version

Summary of OsREG451 (All List)

OrganismOryza sativa  
IDOsREG451  
SequenceACGTGTCC  
Annotation  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE MotifACGTGKC  Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T;  
Total Entry Count1333  

Entry Sequences (1333 entries)

LocusGene modelSequenceDescription
Os01g0104900012-050-A08GGACACGTNONE 
AK121535GGACACGTTransferase family protein. 
Os01g0138500AK073435CACGTGTCCProtein of unknown function DUF789 family protein. 
J023118K18CACGTGTCCNONE 
J033039C22CACGTGTCCNONE 
Os01g0175100AK071289CGCCACGTGTCCKv1.4 voltage-gated K+ channel family protein. 
J023088B10CGCCACGTGTCCNONE 
J065122H15CGCCACGTGTCCNONE 
J065140B19CGCCACGTGTCCNONE 
J100031E12CGCCACGTGTCCNONE 
J100068J03CGCCACGTGTCCNONE 
J100083E12CGCCACGTGTCCNONE 
Os01g0176500AK102552CCCACGTGTCCCTCAConserved hypothetical protein. 
Os01g0218700AK064992GGACACGTGTCCABC transporter, transmembrane region, type 1 domain containing protein. 
Os01g0276300AK108165ACGTGTCCSimilar to Group 3 late embryogenesis abundant protein (Fragment). 
Os01g0281100AK109672GGTGGGACCCACGTGGACACGTGGCConserved hypothetical protein. 
J065013K07GGTGGGACCCACGTGGACACGTGGCNONE 
J065040E15GGTGGGACCCACGTGGACACGTGGCNONE 
J065127F12GGTGGGACCCACGTGGACACGTGGCNONE 
J075155K23GGTGGGACCCACGTGGACACGTGGCNONE 
Os01g0303300J053035N19GGACACGTNONE 
J075042F02GGACACGTNONE 
J075068E10GGACACGTNONE 
J075116E19GGACACGTNONE 
J075131C10GGACACGTNONE 
J075145J11GGACACGTNONE 
J075157P20GGACACGTMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12GGACACGTNONE 
Os01g0382450J065084M05GCCACGTGTCCHypothetical protein. 
J065155G18GCCACGTGTCCNONE 
Os01g0514300AK121086ACGTGTCCLissencephaly type-1-like homology motif domain containing protein. 
Os01g0644900AK106910ACGTGTCCConserved hypothetical protein. 
J100038B07ACGTGTCCNONE 
J100044M17ACGTGTCCNONE 
Os01g0646300AY464568ACGTGTCCSimilar to RGA2 protein. 
J080011P15ACGTGTCCNONE 
J080017D01ACGTGTCCNONE 
J080017H05ACGTGTCCNONE 
J080027A16ACGTGTCCNONE 
J080039F17ACGTGTCCNONE 
J080063E23ACGTGTCCNONE 
J080067L23ACGTGTCCNONE 
J080068H01ACGTGTCCNONE 
J080071F01ACGTGTCCNONE 
J080076J05ACGTGTCCNONE 
J080092L17ACGTGTCCNONE 
Os01g0664500J075157K10GACACGTGTCCNONE 
J100023K08GACACGTGTCCNONE 
J100052N02GACACGTGTCCNONE 
Os01g0685900AK064024CCCACGTGTCCNONE 
AK102005CCCACGTGTCCSimilar to 65kD microtubule associated protein. 
Os01g0720700J033124M22ACGTGTCCNONE 
J065006G21ACGTGTCCNONE 
J065025M24ACGTGTCCNONE 
J065041J02ACGTGTCCNONE 
J065044B14ACGTGTCCNONE 
J065061J06ACGTGTCCNONE 
J065116L21ACGTGTCCNONE 
J075030F18ACGTGTCCNONE 
J075034K17ACGTGTCCNONE 
J075063I02ACGTGTCCNONE 
J075110D21ACGTGTCCSimilar to Serine acetyltransferase. 
J075188L15ACGTGTCCNONE 
J075197B17ACGTGTCCNONE 
Os01g0743400AK059177GGACACGTSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114GGACACGTNONE 
J065070E07GGACACGTNONE 
J065152G11GGACACGTNONE 
Os01g0757200AB092485GGACACGTNONE 
AK060666GGACACGTNONE 
AK060714GGACACGTNONE 
AK099350GGACACGTNONE 
AK101713GGACACGTSimilar to GA 2-oxidase 4. 
Os01g0770400006-112-B08GGACACGTNONE 
AK061253GGACACGTNONE 
AK061585GGACACGTCyclin-like F-box domain containing protein. 
Os01g0806400Os01g0806400GAGACGTGTCCProtein of unknown function DUF617, plant family protein. 
Os01g0816700AK100654GGACACGTSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase). 
Os01g0835500AK100241GCCCACGTGTCCSimilar to Respiratory burst oxidase protein. 
Os01g0865100016-066-A05GGACACGTCACNONE 
AK065779GGACACGTCACNONE 
AK071410GGACACGTCACSimilar to Uricase (Fragment). 
J013039E23GGACACGTCACNONE 
J023024I07GGACACGTCACNONE 
J065160J15GGACACGTCACNONE 
J090052J17GGACACGTCACNONE 
Os01g0915200AK121863ACGTGTCCSimilar to Cystatin. 
Os02g0119400AK060055TTGGCCCACGTGTCCNONE 
AK102774TTGGCCCACGTGTCCSimilar to Syntaxin 52 (AtSYP52). 
J033107H09TTGGCCCACGTGTCCNONE 
J075175F09TTGGCCCACGTGTCCNONE 
J090011H05TTGGCCCACGTGTCCNONE 
J090091O05TTGGCCCACGTGTCCNONE 
Os02g0173100AK066680GGACACGTNONE 
AK100596GGACACGTSimilar to Cytochrome P450 97B3 (EC 1.14.-.-). 
J023106P10GGACACGTNONE 
Os02g0176300AK066588GGACACGTGTCConserved hypothetical protein. 
J013072N24GGACACGTGTCNONE 
Os02g0186500AK068056CGCCACGTGTCCGACCCGCSimilar to Protein kinase-like protein. 
AK099031CGCCACGTGTCCGACCCGCNONE 
J013111A12CGCCACGTGTCCGACCCGCNONE 
J013127K13CGCCACGTGTCCGACCCGCNONE 
J013132O11CGCCACGTGTCCGACCCGCNONE 
J023056A11CGCCACGTGTCCGACCCGCNONE 
J023078M08CGCCACGTGTCCGACCCGCNONE 
J033081F07CGCCACGTGTCCGACCCGCNONE 
J090079E24CGCCACGTGTCCGACCCGCNONE 
J090097I02CGCCACGTGTCCGACCCGCNONE 
Os02g0250600J075143F23ACGTGTCCLate embryogenesis abundant protein repeat containing protein. 
Os02g0453300006-099-D03GGCCGTCCACGTGTCCNONE 
009-120-D02GGCCGTCCACGTGTCCNONE 
AK071220GGCCGTCCACGTGTCCNONE 
AK109380GGCCGTCCACGTGTCCConserved hypothetical protein. 
J023083M17GGCCGTCCACGTGTCCNONE 
Os02g0602300AK065609GGACACGTGNONE 
AK066929GGACACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GGACACGTGNONE 
J090040I23GGACACGTGNONE 
Os02g0651300AK061454ACGTGTCCNONE 
AK099767ACGTGTCCConserved hypothetical protein. 
Os02g0673000AK108650ACGTGTCCProtein of unknown function UPF0005 family protein. 
Os02g0717900AK069653GGACACGTGGCGMSF1 domain containing protein. 
J023031J12GGACACGTGGCGNONE 
J075195G22GGACACGTGGCGNONE 
J100088O11GGACACGTGGCGNONE 
Os02g0721800AK100043GCGGGCCCCACGTGTCCSimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0733900AK111335GGACACGTGConserved hypothetical protein. 
J065092J17GGACACGTGNONE 
J065140P16GGACACGTGNONE 
J065191N21GGACACGTGNONE 
Os02g0753800AK101787GGACACGTSimilar to Annexin p35. 
Os02g0824400AK121390CGCCACGTGTCCConserved hypothetical protein. 
AK121390GCCACGTGTCCConserved hypothetical protein. 
