGTAmino acid/polyamine transporter II family protein. 
AK071118CCAGGCCCACGTNONE 
AK105902CCAGGCCCACGTNONE 
J023052I22CCAGGCCCACGTNONE 
J023082L01CCAGGCCCACGTNONE 
J023112P14CCAGGCCCACGTNONE 
J065043O12CCAGGCCCACGTNONE 
J065045B08CCAGGCCCACGTNONE 
J065059N01CCAGGCCCACGTNONE 
J065073A04CCAGGCCCACGTNONE 
J065078K06CCAGGCCCACGTNONE 
J065124J08CCAGGCCCACGTNONE 
J065140G16CCAGGCCCACGTNONE 
J065185E13CCAGGCCCACGTNONE 
J065197N09CCAGGCCCACGTNONE 
J100024A03CCAGGCCCACGTNONE 
J100042E11CCAGGCCCACGTNONE 
J100069L15CCAGGCCCACGTNONE 
J100078K13CCAGGCCCACGTNONE 
Os04g0626400006-050-B09GCCCACGTGGGCNONE 
006-072-C12GCCCACGTGGGCNONE 
006-092-C11GCCCACGTGGGCNONE 
AK059851GCCCACGTGGGCCalycin-like family protein. 
AK100069GCCCACGTGGGCNONE 
AK104062GCCCACGTGGGCNONE 
AK104663GCCCACGTGGGCNONE 
Os04g0640800AK065522GTGGCCCACGTGProgrammed cell death protein 2, C-terminal domain containing protein. 
AK065522TTTCGGCCCACGTTCCGTProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0661200AK102842GCCACGTGGGCCCGCACCGCProtein of unknown function DUF941 family protein. 
J033075E19GCCACGTGGGCCCGCACCGCNONE 
J033109O19GCCACGTGGGCCCGCACCGCNONE 
J065002J12GCCACGTGGGCCCGCACCGCNONE 
J065026E22GCCACGTGGGCCCGCACCGCNONE 
J065061F05GCCACGTGGGCCCGCACCGCNONE 
J065068D22GCCACGTGGGCCCGCACCGCNONE 
J065072N14GCCACGTGGGCCCGCACCGCNONE 
J065085F02GCCACGTGGGCCCGCACCGCNONE 
J075055G19GCCACGTGGGCCCGCACCGCNONE 
J075105B14GCCACGTGGGCCCGCACCGCNONE 
J075118M17GCCACGTGGGCCCGCACCGCNONE 
J075193H02GCCACGTGGGCCCGCACCGCNONE 
J100040O05GCCACGTGGGCCCGCACCGCNONE 
J100064I04GCCACGTGGGCCCGCACCGCNONE 
Os05g0164100AF456329GGCCCACGTNONE 
AK065086GGCCCACGTNONE 
AK072243GGCCCACGTSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18GGCCCACGTNONE 
J013132O12GGCCCACGTNONE 
J023003N09GGCCCACGTNONE 
Os05g0169300J023091A07ACGTGGGCNONE 
J023113A03ACGTGGGCNONE 
Os05g0194550J075140P14GGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os05g0320700AK100598TCCGGGCCCACGTSimilar to Cytochrome P450. 
AK104994TCCGGGCCCACGTNONE 
Os05g0346100012-005-C07GCCACGTGGGCGCGCGCGANONE 
AK066689GCCACGTGGGCGCGCGCGAPhox-like domain containing protein. 
J013073J06GCCACGTGGGCGCGCGCGANONE 
Os05g0357200014-046-H09GCCCCACGTGGGCCCCACGCCTCNONE 
AK064069GCCCCACGTGGGCCCCACGCCTCNONE 
AK072064GCCCCACGTGGGCCCCACGCCTCMitochondrial substrate carrier family protein. 
J065038M01GCCCCACGTGGGCCCCACGCCTCNONE 
J065121C16GCCCCACGTGGGCCCCACGCCTCNONE 
J075173E09GCCCCACGTGGGCCCCACGCCTCNONE 
J080307A20GCCCCACGTGGGCCCCACGCCTCNONE 
J090046B19GCCCCACGTGGGCCCCACGCCTCNONE 
J100033N12GCCCCACGTGGGCCCCACGCCTCNONE 
J100036G01GCCCCACGTGGGCCCCACGCCTCNONE 
J100057B19GCCCCACGTGGGCCCCACGCCTCNONE 
Os05g0366600015-093-D12ACGTGGGCCAGNONE 
AK071469ACGTGGGCCAGSimilar to Hydroxyisourate hydrolase. 
Os05g0380900AK067214GCCCACGTGTSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2). 
AK099962GCCCACGTGTNONE 
J065083M07GCCCACGTGTNONE 
Os05g0392801J090025K15GTGGGACCCACGTGGGCCCCACGTConserved hypothetical protein. 
J090053E06GTGGGACCCACGTGGGCCCCACGTNONE 
Os05g0411300014-098-D05ACGTGGGCCCCACGTGTCNONE 
015-093-F04ACGTGGGCCCCACGTGTCNONE 
AK071931ACGTGGGCCCCACGTGTCConserved hypothetical protein. 
AK073142ACGTGGGCCCCACGTGTCNONE 
Os05g0423500015-048-C11CACGTGGGCCCACCTNONE 
AK066000CACGTGGGCCCACCTProtein kinase-like domain containing protein. 
J013049L02CACGTGGGCCCACCTNONE 
Os05g0437800015-045-B10GCCCACGTNONE 
AK106328GCCCACGTConserved hypothetical protein. 
Os05g0451200AK073037ACCGGCCCACGTConserved hypothetical protein. 
Os05g0451300AK108341GCCCACGTConserved hypothetical protein. 
Os05g0480000AK061052ACGTGGGCProtein kinase domain containing protein. 
Os05g0487600AK100817TGTGGGGCCCACGTGNONE 
AK103104TGTGGGGCCCACGTGNONE 
J043027P10TGTGGGGCCCACGTGNONE 
J065183N17TGTGGGGCCCACGTGNONE 
Os05g0529300AK102648GCGGGCCCACGTSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06ACGTGGGCCCGCNONE 
AK063846ACGTGGGCCCGCConserved hypothetical protein. 
AK122038ACGTGGGCCCGCNONE 
J033113C01ACGTGGGCCCGCNONE 
Os05g0540100AB021666CACGTGGGCCGCANONE 
AK060623CACGTGGGCCGCANONE 
AK103819CACGTGGGCCGCAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein. 
Os05g0563600009-152-H06CCAGGCCCACGTNONE 
AK058836CCAGGCCCACGTNONE 
AK099313CCAGGCCCACGTBeta-Ig-H3/fasciclin domain containing protein. 
Os05g0583400AK101992TGTGGGGCCCACGTGGGTCCCACSimilar to Mitochondrial import receptor subunit TOM7 (Translocase of outer membrane 7 kDa subunit). 
Os05g0586600AB096011GCCCACGTGGCGPlastid sigma factor SIG5. 
