version

Summary of OsREG452 (All List)

OrganismOryza sativa  
IDOsREG452  
SequenceACGTGTCG  
Annotation  
PPDB MotifACGT  bZIP-binding motif, environmental responses  
PLACE MotifACGTGKC  Experimentally determined sequence requirement of ACGT-core of motif A in ABRE of the rice gene, OSEM; See S000281; DRE and ABRE are interdependent in the ABA-responsive expression of the rd29A in Arabidopsis; K=G/T;  
Total Entry Count1206  

Entry Sequences (1206 entries)

LocusGene modelSequenceDescription
Os01g0198100AK119908CGACACGTGGCConserved hypothetical protein. 
Os01g0372400AK108314CGACACGTGlutathione S-transferase, N-terminal domain containing protein. 
Os01g0390400AK067433ACGTGTCGCGACGCGNONE 
AK106834ACGTGTCGCGACGCGNONE 
J033069B09ACGTGTCGCGACGCGNONE 
Os01g0588700AK066951CGACACGTProtein of unknown function DUF572 family protein. 
AK071911CGACACGTNONE 
J013059D18CGACACGTNONE 
J013090C12CGACACGTNONE 
J090043F17CGACACGTNONE 
Os01g0644200014-007-H12CACGTGTCGNONE 
AK063634CACGTGTCGConserved hypothetical protein. 
AY549310CACGTGTCGNONE 
J075068F10CACGTGTCGNONE 
J075082A11CACGTGTCGNONE 
Os01g0705200011-075-B10CGACACGTGNONE 
014-056-F05CGACACGTGNONE 
014-072-F08CGACACGTGNONE 
014-082-E10CGACACGTGNONE 
014-085-E10CGACACGTGNONE 
AK064074CGACACGTGLate embryogenesis abundant protein repeat containing protein. 
AK073837CGACACGTGNONE 
D26536CGACACGTGNONE 
J033070H10CGACACGTGNONE 
J065138A19CGACACGTGNONE 
J065140A10CGACACGTGNONE 
Os01g0738400AK110661ACGTGTCGSimilar to Zn-finger transcription factor. 
Os01g0800800AK108093CGACACGTConserved hypothetical protein. 
Os01g0803200009-028-E02ACGTGTCGNONE 
AF435976ACGTGTCGNONE 
AK072206ACGTGTCGNONE 
AK121632ACGTGTCGNONE 
D29717ACGTGTCGNONE 
J013088C04ACGTGTCGNONE 
J023110F17ACGTGTCGNONE 
J033029J21ACGTGTCGNONE 
J033050G08ACGTGTCGNONE 
J033121L08ACGTGTCGNONE 
J03469ACGTGTCGNONE 
J043040J18ACGTGTCGNONE 
J065009B11ACGTGTCGNONE 
J065037D05ACGTGTCGNONE 
J065046C08ACGTGTCGNONE 
J065051M08ACGTGTCGNONE 
J065059H24ACGTGTCGNONE 
J065060A10ACGTGTCGNONE 
J065075N07ACGTGTCGNONE 
J065088G17ACGTGTCGNONE 
J065111I03ACGTGTCGNONE 
J065122A02ACGTGTCGNONE 
J065128L10ACGTGTCGNONE 
J065134A09ACGTGTCGNONE 
J065162H09ACGTGTCGNONE 
J065178F05ACGTGTCGNONE 
J065209J08ACGTGTCGNONE 
J065217F08ACGTGTCGNONE 
J075023A10ACGTGTCGNONE 
J075023H20ACGTGTCGNONE 
J075048H09ACGTGTCGNONE 
J075062K16ACGTGTCGNONE 
J075074F03ACGTGTCGNONE 
J075080G02ACGTGTCGNONE 
J075125J09ACGTGTCGNONE 
J075125L15ACGTGTCGNONE 
J075152L15ACGTGTCGNONE 
J075173B03ACGTGTCGNONE 
J075177M22ACGTGTCGNONE 
J080001B16ACGTGTCGNONE 
J080005K01ACGTGTCGNONE 
J080005L08ACGTGTCGNONE 
J080005N22ACGTGTCGNONE 
J080007B02ACGTGTCGNONE 
J080008E24ACGTGTCGNONE 
J080008L18ACGTGTCGNONE 
J080009H13ACGTGTCGNONE 
J080010E21ACGTGTCGNONE 
J080011D21ACGTGTCGNONE 
J080011P22ACGTGTCGNONE 
J080013A16ACGTGTCGNONE 
J080016M01ACGTGTCGNONE 
J080017A09ACGTGTCGNONE 
J080020A09ACGTGTCGNONE 
J080023B21ACGTGTCGNONE 
J080023L04ACGTGTCGNONE 
J080023M10ACGTGTCGNONE 
J080028B02ACGTGTCGNONE 
J080031E01ACGTGTCGNONE 
J080036N13ACGTGTCGNONE 
J080036N17ACGTGTCGNONE 
J080037M05ACGTGTCGNONE 
J080043K21ACGTGTCGNONE 
J080043M11ACGTGTCGNONE 
J080044I08ACGTGTCGNONE 
J080044N16ACGTGTCGNONE 
J080049L02ACGTGTCGNONE 
J080050H04ACGTGTCGNONE 
J080054G17ACGTGTCGNONE 
J080054G21ACGTGTCGNONE 
J080057A13ACGTGTCGNONE 
J080057G02ACGTGTCGNONE 
J080057G23ACGTGTCGNONE 
J080061A19ACGTGTCGNONE 
J080062A13ACGTGTCGNONE 
J080062J22ACGTGTCGNONE 
J080063G15ACGTGTCGNONE 
J080066A18ACGTGTCGNONE 
J080066E03ACGTGTCGNONE 
J080067E10ACGTGTCGNONE 
J080069L14ACGTGTCGNONE 
J080071I09ACGTGTCGNONE 
J080076E22ACGTGTCGNONE 
J080078L03ACGTGTCGNONE 
J080078L15ACGTGTCGNONE 
J080081G17ACGTGTCGNONE 
J080083C20ACGTGTCGNONE 
J080083J03ACGTGTCGNONE 
J080086C02ACGTGTCGNONE 
J080088E16ACGTGTCGNONE 
J080090A03ACGTGTCGNONE 
J080090C14ACGTGTCGNONE 
J080090F11ACGTGTCGNONE 
J080093N06ACGTGTCGNONE 
J080094B22ACGTGTCGNONE 
J080094C11ACGTGTCGNONE 
J080096E22ACGTGTCGNONE 
J080096F18ACGTGTCGNONE 
J080301K11ACGTGTCGNONE 
J080302C22ACGTGTCGNONE 
J080304K12ACGTGTCGNONE 
J080317G06ACGTGTCGNONE 
J080318L23ACGTGTCGNONE 
J090047A06ACGTGTCGNONE 
J100025M24ACGTGTCGNONE 
J100026O09ACGTGTCGNONE 
J100027D03ACGTGTCGNONE 
J100028C19ACGTGTCGNONE 
J100028D07ACGTGTCGNONE 
J100031H13ACGTGTCGNONE 
J100054J03ACGTGTCGNONE 
J100055D24ACGTGTCGNONE 
J100059L24ACGTGTCGNONE 
J100062D23ACGTGTCGNONE 
J100062F02ACGTGTCGNONE 
J100063G22ACGTGTCGNONE 
J100064A04ACGTGTCGNONE 
J100064P17ACGTGTCGNONE 
J100065F17ACGTGTCGNONE 
J100072F05ACGTGTCGNONE 
J100077D21ACGTGTCGNONE 
J100081B17ACGTGTCGNONE 
J100087G09ACGTGTCGNONE 
J100090G01ACGTGTCGNONE 
U54702ACGTGTCGNONE 
Os01g0805700AK069400ACGTGTCGConserved hypothetical protein. 
