version

Summary of OsREG453 (All List)

OrganismOryza sativa  
IDOsREG453  
SequenceACTGACAG  
Annotation  
PPDB Motif 
PLACE MotifTGAC  "A core of TGAC-containing W-box" of, e.g., Amy32b promoter; Binding site of rice WRKY71, a transcriptional repressor of the gibberellin signaling pathway; Parsley WRKY proteins bind specifically to TGAC-containing W box elements within the Pathogenesis-Related Class10 (PR-10) genes (Eulgem et al., 1999); See S000390 (TTGAC), S000442 (TGACT);  
Total Entry Count1259  

Entry Sequences (1259 entries)

LocusGene modelSequenceDescription
Os01g0130400AK063966CCTGTCAGTNONE 
AK102309CCTGTCAGTSimilar to Alpha-xylosidase precursor (Fragment). 
Os01g0167400AB051107CCTGTCAGTGSimilar to Protein synthesis inhibitor II (EC 3.2.2.22) (Ribosome-inactivating protein II) (rRNA N-glycosidase). 
AK120073CCTGTCAGTGNONE 
J065062A04CCTGTCAGTGNONE 
Os01g0184800AK073377CACTGACAGCCCGGGCCCACCPhosducin family protein. 
AK102544CACTGACAGCCCGGGCCCACCNONE 
J023047L21CACTGACAGCCCGGGCCCACCNONE 
J023135I09CACTGACAGCCCGGGCCCACCNONE 
J033028G17CACTGACAGCCCGGGCCCACCNONE 
J065164L07CACTGACAGCCCGGGCCCACCNONE 
J065193F22CACTGACAGCCCGGGCCCACCNONE 
J075035I10CACTGACAGCCCGGGCCCACCNONE 
J075168H15CACTGACAGCCCGGGCCCACCNONE 
Os01g0200400006-024-C04AGATGGGCCCACCTGTCAGTGGNONE 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK104558AGATGGGCCCACCTGTCAGTGGNONE 
J023043M23AGATGGGCCCACCTGTCAGTGGNONE 
J043001A15AGATGGGCCCACCTGTCAGTGGNONE 
J065155O20AGATGGGCCCACCTGTCAGTGGNONE 
J065183G02AGATGGGCCCACCTGTCAGTGGNONE 
J090007F17AGATGGGCCCACCTGTCAGTGGNONE 
J090034P12AGATGGGCCCACCTGTCAGTGGNONE 
Os01g0276700011-014-A12GGGTGGGCCCCACCTGTCAGTNONE 
012-092-G12GGGTGGGCCCCACCTGTCAGTNONE 
AK103164GGGTGGGCCCCACCTGTCAGTNONE 
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09GGGTGGGCCCCACCTGTCAGTNONE 
J023084I02GGGTGGGCCCCACCTGTCAGTNONE 
J033027F20GGGTGGGCCCCACCTGTCAGTNONE 
J033029M06GGGTGGGCCCCACCTGTCAGTNONE 
J033039K13GGGTGGGCCCCACCTGTCAGTNONE 
J033057C24GGGTGGGCCCCACCTGTCAGTNONE 
J033058G20GGGTGGGCCCCACCTGTCAGTNONE 
J033060A14GGGTGGGCCCCACCTGTCAGTNONE 
J033061M21GGGTGGGCCCCACCTGTCAGTNONE 
J033068M10GGGTGGGCCCCACCTGTCAGTNONE 
J033074K16GGGTGGGCCCCACCTGTCAGTNONE 
J033076C11GGGTGGGCCCCACCTGTCAGTNONE 
J033093O13GGGTGGGCCCCACCTGTCAGTNONE 
J033119H20GGGTGGGCCCCACCTGTCAGTNONE 
J033121D22GGGTGGGCCCCACCTGTCAGTNONE 
J033129N11GGGTGGGCCCCACCTGTCAGTNONE 
J033131E12GGGTGGGCCCCACCTGTCAGTNONE 
J033150L07GGGTGGGCCCCACCTGTCAGTNONE 
J053024N17GGGTGGGCCCCACCTGTCAGTNONE 
J053034G19GGGTGGGCCCCACCTGTCAGTNONE 
J053035E18GGGTGGGCCCCACCTGTCAGTNONE 
J053046M01GGGTGGGCCCCACCTGTCAGTNONE 
J053047P04GGGTGGGCCCCACCTGTCAGTNONE 
J053048B06GGGTGGGCCCCACCTGTCAGTNONE 
J053050M22GGGTGGGCCCCACCTGTCAGTNONE 
J053053E09GGGTGGGCCCCACCTGTCAGTNONE 
J053053I07GGGTGGGCCCCACCTGTCAGTNONE 
J053059K03GGGTGGGCCCCACCTGTCAGTNONE 
J053059P12GGGTGGGCCCCACCTGTCAGTNONE 
J053060C12GGGTGGGCCCCACCTGTCAGTNONE 
J053060H24GGGTGGGCCCCACCTGTCAGTNONE 
J053064D19GGGTGGGCCCCACCTGTCAGTNONE 
J053066L15GGGTGGGCCCCACCTGTCAGTNONE 
J053073I02GGGTGGGCCCCACCTGTCAGTNONE 
J053083E15GGGTGGGCCCCACCTGTCAGTNONE 
J053094D05GGGTGGGCCCCACCTGTCAGTNONE 
J053094P18GGGTGGGCCCCACCTGTCAGTNONE 
J053095C15GGGTGGGCCCCACCTGTCAGTNONE 
J053095C21GGGTGGGCCCCACCTGTCAGTNONE 
J053099N16GGGTGGGCCCCACCTGTCAGTNONE 
J090025O19GGGTGGGCCCCACCTGTCAGTNONE 
J090049N22GGGTGGGCCCCACCTGTCAGTNONE 
J090050F17GGGTGGGCCCCACCTGTCAGTNONE 
Os01g0293100AK106850CTGTCAGTGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os01g0327500AK107756CACTGACAGGTGGGConserved hypothetical protein. 
Os01g0373500AK107175CTGTCAGTConserved hypothetical protein. 
Os01g0585600AK062064CTGTCAGTNONE 
Os01g0588200006-052-E10TGCGGGCCCCACTGACAGNONE 
AJ251563TGCGGGCCCCACTGACAGNONE 
AK070745TGCGGGCCCCACTGACAGVoltage-dependent anion channel. 
AK104055TGCGGGCCCCACTGACAGNONE 
AK104419TGCGGGCCCCACTGACAGNONE 
J023057A07TGCGGGCCCCACTGACAGNONE 
J023068C08TGCGGGCCCCACTGACAGNONE 
J023148E24TGCGGGCCCCACTGACAGNONE 
J090045O22TGCGGGCCCCACTGACAGNONE 
J090045P03TGCGGGCCCCACTGACAGNONE 
J090050C18TGCGGGCCCCACTGACAGNONE 
J100023F01TGCGGGCCCCACTGACAGNONE 
J100051I18TGCGGGCCCCACTGACAGNONE 
J100060P17TGCGGGCCCCACTGACAGNONE 
Os01g0663500006-024-H09CCACCTGTCAGTGNONE 
AK058452CCACCTGTCAGTGNONE 
AK060072CCACCTGTCAGTGTranscriptional coactivator/pterin dehydratase family protein. 
Os01g0685900AK064024AATGGGCCCCACCTGTCAGTNONE 
AK102005AATGGGCCCCACCTGTCAGTSimilar to 65kD microtubule associated protein. 
Os01g0716200AK062106CTGTCAGTIQ calmodulin-binding region domain containing protein. 
AK062106GTGTCACTGACAGIQ calmodulin-binding region domain containing protein. 
AK098920CTGTCAGTNONE 
AK098920GTGTCACTGACAGNONE 
J013002N06CTGTCAGTNONE 
J013002N06GTGTCACTGACAGNONE 
J013050O19CTGTCAGTNONE 
J013050O19GTGTCACTGACAGNONE 
J013074N19CTGTCAGTNONE 
J013074N19GTGTCACTGACAGNONE 
J013127F17CTGTCAGTNONE 
J013127F17GTGTCACTGACAGNONE 
J013155C17CTGTCAGTNONE 
J013155C17GTGTCACTGACAGNONE 
J013158K07CTGTCAGTNONE 
J013158K07GTGTCACTGACAGNONE 
J053086D01CTGTCAGTNONE 
J053086D01GTGTCACTGACAGNONE 
Os01g0749400AK064990GGGGCCCATCTCTGTCAGTGGNONE 
AK067731GGGGCCCATCTCTGTCAGTGGHAD-superfamily hydrolase subfamily IIB protein. 
AK103775GGGGCCCATCTCTGTCAGTGGNONE 
J023001B06GGGGCCCATCTCTGTCAGTGGNONE 
Os01g0757700AK102734CCACTGACAGTGGGCCTCConserved hypothetical protein. 
J033106B06CCACTGACAGTGGGCCTCNONE 
J065025B07CCACTGACAGTGGGCCTCNONE 
J065025B08CCACTGACAGTGGGCCTCNONE 
J065033E12CCACTGACAGTGGGCCTCNONE 
J065197B01CCACTGACAGTGGGCCTCNONE 
Os01g0766400AK073493CTGTCAGTConserved hypothetical protein. 