AB096071GCCCACGTGGCGNONE 
AK105697GCCCACGTGGCGNONE 
Os06g0101600AF093636AAGGCCCACGTNONE 
AK070447AAGGCCCACGTPlastocyanin, chloroplast precursor. 
J065001A20AAGGCCCACGTNONE 
J065019M17AAGGCCCACGTNONE 
J065021H18AAGGCCCACGTNONE 
J065061A17AAGGCCCACGTNONE 
J065073L02AAGGCCCACGTNONE 
J065099F17AAGGCCCACGTNONE 
J065101C23AAGGCCCACGTNONE 
J065121E23AAGGCCCACGTNONE 
J065122N04AAGGCCCACGTNONE 
J065141N05AAGGCCCACGTNONE 
J065143N21AAGGCCCACGTNONE 
J065161H09AAGGCCCACGTNONE 
J065161J04AAGGCCCACGTNONE 
J065162P20AAGGCCCACGTNONE 
J065182K10AAGGCCCACGTNONE 
J065184M05AAGGCCCACGTNONE 
J065186H24AAGGCCCACGTNONE 
J065189G21AAGGCCCACGTNONE 
J065190N14AAGGCCCACGTNONE 
J065191H08AAGGCCCACGTNONE 
J065205H17AAGGCCCACGTNONE 
J075001E03AAGGCCCACGTNONE 
J075001H21AAGGCCCACGTNONE 
J075003J23AAGGCCCACGTNONE 
J075003K01AAGGCCCACGTNONE 
J075005I11AAGGCCCACGTNONE 
J075007F16AAGGCCCACGTNONE 
J075017I11AAGGCCCACGTNONE 
J075018O05AAGGCCCACGTNONE 
J075019G24AAGGCCCACGTNONE 
J075032D04AAGGCCCACGTNONE 
J075032N13AAGGCCCACGTNONE 
J075033C09AAGGCCCACGTNONE 
J075033D11AAGGCCCACGTNONE 
J075039A20AAGGCCCACGTNONE 
J075058P12AAGGCCCACGTNONE 
J075062E10AAGGCCCACGTNONE 
J075062P16AAGGCCCACGTNONE 
J075063C17AAGGCCCACGTNONE 
J075066E07AAGGCCCACGTNONE 
J075066I20AAGGCCCACGTNONE 
J075075K21AAGGCCCACGTNONE 
J075078F03AAGGCCCACGTNONE 
J075082F10AAGGCCCACGTNONE 
J075086G16AAGGCCCACGTNONE 
J075087E07AAGGCCCACGTNONE 
J075087K06AAGGCCCACGTNONE 
J075087L04AAGGCCCACGTNONE 
J075088B16AAGGCCCACGTNONE 
J075088D02AAGGCCCACGTNONE 
J075094H21AAGGCCCACGTNONE 
J075094I24AAGGCCCACGTNONE 
J075094K10AAGGCCCACGTNONE 
J075095C18AAGGCCCACGTNONE 
J075097B05AAGGCCCACGTNONE 
J075099C13AAGGCCCACGTNONE 
J075099H22AAGGCCCACGTNONE 
J075099L16AAGGCCCACGTNONE 
J075104K08AAGGCCCACGTNONE 
J075118O06AAGGCCCACGTNONE 
J075119E15AAGGCCCACGTNONE 
J075124N06AAGGCCCACGTNONE 
J075126G02AAGGCCCACGTNONE 
J075127L24AAGGCCCACGTNONE 
J075131E23AAGGCCCACGTNONE 
J075140H06AAGGCCCACGTNONE 
J075146I20AAGGCCCACGTNONE 
J075146N24AAGGCCCACGTNONE 
J075147I19AAGGCCCACGTNONE 
J075155K07AAGGCCCACGTNONE 
J075156C05AAGGCCCACGTNONE 
J075161G07AAGGCCCACGTNONE 
J075164G01AAGGCCCACGTNONE 
J075170J18AAGGCCCACGTNONE 
J075172G17AAGGCCCACGTNONE 
J075176G10AAGGCCCACGTNONE 
J075178C05AAGGCCCACGTNONE 
J075179G01AAGGCCCACGTNONE 
J075181E24AAGGCCCACGTNONE 
J080029D19AAGGCCCACGTNONE 
J080034L11AAGGCCCACGTNONE 
J080039G07AAGGCCCACGTNONE 
J080062M23AAGGCCCACGTNONE 
J080302A01AAGGCCCACGTNONE 
J100042I15AAGGCCCACGTNONE 
J100043G22AAGGCCCACGTNONE 
J100056L12AAGGCCCACGTNONE 
J100061A12AAGGCCCACGTNONE 
J100073O20AAGGCCCACGTNONE 
J100082I08AAGGCCCACGTNONE 
Os06g0113600016-067-E03ACGTGGGCCAGNONE 
AK062095ACGTGGGCCAGNONE 
AK101235ACGTGGGCCAGCyclin-like F-box domain containing protein. 
AK122025ACGTGGGCCAGNONE 
J013022O19ACGTGGGCCAGNONE 
J023045P05ACGTGGGCCAGNONE 
J033031K01ACGTGGGCCAGNONE 
J033034I09ACGTGGGCCAGNONE 
J033041O04ACGTGGGCCAGNONE 
J033071K03ACGTGGGCCAGNONE 
J033075K16ACGTGGGCCAGNONE 
J033097M01ACGTGGGCCAGNONE 
J033099M22ACGTGGGCCAGNONE 
J033108N15ACGTGGGCCAGNONE 
J033121D18ACGTGGGCCAGNONE 
J033125O06ACGTGGGCCAGNONE 
J033139M16ACGTGGGCCAGNONE 
J033145P18ACGTGGGCCAGNONE 
J033149D05ACGTGGGCCAGNONE 
Os06g0122500AK108322ACGTGGGCConserved hypothetical protein. 
AK108322ACGTGGGCConserved hypothetical protein. 
Os06g0129000Os06g0129000GACACGTGGGCCCTConserved hypothetical protein. 
Os06g0136900AK107405GAGACGTGGGCProtein of unknown function DUF296 domain containing protein. 
Os06g0140100011-063-A02GCCCACGTGNONE 
AK063371GCCCACGTGLeucine carboxyl methyltransferase family protein. 
Os06g0144000AK068998TGTGGGCCCACGTGBRCT domain containing protein. 
J023001F16TGTGGGCCCACGTGNONE 
Os06g0147600AK107817ACGTGGGCTGTConserved hypothetical protein. 
Os06g0199300J065045H01ACGTGGGCCTCNONE 
J075177C22ACGTGGGCCTCNONE 
J080068H06ACGTGGGCCTCNONE 
J090048F01ACGTGGGCCTCNONE 
J100066F17ACGTGGGCCTCNONE 
Os06g0291600AK100261GACACGTGGGCCACSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment). 
J023063D14GACACGTGGGCCACNONE 
J090041B12GACACGTGGGCCACNONE 
Os06g0309000AK121021ACGTGGGCTTTTZinc finger, FYVE/PHD-type domain containing protein. 
Os06g0335500AK121989CACGTGGGCAUX/IAA protein family protein. 