J023128P21CGCCACGTGTCCNONE 
J023128P21GCCACGTGTCCNONE 
J053097O16CGCCACGTGTCCNONE 
J053097O16GCCACGTGTCCNONE 
J065012I02CGCCACGTGTCCNONE 
J065012I02GCCACGTGTCCNONE 
J065049C06CGCCACGTGTCCNONE 
J065049C06GCCACGTGTCCNONE 
J065051H02CGCCACGTGTCCNONE 
J065051H02GCCACGTGTCCNONE 
J065069A13CGCCACGTGTCCNONE 
J065069A13GCCACGTGTCCNONE 
J065082E04CGCCACGTGTCCNONE 
J065082E04GCCACGTGTCCNONE 
J065102N09CGCCACGTGTCCNONE 
J065102N09GCCACGTGTCCNONE 
J065157O10CGCCACGTGTCCNONE 
J065157O10GCCACGTGTCCNONE 
J065188N23CGCCACGTGTCCNONE 
J065188N23GCCACGTGTCCNONE 
J065190J11CGCCACGTGTCCNONE 
J065190J11GCCACGTGTCCNONE 
J065202M09CGCCACGTGTCCNONE 
J065202M09GCCACGTGTCCNONE 
Os02g0824500AK111296GGACACGTGGCSimilar to Remorin. 
AK111296GGACACGTGGCGSimilar to Remorin. 
J065048M11GGACACGTGGCNONE 
J065048M11GGACACGTGGCGNONE 
J065081F01GGACACGTGGCNONE 
J065081F01GGACACGTGGCGNONE 
Os03g0122200009-052-H10CACGTGTCCGGCCCNONE 
AB042934CACGTGTCCGGCCCNONE 
AK065033CACGTGTCCGGCCCSimilar to 50S ribosomal protein L11. 
J013001H03CACGTGTCCGGCCCNONE 
J023149C23CACGTGTCCGGCCCNONE 
J065025J15CACGTGTCCGGCCCNONE 
J065093D22CACGTGTCCGGCCCNONE 
Os03g0134300AK102053ACGTGTCCCACCACSimilar to ATP phosphoribosyl transferase. 
Os03g0142900011-054-A05GGACACGTNONE 
AK067103GGACACGTNONE 
AK120438GGACACGTProtein of unknown function DUF946, plant family protein. 
J013097D18GGACACGTNONE 
J013098E18GGACACGTNONE 
J013099I17GGACACGTNONE 
J013108C09GGACACGTNONE 
J023045J15GGACACGTNONE 
J033034E13GGACACGTNONE 
J033095F07GGACACGTNONE 
J033102N22GGACACGTNONE 
J065016C14GGACACGTNONE 
J065034E13GGACACGTNONE 
J065065F21GGACACGTNONE 
J065159M09GGACACGTNONE 
J075012C13GGACACGTNONE 
J075017P18GGACACGTNONE 
J075018M03GGACACGTNONE 
J075021H19GGACACGTNONE 
J075070K23GGACACGTNONE 
J075077B18GGACACGTNONE 
J075085E20GGACACGTNONE 
J075090N23GGACACGTNONE 
J075137M16GGACACGTNONE 
J075151E03GGACACGTNONE 
J090042L02GGACACGTNONE 
J090060C21GGACACGTNONE 
J090089I17GGACACGTNONE 
J100024L19GGACACGTNONE 
J100025A06GGACACGTNONE 
J100033C24GGACACGTNONE 
J100052J17GGACACGTNONE 
J100063H10GGACACGTNONE 
J100073P04GGACACGTNONE 
J100075D01GGACACGTNONE 
J100077J17GGACACGTNONE 
J100087F03GGACACGTNONE 
J100087F09GGACACGTNONE 
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
AK066932GGTGACGTGTCCSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0251500AK101151ACGTGTCCNONE 
AK119298ACGTGTCCSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0288700AK110718GGACACGTCACCAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0298300AK061180CCACGTGTCCProtein of unknown function DUF588 family protein. 
AK099089CCACGTGTCCNONE 
Os03g0300400AF395880ACGTGTCCNONE 
AK121376ACGTGTCCPathogen-related protein (JIOsPR10). 
J013036K14ACGTGTCCNONE 
J023019C05ACGTGTCCNONE 
J023068B20ACGTGTCCNONE 
J023074O20ACGTGTCCNONE 
J023093P15ACGTGTCCNONE 
J023119D19ACGTGTCCNONE 
J023127E15ACGTGTCCNONE 
J023143G09ACGTGTCCNONE 
J033087E12ACGTGTCCNONE 
J075191C11ACGTGTCCNONE 
J100023P07ACGTGTCCNONE 
J100032G15ACGTGTCCNONE 
J100074L17ACGTGTCCNONE 
Os03g0305600014-071-F12ACGTGTCCGGCCCNONE 
AK063714ACGTGTCCGGCCCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065005E12ACGTGTCCGGCCCNONE 
J075099I09ACGTGTCCGGCCCNONE 
J075152H24ACGTGTCCGGCCCNONE 
J075177J04ACGTGTCCGGCCCNONE 
Os03g0322500009-014-F03GGACACGTGGCNONE 
009-076-G10GGACACGTGGCNONE 
009-100-C01GGACACGTGGCNONE 
009-106-F02GGACACGTGGCNONE 
009-123-H11GGACACGTGGCNONE 
009-158-C09GGACACGTGGCNONE 
009-172-D04GGACACGTGGCNONE 
009-179-C11GGACACGTGGCNONE 
009-188-B12GGACACGTGGCNONE 
009-194-D07GGACACGTGGCNONE 
AK103503GGACACGTGGCNONE 
AK121029GGACACGTGGCSimilar to 14 kDa zinc-binding protein (Protein kinase C inhibitor) (PKCI). 
J013066O21GGACACGTGGCNONE 
J023050G22GGACACGTGGCNONE 
J023103H15GGACACGTGGCNONE 
J033075B11GGACACGTGGCNONE 
J033091E24GGACACGTGGCNONE 
J033098N14GGACACGTGGCNONE 
J053089B02GGACACGTGGCNONE 
J065039M05GGACACGTGGCNONE 
J065210G05GGACACGTGGCNONE 
J090036P06GGACACGTGGCNONE 
J090040M04GGACACGTGGCNONE 
Os03g0340500012-007-F10GGACACGTNONE 
AK099406GGACACGTNONE 
AK102158GGACACGTSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13GGACACGTNONE 
J013063E02GGACACGTNONE 
J013063I02GGACACGTNONE 
J013157O07GGACACGTNONE 
J023131N05GGACACGTNONE 
J033033P05GGACACGTNONE 
J033040N16GGACACGTNONE 
J033044M19GGACACGTNONE 
J033086F24GGACACGTNONE 
J033097H01GGACACGTNONE 
J033106C22GGACACGTNONE 
J033128M13GGACACGTNONE 
J033133I15GGACACGTNONE 
J043027A21GGACACGTNONE 
J090028A09GGACACGTNONE 
J090053D06GGACACGTNONE 
J090083O17GGACACGTNONE 
J090099H10GGACACGTNONE 
J100036M05GGACACGTNONE 
Os03g0381500AK108125ACGTGTCCConserved hypothetical protein. 
Os03g0383800009-149-G01ACGTGTCCNONE 
AK062998ACGTGTCCNONE 
AK065904ACGTGTCCNONE 
Os03g0419100AK073482GGACACGTNONE 
AK119969GGACACGTProtein of unknown function DUF1675 family protein. 
Os03g0576900AK064861CACGTGTCCNONE 
J013000I01CACGTGTCCNONE 
J013169P21CACGTGTCCNONE 
J023001P03CACGTGTCCNONE 
J023009M10CACGTGTCCNONE 
J023025G11CACGTGTCCNONE 
J033046B19CACGTGTCCNONE 
J033149I10CACGTGTCCNONE 
J090081C04CACGTGTCCNONE 
Os03g0594900AK069017GGACACGTCytochrome P450 family protein. 
Os03g0648300AK067192GGACACGTGIQ calmodulin-binding region domain containing protein. 
J013098A04GGACACGTGNONE 
J075149P13GGACACGTGNONE 
J100044P16GGACACGTGNONE 
J100053G19GGACACGTGNONE 
Os03g0694000006-079-C12CACGTGTCCNONE 
AK059872CACGTGTCCSimilar to Oxalate oxidase 1 (EC 1.2.3.4) (Germin). 
J043027B01CACGTGTCCNONE 
J065071N13CACGTGTCCNONE 
J065159E22CACGTGTCCNONE 
Os03g0723400AK107276ACGTGTCCConserved hypothetical protein. 