Os01g0830500006-117-F06AGATGGGCCCACACTGACAGNONE 
AK061475AGATGGGCCCACACTGACAGNONE 
AK105801AGATGGGCCCACACTGACAG2OG-Fe(II) oxygenase domain containing protein. 
J065168H17AGATGGGCCCACACTGACAGNONE 
J065211O10AGATGGGCCCACACTGACAGNONE 
Os01g0867900AK061366ACTGACAGGTGGGGCCProtein of unknown function DUF502 family protein. 
Os01g0870100AK067564CACTGACAGGTGGGGCProtein of unknown function DUF1012 family protein. 
AK072312CACTGACAGGTGGGGCNONE 
AK103428CACTGACAGGTGGGGCNONE 
Os01g0884400AK072566CCTGTCAGTGU box domain containing protein. 
Os01g0897200AK061505GGGCCCCACCTGTCAGTGNONE 
AK065055GGGCCCCACCTGTCAGTGNONE 
AK100403GGGCCCCACCTGTCAGTGSimilar to Ribonuclease 2 precursor (EC 3.1.27.1). 
AK105061GGGCCCCACCTGTCAGTGNONE 
AK121862GGGCCCCACCTGTCAGTGNONE 
J013001J04GGGCCCCACCTGTCAGTGNONE 
J033103A19GGGCCCCACCTGTCAGTGNONE 
J075005P18GGGCCCCACCTGTCAGTGNONE 
J090027D12GGGCCCCACCTGTCAGTGNONE 
J090032M01GGGCCCCACCTGTCAGTGNONE 
J090079K10GGGCCCCACCTGTCAGTGNONE 
J100018O17GGGCCCCACCTGTCAGTGNONE 
J100080H14GGGCCCCACCTGTCAGTGNONE 
J100088D08GGGCCCCACCTGTCAGTGNONE 
Os01g0905400012-077-F08CGGGCCCACCTGTCAGTGNONE 
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein. 
Os01g0921100J100040A04CTGTCAGTNONE 
J100058A08CTGTCAGTConserved hypothetical protein. 
J100070H06CTGTCAGTNONE 
Os01g0921600AK071344CACTGACAGGTGGGGCCGGASimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CACTGACAGGTGGGGCCGGANONE 
J013109E03CACTGACAGGTGGGGCCGGANONE 
J023081J12CACTGACAGGTGGGGCCGGANONE 
J023091E24CACTGACAGGTGGGGCCGGANONE 
J033022A01CACTGACAGGTGGGGCCGGANONE 
J033074C13CACTGACAGGTGGGGCCGGANONE 
J065199E03CACTGACAGGTGGGGCCGGANONE 
J075172O04CACTGACAGGTGGGGCCGGANONE 
J090007G18CACTGACAGGTGGGGCCGGANONE 
J090052B17CACTGACAGGTGGGGCCGGANONE 
J090074H01CACTGACAGGTGGGGCCGGANONE 
J100043J09CACTGACAGGTGGGGCCGGANONE 
J100059J05CACTGACAGGTGGGGCCGGANONE 
Os01g0961200011-099-H06CCACTGACAGGNONE 
AK105424CCACTGACAGGCBS domain containing protein. 
J065169J18CCACTGACAGGNONE 
J075109H12CCACTGACAGGNONE 
Os02g0121000AK099931GTGGGTCCCACCTGTCAGTSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0198600005-012-D12ACTGACAGNONE 
AK058299ACTGACAGNONE 
Os02g0236200AK073725ACTGACAGSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
Os02g0316200AK073932CACTGACAGGCyclin-like F-box domain containing protein. 
AK105757CACTGACAGGNONE 
J023039G03CACTGACAGGNONE 
J033076K03CACTGACAGGNONE 
J075157J22CACTGACAGGNONE 
J090097K02CACTGACAGGNONE 
J100053F10CACTGACAGGNONE 
Os02g0574600AK059246CACCTGTCAGTConserved hypothetical protein. 
Os02g0601800AB060276CACTGACAGGTGGNONE 
AK099539CACTGACAGGTGGNONE 
AK101873CACTGACAGGTGGBromodomain containing protein. 
AK106801CACTGACAGGTGGNONE 
AK121758CACTGACAGGTGGNONE 
AK121891CACTGACAGGTGGNONE 
J013059H01CACTGACAGGTGGNONE 
J013092F08CACTGACAGGTGGNONE 
J013146J04CACTGACAGGTGGNONE 
J023001K12CACTGACAGGTGGNONE 
J023002H16CACTGACAGGTGGNONE 
J023013B10CACTGACAGGTGGNONE 
J023081I22CACTGACAGGTGGNONE 
J023084K19CACTGACAGGTGGNONE 
J023150E24CACTGACAGGTGGNONE 
J033023B18CACTGACAGGTGGNONE 
J033025F18CACTGACAGGTGGNONE 
J033048P08CACTGACAGGTGGNONE 
J033060M24CACTGACAGGTGGNONE 
J033070G06CACTGACAGGTGGNONE 
J033088P12CACTGACAGGTGGNONE 
J033105C13CACTGACAGGTGGNONE 
J043009N18CACTGACAGGTGGNONE 
J065103G21CACTGACAGGTGGNONE 
J075039H15CACTGACAGGTGGNONE 
J090014K10CACTGACAGGTGGNONE 
J090022N02CACTGACAGGTGGNONE 
J090033F18CACTGACAGGTGGNONE 
J090033I04CACTGACAGGTGGNONE 
J090041F11CACTGACAGGTGGNONE 
J090045P20CACTGACAGGTGGNONE 
J090054B01CACTGACAGGTGGNONE 
J090055M12CACTGACAGGTGGNONE 
J090071K09CACTGACAGGTGGNONE 
J090098O16CACTGACAGGTGGNONE 
J090099P15CACTGACAGGTGGNONE 
J100050I16CACTGACAGGTGGNONE 
Os02g0608900AK068690ACTGACAGNONE 
AK105867ACTGACAGSimilar to Epstein-Barr virus (B95-8 isolate) U2-IR2 domain encoding nuclear protein EBNA2, complete cds. 
J065017D16ACTGACAGNONE 
J065042D05ACTGACAGNONE 
J065117J15ACTGACAGNONE 
J075020G04ACTGACAGNONE 
J075052B14ACTGACAGNONE 
J075170K13ACTGACAGNONE 
J075178D19ACTGACAGNONE 
J075182F02ACTGACAGNONE 
J075199I18ACTGACAGNONE 
J090057A11ACTGACAGNONE 
J100048A21ACTGACAGNONE 
Os02g0725100AK071759ACTGACAGNONE 
AK071759ACTGACAGGTGTGGCCCACTNONE 
Os02g0781700006-066-G01GGCCCCACCTGTCAGTGGNONE 
009-034-D03GGCCCCACCTGTCAGTGGNONE 
009-194-D04GGCCCCACCTGTCAGTGGNONE 
AK061791GGCCCCACCTGTCAGTGGConserved hypothetical protein. 
AK063223GGCCCCACCTGTCAGTGGNONE 
AY224477GGCCCCACCTGTCAGTGGNONE 
J013045H09GGCCCCACCTGTCAGTGGNONE 
J013061I22GGCCCCACCTGTCAGTGGNONE 
J013071F11GGCCCCACCTGTCAGTGGNONE 
J023130H07GGCCCCACCTGTCAGTGGNONE 
J043036K23GGCCCCACCTGTCAGTGGNONE 
J065010N07GGCCCCACCTGTCAGTGGNONE 
J065219I01GGCCCCACCTGTCAGTGGNONE 
J090073I15GGCCCCACCTGTCAGTGGNONE 
Os02g0815200AK067252ACTGACAGGSimilar to 29 kDa ribonucleoprotein, chloroplast precursor (RNA-binding protein cp29). 
AK104489ACTGACAGGNONE 
Os02g0832700AK099439ACTGACAGSimilar to Metal tolerance protein C2 (AtMTPc2). 
Os03g0135300004-017-A10AGCCCATCTGTCAGTGNONE 
004-017-A10CTGTCAGTGNONE 
006-046-A11AGCCCATCTGTCAGTGNONE 
006-046-A11CTGTCAGTGNONE 
006-110-B05AGCCCATCTGTCAGTGNONE 
006-110-B05CTGTCAGTGNONE 
AF309384AGCCCATCTGTCAGTGNONE 
AF309384CTGTCAGTGNONE 
AK071745AGCCCATCTGTCAGTGSimilar to Glutathione S-transferase GST 10 (EC 2.5.1.18). 
AK071745CTGTCAGTGSimilar to Glutathione S-transferase GST 10 (EC 2.5.1.18). 
AK104680AGCCCATCTGTCAGTGNONE 
AK104680CTGTCAGTGNONE 
J013100M12AGCCCATCTGTCAGTGNONE 
J013100M12CTGTCAGTGNONE 
J023107J18AGCCCATCTGTCAGTGNONE 
J023107J18CTGTCAGTGNONE 
J033081B13AGCCCATCTGTCAGTGNONE 
J033081B13CTGTCAGTGNONE 
J033087L03AGCCCATCTGTCAGTGNONE 
J033087L03CTGTCAGTGNONE 
J065120N18AGCCCATCTGTCAGTGNONE 
J065120N18CTGTCAGTGNONE 
J075032C15AGCCCATCTGTCAGTGNONE 
J075032C15CTGTCAGTGNONE 
J075172P14AGCCCATCTGTCAGTGNONE 
J075172P14CTGTCAGTGNONE 
J090049B05AGCCCATCTGTCAGTGNONE 
J090049B05CTGTCAGTGNONE 
Os03g0152000AK102357ACTGACAGGHeavy metal transport/detoxification protein domain containing protein. 