Os06g0552300011-011-G12GCCACGTGGGCCCCACCNONE 
AK101229GCCACGTGGGCCCCACCBZR1, transcriptional repressor family protein. 
J023061O03GCCACGTGGGCCCCACCNONE 
J033031H19GCCACGTGGGCCCCACCNONE 
J075103K14GCCACGTGGGCCCCACCNONE 
J075108I16GCCACGTGGGCCCCACCNONE 
J075194I23GCCACGTGGGCCCCACCNONE 
J090008K01GCCACGTGGGCCCCACCNONE 
J100062P15GCCACGTGGGCCCCACCNONE 
Os06g0562700AK109753GACGGCCCACGTConserved hypothetical protein. 
Os06g0585200016-065-C02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK068592CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK073844CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK106549CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCConserved hypothetical protein. 
J013154A14CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100049K24CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100059C18CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100082N13CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
Os06g0589500AK073322CACTGACACGTGGGCCCACGGConserved hypothetical protein. 
J033030G15CACTGACACGTGGGCCCACGGNONE 
J033148N18CACTGACACGTGGGCCCACGGNONE 
Os06g0606800AK066355ACGTGGGCCACTargeting for Xklp2 family protein. 
AK106565ACGTGGGCCACNONE 
J013067N05ACGTGGGCCACNONE 
J023127B01ACGTGGGCCACNONE 
J033023J04ACGTGGGCCACNONE 
J033025J18ACGTGGGCCACNONE 
J033032A15ACGTGGGCCACNONE 
J033079F03ACGTGGGCCACNONE 
J033115D22ACGTGGGCCACNONE 
J033119N01ACGTGGGCCACNONE 
J033138G24ACGTGGGCCACNONE 
J033149E08ACGTGGGCCACNONE 
J033150A09ACGTGGGCCACNONE 
J043024B06ACGTGGGCCACNONE 
J065028O13ACGTGGGCCACNONE 
J065070C05ACGTGGGCCACNONE 
J065175H22ACGTGGGCCACNONE 
J090008L08ACGTGGGCCACNONE 
J090009M07ACGTGGGCCACNONE 
J090039L01ACGTGGGCCACNONE 
J090049A02ACGTGGGCCACNONE 
J090050A11ACGTGGGCCACNONE 
J090051G16ACGTGGGCCACNONE 
J090062P20ACGTGGGCCACNONE 
J090073P12ACGTGGGCCACNONE 
J090076B19ACGTGGGCCACNONE 
J090084I23ACGTGGGCCACNONE 
J090088N05ACGTGGGCCACNONE 
J100037J10ACGTGGGCCACNONE 
J100043B06ACGTGGGCCACNONE 
J100058C13ACGTGGGCCACNONE 
J100089N01ACGTGGGCCACNONE 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0709300AK108588ACGTGGGCTTGFAR1 domain containing protein. 
Os07g0100500J033026C11GGGGCCCACGTGGCNONE 
Os07g0112600AK109561CACGTGGGCCTCConserved hypothetical protein. 
Os07g0124100014-015-G11GTTGGGCCCACGTGTNONE 
AJ276693GTTGGGCCCACGTGTPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647GTTGGGCCCACGTGTNONE 
Os07g0141400003-129-D08GATCCGACGTGGGCCAANONE 
006-021-E02GATCCGACGTGGGCCAANONE 
006-025-C06GATCCGACGTGGGCCAANONE 
006-027-H11GATCCGACGTGGGCCAANONE 
006-036-C05GATCCGACGTGGGCCAANONE 
006-046-D07GATCCGACGTGGGCCAANONE 
006-047-A02GATCCGACGTGGGCCAANONE 
006-050-F02GATCCGACGTGGGCCAANONE 
006-053-D07GATCCGACGTGGGCCAANONE 
006-054-E06GATCCGACGTGGGCCAANONE 
006-055-E01GATCCGACGTGGGCCAANONE 
006-055-F01GATCCGACGTGGGCCAANONE 
006-056-H12GATCCGACGTGGGCCAANONE 
006-057-D07GATCCGACGTGGGCCAANONE 
006-074-G10GATCCGACGTGGGCCAANONE 
006-077-C02GATCCGACGTGGGCCAANONE 
006-081-E01GATCCGACGTGGGCCAANONE 
006-089-B08GATCCGACGTGGGCCAANONE 
006-089-C10GATCCGACGTGGGCCAANONE 
006-092-E07GATCCGACGTGGGCCAANONE 
006-096-C11GATCCGACGTGGGCCAANONE 
006-096-H06GATCCGACGTGGGCCAANONE 
006-097-E07GATCCGACGTGGGCCAANONE 
006-098-D03GATCCGACGTGGGCCAANONE 
006-102-C05GATCCGACGTGGGCCAANONE 
006-107-E09GATCCGACGTGGGCCAANONE 
006-110-C09GATCCGACGTGGGCCAANONE 
006-113-C01GATCCGACGTGGGCCAANONE 
006-114-D09GATCCGACGTGGGCCAANONE 
006-115-H06GATCCGACGTGGGCCAANONE 
009-016-G06GATCCGACGTGGGCCAANONE 
009-031-C05GATCCGACGTGGGCCAANONE 
009-060-B05GATCCGACGTGGGCCAANONE 
009-123-H12GATCCGACGTGGGCCAANONE 
009-154-B09GATCCGACGTGGGCCAANONE 
009-172-F07GATCCGACGTGGGCCAANONE 
009-193-A04GATCCGACGTGGGCCAANONE 
AF022732GATCCGACGTGGGCCAANONE 
AF052203GATCCGACGTGGGCCAANONE 
AK065248GATCCGACGTGGGCCAASimilar to 23 kDa polypeptide of photosystem II. 
AK104722GATCCGACGTGGGCCAANONE 
D49713GATCCGACGTGGGCCAANONE 
J013002J02GATCCGACGTGGGCCAANONE 
J065051O13GATCCGACGTGGGCCAANONE 
J065066J18GATCCGACGTGGGCCAANONE 
J065077G23GATCCGACGTGGGCCAANONE 
J065162C22GATCCGACGTGGGCCAANONE 
J065162G22GATCCGACGTGGGCCAANONE 
J075091B13GATCCGACGTGGGCCAANONE 
J075099J22GATCCGACGTGGGCCAANONE 
J100056O22GATCCGACGTGGGCCAANONE 
J100059E01GATCCGACGTGGGCCAANONE 
J100079F20GATCCGACGTGGGCCAANONE 
Os07g0152800AK065458TACTGGGCCCACGTGTConserved hypothetical protein. 