J065104F19ACGTGTCCNONE 
J075026E22ACGTGTCCNONE 
J075047K21ACGTGTCCNONE 
J075071K20ACGTGTCCNONE 
J075071K21ACGTGTCCNONE 
J075140F21ACGTGTCCNONE 
J075177C18ACGTGTCCNONE 
Os03g0723800AK110710GGACACGTConserved hypothetical protein. 
Os03g0747500AK108009CCACGTGTCCSeed maturation protein domain containing protein. 
Os03g0767800004-017-A08CCACGTGTCCNONE 
006-025-G11CCACGTGTCCNONE 
006-088-G04CCACGTGTCCNONE 
009-055-C02CCACGTGTCCNONE 
AF283006CCACGTGTCCNONE 
AK060000CCACGTGTCCNONE 
AK060906CCACGTGTCCNONE 
AK066036CCACGTGTCCCold acclimation WCOR413 family protein. 
J023026I12CCACGTGTCCNONE 
J023049J16CCACGTGTCCNONE 
J033037M10CCACGTGTCCNONE 
J033057D13CCACGTGTCCNONE 
J033105H16CCACGTGTCCNONE 
J033119G10CCACGTGTCCNONE 
J065023C15CCACGTGTCCNONE 
J065080D13CCACGTGTCCNONE 
J080003C23CCACGTGTCCNONE 
J080003P09CCACGTGTCCNONE 
J080004K04CCACGTGTCCNONE 
J080010M14CCACGTGTCCNONE 
J080011J21CCACGTGTCCNONE 
J080013J01CCACGTGTCCNONE 
J080015A16CCACGTGTCCNONE 
J080021F07CCACGTGTCCNONE 
J080023F18CCACGTGTCCNONE 
J080034D18CCACGTGTCCNONE 
J080034O19CCACGTGTCCNONE 
J080038J08CCACGTGTCCNONE 
J080039N10CCACGTGTCCNONE 
J080042P09CCACGTGTCCNONE 
J080043E10CCACGTGTCCNONE 
J080051M02CCACGTGTCCNONE 
J080051O17CCACGTGTCCNONE 
J080053B01CCACGTGTCCNONE 
J080056N01CCACGTGTCCNONE 
J080058J20CCACGTGTCCNONE 
J080061B11CCACGTGTCCNONE 
J080064B15CCACGTGTCCNONE 
J080064O18CCACGTGTCCNONE 
J080071A15CCACGTGTCCNONE 
J080071C13CCACGTGTCCNONE 
J080071F14CCACGTGTCCNONE 
J080071M21CCACGTGTCCNONE 
J080072A10CCACGTGTCCNONE 
J080075J05CCACGTGTCCNONE 
J080076A05CCACGTGTCCNONE 
J080078F05CCACGTGTCCNONE 
J080078K01CCACGTGTCCNONE 
J080081F11CCACGTGTCCNONE 
J080081K15CCACGTGTCCNONE 
J080084K03CCACGTGTCCNONE 
J080089F18CCACGTGTCCNONE 
J080095A21CCACGTGTCCNONE 
J100022L11CCACGTGTCCNONE 
J100029I01CCACGTGTCCNONE 
J100032I15CCACGTGTCCNONE 
J100062N24CCACGTGTCCNONE 
J100067E13CCACGTGTCCNONE 
J100075G02CCACGTGTCCNONE 
J100080L14CCACGTGTCCNONE 
Os03g0820600013-030-F01ACGTGTCCNONE 
AK058941ACGTGTCCSimilar to Actin-depolymerizing factor 3 (ADF 3) (ZmABP3) (ZmADF3). 
J065038I10ACGTGTCCNONE 
J065043C23ACGTGTCCNONE 
J065060H20ACGTGTCCNONE 
J065065E06ACGTGTCCNONE 
J065078K18ACGTGTCCNONE 
J065116J24ACGTGTCCNONE 
J065118G22ACGTGTCCNONE 
J065129D16ACGTGTCCNONE 
J065153G20ACGTGTCCNONE 
J065159I03ACGTGTCCNONE 
J065176E14ACGTGTCCNONE 
J065187B11ACGTGTCCNONE 
J065203D14ACGTGTCCNONE 
J065217P15ACGTGTCCNONE 
J075105D14ACGTGTCCNONE 
J100036F11ACGTGTCCNONE 
J100044M07ACGTGTCCNONE 
Os04g0269900J065139P11ACGTGTCCNONE 
J100034P12ACGTGTCCNONE 
J100045D21ACGTGTCCNONE 
Os04g0380800J075004H10GGACACGTConserved hypothetical protein. 
Os04g0390700AK107261CGCCACGTGTCCGlucose/ribitol dehydrogenase family protein. 
AK107261GGACACGTGGGlucose/ribitol dehydrogenase family protein. 
Os04g0412100AK108223ACGTGTCCConserved hypothetical protein. 
Os04g0493600009-094-A08ACGTGTCCSimilar to Lectin-C precursor (PL-C). 
009-095-F06ACGTGTCCNONE 
009-112-B03ACGTGTCCNONE 
009-155-H08ACGTGTCCNONE 
Os04g0510900012-083-A10GGACACGTNONE 
014-002-F04GGACACGTNONE 
AK063625GGACACGTSimilar to Embryo-specific protein 1 (ATS1). 
J065136I20GGACACGTNONE 
J065144F23GGACACGTNONE 
J065153D08GGACACGTNONE 
J065178A02GGACACGTNONE 
J065178B01GGACACGTNONE 
J065195M21GGACACGTNONE 
Os04g0527900AK108116GCCACACGTGTCCSimilar to Tonoplast membrane integral protein ZmTIP3-2. 
J075013N09GCCACACGTGTCCNONE 
J075023I21GCCACACGTGTCCNONE 
Os04g0541700AK109177GGACACGTCACNONE 
AY554030GGACACGTCACNONE 
J065055P13GGACACGTCACNONE 
J065057N20GGACACGTCACNONE 
J065136D07GGACACGTCACNONE 
Os04g0643100014-026-F09GAGACGTGTCCNONE 
014-026-F09GGACACGTNONE 
AK067501GAGACGTGTCCSimilar to Vacuolar ATP synthase subunit D (EC 3.6.3.14) (V-ATPase D subunit) (Vacuolar proton pump D subunit). 
AK067501GGACACGTSimilar to Vacuolar ATP synthase subunit D (EC 3.6.3.14) (V-ATPase D subunit) (Vacuolar proton pump D subunit). 
AK106989GAGACGTGTCCNONE 
AK106989GGACACGTNONE 
J013110H12GAGACGTGTCCNONE 
J013110H12GGACACGTNONE 
J090089E23GAGACGTGTCCNONE 
J090089E23GGACACGTNONE 
J100033G14GAGACGTGTCCNONE 
J100033G14GGACACGTNONE 
J100033L15GAGACGTGTCCNONE 
J100033L15GGACACGTNONE 
J100041J24GAGACGTGTCCNONE 
J100041J24GGACACGTNONE 
J100041M14GAGACGTGTCCNONE 
J100041M14GGACACGTNONE 
J100057A03GAGACGTGTCCNONE 
J100057A03GGACACGTNONE 
J100059C11GAGACGTGTCCNONE 
J100059C11GGACACGTNONE 
J100072B15GAGACGTGTCCNONE 
J100072B15GGACACGTNONE 
J100073N24GAGACGTGTCCNONE 
J100073N24GGACACGTNONE 
Os04g0643200J013068H06GGACACGTGTCCNONE 
J013153F13GGACACGTGTCCNONE 
J013155G22GGACACGTGTCCNONE 
J013155P06GGACACGTGTCCNONE 
J033138C11GGACACGTGTCCNONE 
J065194O13GGACACGTGTCCNONE 
J075018G07GGACACGTGTCCNONE 
Os04g0688300006-061-B01GGACACGTNONE 
013-018-H08GGACACGTNONE 
013-066-D06GGACACGTNONE 
AK065090GGACACGTHaem peroxidase, plant/fungal/bacterial family protein. 
AK104928GGACACGTNONE 
J013001L22GGACACGTNONE 
J023120H12GGACACGTNONE 
J065002B04GGACACGTNONE 
J065039G09GGACACGTNONE 
J065042E02GGACACGTNONE 
J065079L02GGACACGTNONE 
J065186D12GGACACGTNONE 
J065198I02GGACACGTNONE 
J075103M02GGACACGTNONE 
J075129A09GGACACGTNONE 
Os05g0134200AK067074CGCCACGTGTCCSimilar to Protein phosphatase-2C. 