J023072F16ACTGACAGGNONE 
J033091H19ACTGACAGGNONE 
J065037B07ACTGACAGGNONE 
J065087E11ACTGACAGGNONE 
J065098H09ACTGACAGGNONE 
J065105L15ACTGACAGGNONE 
J065165N20ACTGACAGGNONE 
J065166C14ACTGACAGGNONE 
J065183M01ACTGACAGGNONE 
J065187C11ACTGACAGGNONE 
J075001H11ACTGACAGGNONE 
J075044D12ACTGACAGGNONE 
J075088L19ACTGACAGGNONE 
J075124A10ACTGACAGGNONE 
J075155D14ACTGACAGGNONE 
J075173I10ACTGACAGGNONE 
J090009D11ACTGACAGGNONE 
J090056G24ACTGACAGGNONE 
J100028I24ACTGACAGGNONE 
J100029D09ACTGACAGGNONE 
Os03g0161000AK121425CACTGACAGGTGGGCCGGGGACGGCTNONE 
J023135K12CACTGACAGGTGGGCCGGGGACGGCTNONE 
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0181600AK067807ACTGACAGSimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197ACTGACAGNONE 
Os03g0199500J065099N05CCCACCTGTCAGTGNONE 
J065152P14CCCACCTGTCAGTGConserved hypothetical protein. 
J080009C14CCCACCTGTCAGTGNONE 
J080011K01CCCACCTGTCAGTGNONE 
J080015H12CCCACCTGTCAGTGNONE 
J080022K05CCCACCTGTCAGTGNONE 
J080034G01CCCACCTGTCAGTGNONE 
J080038I04CCCACCTGTCAGTGNONE 
J080039F20CCCACCTGTCAGTGNONE 
J080042J22CCCACCTGTCAGTGNONE 
J080042N23CCCACCTGTCAGTGNONE 
J080043E07CCCACCTGTCAGTGNONE 
J080050A12CCCACCTGTCAGTGNONE 
J080050C11CCCACCTGTCAGTGNONE 
J080052B01CCCACCTGTCAGTGNONE 
J080052H22CCCACCTGTCAGTGNONE 
J080060E02CCCACCTGTCAGTGNONE 
J080063K24CCCACCTGTCAGTGNONE 
J080067I07CCCACCTGTCAGTGNONE 
J080081H22CCCACCTGTCAGTGNONE 
J080085J10CCCACCTGTCAGTGNONE 
J080089E20CCCACCTGTCAGTGNONE 
J080092N04CCCACCTGTCAGTGNONE 
J080093B01CCCACCTGTCAGTGNONE 
J080093N04CCCACCTGTCAGTGNONE 
J080097B03CCCACCTGTCAGTGNONE 
Os03g0206600AK058618CCACTGACAGGTGGGTCCProtein of unknown function DUF588 family protein. 
Os03g0275700AK111329GGCCCACCTGTCAGTGConserved hypothetical protein. 
Os03g0298300AK061180CTGTCAGTGProtein of unknown function DUF588 family protein. 
AK099089CTGTCAGTGNONE 
Os03g0299600009-037-H11TCTCGGCCCAGACTGACAGNONE 
011-072-E02TCTCGGCCCAGACTGACAGNONE 
AK068151TCTCGGCCCAGACTGACAGWound-induced WI12 family protein. 
J013132L05TCTCGGCCCAGACTGACAGNONE 
J023012P15TCTCGGCCCAGACTGACAGNONE 
J023022H03TCTCGGCCCAGACTGACAGNONE 
J023026N15TCTCGGCCCAGACTGACAGNONE 
J023056A21TCTCGGCCCAGACTGACAGNONE 
J023093P10TCTCGGCCCAGACTGACAGNONE 
J075143J10TCTCGGCCCAGACTGACAGNONE 
J075166I19TCTCGGCCCAGACTGACAGNONE 
J090010G13TCTCGGCCCAGACTGACAGNONE 
J090033D23TCTCGGCCCAGACTGACAGNONE 
J090090L22TCTCGGCCCAGACTGACAGNONE 
Os03g0385400009-011-B08ACTGACAGNONE 
009-073-E04ACTGACAGNONE 
009-181-D10ACTGACAGNONE 
014-027-G11ACTGACAGNONE 
AK068223ACTGACAGPlant lipid transfer protein/Par allergen family protein. 
AK070241ACTGACAGNONE 
J065193L18ACTGACAGNONE 
J075086H20ACTGACAGNONE 
J075178G03ACTGACAGNONE 
J075199N02ACTGACAGNONE 
J080014D24ACTGACAGNONE 
Os03g0416300AK103650ACTGACAGSimilar to Phytochelatin synthetase (Fragment). 
Os03g0421800AK099491CCTGTCAGTVirulence factor, pectin lyase fold family protein. 
J065198F08CCTGTCAGTNONE 
Os03g0425900AK105583CCTGTCAGTZinc finger, C2H2-type domain containing protein. 
Os03g0584300009-018-H09CTGTCAGTNONE 
AK105133CTGTCAGTProtein of unknown function UPF0136, Transmembrane family protein. 
J065053M11CTGTCAGTNONE 
Os03g0666200AK102364CACTGACAGPleckstrin homology-type domain containing protein. 
J033097E16CACTGACAGNONE 
Os03g0726100004-005-B05TCTGGACCCACCTGTCAGTGNONE 
006-023-C08TCTGGACCCACCTGTCAGTGNONE 
006-029-H02TCTGGACCCACCTGTCAGTGNONE 
006-032-B03TCTGGACCCACCTGTCAGTGNONE 
006-035-C10TCTGGACCCACCTGTCAGTGNONE 
006-040-H05TCTGGACCCACCTGTCAGTGNONE 
006-043-C02TCTGGACCCACCTGTCAGTGNONE 
006-046-B11TCTGGACCCACCTGTCAGTGNONE 
006-046-E05TCTGGACCCACCTGTCAGTGNONE 
006-046-H04TCTGGACCCACCTGTCAGTGNONE 
006-048-A09TCTGGACCCACCTGTCAGTGNONE 
006-050-A02TCTGGACCCACCTGTCAGTGNONE 
006-063-A02TCTGGACCCACCTGTCAGTGNONE 
006-064-A09TCTGGACCCACCTGTCAGTGNONE 
006-070-G11TCTGGACCCACCTGTCAGTGNONE 
006-072-G04TCTGGACCCACCTGTCAGTGNONE 
006-077-G12TCTGGACCCACCTGTCAGTGNONE 
006-080-F04TCTGGACCCACCTGTCAGTGNONE 
006-080-H01TCTGGACCCACCTGTCAGTGNONE 
006-084-D10TCTGGACCCACCTGTCAGTGNONE 
006-084-G06TCTGGACCCACCTGTCAGTGNONE 
006-085-H10TCTGGACCCACCTGTCAGTGNONE 
006-086-C05TCTGGACCCACCTGTCAGTGNONE 
006-087-D10TCTGGACCCACCTGTCAGTGNONE 
006-096-C09TCTGGACCCACCTGTCAGTGNONE 
006-100-F10TCTGGACCCACCTGTCAGTGNONE 
006-108-D12TCTGGACCCACCTGTCAGTGNONE 
006-115-G10TCTGGACCCACCTGTCAGTGNONE 
006-119-C09TCTGGACCCACCTGTCAGTGNONE 
006-120-E05TCTGGACCCACCTGTCAGTGNONE 
011-042-H01TCTGGACCCACCTGTCAGTGNONE 
011-075-B11TCTGGACCCACCTGTCAGTGNONE 
013-003-D03TCTGGACCCACCTGTCAGTGNONE 
013-028-B11TCTGGACCCACCTGTCAGTGNONE 
013-031-A01TCTGGACCCACCTGTCAGTGNONE 
013-035-F03TCTGGACCCACCTGTCAGTGNONE 
013-051-D02TCTGGACCCACCTGTCAGTGNONE 
013-055-D06TCTGGACCCACCTGTCAGTGNONE 
013-059-H03TCTGGACCCACCTGTCAGTGNONE 
013-076-A09TCTGGACCCACCTGTCAGTGNONE 
013-076-B01TCTGGACCCACCTGTCAGTGNONE 
013-090-F09TCTGGACCCACCTGTCAGTGNONE 
013-100-A05TCTGGACCCACCTGTCAGTGNONE 
013-100-F05TCTGGACCCACCTGTCAGTGNONE 
013-100-G12TCTGGACCCACCTGTCAGTGNONE 
014-006-G08TCTGGACCCACCTGTCAGTGNONE 
015-003-B07TCTGGACCCACCTGTCAGTGNONE 
016-093-C06TCTGGACCCACCTGTCAGTGNONE 
AF030548TCTGGACCCACCTGTCAGTGNONE 
AK102194TCTGGACCCACCTGTCAGTGSimilar to Tubulin alpha-1 chain (Alpha-1 tubulin). 