AK101937ACGTGTCGNONE 
J033074F22ACGTGTCGNONE 
J090027K02ACGTGTCGNONE 
J090033G03ACGTGTCGNONE 
Os01g0825800009-072-E02ACGTGTCGNONE 
AK064301ACGTGTCGNONE 
J033087L14ACGTGTCGNONE 
Os01g0860700009-026-D05CCACGTGTCGNONE 
AK062402CCACGTGTCGConserved hypothetical protein. 
Os01g0867900AK061366CGACACGTGProtein of unknown function DUF502 family protein. 
Os01g0879200AK109033CGACACGTConserved hypothetical protein. 
J065017M17CGACACGTNONE 
J065044O21CGACACGTNONE 
Os01g0950900AK101121CACGTGTCGProtein of unknown function DUF221 domain containing protein. 
J023036H24CACGTGTCGNONE 
J023084G23CACGTGTCGNONE 
J033025J04CACGTGTCGNONE 
J033139J18CACGTGTCGNONE 
J090006A09CACGTGTCGNONE 
J090036D02CACGTGTCGNONE 
Os01g0957600AK059235CGACACGTGSimilar to Elicitor-inducible cytochrome P450. 
Os02g0115900AF006825CCACGTGTCGNONE 
AK065743CCACGTGTCGEndosperm lumenal binding protein. 
AK119653CCACGTGTCGNONE 
Os02g0123100011-014-B01CGACACGTNONE 
012-013-G11CGACACGTNONE 
016-011-A12CGACACGTNONE 
AK063438CGACACGTNONE 
AK064363CGACACGTNONE 
AK101344CGACACGTSimilar to Cell division control protein 28 (EC 2.7.1.37). 
X60375CGACACGTNONE 
Os02g0169900AK070107CGACACGTInositol monophosphatase family protein. 
AK099345CGACACGTNONE 
AK103039CGACACGTNONE 
AK105887CGACACGTNONE 
Os02g0192900AK108910CGACACGTProtein kinase-like domain containing protein. 
J065121E05CGACACGTNONE 
Os02g0276200J075059P05ACGTGTCGIsochorismatase hydrolase family protein. 
J075172E19ACGTGTCGNONE 
J075199I16ACGTGTCGNONE 
Os02g0530600AK102681GGGTGGGCTACGTGTCGBRCT domain containing protein. 
Os02g0539200AK108494ACGTGTCGU box domain containing protein. 
Os02g0559300AK100088ACGTGTCGNONE 
AK121206ACGTGTCGProtein kinase-like domain containing protein. 
J023003H24ACGTGTCGNONE 
J023088A16ACGTGTCGNONE 
J023100K01ACGTGTCGNONE 
J023127H24ACGTGTCGNONE 
Os02g0582800AK108180CGACACGTConserved hypothetical protein. 
J075127H13CGACACGTNONE 
Os02g0586900013-044-D08ACGTGTCGNONE 
014-087-D07ACGTGTCGNONE 
AK063583ACGTGTCGSimilar to Glycine rich protein (Fragment). 
AK105378ACGTGTCGNONE 
Os02g0611500AK072083CGACACGTSimilar to Eukaryotic initiation factor-like protein. 
Os02g0644500Os02g0644500CGACACGTConserved hypothetical protein. 
Os02g0649300014-043-A05GCCACGTGTCGNONE 
AK063685GCCACGTGTCGSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0713700J043034B19ACGTGTCGNONE 
J065041I10ACGTGTCGNONE 
J065121M03ACGTGTCGNONE 
J065134C21ACGTGTCGProtein of unknown function DUF296 domain containing protein. 
J065186F18ACGTGTCGNONE 
J100033H10ACGTGTCGNONE 
J100043C12ACGTGTCGNONE 
J100048E07ACGTGTCGNONE 
J100087G13ACGTGTCGNONE 
J100090J08ACGTGTCGNONE 
Os02g0726000AK072936CGACACGTNONE 
AK099178CGACACGTBeta-Ig-H3/fasciclin domain containing protein. 
J090014C14CGACACGTNONE 
J090014G22CGACACGTNONE 
J090031H04CGACACGTNONE 
J090054D18CGACACGTNONE 
J090054I05CGACACGTNONE 
J090064M02CGACACGTNONE 
J090073C19CGACACGTNONE 
Os02g0727100AK069154CGACACGTAmino acid/polyamine transporter II family protein. 
J023006P21CGACACGTNONE 
J023027D19CGACACGTNONE 
J023044N10CGACACGTNONE 
J023088H15CGACACGTNONE 
J023090A13CGACACGTNONE 
J023142P16CGACACGTNONE 
Os02g0755600014-024-D06CGACACGTNONE 
015-039-F09CGACACGTNONE 
AK064105CGACACGTNONE 
AK106639CGACACGTSimilar to UDP-glucuronosyltransferase. 
Os03g0137400AK072057CGCACCGCGACACGTCACGTCTCNONE 
AK101118CGCACCGCGACACGTCACGTCTCProtein of unknown function DUF221 domain containing protein. 
J013129L02CGCACCGCGACACGTCACGTCTCNONE 
J033025H22CGCACCGCGACACGTCACGTCTCNONE 
J033034L15CGCACCGCGACACGTCACGTCTCNONE 
J033044F21CGCACCGCGACACGTCACGTCTCNONE 
J033046F15CGCACCGCGACACGTCACGTCTCNONE 
J033101I17CGCACCGCGACACGTCACGTCTCNONE 
J033150K16CGCACCGCGACACGTCACGTCTCNONE 
J065042G12CGCACCGCGACACGTCACGTCTCNONE 
J065083F17CGCACCGCGACACGTCACGTCTCNONE 
J100044G19CGCACCGCGACACGTCACGTCTCNONE 
Os03g0138600Os03g0138600ACGTGTCGProtein of unknown function DUF810 family protein. 
Os03g0196600Os03g0196600CGACACGTSimilar to Chloroplast serine acetyltransferase. 
Os03g0214200AK100623CACGTGTCGProtein of unknown function DUF1675 family protein. 
AK100623CGACACGTGTCGCGCGCProtein of unknown function DUF1675 family protein. 
J075053B18CACGTGTCGNONE 
J075053B18CGACACGTGTCGCGCGCNONE 
Os03g0217900AK119980CGACACGTGConserved hypothetical protein. 
J053089K18CGACACGTGNONE 
J090058B20CGACACGTGNONE 
J090081L09CGACACGTGNONE 
Os03g0297800AK107121ACGTGTCGProtein kinase-like domain containing protein. 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0308000016-023-H09CGACACGTGGGCCCAACANONE 
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CGACACGTGGGCCCAACANONE 
J023043K04CGACACGTGGGCCCAACANONE 
J023083I20CGACACGTGGGCCCAACANONE 
J033068F22CGACACGTGGGCCCAACANONE 
J033125P21CGACACGTGGGCCCAACANONE 
J065207A22CGACACGTGGGCCCAACANONE 
J100018D20CGACACGTGGGCCCAACANONE 
J100026L17CGACACGTGGGCCCAACANONE 
J100055D14CGACACGTGGGCCCAACANONE 
J100060P03CGACACGTGGGCCCAACANONE 
J100078A20CGACACGTGGGCCCAACANONE 
Os03g0323100009-108-G02CGACACGTNONE 
AK062803CGACACGTHypothetical protein. 
AK070776CGACACGTNONE 
Os03g0323200AK067323ACGTGTCGSimilar to Protoporphyrin IX Mg-chelatase subunit precursor. 