J013022G05TACTGGGCCCACGTGTNONE 
J013023D18TACTGGGCCCACGTGTNONE 
J013048J16TACTGGGCCCACGTGTNONE 
J013055I03TACTGGGCCCACGTGTNONE 
J013057F12TACTGGGCCCACGTGTNONE 
J023109A22TACTGGGCCCACGTGTNONE 
J023148E09TACTGGGCCCACGTGTNONE 
J033069G17TACTGGGCCCACGTGTNONE 
J033092I18TACTGGGCCCACGTGTNONE 
J033093C02TACTGGGCCCACGTGTNONE 
J033141M17TACTGGGCCCACGTGTNONE 
J043016M18TACTGGGCCCACGTGTNONE 
J090016D12TACTGGGCCCACGTGTNONE 
J090071B10TACTGGGCCCACGTGTNONE 
J090098K07TACTGGGCCCACGTGTNONE 
J100035K14TACTGGGCCCACGTGTNONE 
Os07g0154900009-142-E09GGGGCCCACGTGGGCCCCACGTGTCNONE 
AK062969GGGGCCCACGTGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0173200AK061624ACCGGGCCCACGTFrigida-like family protein. 
AK065275ACCGGGCCCACGTNONE 
AK098856ACCGGGCCCACGTNONE 
AK098899ACCGGGCCCACGTNONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0190600AK070975AGCCCACGTGSimilar to Helicase. 
Os07g0301200AB110202AGCCCACGTGNONE 
AB110202CACGTGGGCCGGCNONE 
AK073463AGCCCACGTGSimilar to RNA helicase (Fragment). 
AK073463CACGTGGGCCGGCSimilar to RNA helicase (Fragment). 
Os07g0435100AB037153ACGTGGGCCTCNONE 
AK061383ACGTGGGCCTCSimilar to 26S proteasome subunit RPN12. 
AK061408ACGTGGGCCTCNONE 
AK101316ACGTGGGCCTCNONE 
J023133D07ACGTGGGCCTCNONE 
J023136B17ACGTGGGCCTCNONE 
J033065M08ACGTGGGCCTCNONE 
J033070F05ACGTGGGCCTCNONE 
J033070L20ACGTGGGCCTCNONE 
J033108J15ACGTGGGCCTCNONE 
J053080M19ACGTGGGCCTCNONE 
J053091B15ACGTGGGCCTCNONE 
J065067J03ACGTGGGCCTCNONE 
J065102C02ACGTGGGCCTCNONE 
J065135H09ACGTGGGCCTCNONE 
J080302K03ACGTGGGCCTCNONE 
J090059J11ACGTGGGCCTCNONE 
J090074G14ACGTGGGCCTCNONE 
J100025F20ACGTGGGCCTCNONE 
J100028L08ACGTGGGCCTCNONE 
J100049L14ACGTGGGCCTCNONE 
J100054O07ACGTGGGCCTCNONE 
Os07g0486000AK069343AGGTGGGCCCACGTGSimilar to MSH4. 
Os07g0486500AK063998CGGGCCCACGTGTCGRho GTPase activation protein domain containing protein. 
AK068175CGGGCCCACGTGTCGNONE 
J013130L24CGGGCCCACGTGTCGNONE 
J013156J03CGGGCCCACGTGTCGNONE 
J033031L21CGGGCCCACGTGTCGNONE 
J043001A20CGGGCCCACGTGTCGNONE 
J043007B17CGGGCCCACGTGTCGNONE 
J043017M19CGGGCCCACGTGTCGNONE 
J043024H09CGGGCCCACGTGTCGNONE 
J043030B12CGGGCCCACGTGTCGNONE 
J065177C18CGGGCCCACGTGTCGNONE 
J075004K10CGGGCCCACGTGTCGNONE 
J075004K12CGGGCCCACGTGTCGNONE 
J075088G07CGGGCCCACGTGTCGNONE 
J075107M02CGGGCCCACGTGTCGNONE 
J075126G01CGGGCCCACGTGTCGNONE 
J075185J08CGGGCCCACGTGTCGNONE 
J100034E04CGGGCCCACGTGTCGNONE 
J100038G12CGGGCCCACGTGTCGNONE 
Os07g0515700AK103117ACGTGGGCGGTGGGCTAnkyrin repeat containing protein. 
Os07g0555400AK070977CACGTGGGCCGGAConserved hypothetical protein. 
Os07g0561300AK072982ACGTGGGCTGCCyclin-like F-box domain containing protein. 
J023149I22ACGTGGGCTGCNONE 
J065149C18ACGTGGGCTGCNONE 
J065166N15ACGTGGGCTGCNONE 
J075011J01ACGTGGGCTGCNONE 
J075013I05ACGTGGGCTGCNONE 
J075039H11ACGTGGGCTGCNONE 
J075067J09ACGTGGGCTGCNONE 
J075084E08ACGTGGGCTGCNONE 
J075085E12ACGTGGGCTGCNONE 
J075090D11ACGTGGGCTGCNONE 
J075092D12ACGTGGGCTGCNONE 
J075126N17ACGTGGGCTGCNONE 
J075179F01ACGTGGGCTGCNONE 
J075184P21ACGTGGGCTGCNONE 
Os07g0570700AK065242AGTTGGGCCCAAGCCCACGTGRibosome recycling factor family protein. 
J013002I12AGTTGGGCCCAAGCCCACGTGNONE 
Os07g0589400AK072501CACGTGGGCCGGTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617CACGTGGGCCGGTNONE 
AK104756CACGTGGGCCGGTNONE 
Os07g0591400Os07g0591400GGTTGGGCCTACGTGGGCCCCCACNONE 
Os07g0591400TGGGGCCCACGTGGGCCCACANONE 
Os07g0594400J065137M02ACGTGGGCTTGGGCCACGGGCCGAConserved hypothetical protein. 
J065218E03ACGTGGGCTTGGGCCACGGGCCGANONE 
Os07g0616900AK071047ACGTGGGCCCTProtein of unknown function DUF500 family protein. 
J013106G03ACGTGGGCCCTNONE 
J013124C20ACGTGGGCCCTNONE 
J033096D16ACGTGGGCCCTNONE 
J043005E08ACGTGGGCCCTNONE 
J065197K12ACGTGGGCCCTNONE 
J065211I03ACGTGGGCCCTNONE 
Os07g0659500AK073537GACACGTGGGCCCCACCNon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0694700006-021-A10GCCACGTGGGCNONE 
006-027-C12GCCACGTGGGCNONE 
006-070-B12GCCACGTGGGCNONE 
006-077-D01GCCACGTGGGCNONE 
006-105-E07GCCACGTGGGCNONE 
006-111-H07GCCACGTGGGCNONE 
009-066-B07GCCACGTGGGCNONE 
009-199-H12GCCACGTGGGCNONE 
AB050724GCCACGTGGGCNONE 
AB053297GCCACGTGGGCNONE 
AK061715GCCACGTGGGCNONE 
AK068430GCCACGTGGGCL-ascorbate peroxidase. 