AK119247TCTGGACCCACCTGTCAGTGNONE 
AK119362TCTGGACCCACCTGTCAGTGNONE 
AK119638TCTGGACCCACCTGTCAGTGNONE 
J013066P16TCTGGACCCACCTGTCAGTGNONE 
J023022H18TCTGGACCCACCTGTCAGTGNONE 
J023087O13TCTGGACCCACCTGTCAGTGNONE 
J023121I16TCTGGACCCACCTGTCAGTGNONE 
J023123M09TCTGGACCCACCTGTCAGTGNONE 
J033022M05TCTGGACCCACCTGTCAGTGNONE 
J033087C05TCTGGACCCACCTGTCAGTGNONE 
J065022K07TCTGGACCCACCTGTCAGTGNONE 
J065024E22TCTGGACCCACCTGTCAGTGNONE 
J065041G05TCTGGACCCACCTGTCAGTGNONE 
J065045M11TCTGGACCCACCTGTCAGTGNONE 
J065082K10TCTGGACCCACCTGTCAGTGNONE 
J065121K18TCTGGACCCACCTGTCAGTGNONE 
J065137O07TCTGGACCCACCTGTCAGTGNONE 
J065144B12TCTGGACCCACCTGTCAGTGNONE 
J065152E04TCTGGACCCACCTGTCAGTGNONE 
J065159D24TCTGGACCCACCTGTCAGTGNONE 
J065217E02TCTGGACCCACCTGTCAGTGNONE 
J075014N22TCTGGACCCACCTGTCAGTGNONE 
J075064O17TCTGGACCCACCTGTCAGTGNONE 
J080316L10TCTGGACCCACCTGTCAGTGNONE 
J080318L20TCTGGACCCACCTGTCAGTGNONE 
J090034D01TCTGGACCCACCTGTCAGTGNONE 
J090034P05TCTGGACCCACCTGTCAGTGNONE 
J090041H08TCTGGACCCACCTGTCAGTGNONE 
J090042F20TCTGGACCCACCTGTCAGTGNONE 
J090042I15TCTGGACCCACCTGTCAGTGNONE 
J090050O17TCTGGACCCACCTGTCAGTGNONE 
J090054L13TCTGGACCCACCTGTCAGTGNONE 
J090062A12TCTGGACCCACCTGTCAGTGNONE 
J090068I22TCTGGACCCACCTGTCAGTGNONE 
J090070J23TCTGGACCCACCTGTCAGTGNONE 
J090070M18TCTGGACCCACCTGTCAGTGNONE 
J090084L07TCTGGACCCACCTGTCAGTGNONE 
J090087H13TCTGGACCCACCTGTCAGTGNONE 
J090095H10TCTGGACCCACCTGTCAGTGNONE 
J090099M17TCTGGACCCACCTGTCAGTGNONE 
J100022O10TCTGGACCCACCTGTCAGTGNONE 
J100048A05TCTGGACCCACCTGTCAGTGNONE 
J100057O06TCTGGACCCACCTGTCAGTGNONE 
X91806TCTGGACCCACCTGTCAGTGNONE 
Os03g0739700003-104-A04CTGTCAGTNONE 
AK062272CTGTCAGTUncharacterized protein UPF0114 family protein. 
Os03g0780400011-100-D09CCCACCTGTCAGTGACACNONE 
AK061347CCCACCTGTCAGTGACACNONE 
AK073162CCCACCTGTCAGTGACACSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22CCCACCTGTCAGTGACACNONE 
J065045I07CCCACCTGTCAGTGACACNONE 
J090036F17CCCACCTGTCAGTGACACNONE 
J090077M14CCCACCTGTCAGTGACACNONE 
J100055G20CCCACCTGTCAGTGACACNONE 
Os03g0818200AK058641CTGTCAGTNAD-dependent epimerase/dehydratase family protein. 
J080067J02CTGTCAGTNONE 
J080085K02CTGTCAGTNONE 
J090088H02CTGTCAGTNONE 
Os03g0839900AK067347CTGTCAGTGACACUspA domain containing protein. 
Os03g0844800AK071813CTGTCAGTConserved hypothetical protein. 
J023114B14CTGTCAGTNONE 
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
Os04g0394200AK068154CACTGACAGGTGGGCCCACCASimilar to 2-oxoglutarate dehydrogenase E2 subunit. 
AK104832CACTGACAGGTGGGCCCACCANONE 
AK121002CACTGACAGGTGGGCCCACCANONE 
J033092H19CACTGACAGGTGGGCCCACCANONE 
Os04g0469000009-089-B06ACTGACAGNONE 
009-111-A10ACTGACAGNONE 
AK062816ACTGACAGHeavy metal transport/detoxification protein domain containing protein. 
J080004F04ACTGACAGNONE 
J080021H03ACTGACAGNONE 
J080038F20ACTGACAGNONE 
J080066G20ACTGACAGNONE 
J080084E17ACTGACAGNONE 
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment). 
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein. 
J065141K24CCACTGACAGGTGGGCCCGCNONE 
J065144O22CCACTGACAGGTGGGCCCGCNONE 
J065162F11CCACTGACAGGTGGGCCCGCNONE 
Os04g0504700AK068596CCTGTCAGTGConserved hypothetical protein. 
Os04g0558400AK061440ACTGACAGGAcyl-CoA thioesterase family protein. 
AK102197ACTGACAGGNONE 
J013046K23ACTGACAGGNONE 
J013090O17ACTGACAGGNONE 
J033087D05ACTGACAGGNONE 
J065029A16ACTGACAGGNONE 
J065121A13ACTGACAGGNONE 
J090063H18ACTGACAGGNONE 
J100048C18ACTGACAGGNONE 
Os04g0623600AK068129AAATGGGCCCCAGGCCCACTGTCAGTSimilar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC 1.1.3.15) (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase). 
J013126M17AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J013131A08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J023133N08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
Os04g0667000AK069874ACTGACAGGTafazzin family protein. 
J100055P09ACTGACAGGNONE 
J100057O12ACTGACAGGNONE 
J100067H07ACTGACAGGNONE 
J100070D06ACTGACAGGNONE 
J100071J16ACTGACAGGNONE 
J100072C15ACTGACAGGNONE 
Os04g0679800AK060662CTTGGGCCCCACCTGTCAGTSimilar to RNA-binding protein-like protein. 
AK099987CTTGGGCCCCACCTGTCAGTNONE 
J013130B11CTTGGGCCCCACCTGTCAGTNONE 
J065049C17CTTGGGCCCCACCTGTCAGTNONE 
J075191N12CTTGGGCCCCACCTGTCAGTNONE 
J075191P12CTTGGGCCCCACCTGTCAGTNONE 
J100031C07CTTGGGCCCCACCTGTCAGTNONE 
Os04g0686700AK105746CACTGACAGTGGGTCCKelch repeat containing protein. 
J065021K04CACTGACAGTGGGTCCNONE 
J065097E18CACTGACAGTGGGTCCNONE 
J075004C12CACTGACAGTGGGTCCNONE 
J080301H10CACTGACAGTGGGTCCNONE 
J090087N02CACTGACAGTGGGTCCNONE 
J100060E19CACTGACAGTGGGTCCNONE 
Os05g0148600003-016-C11CCACTGACAGGNONE 
AK066168CCACTGACAGGNONE 
AK104336CCACTGACAGGSimilar to Na+/H+ antiporter. 
AY360145CCACTGACAGGNONE 
J013055J22CCACTGACAGGNONE 
J013057M24CCACTGACAGGNONE 
J013074N03CCACTGACAGGNONE 
J013158A22CCACTGACAGGNONE 
J075118H09CCACTGACAGGNONE 
Os05g0150600011-043-D06CCACTGACAGCGTGGGCCCACANONE 
AK072977CCACTGACAGCGTGGGCCCACAATP-dependent DNA helicase RecQ family protein. 
AY180331CCACTGACAGCGTGGGCCCACANONE 
J090053A16CCACTGACAGCGTGGGCCCACANONE 
Os05g0163700AK071561ACTGACAGGTGGGCCAGASimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
AK071561CCACCTGTCAGTGGSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0208000AK059612CCCACGGGCCCACCTGTCAGTNONE 
AK063666CCCACGGGCCCACCTGTCAGTNONE 
AK071500CCCACGGGCCCACCTGTCAGTSimilar to 2-oxoglutarate/malate translocator. 
Os05g0350500013-071-D05GGACCCACCTGTCAGTGNONE 
AF020787GGACCCACCTGTCAGTGNONE 
AK061712GGACCCACCTGTCAGTGNONE 
AK102897GGACCCACCTGTCAGTGProliferation-associated protein 1 family protein. 
J033060G23GGACCCACCTGTCAGTGNONE 
J033112P14GGACCCACCTGTCAGTGNONE 
J033127J04GGACCCACCTGTCAGTGNONE 
J090015L18GGACCCACCTGTCAGTGNONE 
J090047K03GGACCCACCTGTCAGTGNONE 
J090097J17GGACCCACCTGTCAGTGNONE 
Os05g0361900006-033-D04ACTGACAGGTGGGCCCAGCCCNONE 
AK060107ACTGACAGGTGGGCCCAGCCCMitochondrial substrate carrier family protein. 