Os03g0335300AK098846CGACACGTNONE 
AK098891CGACACGTNONE 
AK111509CGACACGTSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847CGACACGTNONE 
AK121413CGACACGTNONE 
Os03g0561249J065016H04ACGTGTCGConserved hypothetical protein. 
Os03g0607200013-002-F05CGACACGTNONE 
013-021-H08CGACACGTNONE 
013-038-E10CGACACGTNONE 
014-009-E05CGACACGTNONE 
014-034-H01CGACACGTNONE 
014-038-A08CGACACGTNONE 
014-072-G08CGACACGTNONE 
014-083-B06CGACACGTNONE 
014-088-G10CGACACGTNONE 
AK070268CGACACGTGibberellin regulated protein family protein. 
J023044E14CGACACGTNONE 
J065199F02CGACACGTNONE 
J075001C09CGACACGTNONE 
J075019F02CGACACGTNONE 
J075061J21CGACACGTNONE 
J075068G03CGACACGTNONE 
J075126F10CGACACGTNONE 
J075153F19CGACACGTNONE 
J080305I04CGACACGTNONE 
J080307F24CGACACGTNONE 
J080312E23CGACACGTNONE 
J080315M20CGACACGTNONE 
J080317E18CGACACGTNONE 
J090043I11CGACACGTNONE 
Os03g0622200AK108660CGACACGTTranscriptional factor B3 family protein. 
Os03g0623100014-072-D06ACGTGTCGNONE 
014-072-G11ACGTGTCGNONE 
AK063716ACGTGTCGConserved hypothetical protein. 
J065136O20ACGTGTCGNONE 
J075030G11ACGTGTCGNONE 
J075034O21ACGTGTCGNONE 
J075051D07ACGTGTCGNONE 
J075066M05ACGTGTCGNONE 
J075095G15ACGTGTCGNONE 
Os03g0712400AK111063ACGTGTCGNONE 
Os03g0729600009-092-C12CGACACGTCCACGCCTCNONE 
009-156-H03CGACACGTCCACGCCTCNONE 
AK062697CGACACGTCCACGCCTCNONE 
AK063169CGACACGTCCACGCCTCConserved hypothetical protein. 
Os03g0750000AK071321ACGTGTCGUniversal stress protein (Usp) family protein. 
J023088M23ACGTGTCGNONE 
J065163N07ACGTGTCGNONE 
J075006P15ACGTGTCGNONE 
J075007N13ACGTGTCGNONE 
J075018H04ACGTGTCGNONE 
J075025E04ACGTGTCGNONE 
J075036K02ACGTGTCGNONE 
J075049I06ACGTGTCGNONE 
J075050F19ACGTGTCGNONE 
J075055M07ACGTGTCGNONE 
J075070D11ACGTGTCGNONE 
J075072A01ACGTGTCGNONE 
J075081I23ACGTGTCGNONE 
J075083G08ACGTGTCGNONE 
J075095B03ACGTGTCGNONE 
J075099I22ACGTGTCGNONE 
J075122G06ACGTGTCGNONE 
J075130C13ACGTGTCGNONE 
J075143H06ACGTGTCGNONE 
J075154E20ACGTGTCGNONE 
J075174D01ACGTGTCGNONE 
J075175E01ACGTGTCGNONE 
J075185H11ACGTGTCGNONE 
J080005K09ACGTGTCGNONE 
J080006M06ACGTGTCGNONE 
J080009M15ACGTGTCGNONE 
J080013J23ACGTGTCGNONE 
J080014L22ACGTGTCGNONE 
J080018B22ACGTGTCGNONE 
J080023C20ACGTGTCGNONE 
J080025B08ACGTGTCGNONE 
J080025C17ACGTGTCGNONE 
J080025D21ACGTGTCGNONE 
J080027A19ACGTGTCGNONE 
J080030K08ACGTGTCGNONE 
J080034I08ACGTGTCGNONE 
J080034P08ACGTGTCGNONE 
J080039E04ACGTGTCGNONE 
J080041J05ACGTGTCGNONE 
J080043G01ACGTGTCGNONE 
J080044M21ACGTGTCGNONE 
J080045J24ACGTGTCGNONE 
J080045M10ACGTGTCGNONE 
J080047E17ACGTGTCGNONE 
J080047I12ACGTGTCGNONE 
J080052I15ACGTGTCGNONE 
J080060L19ACGTGTCGNONE 
J080062M06ACGTGTCGNONE 
J080064F23ACGTGTCGNONE 
J080068L14ACGTGTCGNONE 
J080070H15ACGTGTCGNONE 
J080071P16ACGTGTCGNONE 
J080076H11ACGTGTCGNONE 
J080076L20ACGTGTCGNONE 
J080077H05ACGTGTCGNONE 
J080079E17ACGTGTCGNONE 
J080089N23ACGTGTCGNONE 
J080095J09ACGTGTCGNONE 
J080096M12ACGTGTCGNONE 
J080097E11ACGTGTCGNONE 
Os03g0784900006-053-H11CGACACGTNONE 
009-165-F11CGACACGTNONE 
AK060949CGACACGTConserved hypothetical protein. 
AK099097CGACACGTNONE 
J023019M19CGACACGTNONE 
J065024O11CGACACGTNONE 
J065106D20CGACACGTNONE 
J065201L15CGACACGTNONE 
J075031B04CGACACGTNONE 
J075033C19CGACACGTNONE 
J075035F11CGACACGTNONE 
J075074K14CGACACGTNONE 
J075083A22CGACACGTNONE 
J075120O10CGACACGTNONE 
J075153L20CGACACGTNONE 
J075159G02CGACACGTNONE 
J080001J18CGACACGTNONE 
J080015I03CGACACGTNONE 
J080027E23CGACACGTNONE 
J080046D24CGACACGTNONE 
J080053B17CGACACGTNONE 
J080070P07CGACACGTNONE 
J080076D18CGACACGTNONE 
J080078E13CGACACGTNONE 
J080090H03CGACACGTNONE 
J100024F19CGACACGTNONE 
J100052D15CGACACGTNONE 
J100079B14CGACACGTNONE 
Os03g0795900012-092-G05CGACACGTNONE 
015-043-D09CGACACGTNONE 
016-078-G11CGACACGTNONE 
AK068660CGACACGTSimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14CGACACGTNONE 
J023001L04CGACACGTNONE 
J053032K11CGACACGTNONE 
J065059E10CGACACGTNONE 
J065095H19CGACACGTNONE 
J065181M06CGACACGTNONE 
J100047D11CGACACGTNONE 
J100068G04CGACACGTNONE 
Os03g0796800J065024O22CGACACGTConserved hypothetical protein. 
Os03g0815900013-097-G08CGACACGTGGCGNONE 
AK065258CGACACGTGGCGNONE 
AK119756CGACACGTGGCGSimilar to DNA-directed RNA polymerase. 
J013002J17CGACACGTGGCGNONE 
J013074A12CGACACGTGGCGNONE 
J023045C17CGACACGTGGCGNONE 
J033050E21CGACACGTGGCGNONE 
J053094P05CGACACGTGGCGNONE 
J090038F11CGACACGTGGCGNONE 
J090072J01CGACACGTGGCGNONE 
J100026H07CGACACGTGGCGNONE 
J100040O06CGACACGTGGCGNONE 
J100083D07CGACACGTGGCGNONE 
Os03g0835600AK101677CGACACGTGGAcyl-coA-binding protein, ACBP family protein. 
Os03g0837300AK111243GCCACGTGTCGNONE 
AK121140GCCACGTGTCGNicotinate phosphoribosyltransferase and related family protein. 