Os05g0151200J065041L18CACGTGTCCTspO/MBR-related protein family protein. 
J065168L08CACGTGTCCNONE 
Os05g0176700009-076-A09CGCCACGTGTCCNONE 
009-147-H06CGCCACGTGTCCNONE 
009-161-C02CGCCACGTGTCCNONE 
AK071729CGCCACGTGTCCConserved hypothetical protein. 
J023110H11CGCCACGTGTCCNONE 
J075092I23CGCCACGTGTCCNONE 
J100038P12CGCCACGTGTCCNONE 
J100039J21CGCCACGTGTCCNONE 
J100039M13CGCCACGTGTCCNONE 
J100084A22CGCCACGTGTCCNONE 
Os05g0195200015-031-H09CCACGTGTCCNONE 
015-070-C11CCACGTGTCCNONE 
016-063-C11CCACGTGTCCNONE 
AK106392CCACGTGTCCZinc finger, CCCH-type domain containing protein. 
J033051N05CCACGTGTCCNONE 
J065118P05CCACGTGTCCNONE 
J100071H15CCACGTGTCCNONE 
J100078J22CCACGTGTCCNONE 
Os05g0323900006-105-F01GGACGGACACGTNONE 
009-161-D06GGACGGACACGTNONE 
AK070528GGACGGACACGTManganese-superoxide dismutase precursor (EC 1.15.1.1). 
AK104030GGACGGACACGTNONE 
AK104160GGACGGACACGTNONE 
AK119904GGACGGACACGTNONE 
J023060D13GGACGGACACGTNONE 
J033057E10GGACGGACACGTNONE 
J043034F19GGACGGACACGTNONE 
J053099K12GGACGGACACGTNONE 
J065022N03GGACGGACACGTNONE 
J065035G13GGACGGACACGTNONE 
J065059M24GGACGGACACGTNONE 
J065059N23GGACGGACACGTNONE 
J065073I02GGACGGACACGTNONE 
J065095L15GGACGGACACGTNONE 
J065104I24GGACGGACACGTNONE 
J065104J24GGACGGACACGTNONE 
J065112L13GGACGGACACGTNONE 
J065114J24GGACGGACACGTNONE 
J065120J16GGACGGACACGTNONE 
J065141I09GGACGGACACGTNONE 
J065165E17GGACGGACACGTNONE 
J065170C14GGACGGACACGTNONE 
J065182I05GGACGGACACGTNONE 
J065191K20GGACGGACACGTNONE 
J065205L14GGACGGACACGTNONE 
J075017M10GGACGGACACGTNONE 
J075019O04GGACGGACACGTNONE 
J075019O15GGACGGACACGTNONE 
J075032E07GGACGGACACGTNONE 
J075042D13GGACGGACACGTNONE 
J075054J07GGACGGACACGTNONE 
J075089O11GGACGGACACGTNONE 
J075104G09GGACGGACACGTNONE 
J075150N03GGACGGACACGTNONE 
J075187A09GGACGGACACGTNONE 
J075187D04GGACGGACACGTNONE 
J090006G06GGACGGACACGTNONE 
J090045C09GGACGGACACGTNONE 
J090083D13GGACGGACACGTNONE 
J090084B13GGACGGACACGTNONE 
J100021H22GGACGGACACGTNONE 
J100034A15GGACGGACACGTNONE 
J100041N15GGACGGACACGTNONE 
J100042D05GGACGGACACGTNONE 
J100042D08GGACGGACACGTNONE 
J100059P21GGACGGACACGTNONE 
L19436GGACGGACACGTNONE 
L34038GGACGGACACGTNONE 
Os05g0361700AJ575218ACGTGTCCNONE 
J075074A07ACGTGTCCNONE 
Os05g0372400AK068781GGACACGTGGGTCCCACLipase, class 3 family protein. 
Os05g0381400014-036-H12ACGTGTCCNONE 
014-085-H12ACGTGTCCNONE 
AK102039ACGTGTCCSimilar to ABA induced plasma membrane protein PM 19. 
J075011E17ACGTGTCCNONE 
J075057P04ACGTGTCCNONE 
J075066K19ACGTGTCCNONE 
J075068L13ACGTGTCCNONE 
J075074J21ACGTGTCCNONE 
J075076N10ACGTGTCCNONE 
J075078L14ACGTGTCCNONE 
J075099O16ACGTGTCCNONE 
J075120C05ACGTGTCCNONE 
J075140I24ACGTGTCCNONE 
J075148F21ACGTGTCCNONE 
J075151F01ACGTGTCCNONE 
J075151I10ACGTGTCCNONE 
J075156M15ACGTGTCCNONE 
J075191F07ACGTGTCCNONE 
J075192K20ACGTGTCCNONE 
J075195M22ACGTGTCCNONE 
Os05g0381700AK058835GGACACGTNONE 
J080020E01GGACACGTNONE 
J080023G04GGACACGTNONE 
Os05g0490200016-097-B03CGCCACGTGTCCNONE 
AK101147CGCCACGTGTCCProtein of unknown function DUF1692 domain containing protein. 
AK105601CGCCACGTGTCCNONE 
J033026P06CGCCACGTGTCCNONE 
Os05g0566800AK065748GGACACGTGGCold acclimation protein COR413-TM1. 
AY181210GGACACGTGGNONE 
Os05g0574900AK107256CACGTGTCCGRAS transcription factor domain containing protein. 
Os05g0591600Os05g0591600GGACACGTSimilar to Lysine decarboxylase-like protein. 
Os05g0592800AK067627CGCGTCGCCACGTGTCCACGCCSimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2). 
AK070388CGCGTCGCCACGTGTCCACGCCNONE 
AK104323CGCGTCGCCACGTGTCCACGCCNONE 
Os06g0115300009-165-C05GGACACGTGTCCNONE 
AK058833GGACACGTGTCCSimilar to Acyl-CoA-binding protein 2 (ACBP 2) (Fragment). 
J065135L09GGACACGTGTCCNONE 
J075002E09GGACACGTGTCCNONE 
J075015K23GGACACGTGTCCNONE 
J075043B06GGACACGTGTCCNONE 
J075057O21GGACACGTGTCCNONE 
J075085L21GGACACGTGTCCNONE 
J075134N20GGACACGTGTCCNONE 
J075155O22GGACACGTGTCCNONE 
J075198N22GGACACGTGTCCNONE 
Os06g0134900AK103205GGACACGTConserved hypothetical protein. 
J033122E01GGACACGTNONE 
Os06g0135000J075008J15ACGTGTCCNONE 
J075166F23ACGTGTCCNONE 
J075185F03ACGTGTCCNONE 
Os06g0159400AK101286ACGTGTCCU box domain containing protein. 
J033033F04ACGTGTCCNONE 
Os06g0199300J065045H01GGCCCCACGTGTCCNONE 
J075177C22GGCCCCACGTGTCCNONE 
J080068H06GGCCCCACGTGTCCNONE 
J090048F01GGCCCCACGTGTCCNONE 
J100066F17GGCCCCACGTGTCCNONE 
Os06g0341300AK107654ACGTGTCCSeed maturation protein domain containing protein. 
Os06g0354500AK066934GGACACGTSimilar to Acyl-coenzyme A oxidase 3, peroxisomal precursor (EC 1.3.3.6) (AOX 3) (Medium-chain acyl-CoA oxidase) (AtCX3). 
Os06g0472200AK059428ACGTGTCCNONE 
AK103043ACGTGTCCSimilar to Isoflavone reductase homolog Bet v 6.0101 (Fragment). 
J033117F05ACGTGTCCNONE 
Os06g0560400AK103575CCGATCCGACGTGTCCNONE 
AK108074CCGATCCGACGTGTCCProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0658400J065217K01ACGTGTCCConserved hypothetical protein. 
J065217K01GGACACGTConserved hypothetical protein. 
Os06g0703400AK107025CACGTGTCCConserved hypothetical protein. 
Os06g0714900AK071975ACGTGTCCNONE 
AK105337ACGTGTCCProtein kinase-like domain containing protein. 
Os06g0716700AB037681CGCCACGTGTCCGGCCCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385CGCCACGTGTCCGGCCCNONE 
AK102478CGCCACGTGTCCGGCCCNONE 
J013030D18CGCCACGTGTCCGGCCCNONE 
J090091L06CGCCACGTGTCCGGCCCNONE 
Os07g0139400AB096864ACGTGTCCNONE 
AK065558ACGTGTCCUDP-glucose 4-epimerase family protein. 