J013021I10GCCACGTGGGCNONE 
J013034P12GCCACGTGGGCNONE 
J013045L04GCCACGTGGGCNONE 
J013050F21GCCACGTGGGCNONE 
J013066C16GCCACGTGGGCNONE 
J013067N13GCCACGTGGGCNONE 
J013111K04GCCACGTGGGCNONE 
J013123I20GCCACGTGGGCNONE 
J013126F24GCCACGTGGGCNONE 
J013134J06GCCACGTGGGCNONE 
J013155B13GCCACGTGGGCNONE 
J013156P11GCCACGTGGGCNONE 
J023003N11GCCACGTGGGCNONE 
J023008D23GCCACGTGGGCNONE 
J023011I01GCCACGTGGGCNONE 
J023014M13GCCACGTGGGCNONE 
J023020A10GCCACGTGGGCNONE 
J023028F09GCCACGTGGGCNONE 
J023034I04GCCACGTGGGCNONE 
J023037L11GCCACGTGGGCNONE 
J023065M21GCCACGTGGGCNONE 
J023072C05GCCACGTGGGCNONE 
J023073M06GCCACGTGGGCNONE 
J023079M21GCCACGTGGGCNONE 
J023081M07GCCACGTGGGCNONE 
J023082O15GCCACGTGGGCNONE 
J023086M10GCCACGTGGGCNONE 
J023087H15GCCACGTGGGCNONE 
J023088K10GCCACGTGGGCNONE 
J023091G08GCCACGTGGGCNONE 
J023098C04GCCACGTGGGCNONE 
J023102D23GCCACGTGGGCNONE 
J023106M19GCCACGTGGGCNONE 
J023110D18GCCACGTGGGCNONE 
J023111B03GCCACGTGGGCNONE 
J023115I03GCCACGTGGGCNONE 
J023120G01GCCACGTGGGCNONE 
J023126C05GCCACGTGGGCNONE 
J023126C11GCCACGTGGGCNONE 
J023126F22GCCACGTGGGCNONE 
J023131L23GCCACGTGGGCNONE 
J023132K24GCCACGTGGGCNONE 
J023139P05GCCACGTGGGCNONE 
J023140F02GCCACGTGGGCNONE 
J023141F15GCCACGTGGGCNONE 
J023149G01GCCACGTGGGCNONE 
J033024O13GCCACGTGGGCNONE 
J033026M13GCCACGTGGGCNONE 
J033061C14GCCACGTGGGCNONE 
J033103E18GCCACGTGGGCNONE 
J033103L21GCCACGTGGGCNONE 
J033107I09GCCACGTGGGCNONE 
J033111N15GCCACGTGGGCNONE 
J033120G04GCCACGTGGGCNONE 
J033124J05GCCACGTGGGCNONE 
J043015A21GCCACGTGGGCNONE 
J043022H01GCCACGTGGGCNONE 
J043027O20GCCACGTGGGCNONE 
J043031F14GCCACGTGGGCNONE 
J065047K03GCCACGTGGGCNONE 
J065093N11GCCACGTGGGCNONE 
J065105P20GCCACGTGGGCNONE 
J065164L16GCCACGTGGGCNONE 
J065167K06GCCACGTGGGCNONE 
J075087I15GCCACGTGGGCNONE 
J080032F23GCCACGTGGGCNONE 
J080061N21GCCACGTGGGCNONE 
J080064L14GCCACGTGGGCNONE 
J080064L20GCCACGTGGGCNONE 
J080304B21GCCACGTGGGCNONE 
J080305A04GCCACGTGGGCNONE 
J080308L24GCCACGTGGGCNONE 
J080312J04GCCACGTGGGCNONE 
J080319N10GCCACGTGGGCNONE 
J090011C08GCCACGTGGGCNONE 
J090028G14GCCACGTGGGCNONE 
J090037N03GCCACGTGGGCNONE 
J090041I10GCCACGTGGGCNONE 
J090057B14GCCACGTGGGCNONE 
J090062P18GCCACGTGGGCNONE 
J090072L03GCCACGTGGGCNONE 
J090073A02GCCACGTGGGCNONE 
J090073C10GCCACGTGGGCNONE 
J090078N11GCCACGTGGGCNONE 
J090085L16GCCACGTGGGCNONE 
J100023N07GCCACGTGGGCNONE 
J100028F02GCCACGTGGGCNONE 
J100033K09GCCACGTGGGCNONE 
J100038K23GCCACGTGGGCNONE 
J100038O11GCCACGTGGGCNONE 
J100040G12GCCACGTGGGCNONE 
J100057L23GCCACGTGGGCNONE 
J100058N21GCCACGTGGGCNONE 
J100059N10GCCACGTGGGCNONE 
J100063D09GCCACGTGGGCNONE 
J100065O12GCCACGTGGGCNONE 
J100066G11GCCACGTGGGCNONE 
J100067I01GCCACGTGGGCNONE 
J100069J23GCCACGTGGGCNONE 
J100071M03GCCACGTGGGCNONE 
J100072C11GCCACGTGGGCNONE 
J100072D01GCCACGTGGGCNONE 
J100079M19GCCACGTGGGCNONE 
Os07g0695400015-036-B08ACGTGGGCTGCNONE 
AK100615ACGTGGGCTGCNONE 
AK106304ACGTGGGCTGCKIP1-like domain containing protein. 
J023108B01ACGTGGGCTGCNONE 
Os08g0150800AK101530AGCCCACGTSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0195400006-057-E04CACGTGGGCTGGNONE 
006-060-B10CACGTGGGCTGGNONE 
AK070464CACGTGGGCTGGConserved hypothetical protein. 
AK104389CACGTGGGCTGGNONE 
AK106140CACGTGGGCTGGNONE 
J023013G08CACGTGGGCTGGNONE 
J023054K19CACGTGGGCTGGNONE 
J023089D18CACGTGGGCTGGNONE 
J023092K05CACGTGGGCTGGNONE 
J033025A08CACGTGGGCTGGNONE 
J033067P12CACGTGGGCTGGNONE 
J033098A10CACGTGGGCTGGNONE 
J065219L04CACGTGGGCTGGNONE 
J090021P06CACGTGGGCTGGNONE 
J090062M05CACGTGGGCTGGNONE 
J090079F15CACGTGGGCTGGNONE 
J100041H19CACGTGGGCTGGNONE 
Os08g0224200AK101331CACGTGGGCTGGSimilar to Ythdf2-prov protein. 
Os08g0305000AK102896TGTGGGGCCCACGTGGGNONE 
AK107492TGTGGGGCCCACGTGGGHypothetical protein. 
Os08g0386300AK059323GTGGCCCACGTGGCNONE 
AK070379GTGGCCCACGTGGCCytochrome b5 domain containing protein. 
J023054P20GTGGCCCACGTGGCNONE 
J033089H01GTGGCCCACGTGGCNONE 
J065013I01GTGGCCCACGTGGCNONE 
J065212E17GTGGCCCACGTGGCNONE 
J080317O15GTGGCCCACGTGGCNONE 
J090018O07GTGGCCCACGTGGCNONE 
Os08g0398000AK101910CACTGACACGTGGGCCCCACAABC transporter related domain containing protein. 
Os08g0473650J065031A07AATTGGGCCCACGTGTCHypothetical protein. 
J065129E01AATTGGGCCCACGTGTCNONE 
J065134I05AATTGGGCCCACGTGTCNONE 
J065212K13AATTGGGCCCACGTGTCNONE 
J065217M14AATTGGGCCCACGTGTCNONE 
Os08g0485700AK068131TCGGCCCACGTNONE 
AK069097TCGGCCCACGTMethyl-CpG binding domain containing protein. 