AY214337GCCACGTGTCGNONE 
J023077G12GCCACGTGTCGNONE 
J023078M10GCCACGTGTCGNONE 
J033031B10GCCACGTGTCGNONE 
J033067L18GCCACGTGTCGNONE 
J043005P09GCCACGTGTCGNONE 
J090013J15GCCACGTGTCGNONE 
J090042E10GCCACGTGTCGNONE 
J090045A20GCCACGTGTCGNONE 
J100022H02GCCACGTGTCGNONE 
Os04g0175400AK107892CGACACGTConserved hypothetical protein. 
J065212M08CGACACGTNONE 
Os04g0231800AK068417ACGTGTCGNONE 
J013153L19ACGTGTCGNONE 
J065020J04ACGTGTCGNONE 
J065201K08ACGTGTCGNONE 
J065214C10ACGTGTCGNONE 
Os04g0266900011-064-A07ACGTGTCGNONE 
AK069447ACGTGTCGBacterial transketolase family protein. 
J023019B19ACGTGTCGNONE 
Os04g0390700AK107261GTGACGTGTCGGlucose/ribitol dehydrogenase family protein. 
Os04g0493000J013052L03GAGACGTGTCGNONE 
J080308E10GAGACGTGTCGNONE 
Os04g0503500AK099404CGACACGTGGLeucine-rich repeat, cysteine-containing subtype containing protein. 
AK101695CGACACGTGGNONE 
Os04g0510900012-083-A10CGACACGTNONE 
014-002-F04CGACACGTNONE 
AK063625CGACACGTSimilar to Embryo-specific protein 1 (ATS1). 
J065136I20CGACACGTNONE 
J065144F23CGACACGTNONE 
J065153D08CGACACGTNONE 
J065178A02CGACACGTNONE 
J065178B01CGACACGTNONE 
J065195M21CGACACGTNONE 
Os04g0542900AK068610CGACACGTCGGATCConserved hypothetical protein. 
Os04g0555000AK100757CGACACGTGRAS transcription factor domain containing protein. 
J023002M24CGACACGTNONE 
J023118P13CGACACGTNONE 
J065166A22CGACACGTNONE 
J065192H19CGACACGTNONE 
Os04g0617050J065197A20CGACACGTGNONE 
J090067K01CGACACGTGAuxin responsive SAUR protein family protein. 
Os04g0640700J080013H22CGACACGTNONE 
J080042M16CGACACGTNONE 
J080060L10CGACACGTNONE 
J080069J19CGACACGTNONE 
J080097M13CGACACGTNONE 
Os04g0652900AK071125GCCACGTGTCGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03GCCACGTGTCGNONE 
J075142E01GCCACGTGTCGNONE 
Os04g0670400012-048-A10ACGTGTCGNONE 
AK103099ACGTGTCGOvarian tumour, otubain domain containing protein. 
J033118N06ACGTGTCGNONE 
J100019K03ACGTGTCGNONE 
Os04g0670500AK107506CGACACGTCysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0674350J065104O14CACGTGTCGNONE 
J065118J19CACGTGTCGNONE 
J065167I12CACGTGTCGHypothetical protein. 
Os04g0674400015-042-B08CGACACGTGNONE 
AK102124CGACACGTGSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2. 
J013129O22CGACACGTGNONE 
J023022I24CGACACGTGNONE 
J023120A15CGACACGTGNONE 
J023123P20CGACACGTGNONE 
J033068P09CGACACGTGNONE 
J033107G22CGACACGTGNONE 
J033116G12CGACACGTGNONE 
J033133F03CGACACGTGNONE 
J033143B20CGACACGTGNONE 
J043006G12CGACACGTGNONE 
J043027M18CGACACGTGNONE 
J043034H17CGACACGTGNONE 
J090091E20CGACACGTGNONE 
J100035H09CGACACGTGNONE 
J100037J04CGACACGTGNONE 
J100047J24CGACACGTGNONE 
J100059G06CGACACGTGNONE 
J100066O12CGACACGTGNONE 
J100074G23CGACACGTGNONE 
J100077M12CGACACGTGNONE 
Os05g0151200J065041L18CGACACGTGTspO/MBR-related protein family protein. 
J065168L08CGACACGTGNONE 
Os05g0247800AK073843CGACACGTGlycoside hydrolase, family 18 protein. 
J033068H05CGACACGTNONE 
Os05g0267800006-099-A08ACGTGTCGCGACGCNONE 
AK061207ACGTGTCGCGACGCCellular retinaldehyde-binding/triple function, N-terminal domain containing protein. 
Os05g0312600J100061B04ACGTGTCGEF-Hand type domain containing protein. 
Os05g0349800011-076-D06ACGTGTCGNONE 
011-076-D06CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
014-037-D12ACGTGTCGNONE 
014-037-D12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
AK063677ACGTGTCGEmbryonic abundant protein 1. 
AK063677CCGAGCCGTCCGCGTCGCCGCGCGACACGTEmbryonic abundant protein 1. 
AK119674ACGTGTCGNONE 
AK119674CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053027D20ACGTGTCGNONE 
J053027D20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053039D11ACGTGTCGNONE 
J053039D11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053047P16ACGTGTCGNONE 
J053047P16CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053048F05ACGTGTCGNONE 
J053048F05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053058E11ACGTGTCGNONE 
J053058E11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053060C03ACGTGTCGNONE 
J053060C03CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053082N12ACGTGTCGNONE 
J053082N12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065017B15ACGTGTCGNONE 
J065017B15CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065117G02ACGTGTCGNONE 
J065117G02CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065212K21ACGTGTCGNONE 
J065212K21CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075001H18ACGTGTCGNONE 
J075001H18CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075003F20ACGTGTCGNONE 
J075003F20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075026F11ACGTGTCGNONE 
J075026F11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075035F13ACGTGTCGNONE 
J075035F13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075055C12ACGTGTCGNONE 
J075055C12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075067L20ACGTGTCGNONE 
J075067L20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075067O13ACGTGTCGNONE 
J075067O13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075070A12ACGTGTCGNONE 
J075070A12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075089E05ACGTGTCGNONE 
J075089E05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075128J17ACGTGTCGNONE 
J075128J17CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075134M19ACGTGTCGNONE 
J075134M19CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075192L11ACGTGTCGNONE 
J075192L11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075199D14ACGTGTCGNONE 
J075199D14CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
Os05g0381400014-036-H12CGACACGTGNONE 
014-085-H12CGACACGTGNONE 
AK102039CGACACGTGSimilar to ABA induced plasma membrane protein PM 19. 
J075011E17CGACACGTGNONE 
J075057P04CGACACGTGNONE 
J075066K19CGACACGTGNONE 
J075068L13CGACACGTGNONE 
J075074J21CGACACGTGNONE 
J075076N10CGACACGTGNONE 
J075078L14CGACACGTGNONE 
J075099O16CGACACGTGNONE 
J075120C05CGACACGTGNONE 
J075140I24CGACACGTGNONE 
J075148F21CGACACGTGNONE 
J075151F01CGACACGTGNONE 
J075151I10CGACACGTGNONE 
J075156M15CGACACGTGNONE 
J075191F07CGACACGTGNONE 
J075192K20CGACACGTGNONE 
J075195M22CGACACGTGNONE 
Os05g0395300AK066212CCACGTGTCGProtein of unknown function DUF21 domain containing protein. 
Os05g0397700AK067298GCGCGCGACACGTGSecY protein family protein. 
Os05g0429700AK069203CGACACGTNONE 
AK103559CGACACGTC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0506000AF031609CGACACGTGACGCGACNONE 
AK062012CGACACGTGACGCGACNONE 
AK098900CGACACGTGACGCGACNONE 
AK122090CGACACGTGACGCGACSimilar to MS5-like protein (Fragment). 