AK104602ACTGACAGGTGGGCCCAGCCCNONE 
AK104747ACTGACAGGTGGGCCCAGCCCNONE 
J033133L03ACTGACAGGTGGGCCCAGCCCNONE 
J080001O06ACTGACAGGTGGGCCCAGCCCNONE 
J080004F05ACTGACAGGTGGGCCCAGCCCNONE 
J080005D12ACTGACAGGTGGGCCCAGCCCNONE 
J080008G19ACTGACAGGTGGGCCCAGCCCNONE 
J080015D10ACTGACAGGTGGGCCCAGCCCNONE 
J080015H22ACTGACAGGTGGGCCCAGCCCNONE 
J080016K15ACTGACAGGTGGGCCCAGCCCNONE 
J080018D12ACTGACAGGTGGGCCCAGCCCNONE 
J080020A01ACTGACAGGTGGGCCCAGCCCNONE 
J080027A09ACTGACAGGTGGGCCCAGCCCNONE 
J080032F05ACTGACAGGTGGGCCCAGCCCNONE 
J080039D09ACTGACAGGTGGGCCCAGCCCNONE 
J080043J19ACTGACAGGTGGGCCCAGCCCNONE 
J080052G22ACTGACAGGTGGGCCCAGCCCNONE 
J080052M15ACTGACAGGTGGGCCCAGCCCNONE 
J080053D22ACTGACAGGTGGGCCCAGCCCNONE 
J080061I18ACTGACAGGTGGGCCCAGCCCNONE 
J080064O14ACTGACAGGTGGGCCCAGCCCNONE 
J080075K01ACTGACAGGTGGGCCCAGCCCNONE 
J080082I02ACTGACAGGTGGGCCCAGCCCNONE 
J080095C14ACTGACAGGTGGGCCCAGCCCNONE 
J100028N14ACTGACAGGTGGGCCCAGCCCNONE 
Os05g0430300AK121670CTGTCAGTProtein of unknown function DUF668 family protein. 
Os05g0436400003-014-B09ACTGACAGNONE 
AK060776ACTGACAGPeptidase A22, presenilin signal peptide family protein. 
Os05g0467300006-113-H02GCGGCCCACCTGTCAGTGNONE 
AK061873GCGGCCCACCTGTCAGTGSelT/selW/selH selenoprotein family protein. 
AK098945GCGGCCCACCTGTCAGTGNONE 
J013050H09GCGGCCCACCTGTCAGTGNONE 
J023108B17GCGGCCCACCTGTCAGTGNONE 
J065189J01GCGGCCCACCTGTCAGTGNONE 
J075011H05GCGGCCCACCTGTCAGTGNONE 
J075019G20GCGGCCCACCTGTCAGTGNONE 
Os05g0477100AK108641ACTGACAGGConserved hypothetical protein. 
Os05g0503300011-013-H12GTGTCACTGACAGTGGGACCCACCACNONE 
012-072-B03GTGTCACTGACAGTGGGACCCACCACNONE 
AK073969GTGTCACTGACAGTGGGACCCACCACSimilar to Sulfite reductase (Fragment). 
AK100773GTGTCACTGACAGTGGGACCCACCACNONE 
AK103289GTGTCACTGACAGTGGGACCCACCACNONE 
J013045K07GTGTCACTGACAGTGGGACCCACCACNONE 
J033075F01GTGTCACTGACAGTGGGACCCACCACNONE 
J033125N07GTGTCACTGACAGTGGGACCCACCACNONE 
J033130G12GTGTCACTGACAGTGGGACCCACCACNONE 
Os05g0549100AK072422CACTGACAGGTGGGCCAASimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os05g0557800009-156-G05AGGGCCCACTGTCAGTGNONE 
013-049-C12AGGGCCCACTGTCAGTGNONE 
AK068460AGGGCCCACTGTCAGTGSimilar to 50S ribosomal protein L21, mitochondrial precursor. 
AK105327AGGGCCCACTGTCAGTGNONE 
J013153H24AGGGCCCACTGTCAGTGNONE 
J023003F16AGGGCCCACTGTCAGTGNONE 
J065216G02AGGGCCCACTGTCAGTGNONE 
J075037C20AGGGCCCACTGTCAGTGNONE 
J100032H16AGGGCCCACTGTCAGTGNONE 
Os06g0114000006-033-H09ACTGACAGNONE 
AK060117ACTGACAGNONE 
Os06g0168700011-054-F04CACTGACAGNONE 
012-001-G03CACTGACAGNONE 
AK101305CACTGACAGNONE 
AK103637CACTGACAGSimilar to Prolin rich protein. 
J075082N06CACTGACAGNONE 
J100086I19CACTGACAGNONE 
Os06g0604000006-085-H11CCACTGACAGNONE 
AK061163CCACTGACAGNONE 
AK066422CCACTGACAGSimilar to Ethylene response factor 1. 
J065063N22CCACTGACAGNONE 
J065099J09CCACTGACAGNONE 
J090023J05CCACTGACAGNONE 
Os06g0643800AK071732CTGTCAGTSimilar to Sucrose-phosphate synthase 7 (EC 2.4.1.14) (Fragment). 
J023111F20CTGTCAGTNONE 
Os06g0695900011-023-F07CTGTCAGTGGNONE 
J023143A16CTGTCAGTGGZinc finger, RING-type domain containing protein. 
Os06g0714000AK069538CCCACCTGTCAGTProtein of unknown function UPF0183 family protein. 
AK069538CCCACCTGTCAGTGProtein of unknown function UPF0183 family protein. 
J023020A02CCCACCTGTCAGTNONE 
J023020A02CCCACCTGTCAGTGNONE 
J023039H03CCCACCTGTCAGTNONE 
J023039H03CCCACCTGTCAGTGNONE 
J100042E23CCCACCTGTCAGTNONE 
J100042E23CCCACCTGTCAGTGNONE 
J100069N01CCCACCTGTCAGTNONE 
J100069N01CCCACCTGTCAGTGNONE 
J100089L13CCCACCTGTCAGTNONE 
J100089L13CCCACCTGTCAGTGNONE 
Os06g0715500AK059749CTGTCAGTGGNONE 
AK060137CTGTCAGTGGNONE 
AK100782CTGTCAGTGGSimilar to Translocon-associated protein alpha subunit precursor (TRAP-alpha) (Signal sequence receptor alpha subunit) (SSR-alpha). 
Os06g0715700AK121440ACTGACAGGProtein of unknown function DUF803 family protein. 