J013130L03TCGGCCCACGTNONE 
Os08g0535400004-001-H10GAGACGTGGGCCCCACCCTCGCGCGCNONE 
AK071527GAGACGTGGGCCCCACCCTCGCGCGCZinc finger, DHHC-type domain containing protein. 
J023107B02GAGACGTGGGCCCCACCCTCGCGCGCNONE 
Os08g0544500AK071354ACGTGGGCCCGSimilar to ARP2/3 regulatory protein subunit NAPP. 
Os08g0549300009-008-F01CGCCACGTGGGCCCCACCNONE 
009-033-G10CGCCACGTGGGCCCCACCNONE 
AK120938CGCCACGTGGGCCCCACCSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420CGCCACGTGGGCCCCACCNONE 
J023037A21CGCCACGTGGGCCCCACCNONE 
J023066D20CGCCACGTGGGCCCCACCNONE 
J033099K13CGCCACGTGGGCCCCACCNONE 
J065116C14CGCCACGTGGGCCCCACCNONE 
J075009K15CGCCACGTGGGCCCCACCNONE 
J075071P13CGCCACGTGGGCCCCACCNONE 
J075080D18CGCCACGTGGGCCCCACCNONE 
J075124F24CGCCACGTGGGCCCCACCNONE 
J075198F23CGCCACGTGGGCCCCACCNONE 
J080006B15CGCCACGTGGGCCCCACCNONE 
J090078H13CGCCACGTGGGCCCCACCNONE 
J090089J09CGCCACGTGGGCCCCACCNONE 
J100017A03CGCCACGTGGGCCCCACCNONE 
J100023G03CGCCACGTGGGCCCCACCNONE 
Os08g0556200009-008-D12ACGTGGGCCCCNONE 
AK121222ACGTGGGCCCCSimilar to Dihydroneopterin aldolase. 
J023090H22ACGTGGGCCCCNONE 
J075027J23ACGTGGGCCCCNONE 
J075032L14ACGTGGGCCCCNONE 
J075053H04ACGTGGGCCCCNONE 
J075171P20ACGTGGGCCCCNONE 
J100057F12ACGTGGGCCCCNONE 
Os09g0113000009-104-D11GCCCACGTNONE 
AK062770GCCCACGTHypothetical protein. 
Os09g0332700AK067899CACGGCCCACGTSimilar to PDR-type ABC transporter 2 (Fragment). 
Os09g0462200AK064734CACGTGGGCCACEsterase/lipase/thioesterase domain containing protein. 
Os09g0462300J065097M23GTGGCCCACGTGEsterase/lipase/thioesterase domain containing protein. 
J065161K12GTGGCCCACGTGNONE 
Os09g0468900AK120990TCGGCCCATCAGGCCCACGTConserved hypothetical protein. 
J013123P13TCGGCCCATCAGGCCCACGTNONE 
J023013I09TCGGCCCATCAGGCCCACGTNONE 
J023023G08TCGGCCCATCAGGCCCACGTNONE 
J023043E08TCGGCCCATCAGGCCCACGTNONE 
J033124D24TCGGCCCATCAGGCCCACGTNONE 
J065047I07TCGGCCCATCAGGCCCACGTNONE 
J065093C16TCGGCCCATCAGGCCCACGTNONE 
J090088O03TCGGCCCATCAGGCCCACGTNONE 
J100032M21TCGGCCCATCAGGCCCACGTNONE 
Os09g0517800012-034-H10CCACGGCCTGGATGGGCCCACGTNONE 
AK121391CCACGGCCTGGATGGGCCCACGTCyclin-like F-box domain containing protein. 
J023129D04CCACGGCCTGGATGGGCCCACGTNONE 
J043012D11CCACGGCCTGGATGGGCCCACGTNONE 
Os11g0187500012-002-D06TCATGGGCTATGGCCCACGTNONE 
012-035-H04TCATGGGCTATGGCCCACGTNONE 
012-065-F08TCATGGGCTATGGCCCACGTNONE 
AK063977TCATGGGCTATGGCCCACGTSimilar to Heat shock protein 70. 
AK103083TCATGGGCTATGGCCCACGTNONE 
J033118G15TCATGGGCTATGGCCCACGTNONE 
J065115E02TCATGGGCTATGGCCCACGTNONE 
J065178K04TCATGGGCTATGGCCCACGTNONE 
J065178L03TCATGGGCTATGGCCCACGTNONE 
J090064A22TCATGGGCTATGGCCCACGTNONE 
Os11g0199600AK101774TCGGCCCATTAACGGCCCACGTZinc finger, CCHC-type domain containing protein. 
AK120040TCGGCCCATTAACGGCCCACGTNONE 
J023047I06TCGGCCCATTAACGGCCCACGTNONE 
J033064L23TCGGCCCATTAACGGCCCACGTNONE 
J033117I01TCGGCCCATTAACGGCCCACGTNONE 
J033123I18TCGGCCCATTAACGGCCCACGTNONE 
J053026H17TCGGCCCATTAACGGCCCACGTNONE 
J053078G05TCGGCCCATTAACGGCCCACGTNONE 
J065102A09TCGGCCCATTAACGGCCCACGTNONE 
J065113G11TCGGCCCATTAACGGCCCACGTNONE 
J065207F20TCGGCCCATTAACGGCCCACGTNONE 
J075027K21TCGGCCCATTAACGGCCCACGTNONE 
Os11g0200600AK101818GCCACGTGGGCCyclin-like F-box domain containing protein. 
AK111444GCCACGTGGGCNONE 
J065098I12GCCACGTGGGCNONE 
Os11g0216100AK059179ACGTGGGCCCGGGSimilar to Chaperone protein dnaJ. 
Os11g0530600AB000801AGCCCACGTGGCSimilar to Chalcone synthase C2 (EC 2.3.1.74) (Naringenin-chalcone synthase C2). 
AK067810AGCCCACGTGGCNONE 
D29697AGCCCACGTGGCNONE 
J013119K06AGCCCACGTGGCNONE 
J023001C21AGCCCACGTGGCNONE 
J023081C19AGCCCACGTGGCNONE 
J065026K21AGCCCACGTGGCNONE 
J065040A17AGCCCACGTGGCNONE 
J065043H01AGCCCACGTGGCNONE 
J065093P05AGCCCACGTGGCNONE 
J065104P15AGCCCACGTGGCNONE 
J065127C09AGCCCACGTGGCNONE 
J065140D08AGCCCACGTGGCNONE 
X89859AGCCCACGTGGCNONE 
Os11g0582400AF049348CCCCCGCGCGCGACGTGGGCTConserved hypothetical protein. 