J013002B13CGACACGTGACGCGACNONE 
J023149G13CGACACGTGACGCGACNONE 
J033123O20CGACACGTGACGCGACNONE 
J080315O17CGACACGTGACGCGACNONE 
Os05g0524400AK063963CGACACGTNONE 
AK072857CGACACGTPhosphofructokinase family protein. 
Os05g0568600009-024-B09CGCCACGTGTCGNONE 
AK063781CGCCACGTGTCGProtein of unknown function DUF1645 family protein. 
J080049H14CGCCACGTGTCGNONE 
J080062M08CGCCACGTGTCGNONE 
J080064I07CGCCACGTGTCGNONE 
J080068A12CGCCACGTGTCGNONE 
J080086J10CGCCACGTGTCGNONE 
Os05g0576700013-062-H04CGACACGTGNONE 
AK063599CGACACGTGNONE 
AK108377CGACACGTGOleosin family protein. 
Os05g0594500AK100617ATCCAACGTGTCGNONE 
Os06g0181500AK068950CGACACGTGNONE 
AK100878CGACACGTGSimilar to Plasma membrane H+-ATPase (EC 3.6.1.3). 
J023001P16CGACACGTGNONE 
Os06g0225800AB188835CGACACGTShikimate kinase domain containing protein. 
AK109730CGACACGTNONE 
J065176A08CGACACGTNONE 
Os06g0304500AK119441GACACGTGTCGCRS1/YhbY domain containing protein. 
J075143M24GACACGTGTCGNONE 
J075194D03GACACGTGTCGNONE 
Os06g0324400014-079-C07CGACACGTNONE 
AK063726CGACACGTLate embryogenesis abundant (LEA) group 1 family protein. 
J065159N12CGACACGTNONE 
J075053K06CGACACGTNONE 
Os06g0341300AK107654ACGTGTCGSeed maturation protein domain containing protein. 
Os06g0354700AK066777CGACACGTGEsterase/lipase/thioesterase domain containing protein. 
AK068937CGACACGTGNONE 
J013056F09CGACACGTGNONE 
J013065L21CGACACGTGNONE 
J013069H09CGACACGTGNONE 
J013070D15CGACACGTGNONE 
J013073L19CGACACGTGNONE 
J013075L23CGACACGTGNONE 
J013088D18CGACACGTGNONE 
J013095G23CGACACGTGNONE 
J013097K24CGACACGTGNONE 
J013106G04CGACACGTGNONE 
J013132J10CGACACGTGNONE 
J013135F08CGACACGTGNONE 
J013156B21CGACACGTGNONE 
J013159L05CGACACGTGNONE 
J013170J16CGACACGTGNONE 
J023007C08CGACACGTGNONE 
J023062F13CGACACGTGNONE 
J023085D05CGACACGTGNONE 
J033046C05CGACACGTGNONE 
J043015P17CGACACGTGNONE 
J090029M06CGACACGTGNONE 
J090035K04CGACACGTGNONE 
J090066H02CGACACGTGNONE 
Os06g0553100J065130H10CGCGCGACACGTNONE 
J075102G23CGCGCGACACGTNONE 
J075147H23CGCGCGACACGTHeat shock factor (HSF)-type, DNA-binding domain containing protein. 
Os06g0693000AK064280CGACACGTProtein kinase-like domain containing protein. 
Os06g0698711AK070810CGACACGTCTCGGCCConserved hypothetical protein. 
J065019B03CGACACGTCTCGGCCNONE 
J065047C24CGACACGTCTCGGCCNONE 
Os06g0698748004-013-F09CGACACGTCTCNONE 
006-099-E12CGACACGTCTCNONE 
009-074-D06CGACACGTCTCNONE 
009-081-C02CGACACGTCTCNONE 
013-065-B10CGACACGTCTCNONE 
AK100361CGACACGTCTCConserved hypothetical protein. 
AK105781CGACACGTCTCNONE 
J013088K23CGACACGTCTCNONE 
J013158L05CGACACGTCTCNONE 
J023083M02CGACACGTCTCNONE 
J075034E21CGACACGTCTCNONE 
J075049F24CGACACGTCTCNONE 
J075055A21CGACACGTCTCNONE 
J100044A04CGACACGTCTCNONE 
J100058I01CGACACGTCTCNONE 
Os06g0709100006-057-D06CGACACGTNONE 
011-040-A08CGACACGTNONE 
016-044-A01CGACACGTNONE 
J065026P10CGACACGTNONE 
J090017L13CGACACGTNONE 
Os07g0124700AK109848CGACACGTSimilar to PLETHORA1. 
Os07g0160600011-014-G11ACGTGTCGNONE 
015-033-C08ACGTGTCGNONE 
AK065047ACGTGTCGBeta-Ig-H3/fasciclin domain containing protein. 
AK098844ACGTGTCGNONE 
J013000B24ACGTGTCGNONE 
J013001I08ACGTGTCGNONE 
J023150E13ACGTGTCGNONE 
J033026K03ACGTGTCGNONE 
J065093N10ACGTGTCGNONE 
J075054B05ACGTGTCGNONE 
J075131H23ACGTGTCGNONE 
J090007M18ACGTGTCGNONE 
J090029B19ACGTGTCGNONE 
J100026A09ACGTGTCGNONE 
Os07g0241500AK107239CACGTCACCGACACGTGGGGCCCACCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J065065I20CACGTCACCGACACGTGGGGCCCACCCNONE 
J065158P15CACGTCACCGACACGTGGGGCCCACCCNONE 
J065167J16CACGTCACCGACACGTGGGGCCCACCCNONE 
J065183I01CACGTCACCGACACGTGGGGCCCACCCNONE 
J065187L18CACGTCACCGACACGTGGGGCCCACCCNONE 
J065205J10CACGTCACCGACACGTGGGGCCCACCCNONE 
Os07g0262950J033120B02ACGTGTCGConserved hypothetical protein. 
J075040G05ACGTGTCGNONE 
J075160F23ACGTGTCGNONE 
Os07g0295400AK060569ACGTGTCGConserved hypothetical protein. 
AK073103ACGTGTCGNONE 
J033024G02ACGTGTCGNONE 
Os07g0480900012-002-E04ACGTGTCGNONE 
AK063422ACGTGTCGSimilar to Cysteine protease (Fragment). 
J065073E02ACGTGTCGNONE 
J065122P21ACGTGTCGNONE 
J075108D13ACGTGTCGNONE 
J075147K14ACGTGTCGNONE 
Os07g0486500AK063998CGGGCCCACGTGTCGRho GTPase activation protein domain containing protein. 
AK068175CGGGCCCACGTGTCGNONE 
J013130L24CGGGCCCACGTGTCGNONE 
J013156J03CGGGCCCACGTGTCGNONE 
J033031L21CGGGCCCACGTGTCGNONE 
J043001A20CGGGCCCACGTGTCGNONE 
J043007B17CGGGCCCACGTGTCGNONE 
J043017M19CGGGCCCACGTGTCGNONE 
J043024H09CGGGCCCACGTGTCGNONE 
J043030B12CGGGCCCACGTGTCGNONE 
J065177C18CGGGCCCACGTGTCGNONE 
J075004K10CGGGCCCACGTGTCGNONE 
J075004K12CGGGCCCACGTGTCGNONE 
J075088G07CGGGCCCACGTGTCGNONE 
J075107M02CGGGCCCACGTGTCGNONE 
J075126G01CGGGCCCACGTGTCGNONE 
J075185J08CGGGCCCACGTGTCGNONE 
J100034E04CGGGCCCACGTGTCGNONE 
J100038G12CGGGCCCACGTGTCGNONE 
Os07g0616900AK071047CGACACGTGTCCProtein of unknown function DUF500 family protein. 