AK099140ACGTGTCCNONE 
AK099183ACGTGTCCNONE 
J013033B01ACGTGTCCNONE 
J013157B14ACGTGTCCNONE 
J023052E04ACGTGTCCNONE 
J023086K05ACGTGTCCNONE 
J023099C15ACGTGTCCNONE 
J033025C08ACGTGTCCNONE 
J033072I24ACGTGTCCNONE 
J043020I04ACGTGTCCNONE 
J090039I21ACGTGTCCNONE 
J090078P20ACGTGTCCNONE 
J090084C18ACGTGTCCNONE 
J100024F07ACGTGTCCNONE 
J100054D22ACGTGTCCNONE 
J100062O08ACGTGTCCNONE 
Os07g0209100AK120944GGACACGTCACCSimilar to Seed imbibition protein (Fragment). 
Os07g0474300AK108961CGCCACGTGTCCGGGCCCCConserved hypothetical protein. 
Os07g0509800Os07g0509800GACACGTGTCCSimilar to APS reductase (Fragment). 
Os07g0558500AK064914GGACACGTGGCGInositol phosphatase-like protein. 
AY224446GGACACGTGGCGNONE 
J013000M13GGACACGTGGCGNONE 
Os07g0586600Os07g0586600GGACACGTConserved hypothetical protein. 
Os07g0597000009-013-A01CACGTGTCCNONE 
009-077-A02CACGTGTCCNONE 
009-195-H04CACGTGTCCNONE 
AF094773CACGTGTCCNONE 
AK062134CACGTGTCCNONE 
AK103429CACGTGTCCSimilar to Eukaryotic translation initiation factor 5A (eIF-5A). 
J013088G19CACGTGTCCNONE 
J013152D01CACGTGTCCNONE 
J023024K09CACGTGTCCNONE 
J023058J15CACGTGTCCNONE 
J023097I07CACGTGTCCNONE 
J023132B05CACGTGTCCNONE 
J033065L11CACGTGTCCNONE 
J033086B12CACGTGTCCNONE 
J033128M07CACGTGTCCNONE 
J043010M23CACGTGTCCNONE 
J043024A05CACGTGTCCNONE 
J053057P08CACGTGTCCNONE 
J065022G24CACGTGTCCNONE 
J065028I10CACGTGTCCNONE 
J065065D08CACGTGTCCNONE 
J065103D22CACGTGTCCNONE 
J065153K16CACGTGTCCNONE 
J065210B16CACGTGTCCNONE 
J075015H18CACGTGTCCNONE 
J075102C14CACGTGTCCNONE 
J080302G09CACGTGTCCNONE 
J080302L20CACGTGTCCNONE 
J080303K11CACGTGTCCNONE 
J080312C18CACGTGTCCNONE 
J080316F08CACGTGTCCNONE 
J090023I05CACGTGTCCNONE 
J090023I07CACGTGTCCNONE 
J090053C21CACGTGTCCNONE 
J090067J22CACGTGTCCNONE 
J090070E24CACGTGTCCNONE 
J090078H04CACGTGTCCNONE 
J090089P06CACGTGTCCNONE 
J090092E21CACGTGTCCNONE 
J100014G01CACGTGTCCNONE 
J100022L20CACGTGTCCNONE 
J100024I05CACGTGTCCNONE 
J100025L08CACGTGTCCNONE 
J100030J03CACGTGTCCNONE 
J100031K12CACGTGTCCNONE 
J100036N01CACGTGTCCNONE 
J100050C23CACGTGTCCNONE 
J100062G12CACGTGTCCNONE 
J100067L17CACGTGTCCNONE 
J100074O09CACGTGTCCNONE 
Os07g0616900AK071047CGACACGTGTCCProtein of unknown function DUF500 family protein. 
J013106G03CGACACGTGTCCNONE 
J013124C20CGACACGTGTCCNONE 
J033096D16CGACACGTGTCCNONE 
J043005E08CGACACGTGTCCNONE 
J065197K12CGACACGTGTCCNONE 
J065211I03CGACACGTGTCCNONE 
Os07g0627400J065142N02ACGTGTCCConserved hypothetical protein. 
Os07g0633200AK061338GGACACGTGTCSimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451GGACACGTGTCNONE 
J033096E22GGACACGTGTCNONE 
J033125D06GGACACGTGTCNONE 
J075048C23GGACACGTGTCNONE 
J075050G02GGACACGTGTCNONE 
J075104J04GGACACGTGTCNONE 
J075144N04GGACACGTGTCNONE 
Os07g0637200AK072575ACGTGTCCProtein of unknown function DUF537 family protein. 
J013055P10ACGTGTCCNONE 
J013058B01ACGTGTCCNONE 
J013058B02ACGTGTCCNONE 
J013131K14ACGTGTCCNONE 
J013152K05ACGTGTCCNONE 
J013160P05ACGTGTCCNONE 
J023083J04ACGTGTCCNONE 
J023121E11ACGTGTCCNONE 
J023127O12ACGTGTCCNONE 
J033037E08ACGTGTCCNONE 
J033082F17ACGTGTCCNONE 
J033108O20ACGTGTCCNONE 
J033115N22ACGTGTCCNONE 
J043016E24ACGTGTCCNONE 
J090037G22ACGTGTCCNONE 
J090060E15ACGTGTCCNONE 
Os07g0643700AK109637ACGTGTCCEsterase/lipase/thioesterase domain containing protein. 
Os07g0686300009-078-D10GGACACGTNONE 
AK062636GGACACGTZinc finger, RING-type domain containing protein. 
Os07g0687900AK099548GGACACGTGNONE 
AK107065GGACACGTGWSI76 protein induced by water stress. 
D26537GGACACGTGNONE 
J080303H14GGACACGTGNONE 
J080309E11GGACACGTGNONE 
Os07g0695100AB189039GGACACGTGGGNONE 
AB189042GGACACGTGGGNONE 
AK059514GGACACGTGGGNONE 
AK066112GGACACGTGGGCheY-like domain containing protein. 
J013051N02GGACACGTGGGNONE 
J013127M02GGACACGTGGGNONE 
J023007I05GGACACGTGGGNONE 
Os08g0113100003-102-G01ACGTGTCCNONE 
011-041-F02ACGTGTCCNONE 
011-063-A09ACGTGTCCNONE 
AB110164ACGTGTCCNONE 
AF429947ACGTGTCCNONE 
AK070120ACGTGTCCSimilar to Fructokinase (Fragment). 
AK099353ACGTGTCCNONE 
J013072L23ACGTGTCCNONE 
J023031J20ACGTGTCCNONE 
J023041C07ACGTGTCCNONE 
J023068B05ACGTGTCCNONE 
J023111H11ACGTGTCCNONE 
J023114G22ACGTGTCCNONE 
J023121E01ACGTGTCCNONE 
J023121G16ACGTGTCCNONE 
J023128D15ACGTGTCCNONE 
J023142I22ACGTGTCCNONE 
J033058M11ACGTGTCCNONE 
J033092F23ACGTGTCCNONE 
J033108M10ACGTGTCCNONE 
J065085D10ACGTGTCCNONE 
J065086I17ACGTGTCCNONE 
J065137I08ACGTGTCCNONE 
J065154L19ACGTGTCCNONE 
J065179C12ACGTGTCCNONE 
J065184K15ACGTGTCCNONE 
J065195G07ACGTGTCCNONE 
J075052K09ACGTGTCCNONE 
J075093D08ACGTGTCCNONE 
J075093L13ACGTGTCCNONE 
J090005F03ACGTGTCCNONE 
J090013F02ACGTGTCCNONE 
J090026L07ACGTGTCCNONE 
J090041P18ACGTGTCCNONE 
J090081E12ACGTGTCCNONE 
J090087F17ACGTGTCCNONE 
J090091C17ACGTGTCCNONE 
J090099P12ACGTGTCCNONE 
J100030P08ACGTGTCCNONE 
J100055E21ACGTGTCCNONE 
J100056N16ACGTGTCCNONE 
J100061I23ACGTGTCCNONE 
J100063L04ACGTGTCCNONE 
J100065A14ACGTGTCCNONE 
J100072A15ACGTGTCCNONE 
J100080A04ACGTGTCCNONE 
J100082K16ACGTGTCCNONE 
J100088C06ACGTGTCCNONE 
J100088L18ACGTGTCCNONE 
Os08g0128200AK120428CACGCCACGTGTCCConserved hypothetical protein. 