AF516927CCCCCGCGCGCGACGTGGGCTNONE 
AK073083CCCCCGCGCGCGACGTGGGCTNONE 
AK108352CCCCCGCGCGCGACGTGGGCTNONE 
J075005O16CCCCCGCGCGCGACGTGGGCTNONE 
J075007D15CCCCCGCGCGCGACGTGGGCTNONE 
J075007L04CCCCCGCGCGCGACGTGGGCTNONE 
J075009C11CCCCCGCGCGCGACGTGGGCTNONE 
J075012L11CCCCCGCGCGCGACGTGGGCTNONE 
J075013A14CCCCCGCGCGCGACGTGGGCTNONE 
J075015K01CCCCCGCGCGCGACGTGGGCTNONE 
J075019O21CCCCCGCGCGCGACGTGGGCTNONE 
J075020G20CCCCCGCGCGCGACGTGGGCTNONE 
J075020H06CCCCCGCGCGCGACGTGGGCTNONE 
J075022D07CCCCCGCGCGCGACGTGGGCTNONE 
J075024M12CCCCCGCGCGCGACGTGGGCTNONE 
J075025G04CCCCCGCGCGCGACGTGGGCTNONE 
J075026F09CCCCCGCGCGCGACGTGGGCTNONE 
J075027D19CCCCCGCGCGCGACGTGGGCTNONE 
J075030A12CCCCCGCGCGCGACGTGGGCTNONE 
J075030C16CCCCCGCGCGCGACGTGGGCTNONE 
J075030D15CCCCCGCGCGCGACGTGGGCTNONE 
J075034M20CCCCCGCGCGCGACGTGGGCTNONE 
J075041H12CCCCCGCGCGCGACGTGGGCTNONE 
J075052D12CCCCCGCGCGCGACGTGGGCTNONE 
J075052G11CCCCCGCGCGCGACGTGGGCTNONE 
J075053L09CCCCCGCGCGCGACGTGGGCTNONE 
J075064G05CCCCCGCGCGCGACGTGGGCTNONE 
J075067J01CCCCCGCGCGCGACGTGGGCTNONE 
J075071O03CCCCCGCGCGCGACGTGGGCTNONE 
J075072G12CCCCCGCGCGCGACGTGGGCTNONE 
J075078H06CCCCCGCGCGCGACGTGGGCTNONE 
J075081D06CCCCCGCGCGCGACGTGGGCTNONE 
J075084G23CCCCCGCGCGCGACGTGGGCTNONE 
J075085M10CCCCCGCGCGCGACGTGGGCTNONE 
J075087N20CCCCCGCGCGCGACGTGGGCTNONE 
J075088E11CCCCCGCGCGCGACGTGGGCTNONE 
J075088O22CCCCCGCGCGCGACGTGGGCTNONE 
J075091E10CCCCCGCGCGCGACGTGGGCTNONE 
J075092B12CCCCCGCGCGCGACGTGGGCTNONE 
J075093E08CCCCCGCGCGCGACGTGGGCTNONE 
J075095D04CCCCCGCGCGCGACGTGGGCTNONE 
J075095J10CCCCCGCGCGCGACGTGGGCTNONE 
J075095O19CCCCCGCGCGCGACGTGGGCTNONE 
J075096H20CCCCCGCGCGCGACGTGGGCTNONE 
J075098F10CCCCCGCGCGCGACGTGGGCTNONE 
J075100H10CCCCCGCGCGCGACGTGGGCTNONE 
J075104C23CCCCCGCGCGCGACGTGGGCTNONE 
J075105B10CCCCCGCGCGCGACGTGGGCTNONE 
J075106I24CCCCCGCGCGCGACGTGGGCTNONE 
J075109H23CCCCCGCGCGCGACGTGGGCTNONE 
J075115A03CCCCCGCGCGCGACGTGGGCTNONE 
J075118M06CCCCCGCGCGCGACGTGGGCTNONE 
J075121G08CCCCCGCGCGCGACGTGGGCTNONE 
J075122C09CCCCCGCGCGCGACGTGGGCTNONE 
J075122J12CCCCCGCGCGCGACGTGGGCTNONE 
J075123E06CCCCCGCGCGCGACGTGGGCTNONE 
J075123E16CCCCCGCGCGCGACGTGGGCTNONE 
J075124N09CCCCCGCGCGCGACGTGGGCTNONE 
J075127F23CCCCCGCGCGCGACGTGGGCTNONE 
J075128H17CCCCCGCGCGCGACGTGGGCTNONE 
J075129C02CCCCCGCGCGCGACGTGGGCTNONE 
J075139P18CCCCCGCGCGCGACGTGGGCTNONE 
J075140H17CCCCCGCGCGCGACGTGGGCTNONE 
J075146E12CCCCCGCGCGCGACGTGGGCTNONE 
J075146I07CCCCCGCGCGCGACGTGGGCTNONE 
J075150A08CCCCCGCGCGCGACGTGGGCTNONE 
J075150I22CCCCCGCGCGCGACGTGGGCTNONE 
J075155D01CCCCCGCGCGCGACGTGGGCTNONE 
J075155N10CCCCCGCGCGCGACGTGGGCTNONE 
J075155O09CCCCCGCGCGCGACGTGGGCTNONE 
J075156K11CCCCCGCGCGCGACGTGGGCTNONE 
J075157N01CCCCCGCGCGCGACGTGGGCTNONE 
J075164L09CCCCCGCGCGCGACGTGGGCTNONE 
J075166F14CCCCCGCGCGCGACGTGGGCTNONE 
J075169E20CCCCCGCGCGCGACGTGGGCTNONE 
J075170B13CCCCCGCGCGCGACGTGGGCTNONE 
J075170F24CCCCCGCGCGCGACGTGGGCTNONE 
J075170N16CCCCCGCGCGCGACGTGGGCTNONE 
J075172H22CCCCCGCGCGCGACGTGGGCTNONE 
J075172I02CCCCCGCGCGCGACGTGGGCTNONE 
J075176E08CCCCCGCGCGCGACGTGGGCTNONE 
J075177H17CCCCCGCGCGCGACGTGGGCTNONE 
J075179C18CCCCCGCGCGCGACGTGGGCTNONE 
J075182H23CCCCCGCGCGCGACGTGGGCTNONE 
J075187B10CCCCCGCGCGCGACGTGGGCTNONE 
J075192L10CCCCCGCGCGCGACGTGGGCTNONE 
J075195C04CCCCCGCGCGCGACGTGGGCTNONE 
U25969CCCCCGCGCGCGACGTGGGCTNONE 
Os11g0586300AK072257TCGGCCCGGCCCACGTConserved hypothetical protein. 
Os11g0595200009-005-A06GCCCACGTGNONE 
AK071115GCCCACGTGNONE 
AK106159GCCCACGTGPAP fibrillin family protein. 
AY387683GCCCACGTGNONE 
AY387684GCCCACGTGNONE 
J065166K17GCCCACGTGNONE 
Os11g0615700AB026561ACACGTGGGCCCGCANONE 
AK059521ACACGTGGGCCCGCANONE 
AK103487ACACGTGGGCCCGCAProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14ACACGTGGGCCCGCANONE 
J065044A11ACACGTGGGCCCGCANONE 
J065090I02ACACGTGGGCCCGCANONE 
J065104I09ACACGTGGGCCCGCANONE 
J065187J10ACACGTGGGCCCGCANONE 
J075024E07ACACGTGGGCCCGCANONE 
J075025O13ACACGTGGGCCCGCANONE 
J090062N12ACACGTGGGCCCGCANONE 
J090087G06ACACGTGGGCCCGCANONE 
J090098K11ACACGTGGGCCCGCANONE 
Os11g0620400AK068224ATCGGACGGCCCACGTNONE 
AK120270ATCGGACGGCCCACGTConserved hypothetical protein. 