Os06g0726400AF136268ACTGACAGNONE 
AK065121ACTGACAGNONE 
AK119436ACTGACAGBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
AK120332ACTGACAGNONE 
AY302112ACTGACAGNONE 
D10752ACTGACAGNONE 
D11082ACTGACAGNONE 
J013031L12ACTGACAGNONE 
J013042M09ACTGACAGNONE 
J013058E01ACTGACAGNONE 
J013058O09ACTGACAGNONE 
J013063J17ACTGACAGNONE 
J013066I24ACTGACAGNONE 
J013069F17ACTGACAGNONE 
J013106E01ACTGACAGNONE 
J013118D19ACTGACAGNONE 
J013162M11ACTGACAGNONE 
J023028B19ACTGACAGNONE 
J023031A13ACTGACAGNONE 
J023047H18ACTGACAGNONE 
J023059N10ACTGACAGNONE 
J023104N22ACTGACAGNONE 
J033025J03ACTGACAGNONE 
J033045B05ACTGACAGNONE 
J033067M08ACTGACAGNONE 
J033113D04ACTGACAGNONE 
J043003D11ACTGACAGNONE 
J043009O20ACTGACAGNONE 
J043016P06ACTGACAGNONE 
J043017C21ACTGACAGNONE 
J043017J20ACTGACAGNONE 
J043021P15ACTGACAGNONE 
J043026I22ACTGACAGNONE 
J043032L15ACTGACAGNONE 
J043034G14ACTGACAGNONE 
J043039L16ACTGACAGNONE 
J075003D02ACTGACAGNONE 
J075003O22ACTGACAGNONE 
J075005I24ACTGACAGNONE 
J075006N09ACTGACAGNONE 
J075011A22ACTGACAGNONE 
J075012K24ACTGACAGNONE 
J075017D01ACTGACAGNONE 
J075017I23ACTGACAGNONE 
J075023D17ACTGACAGNONE 
J075024B03ACTGACAGNONE 
J075025H05ACTGACAGNONE 
J075031D19ACTGACAGNONE 
J075034B02ACTGACAGNONE 
J075035C02ACTGACAGNONE 
J075037J12ACTGACAGNONE 
J075038M11ACTGACAGNONE 
J075039J17ACTGACAGNONE 
J075042P10ACTGACAGNONE 
J075046J20ACTGACAGNONE 
J075047F21ACTGACAGNONE 
J075053E05ACTGACAGNONE 
J075054D11ACTGACAGNONE 
J075054K06ACTGACAGNONE 
J075059E15ACTGACAGNONE 
J075061O04ACTGACAGNONE 
J075062I20ACTGACAGNONE 
J075066I12ACTGACAGNONE 
J075066L06ACTGACAGNONE 
J075071H12ACTGACAGNONE 
J075071N19ACTGACAGNONE 
J075074K01ACTGACAGNONE 
J075077H22ACTGACAGNONE 
J075083H18ACTGACAGNONE 
J075085F04ACTGACAGNONE 
J075085K09ACTGACAGNONE 
J075086C06ACTGACAGNONE 
J075086E06ACTGACAGNONE 
J075087A15ACTGACAGNONE 
J075090N02ACTGACAGNONE 
J075090N22ACTGACAGNONE 
J075091C04ACTGACAGNONE 
J075091G16ACTGACAGNONE 
J075097E04ACTGACAGNONE 
J075099E04ACTGACAGNONE 
J075102P22ACTGACAGNONE 
J075109B08ACTGACAGNONE 
J075109J02ACTGACAGNONE 
J075115I12ACTGACAGNONE 
J075117E17ACTGACAGNONE 
J075123C07ACTGACAGNONE 
J075124N05ACTGACAGNONE 
J075125E12ACTGACAGNONE 
J075126B11ACTGACAGNONE 
J075129E14ACTGACAGNONE 
J075130N15ACTGACAGNONE 
J075131I07ACTGACAGNONE 
J075141B13ACTGACAGNONE 
J075141B20ACTGACAGNONE 
J075144D23ACTGACAGNONE 
J075144N01ACTGACAGNONE 
J075147M24ACTGACAGNONE 
J075148L16ACTGACAGNONE 
J075151A22ACTGACAGNONE 
J075151D03ACTGACAGNONE 
J075151D04ACTGACAGNONE 
J075153E23ACTGACAGNONE 
J075156D02ACTGACAGNONE 
J075156P05ACTGACAGNONE 
J075162E23ACTGACAGNONE 
J075165J22ACTGACAGNONE 
J075166A06ACTGACAGNONE 
J075168H13ACTGACAGNONE 
J075170D04ACTGACAGNONE 
J075171C19ACTGACAGNONE 
J075173B12ACTGACAGNONE 
J075173M23ACTGACAGNONE 
J075174C03ACTGACAGNONE 
J075185O11ACTGACAGNONE 
J075186G21ACTGACAGNONE 
J075187D06ACTGACAGNONE 
J075195G21ACTGACAGNONE 
J090003D18ACTGACAGNONE 
J090005I12ACTGACAGNONE 
J090007D15ACTGACAGNONE 
J090007G20ACTGACAGNONE 
J090014G13ACTGACAGNONE 
J090014L08ACTGACAGNONE 
J090016J03ACTGACAGNONE 
J090023P22ACTGACAGNONE 
J090025C19ACTGACAGNONE 
J090028F11ACTGACAGNONE 
J090028G01ACTGACAGNONE 
J090028H02ACTGACAGNONE 
J090037I11ACTGACAGNONE 
J090040F21ACTGACAGNONE 
J090040N24ACTGACAGNONE 
J090044M12ACTGACAGNONE 
J090045B13ACTGACAGNONE 
J090045M22ACTGACAGNONE 
J090048C10ACTGACAGNONE 
J090051J02ACTGACAGNONE 
J090058O15ACTGACAGNONE 
J090062F11ACTGACAGNONE 
J090067D23ACTGACAGNONE 
J090069G15ACTGACAGNONE 
J090072I06ACTGACAGNONE 
J090073H18ACTGACAGNONE 
J090073L01ACTGACAGNONE 
J090075O21ACTGACAGNONE 
J090084K24ACTGACAGNONE 
J090087P11ACTGACAGNONE 
J090092B17ACTGACAGNONE 
J100042H08ACTGACAGNONE 
Os06g0727400AK069558CACTGACAGGTGGGCCCCSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os07g0133500015-010-H05CCACTGACAGGTGGGNONE 
AB110179CCACTGACAGGTGGGNONE 
AK106244CCACTGACAGGTGGGProtein of unknown function DUF1005 family protein. 
J090075I21CCACTGACAGGTGGGNONE 
Os07g0147600AK099551CACTGACAGNONE 
AK102834CACTGACAGProtein kinase-like domain containing protein. 
J090004P22CACTGACAGNONE 
J090040K07CACTGACAGNONE 
J090044I03CACTGACAGNONE 
J090060I04CACTGACAGNONE 
J090063O16CACTGACAGNONE 
J090072C03CACTGACAGNONE 
J090072E05CACTGACAGNONE 
J090091P08CACTGACAGNONE 
J090099P14CACTGACAGNONE 
Os07g0176200AK062003CTGTCAGTNONE 
J013048O08CTGTCAGTNONE 
J013093K05CTGTCAGTNONE 
J023075A11CTGTCAGTNONE 
J033022L15CTGTCAGTNONE 
J033123I21CTGTCAGTNONE 
J065152L07CTGTCAGTNONE 
J065195F21CTGTCAGTNONE 
J090008P11CTGTCAGTNONE 
J090011C01CTGTCAGTNONE 
J090019H19CTGTCAGTNONE 
J090043M15CTGTCAGTNONE 
J100060I19CTGTCAGTNONE 
J100072B03CTGTCAGTNONE 
Os07g0185200AK066157CCACTGACAGGTGGGCCCAGATSimilar to Membrane related protein-like. 
Os07g0245100J023048C16GGGCCCCACCTGTCAGTNONE 
J023110L14GGGCCCCACCTGTCAGTNONE 
J053023B18GGGCCCCACCTGTCAGTNONE 
J053031L17GGGCCCCACCTGTCAGTNONE 
J065035I22GGGCCCCACCTGTCAGTNONE 
J065043D21GGGCCCCACCTGTCAGTNONE 
J065072L16GGGCCCCACCTGTCAGTNONE 
J065214I23GGGCCCCACCTGTCAGTNONE 
Os07g0479300AK120117CACTGACAGGPeptidase S10, serine carboxypeptidase family protein. 
D17587CACTGACAGGNONE 
Os07g0490400AK067941CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGANONE 
Os07g0568300AK067784CCACTGACAGGTGGGTCCCACNONE 
AK067895CCACTGACAGGTGGGTCCCACSimilar to ZF protein (Fragment). 
J013119M01CCACTGACAGGTGGGTCCCACNONE 
J013120B09CCACTGACAGGTGGGTCCCACNONE 
J013123G12CCACTGACAGGTGGGTCCCACNONE 
J023012C12CCACTGACAGGTGGGTCCCACNONE 
J023020G17CCACTGACAGGTGGGTCCCACNONE 
J023037E23CCACTGACAGGTGGGTCCCACNONE 
J033076I01CCACTGACAGGTGGGTCCCACNONE 
J033108A07CCACTGACAGGTGGGTCCCACNONE 
J033138J02CCACTGACAGGTGGGTCCCACNONE 
J075033L09CCACTGACAGGTGGGTCCCACNONE 
J075049E02CCACTGACAGGTGGGTCCCACNONE 
J075060N23CCACTGACAGGTGGGTCCCACNONE 
J075094H13CCACTGACAGGTGGGTCCCACNONE 
J075179L18CCACTGACAGGTGGGTCCCACNONE 
J080005P09CCACTGACAGGTGGGTCCCACNONE 
J080044J03CCACTGACAGGTGGGTCCCACNONE 
J080062G20CCACTGACAGGTGGGTCCCACNONE 
J080063L23CCACTGACAGGTGGGTCCCACNONE 
J080065B16CCACTGACAGGTGGGTCCCACNONE 
J080071K09CCACTGACAGGTGGGTCCCACNONE 
J080089C23CCACTGACAGGTGGGTCCCACNONE 
J090008P21CCACTGACAGGTGGGTCCCACNONE 
J090046B22CCACTGACAGGTGGGTCCCACNONE 
J090094C19CCACTGACAGGTGGGTCCCACNONE 
J090096B19CCACTGACAGGTGGGTCCCACNONE 
J100060G03CCACTGACAGGTGGGTCCCACNONE 
J100082D16CCACTGACAGGTGGGTCCCACNONE 
Os07g0618400AK111671ACTGACAGNONE 
AK111826ACTGACAGSimilar to Leucine-rich repeat transmembrane protein kinase 1 (Fragment). 
J065217K18ACTGACAGNONE 
Os07g0620200AK099859ACTGACAGGTGGGCCCCHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04ACTGACAGGTGGGCCCCNONE 
Os07g0622900006-108-G01CCTGTCAGTNONE 
AK059960CCTGTCAGTConserved hypothetical protein. 
J065176B03CCTGTCAGTNONE 
J080005P16CCTGTCAGTNONE 
J080009F09CCTGTCAGTNONE 
J080013F07CCTGTCAGTNONE 
J080016L01CCTGTCAGTNONE 
J080021K23CCTGTCAGTNONE 
J080023D15CCTGTCAGTNONE 
J080025D04CCTGTCAGTNONE 
J080039C01CCTGTCAGTNONE 
J080039G22CCTGTCAGTNONE 
J080043K06CCTGTCAGTNONE 
J080049H15CCTGTCAGTNONE 
J080051K09CCTGTCAGTNONE 
J080053I18CCTGTCAGTNONE 
J080067C12CCTGTCAGTNONE 
J080067G19CCTGTCAGTNONE 
J080068L22CCTGTCAGTNONE 
J080068M23CCTGTCAGTNONE 
J080077I06CCTGTCAGTNONE 
J080077J19CCTGTCAGTNONE 
J080080A18CCTGTCAGTNONE 
J080092J08CCTGTCAGTNONE 
Os07g0631900AK061072CACTGACAGTGGGCCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0121900AK101512CACTGACAGGProtein of unknown function DUF23 family protein. 