Os08g0162500AK121633GACACGTGTCCConserved hypothetical protein. 
J033105E19GACACGTGTCCNONE 
J080012K11GACACGTGTCCNONE 
J080041I12GACACGTGTCCNONE 
J080049G05GACACGTGTCCNONE 
J080050P09GACACGTGTCCNONE 
J080051A10GACACGTGTCCNONE 
J080054G05GACACGTGTCCNONE 
J080058M08GACACGTGTCCNONE 
J080064N23GACACGTGTCCNONE 
J080072L15GACACGTGTCCNONE 
J080096H09GACACGTGTCCNONE 
J100079I08GACACGTGTCCNONE 
Os08g0175200AK072367CACGTGTCCProtein of unknown function DUF292, eukaryotic domain containing protein. 
J013149H16CACGTGTCCNONE 
J023075K04CACGTGTCCNONE 
J023082L15CACGTGTCCNONE 
J043015G07CACGTGTCCNONE 
J065052L17CACGTGTCCNONE 
J065202P07CACGTGTCCNONE 
J075061D17CACGTGTCCNONE 
J100088P13CACGTGTCCNONE 
Os08g0237000003-111-F01GGACACGTNONE 
006-022-H07GGACACGTNONE 
006-028-G01GGACACGTNONE 
006-032-D10GGACACGTNONE 
006-039-F08GGACACGTNONE 
006-039-H01GGACACGTNONE 
006-051-E01GGACACGTNONE 
006-053-E11GGACACGTNONE 
006-055-E09GGACACGTNONE 
006-061-H02GGACACGTNONE 
006-062-G07GGACACGTNONE 
006-074-D07GGACACGTNONE 
006-074-F11GGACACGTNONE 
006-076-F03GGACACGTNONE 
006-080-G01GGACACGTNONE 
006-081-A03GGACACGTNONE 
006-084-F05GGACACGTNONE 
006-085-B08GGACACGTNONE 
006-089-C03GGACACGTNONE 
006-090-B12GGACACGTNONE 
006-092-D04GGACACGTNONE 
006-095-E05GGACACGTNONE 
006-100-C12GGACACGTNONE 
006-109-C03GGACACGTNONE 
006-114-E09GGACACGTNONE 
009-033-G02GGACACGTNONE 
009-189-F09GGACACGTNONE 
009-200-A08GGACACGTNONE 
009-200-D07GGACACGTNONE 
AB110604GGACACGTXyloglucan endotransglycosylase/hydrolase protein 8 precursor (EC 2.4.1.207) (End-xyloglucan transferase) (OsXTH8) (OsXRT5). 
AK060654GGACACGTNONE 
AK104451GGACACGTNONE 
Os08g0249000AK109938CCACGTGTCCZinc finger, B-box domain containing protein. 
Os08g0290500004-010-C07GGCCGTCCACGTGTCCNONE 
009-111-A08GGCCGTCCACGTGTCCNONE 
011-046-F10GGCCGTCCACGTGTCCNONE 
AK066894GGCCGTCCACGTGTCCNONE 
AK067122GGCCGTCCACGTGTCCNONE 
AK102868GGCCGTCCACGTGTCCSimilar to AF-10 protein. 
J013089O21GGCCGTCCACGTGTCCNONE 
J033072D17GGCCGTCCACGTGTCCNONE 
J033095M14GGCCGTCCACGTGTCCNONE 
J033111N23GGCCGTCCACGTGTCCNONE 
J043024M17GGCCGTCCACGTGTCCNONE 
J065176I24GGCCGTCCACGTGTCCNONE 
J090035C05GGCCGTCCACGTGTCCNONE 
Os08g0425100AK069134CCACGTGTCCDynamin family protein. 
AK072791CCACGTGTCCNONE 
Os08g0425800009-168-F06GGACACGTGTCNONE 
AK061339GGACACGTGTCConserved hypothetical protein. 
AK101198GGACACGTGTCNONE 
J033030L06GGACACGTGTCNONE 
J100036D08GGACACGTGTCNONE 
J100052I22GGACACGTGTCNONE 
Os08g0440500AK058761ACGTGTCCMIR domain containing protein. 
Os08g0458600AK107384GGACACGTCheY-like domain containing protein. 
Os08g0481500J065054C23CCACGTGTCCConserved hypothetical protein. 
J065218E06CCACGTGTCCNONE 
Os08g0521600AK108208CGCCACGTGTCCSimilar to Dehydration responsive element binding protein 2C (DREB2C protein). 
AK108208GGACACGTGGCSimilar to Dehydration responsive element binding protein 2C (DREB2C protein). 
Os08g0547100006-088-E09GACACGTGTCCNONE 
AK073704GACACGTGTCCNONE 
AK109374GACACGTGTCC6-phosphogluconolactonase domain containing protein. 
J023055A08GACACGTGTCCNONE 
J023150G19GACACGTGTCCNONE 
J033060E10GACACGTGTCCNONE 
J033112J12GACACGTGTCCNONE 
Os09g0115400AK067816GGACACGTGCACGGCCCATGTNONE 
AK101706GGACACGTGCACGGCCCATGTSimilar to Poly(A)-binding protein. 
Os09g0296800AK066997CGCCACGTGTCCGTCCCACCChlorophyll A-B binding protein family protein. 
Os09g0325700011-041-G03CACGTGTCCGGGCCTGGNONE 
011-041-G03GGACACGTGTCGNONE 
AK063334CACGTGTCCGGGCCTGGSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
AK063334GGACACGTGTCGSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24CACGTGTCCGGGCCTGGNONE 
J080317M24GGACACGTGTCGNONE 
Os09g0370300AK108199GCCACACGTGTCCGCGACGCSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0499500J075050M22ACGTGTCCHypothetical protein. 
J075050M22ACGTGTCCHypothetical protein. 
J075157M01ACGTGTCCNONE 
J075157M01ACGTGTCCNONE 
Os09g0553200003-101-F12CGCCACGTGTCCNONE 
003-125-E09CGCCACGTGTCCNONE 
011-031-H12CGCCACGTGTCCNONE 
012-033-A01CGCCACGTGTCCNONE 
015-046-H04CGCCACGTGTCCNONE 
015-056-F04CGCCACGTGTCCNONE 
016-029-H06CGCCACGTGTCCNONE 
016-080-D05CGCCACGTGTCCNONE 
AB062606CGCCACGTGTCCNONE 
AK065780CGCCACGTGTCCSimilar to UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) (UDP-glucose pyrophosphorylase) (UDPGP) (UGPase). 
AK103930CGCCACGTGTCCNONE 
AK104344CGCCACGTGTCCNONE 
AK119197CGCCACGTGTCCNONE 
AK119232CGCCACGTGTCCNONE 
J013039M01CGCCACGTGTCCNONE 
J013043M01CGCCACGTGTCCNONE 
J013064F03CGCCACGTGTCCNONE 
J013066K19CGCCACGTGTCCNONE 
J013092G12CGCCACGTGTCCNONE 
J013123P09CGCCACGTGTCCNONE 
J013155F01CGCCACGTGTCCNONE 
J013158J12CGCCACGTGTCCNONE 
J013159H14CGCCACGTGTCCNONE 
J013169C10CGCCACGTGTCCNONE 
J013170L23CGCCACGTGTCCNONE 
J023010J18CGCCACGTGTCCNONE 
J023019E23CGCCACGTGTCCNONE 
J023045B14CGCCACGTGTCCNONE 
J023082K24CGCCACGTGTCCNONE 
J023086G04CGCCACGTGTCCNONE 
J023090N09CGCCACGTGTCCNONE 
J023113C08CGCCACGTGTCCNONE 
J023125H18CGCCACGTGTCCNONE 
J033034M08CGCCACGTGTCCNONE 
J033035K03CGCCACGTGTCCNONE 
J033039D15CGCCACGTGTCCNONE 
J033045P18CGCCACGTGTCCNONE 
J033058P08CGCCACGTGTCCNONE 
J033061D16CGCCACGTGTCCNONE 
J033070F14CGCCACGTGTCCNONE 
J033086F23CGCCACGTGTCCNONE 
J033095C05CGCCACGTGTCCNONE 
J033114H22CGCCACGTGTCCNONE 
J033133M20CGCCACGTGTCCNONE 
J043026G01CGCCACGTGTCCNONE 
J043037F17CGCCACGTGTCCNONE 
J065120K17CGCCACGTGTCCNONE 
J065123O07CGCCACGTGTCCNONE 
J080305H06CGCCACGTGTCCNONE 
J090001F11CGCCACGTGTCCNONE 
J090020C17CGCCACGTGTCCNONE 
J090043A19CGCCACGTGTCCNONE 
J090051J17CGCCACGTGTCCNONE 
J090068K06CGCCACGTGTCCNONE 
J090075P19CGCCACGTGTCCNONE 
J100036G10CGCCACGTGTCCNONE 
J100084F02CGCCACGTGTCCNONE 
Os11g0184900011-088-C07CGACACGTGTCCNONE 
015-036-B03CGACACGTGTCCNONE 
016-087-F07CGACACGTGTCCNONE 
AB028184CGACACGTGTCCNONE 
AK063399CGACACGTGTCCSimilar to NAC-domain protein 5-7. 