J013106G03CGACACGTGTCCNONE 
J013124C20CGACACGTGTCCNONE 
J033096D16CGACACGTGTCCNONE 
J043005E08CGACACGTGTCCNONE 
J065197K12CGACACGTGTCCNONE 
J065211I03CGACACGTGTCCNONE 
Os07g0633000Os07g0633000GATCCGACACGTConserved hypothetical protein. 
Os07g0643700AK109637CGACACGTEsterase/lipase/thioesterase domain containing protein. 
Os08g0129200014-040-E08ACGTGTCGNONE 
AK070034ACGTGTCGNONE 
AK101577ACGTGTCGSimilar to Cold shock protein-1. 
J065137A09ACGTGTCGNONE 
J100062K14ACGTGTCGNONE 
Os08g0192800AK059490CGCCACGTGTCGNONE 
AK101678CGCCACGTGTCGNONE 
AK120613CGCCACGTGTCGBromodomain containing protein. 
J080039B22CGCCACGTGTCGNONE 
J080039I23CGCCACGTGTCGNONE 
J080074D19CGCCACGTGTCGNONE 
J080086N13CGCCACGTGTCGNONE 
Os08g0205700009-047-A11CGACACGTGNONE 
009-167-C10CGACACGTGNONE 
014-088-E02CGACACGTGNONE 
J065029D05CGACACGTGNONE 
J065096A14CGACACGTGNONE 
J065118E14CGACACGTGNONE 
J065186J24CGACACGTGNONE 
J065199O09CGACACGTGNONE 
J100060I06CGACACGTGNONE 
Os08g0261000AK100590ACGTGTCGDisease resistance protein family protein. 
Os08g0326600AK065219GAGACGTGTCGSimilar to GMP synthetase. 
Os08g0347200AK058279CGACACGTHypothetical protein. 
J100058J16CGACACGTNONE 
Os08g0412800AK108716CGACACGTGProtein of unknown function DUF1262 family protein. 
Os08g0442900AK110520ACGTGTCGEggshell protein family protein. 
Os08g0449850J075182C20CGACACGTGConserved hypothetical protein. 
Os08g0519100011-019-F03CGACACGTNONE 
011-035-H12CGACACGTNONE 
AK063287CGACACGTNONE 
AK063323CGACACGTPlant-specific FAD-dependent oxidoreductase family protein. 
J065046G23CGACACGTNONE 
J065099P05CGACACGTNONE 
Os08g0531900AY177701CGACACGTGGSimilar to MADS box transcription factor-like protein (MADS-box protein AGL72). 
J090094F15CGACACGTGGNONE 
Os08g0532300009-122-A05CGACACGTGGCNONE 
009-129-H05CGACACGTGGCNONE 
AB011262CGACACGTGGCNONE 
AK065141CGACACGTGGCNONE 
AK119730CGACACGTGGCSimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14CGACACGTGGCNONE 
J013042K23CGACACGTGGCNONE 
J023057J08CGACACGTGGCNONE 
J023057N10CGACACGTGGCNONE 
J023113C21CGACACGTGGCNONE 
J053054E03CGACACGTGGCNONE 
J053062B07CGACACGTGGCNONE 
J053075O17CGACACGTGGCNONE 
J053075P09CGACACGTGGCNONE 
J065024H05CGACACGTGGCNONE 
J065049F22CGACACGTGGCNONE 
J065063L03CGACACGTGGCNONE 
J065102O07CGACACGTGGCNONE 
J065104M12CGACACGTGGCNONE 
J065119E04CGACACGTGGCNONE 
J065153E10CGACACGTGGCNONE 
J065168M24CGACACGTGGCNONE 
J065173I10CGACACGTGGCNONE 
J065181L04CGACACGTGGCNONE 
J065184I18CGACACGTGGCNONE 
J065203M15CGACACGTGGCNONE 
J075004C21CGACACGTGGCNONE 
J075047B11CGACACGTGGCNONE 
J075055F18CGACACGTGGCNONE 
J075065G09CGACACGTGGCNONE 
J075094O14CGACACGTGGCNONE 
J075143C22CGACACGTGGCNONE 
J075153K18CGACACGTGGCNONE 
J075164N10CGACACGTGGCNONE 
J075197C11CGACACGTGGCNONE 
J080001A01CGACACGTGGCNONE 
J080003B11CGACACGTGGCNONE 
J080006G17CGACACGTGGCNONE 
J080007J06CGACACGTGGCNONE 
J080010H12CGACACGTGGCNONE 
J080014I01CGACACGTGGCNONE 
J080015C16CGACACGTGGCNONE 
J080016P19CGACACGTGGCNONE 
J080020G24CGACACGTGGCNONE 
J080021E12CGACACGTGGCNONE 
J080023I11CGACACGTGGCNONE 
J080024H24CGACACGTGGCNONE 
J080025G18CGACACGTGGCNONE 
J080028H08CGACACGTGGCNONE 
J080030G08CGACACGTGGCNONE 
J080031H20CGACACGTGGCNONE 
J080034C20CGACACGTGGCNONE 
J080040H13CGACACGTGGCNONE 
J080044M04CGACACGTGGCNONE 
J080047D02CGACACGTGGCNONE 
J080049D17CGACACGTGGCNONE 
J080049J17CGACACGTGGCNONE 
J080050A05CGACACGTGGCNONE 
J080051C11CGACACGTGGCNONE 
J080051K06CGACACGTGGCNONE 
J080053A07CGACACGTGGCNONE 
J080053I08CGACACGTGGCNONE 
J080056L12CGACACGTGGCNONE 
J080061I19CGACACGTGGCNONE 
J080075G09CGACACGTGGCNONE 
J080078C23CGACACGTGGCNONE 
J080080I21CGACACGTGGCNONE 
J080084F04CGACACGTGGCNONE 
J080085K16CGACACGTGGCNONE 
J080097A12CGACACGTGGCNONE 
J080097N01CGACACGTGGCNONE 
J090027L10CGACACGTGGCNONE 
J100034N17CGACACGTGGCNONE 
Os08g0532400AK101608GCCACGTGTCGSimilar to AT.I.24-7 protein. 
Os09g0133600006-034-E08CGACACGTCTCNONE 
AK061477CGACACGTCTCPAP fibrillin family protein. 
AK099394CGACACGTCTCNONE 
AK104742CGACACGTCTCNONE 
AY224474CGACACGTCTCNONE 
Os09g0247700AK059400CGACACGTConserved hypothetical protein. 
Os09g0325700011-041-G03GGACACGTGTCGNONE 
AK063334GGACACGTGTCGSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24GGACACGTGTCGNONE 
Os09g0445600AK107839ACGTGTCGConserved hypothetical protein. 
Os09g0499000AK060116ACGTGTCGConserved hypothetical protein. 
Os09g0558100009-028-D03ACGTGTCGGCCCATACNONE 
014-011-A04ACGTGTCGGCCCATACNONE 
AB030211ACGTGTCGGCCCATACSimilar to Low-temperature induced protein lt101.2. 
AK062410ACGTGTCGGCCCATACNONE 
J065006B17ACGTGTCGGCCCATACNONE 
J065067M15ACGTGTCGGCCCATACNONE 
J065075E19ACGTGTCGGCCCATACNONE 
J075011G16ACGTGTCGGCCCATACNONE 
J075015L22ACGTGTCGGCCCATACNONE 
J075035O11ACGTGTCGGCCCATACNONE 
J075072E15ACGTGTCGGCCCATACNONE 
J075100O22ACGTGTCGGCCCATACNONE 
Os11g0118200AK105536GTGGGACCCACGTGTCGHypothetical protein. 