Os08g0157900012-025-H08CCACTGACAGGNONE 
012-069-E02CCACTGACAGGNONE 
012-074-H11CCACTGACAGGNONE 
AK065294CCACTGACAGGSimilar to NAM protein. 
J013002N10CCACTGACAGGNONE 
J013042J10CCACTGACAGGNONE 
J023060K03CCACTGACAGGNONE 
J023145N12CCACTGACAGGNONE 
J033040L20CCACTGACAGGNONE 
J033044L13CCACTGACAGGNONE 
J033057C19CCACTGACAGGNONE 
J033107E01CCACTGACAGGNONE 
J033123M07CCACTGACAGGNONE 
J033136I18CCACTGACAGGNONE 
J065051P18CCACTGACAGGNONE 
J065055L08CCACTGACAGGNONE 
J065196D15CCACTGACAGGNONE 
Os08g0282400AK100935ACTGACAGGSimilar to Alpha-SNAP (Fragment). 
Os08g0408200AK111715CACTGACAGSimilar to GAMYB-binding protein (Fragment). 
Os08g0425800009-168-F06CCACTGACAGGTGGGTCCNONE 
AK061339CCACTGACAGGTGGGTCCConserved hypothetical protein. 
AK101198CCACTGACAGGTGGGTCCNONE 
J033030L06CCACTGACAGGTGGGTCCNONE 
J100036D08CCACTGACAGGTGGGTCCNONE 
J100052I22CCACTGACAGGTGGGTCCNONE 
Os08g0434300AK058477CTGTCAGTSimilar to Malate dehydrogenase precursor (EC 1.1.1.37). 
J065197F02CTGTCAGTNONE 
Os08g0450100AK058651CTGTCAGTGSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
J090084L01CTGTCAGTGNONE 
Os08g0532300009-122-A05CCTGTCAGTTTGTGGGCCCACCTNONE 
009-129-H05CCTGTCAGTTTGTGGGCCCACCTNONE 
AB011262CCTGTCAGTTTGTGGGCCCACCTNONE 
AK065141CCTGTCAGTTTGTGGGCCCACCTNONE 
AK119730CCTGTCAGTTTGTGGGCCCACCTSimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14CCTGTCAGTTTGTGGGCCCACCTNONE 
J013042K23CCTGTCAGTTTGTGGGCCCACCTNONE 
J023057J08CCTGTCAGTTTGTGGGCCCACCTNONE 
J023057N10CCTGTCAGTTTGTGGGCCCACCTNONE 
J023113C21CCTGTCAGTTTGTGGGCCCACCTNONE 
J053054E03CCTGTCAGTTTGTGGGCCCACCTNONE 
J053062B07CCTGTCAGTTTGTGGGCCCACCTNONE 
J053075O17CCTGTCAGTTTGTGGGCCCACCTNONE 
J053075P09CCTGTCAGTTTGTGGGCCCACCTNONE 
J065024H05CCTGTCAGTTTGTGGGCCCACCTNONE 
J065049F22CCTGTCAGTTTGTGGGCCCACCTNONE 
J065063L03CCTGTCAGTTTGTGGGCCCACCTNONE 
J065102O07CCTGTCAGTTTGTGGGCCCACCTNONE 
J065104M12CCTGTCAGTTTGTGGGCCCACCTNONE 
J065119E04CCTGTCAGTTTGTGGGCCCACCTNONE 
J065153E10CCTGTCAGTTTGTGGGCCCACCTNONE 
J065168M24CCTGTCAGTTTGTGGGCCCACCTNONE 
J065173I10CCTGTCAGTTTGTGGGCCCACCTNONE 
J065181L04CCTGTCAGTTTGTGGGCCCACCTNONE 
J065184I18CCTGTCAGTTTGTGGGCCCACCTNONE 
J065203M15CCTGTCAGTTTGTGGGCCCACCTNONE 
J075004C21CCTGTCAGTTTGTGGGCCCACCTNONE 
J075047B11CCTGTCAGTTTGTGGGCCCACCTNONE 
J075055F18CCTGTCAGTTTGTGGGCCCACCTNONE 
J075065G09CCTGTCAGTTTGTGGGCCCACCTNONE 
J075094O14CCTGTCAGTTTGTGGGCCCACCTNONE 
J075143C22CCTGTCAGTTTGTGGGCCCACCTNONE 
J075153K18CCTGTCAGTTTGTGGGCCCACCTNONE 
J075164N10CCTGTCAGTTTGTGGGCCCACCTNONE 
J075197C11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080001A01CCTGTCAGTTTGTGGGCCCACCTNONE 
J080003B11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080006G17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080007J06CCTGTCAGTTTGTGGGCCCACCTNONE 
J080010H12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080014I01CCTGTCAGTTTGTGGGCCCACCTNONE 
J080015C16CCTGTCAGTTTGTGGGCCCACCTNONE 
J080016P19CCTGTCAGTTTGTGGGCCCACCTNONE 
J080020G24CCTGTCAGTTTGTGGGCCCACCTNONE 
J080021E12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080023I11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080024H24CCTGTCAGTTTGTGGGCCCACCTNONE 
J080025G18CCTGTCAGTTTGTGGGCCCACCTNONE 
J080028H08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080030G08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080031H20CCTGTCAGTTTGTGGGCCCACCTNONE 
J080034C20CCTGTCAGTTTGTGGGCCCACCTNONE 
J080040H13CCTGTCAGTTTGTGGGCCCACCTNONE 
J080044M04CCTGTCAGTTTGTGGGCCCACCTNONE 
J080047D02CCTGTCAGTTTGTGGGCCCACCTNONE 
J080049D17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080049J17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080050A05CCTGTCAGTTTGTGGGCCCACCTNONE 
J080051C11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080051K06CCTGTCAGTTTGTGGGCCCACCTNONE 
J080053A07CCTGTCAGTTTGTGGGCCCACCTNONE 
J080053I08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080056L12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080061I19CCTGTCAGTTTGTGGGCCCACCTNONE 
J080075G09CCTGTCAGTTTGTGGGCCCACCTNONE 
J080078C23CCTGTCAGTTTGTGGGCCCACCTNONE 
J080080I21CCTGTCAGTTTGTGGGCCCACCTNONE 
J080084F04CCTGTCAGTTTGTGGGCCCACCTNONE 
J080085K16CCTGTCAGTTTGTGGGCCCACCTNONE 
J080097A12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080097N01CCTGTCAGTTTGTGGGCCCACCTNONE 
J090027L10CCTGTCAGTTTGTGGGCCCACCTNONE 
J100034N17CCTGTCAGTTTGTGGGCCCACCTNONE 
Os08g0532400AK101608AGGTGGGCCCACAAACTGACAGGSimilar to AT.I.24-7 protein. 
Os08g0537900AK119425CACTGACAGGTGGGTCCNONE 
AY341827CACTGACAGGTGGGTCCSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3) (EREBP-3) (AtERF3). 
Os08g0547200AK101130AGTGACACTGACAGGTGGGCCCCACGRabGAP/TBC domain containing protein. 
AK101130CCACTGACAGGTGGGGCCCCACCRabGAP/TBC domain containing protein. 
AK119577AGTGACACTGACAGGTGGGCCCCACGNONE 
AK119577CCACTGACAGGTGGGGCCCCACCNONE 
Os08g0549200AK069066CCTGTCAGTGlycoside hydrolase, family 35 protein. 
J023007A22CCTGTCAGTNONE 
J023030P18CCTGTCAGTNONE 
J023056L18CCTGTCAGTNONE 
J023090P11CCTGTCAGTNONE 
J023104P10CCTGTCAGTNONE 
J023115M06CCTGTCAGTNONE 
Os08g0560900003-019-H10CACTGACAGNONE 
003-112-D04CACTGACAGNONE 
003-116-A09CACTGACAGNONE 
006-058-C09CACTGACAGNONE 
006-095-B02CACTGACAGNONE 
006-105-B12CACTGACAGNONE 
009-006-E06CACTGACAGNONE 
009-029-C10CACTGACAGNONE 
009-032-C06CACTGACAGNONE 
009-032-F04CACTGACAGNONE 
009-032-H04CACTGACAGNONE 
009-037-E04CACTGACAGNONE 
009-038-F10CACTGACAGNONE 
009-043-H08CACTGACAGNONE 
009-059-C01CACTGACAGNONE 
009-097-B10CACTGACAGNONE 
009-102-A07CACTGACAGNONE 
009-105-C05CACTGACAGNONE 
009-108-H08CACTGACAGNONE 
009-115-B01CACTGACAGNONE 
009-123-B08CACTGACAGNONE 
009-127-D01CACTGACAGNONE 
009-138-B01CACTGACAGNONE 
009-148-D08CACTGACAGNONE 
009-148-E07CACTGACAGNONE 
009-155-E12CACTGACAGNONE 
009-161-A05CACTGACAGNONE 
009-163-C07CACTGACAGNONE 
009-168-E06CACTGACAGNONE 
009-177-A04CACTGACAGNONE 
009-177-E04CACTGACAGNONE 
009-179-E01CACTGACAGNONE 
009-184-F07CACTGACAGNONE 
009-185-G04CACTGACAGNONE 
009-197-C11CACTGACAGNONE 
AK061775CACTGACAGNONE 
AK120366CACTGACAGNONE 
AK120372CACTGACAGSimilar to Photosystem I reaction center subunit II, chloroplast precursor (Photosystem I 20 kDa subunit) (PSI-D). 