AK064292CGACACGTGTCCNONE 
AK102475CGACACGTGTCCNONE 
J033094I01CGACACGTGTCCNONE 
J090087J16CGACACGTGTCCNONE 
Os11g0202000AK063427GAGACGTGGACACGTGTCCyclin-like F-box domain containing protein. 
AK122020GAGACGTGGACACGTGTCNONE 
J033111N03GAGACGTGGACACGTGTCNONE 
Os11g0454300009-010-F05GGACACGTNONE 
011-073-B07GGACACGTNONE 
011-089-D03GGACACGTNONE 
012-041-B07GGACACGTNONE 
012-042-D12GGACACGTNONE 
012-046-G11GGACACGTNONE 
012-072-D10GGACACGTNONE 
012-090-F06GGACACGTNONE 
013-009-A10GGACACGTNONE 
013-096-B03GGACACGTNONE 
014-002-F10GGACACGTNONE 
014-006-A10GGACACGTNONE 
014-006-C05GGACACGTNONE 
014-006-E01GGACACGTNONE 
014-006-H04GGACACGTNONE 
014-009-D05GGACACGTNONE 
014-010-D07GGACACGTNONE 
014-012-A10GGACACGTNONE 
014-013-F08GGACACGTNONE 
014-014-D01GGACACGTNONE 
014-016-D07GGACACGTNONE 
014-020-F09GGACACGTNONE 
014-023-C07GGACACGTNONE 
014-024-A03GGACACGTNONE 
014-025-D11GGACACGTNONE 
014-027-D02GGACACGTNONE 
014-030-F11GGACACGTNONE 
014-032-H06GGACACGTNONE 
014-034-D06GGACACGTNONE 
014-037-E04GGACACGTNONE 
014-038-C02GGACACGTNONE 
014-041-B08GGACACGTNONE 
014-044-A10GGACACGTNONE 
014-045-C11GGACACGTNONE 
014-046-B04GGACACGTNONE 
014-047-D01GGACACGTNONE 
014-053-C03GGACACGTNONE 
014-053-C09GGACACGTNONE 
014-072-D09GGACACGTNONE 
014-073-D09GGACACGTNONE 
014-073-F01GGACACGTNONE 
014-081-B04GGACACGTNONE 
014-081-G07GGACACGTNONE 
014-084-C10GGACACGTNONE 
014-084-F03GGACACGTNONE 
014-085-D08GGACACGTNONE 
014-087-H10GGACACGTNONE 
014-095-E02GGACACGTNONE 
014-095-G07GGACACGTNONE 
AK121952GGACACGTSimilar to Water-stress inducible protein RAB21. 
J033107K14GGACACGTNONE 
J065021B08GGACACGTNONE 
J065059D24GGACACGTNONE 
J065066D13GGACACGTNONE 
J065070K11GGACACGTNONE 
J065081I18GGACACGTNONE 
J065120F19GGACACGTNONE 
J065186M13GGACACGTNONE 
J075031E22GGACACGTNONE 
J075046F04GGACACGTNONE 
J075069L13GGACACGTNONE 
J075097G09GGACACGTNONE 
J075099C23GGACACGTNONE 
J075149N21GGACACGTNONE 
J075150G23GGACACGTNONE 
J075170K09GGACACGTNONE 
J075173A09GGACACGTNONE 
J075177C21GGACACGTNONE 
Os11g0461000AK062672ACGTGTCCNONE 
AK072925ACGTGTCCPeptidase S10, serine carboxypeptidase family protein. 
AK106123ACGTGTCCNONE 
AK121476ACGTGTCCNONE 
J023148C06ACGTGTCCNONE 
Os11g0490100AK108872CACGTGTCCProtein of unknown function DUF579, plant family protein. 
Os11g0536900J100027G18GCCACGTGTCCConserved hypothetical protein. 
J100073G12GCCACGTGTCCNONE 
Os11g0581900AK069449GACACGTGTCCProtein of unknown function UPF0005 family protein. 
Os11g0582400AF049348GGACACGTConserved hypothetical protein. 
AF516927GGACACGTNONE 
AK073083GGACACGTNONE 
AK108352GGACACGTNONE 
J075005O16GGACACGTNONE 
J075007D15GGACACGTNONE 
J075007L04GGACACGTNONE 
J075009C11GGACACGTNONE 
J075012L11GGACACGTNONE 
J075013A14GGACACGTNONE 
J075015K01GGACACGTNONE 
J075019O21GGACACGTNONE 
J075020G20GGACACGTNONE 
J075020H06GGACACGTNONE 
J075022D07GGACACGTNONE 
J075024M12GGACACGTNONE 
J075025G04GGACACGTNONE 
J075026F09GGACACGTNONE 
J075027D19GGACACGTNONE 
J075030A12GGACACGTNONE 
J075030C16GGACACGTNONE 
J075030D15GGACACGTNONE 
J075034M20GGACACGTNONE 
J075041H12GGACACGTNONE 
J075052D12GGACACGTNONE 
J075052G11GGACACGTNONE 
J075053L09GGACACGTNONE 
J075064G05GGACACGTNONE 
J075067J01GGACACGTNONE 
J075071O03GGACACGTNONE 
J075072G12GGACACGTNONE 
J075078H06GGACACGTNONE 
J075081D06GGACACGTNONE 
J075084G23GGACACGTNONE 
J075085M10GGACACGTNONE 
J075087N20GGACACGTNONE 
J075088E11GGACACGTNONE 
J075088O22GGACACGTNONE 
J075091E10GGACACGTNONE 
J075092B12GGACACGTNONE 
J075093E08GGACACGTNONE 
J075095D04GGACACGTNONE 
J075095J10GGACACGTNONE 
J075095O19GGACACGTNONE 
J075096H20GGACACGTNONE 
J075098F10GGACACGTNONE 
J075100H10GGACACGTNONE 
J075104C23GGACACGTNONE 
J075105B10GGACACGTNONE 
J075106I24GGACACGTNONE 
J075109H23GGACACGTNONE 
J075115A03GGACACGTNONE 
J075118M06GGACACGTNONE 
J075121G08GGACACGTNONE 
J075122C09GGACACGTNONE 
J075122J12GGACACGTNONE 
J075123E06GGACACGTNONE 
J075123E16GGACACGTNONE 
J075124N09GGACACGTNONE 
J075127F23GGACACGTNONE 
J075128H17GGACACGTNONE 
J075129C02GGACACGTNONE 
J075139P18GGACACGTNONE 
J075140H17GGACACGTNONE 
J075146E12GGACACGTNONE 
J075146I07GGACACGTNONE 
J075150A08GGACACGTNONE 
J075150I22GGACACGTNONE 
J075155D01GGACACGTNONE 
J075155N10GGACACGTNONE 
J075155O09GGACACGTNONE 
J075156K11GGACACGTNONE 
J075157N01GGACACGTNONE 
J075164L09GGACACGTNONE 
J075166F14GGACACGTNONE 
J075169E20GGACACGTNONE 
J075170B13GGACACGTNONE 
J075170F24GGACACGTNONE 
J075170N16GGACACGTNONE 
J075172H22GGACACGTNONE 
J075172I02GGACACGTNONE 
J075176E08GGACACGTNONE 
J075177H17GGACACGTNONE 
J075179C18GGACACGTNONE 
J075182H23GGACACGTNONE 
J075187B10GGACACGTNONE 
J075192L10GGACACGTNONE 
J075195C04GGACACGTNONE 
U25969GGACACGTNONE 
Os11g0620300AJ704770GGACACGTNONE 
AK107901GGACACGTSimilar to Nonspecific lipid-transfer protein 2 (LTP 2). 