Os11g0659500AK068543ACGTGGGCCACSimilar to Acyl-ACP thioesterase (Fragment). 
AK068543ACGTGGGCCACSimilar to Acyl-ACP thioesterase (Fragment). 
J013072O18ACGTGGGCCACNONE 
J013072O18ACGTGGGCCACNONE 
J013097B18ACGTGGGCCACNONE 
J013097B18ACGTGGGCCACNONE 
J013157H03ACGTGGGCCACNONE 
J013157H03ACGTGGGCCACNONE 
J023001D14ACGTGGGCCACNONE 
J023001D14ACGTGGGCCACNONE 
J080311F23ACGTGGGCCACNONE 
J080311F23ACGTGGGCCACNONE 
J090030F08ACGTGGGCCACNONE 
J090030F08ACGTGGGCCACNONE 
J090036B09ACGTGGGCCACNONE 
J090036B09ACGTGGGCCACNONE 
J090045G05ACGTGGGCCACNONE 
J090045G05ACGTGGGCCACNONE 
J100054J10ACGTGGGCCACNONE 
J100054J10ACGTGGGCCACNONE 
Os12g0133600AK103096ACGTGGGCTTTConserved hypothetical protein. 
J033118M03ACGTGGGCTTTNONE 
Os12g0145200AK111428GTGGGACCCACGTGGGCCCCACASimilar to Protein MONOCULM 1. 
J065208D22GTGGGACCCACGTGGGCCCCACANONE 
Os12g0233500Os12g0233500CCCACGTGGGCCCCANONE 
Os12g0242500J065129F10AGTGACACGTGGGCCTCNONE 
J090032G12AGTGACACGTGGGCCTCConserved hypothetical protein. 
Os12g0285600AK069104CGACACGTGGGCCATOxysterol-binding protein family protein. 
Os12g0403800AK059940ACGTGGGCCTCACGTGGGNONE 
AK064189ACGTGGGCCTCACGTGGGExoribonuclease domain containing protein. 
Os12g0460800J023003J21CACTGACACGTGGGCCACNONE 
Os12g0507600009-155-B05TGGGGCCCACGTNONE 
AK070613TGGGGCCCACGTConserved hypothetical protein. 
J023063G03TGGGGCCCACGTNONE 
Os12g0554400AK072345GACACGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os12g0560300AK060332CCCGGGCCCACGTGTCSimilar to NTGB2 (Fragment). 
AK099125CCCGGGCCCACGTGTCNONE 
AK099149CCCGGGCCCACGTGTCNONE 
J023044P12CCCGGGCCCACGTGTCNONE 
J023063C05CCCGGGCCCACGTGTCNONE 
J043006H11CCCGGGCCCACGTGTCNONE 
J065055C21CCCGGGCCCACGTGTCNONE 
J065104A14CCCGGGCCCACGTGTCNONE 
J075156I06CCCGGGCCCACGTGTCNONE 
J090083J19CCCGGGCCCACGTGTCNONE 
J100069A17CCCGGGCCCACGTGTCNONE 
Os12g0573000AK067552AACGGCCCACGGCCCACGTHypothetical protein. 
AK069292AACGGCCCACGGCCCACGTNONE 
Os12g0578500AK065485ACACGTGGGCGlycosyl transferase, family 8 protein. 
J043027D21ACACGTGGGCNONE 
J075120F12ACACGTGGGCNONE 
J080010J21ACACGTGGGCNONE 
J080015L10ACACGTGGGCNONE 
J080016C19ACACGTGGGCNONE 
J080016F10ACACGTGGGCNONE 
J080022A12ACACGTGGGCNONE 
J080024B10ACACGTGGGCNONE 
J080025C16ACACGTGGGCNONE 
J080026B03ACACGTGGGCNONE 
J080028B11ACACGTGGGCNONE 
J080028M19ACACGTGGGCNONE 
J080030I02ACACGTGGGCNONE 
J080032F18ACACGTGGGCNONE 
J080038O16ACACGTGGGCNONE 
J080040D01ACACGTGGGCNONE 
J080043H19ACACGTGGGCNONE 
J080045N21ACACGTGGGCNONE 
J080046H14ACACGTGGGCNONE 
J080053B20ACACGTGGGCNONE 
J080053P14ACACGTGGGCNONE 
J080056L15ACACGTGGGCNONE 
J080057F14ACACGTGGGCNONE 
J080060C10ACACGTGGGCNONE 
J080061D20ACACGTGGGCNONE 
J080061J12ACACGTGGGCNONE 
J080062F17ACACGTGGGCNONE 
J080065M15ACACGTGGGCNONE 
J080066N15ACACGTGGGCNONE 
J080069K21ACACGTGGGCNONE 
J080070L14ACACGTGGGCNONE 
J080072L05ACACGTGGGCNONE 
J080072L16ACACGTGGGCNONE 
J080075D08ACACGTGGGCNONE 
J080075I19ACACGTGGGCNONE 
J080076M24ACACGTGGGCNONE 
J080077M11ACACGTGGGCNONE 
J080078O10ACACGTGGGCNONE 
J080081K24ACACGTGGGCNONE 
J080082J02ACACGTGGGCNONE 
J080083N20ACACGTGGGCNONE 
J080085M09ACACGTGGGCNONE 
J080093K05ACACGTGGGCNONE 
J080094J19ACACGTGGGCNONE 
J080095E06ACACGTGGGCNONE 
J080096B04ACACGTGGGCNONE 
J080096H08ACACGTGGGCNONE 
J090034I21ACACGTGGGCNONE 
J090045J19ACACGTGGGCNONE 
J090065F20ACACGTGGGCNONE 
J100077M24ACACGTGGGCNONE 
Os12g0580400AK099986GCCACGTGGGCCCACCAmino acid/polyamine transporter I family protein. 
J065120C05GCCACGTGGGCCCACCNONE 
Os12g0596000AK073530ACAGCCCACGTSimilar to Lipoyltransferase (EC 2.3.1.-) (Lipoyl-[acyl-carrier protein]-protein- N-lipoyltransferase) (Lipoate-protein ligase B). 
AK101541ACAGCCCACGTNONE 
Os12g0609800AK101303CCCGGCCCACGTCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01CCCGGCCCACGTNONE 
J033033K21CCCGGCCCACGTNONE 
J033082L13CCCGGCCCACGTNONE 
J043034M20CCCGGCCCACGTNONE 
J065137J24CCCGGCCCACGTNONE 
J065141A11CCCGGCCCACGTNONE 
J065217H09CCCGGCCCACGTNONE 
Os12g0621500AK111785TGTGGGGCCCACGTGSimilar to IRE. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.