Os11g0180000006-025-E11CGCCACGTGTCGNONE 
006-044-A07CGCCACGTGTCGNONE 
AK060077CGCCACGTGTCGPlant disease resistance response protein family protein. 
Os11g0184900011-088-C07CGACACGTGTCNONE 
011-088-C07CGACACGTGTCCNONE 
015-036-B03CGACACGTGTCNONE 
015-036-B03CGACACGTGTCCNONE 
016-087-F07CGACACGTGTCNONE 
016-087-F07CGACACGTGTCCNONE 
AB028184CGACACGTGTCNONE 
AB028184CGACACGTGTCCNONE 
AK063399CGACACGTGTCSimilar to NAC-domain protein 5-7. 
AK063399CGACACGTGTCCSimilar to NAC-domain protein 5-7. 
AK064292CGACACGTGTCNONE 
AK064292CGACACGTGTCCNONE 
AK102475CGACACGTGTCNONE 
AK102475CGACACGTGTCCNONE 
J033094I01CGACACGTGTCNONE 
J033094I01CGACACGTGTCCNONE 
J090087J16CGACACGTGTCNONE 
J090087J16CGACACGTGTCCNONE 
Os11g0202300AK066860CGACACGTGNONE 
AK068673CGACACGTGConserved hypothetical protein. 
J013073M16CGACACGTGNONE 
J013088K08CGACACGTGNONE 
Os11g0216300AK067129ACGTGTCGABC-1 domain containing protein. 
Os11g0220300AK068820CGACACGTGTCConserved hypothetical protein. 
Os11g0417700J075031P16ACGTGTCGConserved hypothetical protein. 
J075031P16CGACACGTGGCConserved hypothetical protein. 
J075034C16ACGTGTCGNONE 
J075034C16CGACACGTGGCNONE 
J075034J22ACGTGTCGNONE 
J075034J22CGACACGTGGCNONE 
J075042C07ACGTGTCGNONE 
J075042C07CGACACGTGGCNONE 
J075046O07ACGTGTCGNONE 
J075046O07CGACACGTGGCNONE 
J075062O13ACGTGTCGNONE 
J075062O13CGACACGTGGCNONE 
J075091G08ACGTGTCGNONE 
J075091G08CGACACGTGGCNONE 
J075135H20ACGTGTCGNONE 
J075135H20CGACACGTGGCNONE 
J075172B13ACGTGTCGNONE 
J075172B13CGACACGTGGCNONE 
J075179G14ACGTGTCGNONE 
J075179G14CGACACGTGGCNONE 
Os11g0429000AK067370CGACACGTGConserved hypothetical protein. 
Os11g0458100015-015-H01CGACACGTNONE 
AK064092CGACACGTConserved hypothetical protein. 
Os11g0463600AK064625ACGTGTCGSimilar to Transcriptional activator FHA1. 
Os11g0530600AB000801CACGTGTCGSimilar to Chalcone synthase C2 (EC 2.3.1.74) (Naringenin-chalcone synthase C2). 
AK067810CACGTGTCGNONE 
D29697CACGTGTCGNONE 
J013119K06CACGTGTCGNONE 
J023001C21CACGTGTCGNONE 
J023081C19CACGTGTCGNONE 
J065026K21CACGTGTCGNONE 
J065040A17CACGTGTCGNONE 
J065043H01CACGTGTCGNONE 
J065093P05CACGTGTCGNONE 
J065104P15CACGTGTCGNONE 
J065127C09CACGTGTCGNONE 
J065140D08CACGTGTCGNONE 
X89859CACGTGTCGNONE 
Os11g0546300AK121962CGACACGTGTCGPatatin family protein. 
J075030A04CGACACGTGTCGNONE 
J075073J11CGACACGTGTCGNONE 
J075161G14CGACACGTGTCGNONE 
J075178C13CGACACGTGTCGNONE 
Os12g0223300006-037-D03ACGTGTCGNONE 
AJ429043ACGTGTCGNONE 
AK060133ACGTGTCGSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK073017ACGTGTCGNONE 
J065085K05ACGTGTCGNONE 
J075053C01ACGTGTCGNONE 
J075055O06ACGTGTCGNONE 
J075073B01ACGTGTCGNONE 
J075089M07ACGTGTCGNONE 
J075095E16ACGTGTCGNONE 
J075112O19ACGTGTCGNONE 
J075143A11ACGTGTCGNONE 
J075173D24ACGTGTCGNONE 
J075199G18ACGTGTCGNONE 
J090030N06ACGTGTCGNONE 
J100052H12ACGTGTCGNONE 
J100079F09ACGTGTCGNONE 
Os12g0255866J075127N18ACGTGTCGConserved hypothetical protein. 
Os12g0267500AK065740CGACACGTGConserved hypothetical protein. 
J013042N04CGACACGTGNONE 
Os12g0285600AK069104CGACACGTGGGCCATOxysterol-binding protein family protein. 
Os12g0291100013-021-D10CGACACGTGGCNONE 
013-038-B12CGACACGTGGCNONE 
AK068555CGACACGTGGCSimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
AY445627CGACACGTGGCNONE 
D00644CGACACGTGGCNONE 
J013156H12CGACACGTGGCNONE 
J023122F15CGACACGTGGCNONE 
J065001F13CGACACGTGGCNONE 
J065001O16CGACACGTGGCNONE 
J065006D15CGACACGTGGCNONE 
J065008I17CGACACGTGGCNONE 
J065008N22CGACACGTGGCNONE 
J065010K05CGACACGTGGCNONE 
J065015G11CGACACGTGGCNONE 
J065019H21CGACACGTGGCNONE 
J065020N17CGACACGTGGCNONE 
J065024O18CGACACGTGGCNONE 
J065025A04CGACACGTGGCNONE 
J065026I06CGACACGTGGCNONE 
J065028C06CGACACGTGGCNONE 
J065029C01CGACACGTGGCNONE 
J065029C06CGACACGTGGCNONE 
J065029D16CGACACGTGGCNONE 
J065029E02CGACACGTGGCNONE 
J065030P11CGACACGTGGCNONE 
J065032M13CGACACGTGGCNONE 
J065034C06CGACACGTGGCNONE 
J065037H24CGACACGTGGCNONE 
J065037O14CGACACGTGGCNONE 
J065038A12CGACACGTGGCNONE 
J065043A05CGACACGTGGCNONE 
J065046C06CGACACGTGGCNONE 
J065046D22CGACACGTGGCNONE 
J065048C14CGACACGTGGCNONE 
J065048D24CGACACGTGGCNONE 
J065049F19CGACACGTGGCNONE 
J065050C04CGACACGTGGCNONE 
J065052J16CGACACGTGGCNONE 
J065055E07CGACACGTGGCNONE 
J065055I04CGACACGTGGCNONE 
J065060L04CGACACGTGGCNONE 
J065062I15CGACACGTGGCNONE 
J065062J11CGACACGTGGCNONE 
J065065I12CGACACGTGGCNONE 
J065068C24CGACACGTGGCNONE 
J065069M04CGACACGTGGCNONE 
J065071J22CGACACGTGGCNONE 
J065076A12CGACACGTGGCNONE 
J065076C24CGACACGTGGCNONE 
J065076F09CGACACGTGGCNONE 
J065076F16CGACACGTGGCNONE 
J065077O06CGACACGTGGCNONE 
J065081E14CGACACGTGGCNONE 
J065082K22CGACACGTGGCNONE 