J075006M12GGACACGTNONE 
J075046J22GGACACGTNONE 
Os11g0703900009-118-C12GGACACGTGNONE 
AK119710GGACACGTGNONE 
J080038G19GGACACGTGNONE 
J080054L02GGACACGTGNONE 
J080068K07GGACACGTGNONE 
J080069A04GGACACGTGNONE 
J080081I01GGACACGTGNONE 
J080091E17GGACACGTGNONE 
Os11g0704500009-051-D07GGACACGTNONE 
009-057-C06GGACACGTNONE 
009-065-A02GGACACGTNONE 
009-073-F09GGACACGTNONE 
009-088-E07GGACACGTNONE 
009-098-A05GGACACGTNONE 
009-119-H04GGACACGTNONE 
009-127-D03GGACACGTNONE 
009-127-E06GGACACGTNONE 
009-130-B07GGACACGTNONE 
009-134-C03GGACACGTNONE 
009-135-A05GGACACGTNONE 
009-135-F09GGACACGTNONE 
009-137-B10GGACACGTNONE 
009-138-D02GGACACGTNONE 
009-150-D07GGACACGTNONE 
009-150-D11GGACACGTNONE 
009-163-G09GGACACGTNONE 
009-165-G09GGACACGTNONE 
009-181-F06GGACACGTNONE 
009-184-E05GGACACGTNONE 
013-078-E09GGACACGTNONE 
014-031-E08GGACACGTNONE 
AF017366GGACACGTNONE 
AK062653GGACACGTNONE 
AK119726GGACACGTNONE 
AK120630GGACACGTNONE 
AY491534GGACACGTNONE 
J013153E02GGACACGTNONE 
J043005N03GGACACGTNONE 
J043021L09GGACACGTNONE 
J065006C17GGACACGTNONE 
J065008J16GGACACGTNONE 
J065013B03GGACACGTNONE 
J065014C14GGACACGTNONE 
J065015M07GGACACGTNONE 
J065021E11GGACACGTNONE 
J065021K02GGACACGTNONE 
J065036E08GGACACGTNONE 
J065044C12GGACACGTNONE 
J065057H20GGACACGTNONE 
J065058P16GGACACGTNONE 
J065061L16GGACACGTNONE 
J065064F09GGACACGTNONE 
J065073J04GGACACGTNONE 
J065087N15GGACACGTNONE 
J065088J04GGACACGTNONE 
J065093H07GGACACGTNONE 
J065102E14GGACACGTNONE 
J065105H15GGACACGTNONE 
J065105I18GGACACGTNONE 
J065107J19GGACACGTNONE 
J065115N10GGACACGTNONE 
J065128F10GGACACGTNONE 
J065129H03GGACACGTNONE 
J065150J03GGACACGTNONE 
J065153B19GGACACGTNONE 
J065158A22GGACACGTNONE 
J065173K09GGACACGTNONE 
J065179I02GGACACGTNONE 
J065179J01GGACACGTNONE 
J065190C16GGACACGTNONE 
J065192L10GGACACGTNONE 
J065201E04GGACACGTNONE 
J065214J05GGACACGTNONE 
J065217E04GGACACGTNONE 
J065218E14GGACACGTNONE 
J075024O17GGACACGTNONE 
J075030J12GGACACGTNONE 
J075037D22GGACACGTNONE 
J075046B03GGACACGTNONE 
J075064C12GGACACGTNONE 
J075069B06GGACACGTNONE 
J075084D08GGACACGTNONE 
J075085F12GGACACGTNONE 
J075101J07GGACACGTNONE 
J075115H07GGACACGTNONE 
J075118N14GGACACGTNONE 
J075145H05GGACACGTNONE 
J075151A20GGACACGTNONE 
J075158M08GGACACGTNONE 
J075190E14GGACACGTNONE 
J080018F13GGACACGTNONE 
J080020G03GGACACGTNONE 
J080043E18GGACACGTNONE 
J080049H17GGACACGTNONE 
J080085C11GGACACGTNONE 
J080303N11GGACACGTNONE 
J080308G19GGACACGTNONE 
J080315K08GGACACGTNONE 
J080316E10GGACACGTNONE 
J080318G23GGACACGTNONE 
J080319H03GGACACGTNONE 
J100017J24GGACACGTNONE 
J100021M18GGACACGTNONE 
J100026P07GGACACGTNONE 
J100028F11GGACACGTNONE 
J100030A13GGACACGTNONE 
J100030A21GGACACGTNONE 
J100030J06GGACACGTNONE 
J100030J23GGACACGTNONE 
J100035G15GGACACGTNONE 
J100037O13GGACACGTNONE 
J100039J23GGACACGTNONE 
J100039M10GGACACGTNONE 
J100041F08GGACACGTNONE 
J100041G14GGACACGTNONE 
J100043J17GGACACGTNONE 
J100046N04GGACACGTNONE 
J100048E23GGACACGTNONE 
J100049I04GGACACGTNONE 
J100049N19GGACACGTNONE 
J100055I02GGACACGTNONE 
J100055O07GGACACGTNONE 
J100056J18GGACACGTNONE 
J100057H14GGACACGTNONE 
J100061A11GGACACGTNONE 
J100062D17GGACACGTNONE 
J100062F04GGACACGTNONE 
J100067M21GGACACGTNONE 
J100068F14GGACACGTNONE 
J100068N06GGACACGTNONE 
J100069I12GGACACGTNONE 
J100069P13GGACACGTNONE 
J100070I11GGACACGTNONE 
J100070J21GGACACGTNONE 
J100070P09GGACACGTNONE 
J100073F06GGACACGTNONE 
J100074I16GGACACGTNONE 
J100074J23GGACACGTNONE 
J100075E08GGACACGTNONE 
J100081C18GGACACGTNONE 
J100082I10GGACACGTNONE 
J100083E23GGACACGTNONE 
J100083F03GGACACGTNONE 
J100085J08GGACACGTNONE 
J100086E14GGACACGTNONE 
J100089F06GGACACGTNONE 
J100090N14GGACACGTNONE 
U43529GGACACGTMetallothionein-like protein type 1. 
Os12g0116000AK102691GGACACGTNONE 
J023087D16GGACACGTNONE 
J033099O13GGACACGTNONE 
Os12g0464400AK121922ACGTGTCCGlucose/ribitol dehydrogenase family protein. 
J033106F11ACGTGTCCNONE 
J065037O17ACGTGTCCNONE 
J065090K04ACGTGTCCNONE 
J075007O03ACGTGTCCNONE 
J075030J20ACGTGTCCNONE 
J075071F12ACGTGTCCNONE 
J075090G11ACGTGTCCNONE 
J075091A09ACGTGTCCNONE 
J075092N10ACGTGTCCNONE 
J075116A20ACGTGTCCNONE 
J075126P10ACGTGTCCNONE 
J075133E24ACGTGTCCNONE 
Os12g0478100013-036-F11GCCACGTGTCCNONE 
AK063578GCCACGTGTCCGRAM domain containing protein. 
Os12g0535400004-008-H02GGCCGTCCACGTGTCCNONE 
AK065318GGCCGTCCACGTGTCCHypothetical protein. 
J013002P10GGCCGTCCACGTGTCCNONE 
Os12g0575000009-057-B12CACGTGTCCNONE 
009-113-B05CACGTGTCCNONE 
009-170-F09CACGTGTCCNONE 
009-191-D05CACGTGTCCNONE 
AK059885CACGTGTCCNONE 
AK104945CACGTGTCCProtein of unknown function DUF1118 family protein. 
J013124C09CACGTGTCCNONE 
J013156G23CACGTGTCCNONE 
J023033G18CACGTGTCCNONE 
J065055H05CACGTGTCCNONE 
J065129P17CACGTGTCCNONE 
J065188E10CACGTGTCCNONE 
J065195J24CACGTGTCCNONE 
J075027I24CACGTGTCCNONE 
J075028H07CACGTGTCCNONE 
J075032A03CACGTGTCCNONE 
J075057M10CACGTGTCCNONE 
J075093K11CACGTGTCCNONE 
J075098D20CACGTGTCCNONE 
J075126N24CACGTGTCCNONE 
J075140M14CACGTGTCCNONE 
J075140M21CACGTGTCCNONE 
J075147P07CACGTGTCCNONE 
J075153F12CACGTGTCCNONE 
J075157C13CACGTGTCCNONE 
J075174K01CACGTGTCCNONE 
J075194B17CACGTGTCCNONE 
J075195E11CACGTGTCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.