J065082L04CGACACGTGGCNONE 
J065085B02CGACACGTGGCNONE 
J065089C21CGACACGTGGCNONE 
J065092L07CGACACGTGGCNONE 
J065093G08CGACACGTGGCNONE 
J065093I19CGACACGTGGCNONE 
J065093K24CGACACGTGGCNONE 
J065093N04CGACACGTGGCNONE 
J065094I09CGACACGTGGCNONE 
J065094N19CGACACGTGGCNONE 
J065095J17CGACACGTGGCNONE 
J065095N24CGACACGTGGCNONE 
J065096B17CGACACGTGGCNONE 
J065096C02CGACACGTGGCNONE 
J065097P18CGACACGTGGCNONE 
J065099E07CGACACGTGGCNONE 
J065103D23CGACACGTGGCNONE 
J065104F04CGACACGTGGCNONE 
J065104L17CGACACGTGGCNONE 
J065111L14CGACACGTGGCNONE 
J065112K11CGACACGTGGCNONE 
J065115P09CGACACGTGGCNONE 
J065123A02CGACACGTGGCNONE 
J065127P14CGACACGTGGCNONE 
J065137E16CGACACGTGGCNONE 
J065138H20CGACACGTGGCNONE 
J065138J11CGACACGTGGCNONE 
J065141K23CGACACGTGGCNONE 
J065141L14CGACACGTGGCNONE 
J065143P04CGACACGTGGCNONE 
J065146N12CGACACGTGGCNONE 
J065147F21CGACACGTGGCNONE 
J065147N15CGACACGTGGCNONE 
J065154L06CGACACGTGGCNONE 
J065156C09CGACACGTGGCNONE 
J065156J18CGACACGTGGCNONE 
J065157C19CGACACGTGGCNONE 
J065159H23CGACACGTGGCNONE 
J065159M08CGACACGTGGCNONE 
J065163B19CGACACGTGGCNONE 
J065164K14CGACACGTGGCNONE 
J065166K07CGACACGTGGCNONE 
J065166O07CGACACGTGGCNONE 
J065168A18CGACACGTGGCNONE 
J065170B18CGACACGTGGCNONE 
J065170D18CGACACGTGGCNONE 
J065173E05CGACACGTGGCNONE 
J065174L23CGACACGTGGCNONE 
J065177F08CGACACGTGGCNONE 
J065177I05CGACACGTGGCNONE 
J065178P20CGACACGTGGCNONE 
J065181G24CGACACGTGGCNONE 
J065182A07CGACACGTGGCNONE 
J065183D24CGACACGTGGCNONE 
J065184K10CGACACGTGGCNONE 
J065185F09CGACACGTGGCNONE 
J065185P10CGACACGTGGCNONE 
J065186J16CGACACGTGGCNONE 
J065188K23CGACACGTGGCNONE 
J065190E22CGACACGTGGCNONE 
J065191D06CGACACGTGGCNONE 
J065193C05CGACACGTGGCNONE 
J065193N13CGACACGTGGCNONE 
J065194B15CGACACGTGGCNONE 
J065199C03CGACACGTGGCNONE 
J065200P19CGACACGTGGCNONE 
J065202O18CGACACGTGGCNONE 
J065203F16CGACACGTGGCNONE 
J065204A15CGACACGTGGCNONE 
J065206P13CGACACGTGGCNONE 
J065207P12CGACACGTGGCNONE 
J065210J24CGACACGTGGCNONE 
J065211K01CGACACGTGGCNONE 
J065213O21CGACACGTGGCNONE 
J065215L18CGACACGTGGCNONE 
J065216N22CGACACGTGGCNONE 
J065219A16CGACACGTGGCNONE 
J065219C24CGACACGTGGCNONE 
J075012P04CGACACGTGGCNONE 
J075013K19CGACACGTGGCNONE 
J075028N24CGACACGTGGCNONE 
J075028P16CGACACGTGGCNONE 
J075032H22CGACACGTGGCNONE 
J075032J18CGACACGTGGCNONE 
J075042O14CGACACGTGGCNONE 
J075047A04CGACACGTGGCNONE 
J075053A16CGACACGTGGCNONE 
J075064C23CGACACGTGGCNONE 
J075072H11CGACACGTGGCNONE 
J075073C03CGACACGTGGCNONE 
J075081G11CGACACGTGGCNONE 
J075093H04CGACACGTGGCNONE 
J075095A11CGACACGTGGCNONE 
J075095C13CGACACGTGGCNONE 
J075100D18CGACACGTGGCNONE 
J075101P08CGACACGTGGCNONE 
J075114G11CGACACGTGGCNONE 
J075118D19CGACACGTGGCNONE 
J075122K13CGACACGTGGCNONE 
J075125G22CGACACGTGGCNONE 
J075129E22CGACACGTGGCNONE 
J075129I07CGACACGTGGCNONE 
J075132C12CGACACGTGGCNONE 
J075135E24CGACACGTGGCNONE 
J075136I06CGACACGTGGCNONE 
J075136O07CGACACGTGGCNONE 
J075138I07CGACACGTGGCNONE 
J075142G08CGACACGTGGCNONE 
J075147J22CGACACGTGGCNONE 
J075150H20CGACACGTGGCNONE 
J075151A15CGACACGTGGCNONE 
J075151G24CGACACGTGGCNONE 
J075151J20CGACACGTGGCNONE 
J075156N21CGACACGTGGCNONE 
J075158O12CGACACGTGGCNONE 
J075161E05CGACACGTGGCNONE 
J075166F17CGACACGTGGCNONE 
J075169M10CGACACGTGGCNONE 
J075174K15CGACACGTGGCNONE 
J075179F17CGACACGTGGCNONE 
J075185G15CGACACGTGGCNONE 
J075188P12CGACACGTGGCNONE 
J075191P15CGACACGTGGCNONE 
J075192A13CGACACGTGGCNONE 
J075197E23CGACACGTGGCNONE 
J075197M02CGACACGTGGCNONE 
J075198M16CGACACGTGGCNONE 
J080020B11CGACACGTGGCNONE 
J080021M20CGACACGTGGCNONE 
J080066K02CGACACGTGGCNONE 
J080301F01CGACACGTGGCNONE 
J080301G19CGACACGTGGCNONE 
J080305G02CGACACGTGGCNONE 
J080306N09CGACACGTGGCNONE 
J080309D21CGACACGTGGCNONE 
J080309I02CGACACGTGGCNONE 
J080313J11CGACACGTGGCNONE 
J080313P09CGACACGTGGCNONE 
J080315B10CGACACGTGGCNONE 
J080315O13CGACACGTGGCNONE 
J080316G02CGACACGTGGCNONE 
J080317F03CGACACGTGGCNONE 
J080318D17CGACACGTGGCNONE 
J080319C10CGACACGTGGCNONE 
J090017E03CGACACGTGGCNONE 
J090034N22CGACACGTGGCNONE 
J090042G07CGACACGTGGCNONE 
J090062P21CGACACGTGGCNONE 
J090082D08CGACACGTGGCNONE 
J090096M13CGACACGTGGCNONE 
J100086J22CGACACGTGGCNONE 
Os12g0407100J075130F11GCGCGCGACACGTGTCNONE 
J075150G14GCGCGCGACACGTGTCConserved hypothetical protein. 
J090089B20GCGCGCGACACGTGTCNONE 
J100042D22GCGCGCGACACGTGTCNONE 
Os12g0411700AK067639CACGTGTCGABC transporter related domain containing protein. 
J080005L02CACGTGTCGNONE 
J080009H17CACGTGTCGNONE 
J080025L24CACGTGTCGNONE 
J080063F18CACGTGTCGNONE 
J080086M05CACGTGTCGNONE 
Os12g0478100013-036-F11CGACACGTGTCNONE 
AK063578CGACACGTGTCGRAM domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.