AY224449CACTGACAGNONE 
J013025F24CACTGACAGNONE 
J013042G23CACTGACAGNONE 
J013070L10CACTGACAGNONE 
J023014L18CACTGACAGNONE 
J023054N16CACTGACAGNONE 
J023142N18CACTGACAGNONE 
J065032D16CACTGACAGNONE 
J065040K22CACTGACAGNONE 
J065164K07CACTGACAGNONE 
J075005D03CACTGACAGNONE 
J075010M23CACTGACAGNONE 
J075048F22CACTGACAGNONE 
J075048J19CACTGACAGNONE 
J075078L10CACTGACAGNONE 
J075092N16CACTGACAGNONE 
J075153D24CACTGACAGNONE 
J075172E20CACTGACAGNONE 
J075177L06CACTGACAGNONE 
J075189P17CACTGACAGNONE 
J080001L20CACTGACAGNONE 
J080005G19CACTGACAGNONE 
J080005N23CACTGACAGNONE 
J080008G20CACTGACAGNONE 
J080010K19CACTGACAGNONE 
J080014H07CACTGACAGNONE 
J080017K02CACTGACAGNONE 
J080017O16CACTGACAGNONE 
J080021G13CACTGACAGNONE 
J080021L11CACTGACAGNONE 
J080022B21CACTGACAGNONE 
J080024G06CACTGACAGNONE 
J080024K22CACTGACAGNONE 
J080025L08CACTGACAGNONE 
J080025N05CACTGACAGNONE 
J080027P04CACTGACAGNONE 
J080028D10CACTGACAGNONE 
J080028G18CACTGACAGNONE 
J080028I16CACTGACAGNONE 
J080029P10CACTGACAGNONE 
J080033M20CACTGACAGNONE 
J080039P03CACTGACAGNONE 
J080042N05CACTGACAGNONE 
J080042O19CACTGACAGNONE 
J080043F22CACTGACAGNONE 
J080043L09CACTGACAGNONE 
J080043P06CACTGACAGNONE 
J080044C24CACTGACAGNONE 
J080044P09CACTGACAGNONE 
J080046B22CACTGACAGNONE 
J080046I24CACTGACAGNONE 
J080048C06CACTGACAGNONE 
J080048O05CACTGACAGNONE 
J080052G23CACTGACAGNONE 
J080052H20CACTGACAGNONE 
J080052P04CACTGACAGNONE 
J080058H24CACTGACAGNONE 
J080059E03CACTGACAGNONE 
J080061M10CACTGACAGNONE 
J080063M21CACTGACAGNONE 
J080064E12CACTGACAGNONE 
J080065A13CACTGACAGNONE 
J080066P16CACTGACAGNONE 
J080067F06CACTGACAGNONE 
J080069L01CACTGACAGNONE 
J080070P08CACTGACAGNONE 
J080072D01CACTGACAGNONE 
J080072H07CACTGACAGNONE 
J080075G22CACTGACAGNONE 
J080076N13CACTGACAGNONE 
J080078P22CACTGACAGNONE 
J080079A05CACTGACAGNONE 
J080081M15CACTGACAGNONE 
J080082B16CACTGACAGNONE 
J080083G16CACTGACAGNONE 
J080083K10CACTGACAGNONE 
J080085A07CACTGACAGNONE 
J080086F24CACTGACAGNONE 
J080090O18CACTGACAGNONE 
J080092M14CACTGACAGNONE 
J080095K06CACTGACAGNONE 
J080096G07CACTGACAGNONE 
J080096N05CACTGACAGNONE 
J080097B20CACTGACAGNONE 
J080097E08CACTGACAGNONE 
J080309D01CACTGACAGNONE 
J090096F03CACTGACAGNONE 
J100048I20CACTGACAGNONE 
Os08g0565800009-034-G02CTGTCAGTNONE 
009-111-D12CTGTCAGTNONE 
AK062431CTGTCAGTSimilar to Glutaredoxin. 
AK062820CTGTCAGTNONE 
J075022E05CTGTCAGTNONE 
J075066F07CTGTCAGTNONE 
J075146B21CTGTCAGTNONE 
Os09g0129400AK109483CTGTCAGTConserved hypothetical protein. 
Os09g0309500J100027L22CACTGACAGGGTGGGCCCGCConserved hypothetical protein. 
Os09g0327100AK071461ACTGACAGSimilar to GTP-binding protein. 
J023036G03ACTGACAGNONE 
J023092H24ACTGACAGNONE 
J023098C21ACTGACAGNONE 
J023139E17ACTGACAGNONE 
J065123A17ACTGACAGNONE 
Os09g0338500AK058543CTGTCAGTGSimilar to Desaturase/cytochrome b5 protein. 
Os09g0426800AK060786ACTGACAGGTGNONE 
AK120227ACTGACAGGTGSimilar to Glossy1 protein. 
Os09g0458400AK070055ACTGACAGCCCAGCCCATTAConserved hypothetical protein. 
AK120321ACTGACAGCCCAGCCCATTANONE 
J065064N11ACTGACAGCCCAGCCCATTANONE 
J065083J06ACTGACAGCCCAGCCCATTANONE 
J065121D24ACTGACAGCCCAGCCCATTANONE 
J065156I22ACTGACAGCCCAGCCCATTANONE 
J065163J24ACTGACAGCCCAGCCCATTANONE 
J075001I02ACTGACAGCCCAGCCCATTANONE 
J090088O06ACTGACAGCCCAGCCCATTANONE 
Os09g0460100006-087-B02CACTGACAGConserved hypothetical protein. 
J065208G04CACTGACAGNONE 
Os09g0477700AK121644CACTGACAGGTGGGTCCCACGGGConserved hypothetical protein. 
Os09g0482740006-098-F12CACTGACAGGTGGGCCCGNONE 
AK061852CACTGACAGGTGGGCCCGProtein of unknown function DUF1664 family protein. 
J013032I17CACTGACAGGTGGGCCCGNONE 
J013119L22CACTGACAGGTGGGCCCGNONE 
J065114C06CACTGACAGGTGGGCCCGNONE 
J090059O06CACTGACAGGTGGGCCCGNONE 
J090062K09CACTGACAGGTGGGCCCGNONE 
J100031O03CACTGACAGGTGGGCCCGNONE 
J100038P06CACTGACAGGTGGGCCCGNONE 
J100051M18CACTGACAGGTGGGCCCGNONE 
J100075H20CACTGACAGGTGGGCCCGNONE 
J100077O11CACTGACAGGTGGGCCCGNONE 
Os09g0518700AK064305ACTGACAGGNONE 
AK102571ACTGACAGGInositol 1, 3, 4-trisphosphate 56-kinase family protein. 
Os09g0527900AK122172TCTGGCCCCACCTGTCAGTGSimilar to Hd1-like protein. 
J033148H23TCTGGCCCCACCTGTCAGTGNONE 
J080070L07TCTGGCCCCACCTGTCAGTGNONE 
J090088G19TCTGGCCCCACCTGTCAGTGNONE 
Os09g0529300AK066042CTGTCAGTGGGGCCCCANONE 
AY702437CTGTCAGTGGGGCCCCAConserved hypothetical protein. 
J013048L17CTGTCAGTGGGGCCCCANONE 
Os09g0554000J065123C23CACTGACAGGTGGSimilar to Mitochondrial phosphate transporter. 
Os09g0559900AK111842TAATGGGCCGTGTTGGGCCGGCCCACTGACAGProtein kinase-like domain containing protein. 
Os12g0104700AK067342CACTGACAGProtein of unknown function DUF231, plant domain containing protein. 
J013106M21CACTGACAGNONE 
J053037L07CACTGACAGNONE 
J053094I07CACTGACAGNONE 
J065167K17CACTGACAGNONE 
J065168N12CACTGACAGNONE 
J075029F14CACTGACAGNONE 
J075130H08CACTGACAGNONE 
J075190L10CACTGACAGNONE 
Os12g0168000AK065623GGTCCCACCTGTCAGTG5-formyltetrahydrofolate cyclo-ligase family protein. 
AK072953GGTCCCACCTGTCAGTGNONE 
J100024I20GGTCCCACCTGTCAGTGNONE 
Os12g0170400012-013-C12CACTGACAGNONE 
012-078-F04CACTGACAGNONE 
016-038-B08CACTGACAGNONE 
AK121826CACTGACAGZinc finger, C2H2-type domain containing protein. 
J033086P08CACTGACAGNONE 
J033099G14CACTGACAGNONE 
J065019L01CACTGACAGNONE 
J065093E18CACTGACAGNONE 
J065138J04CACTGACAGNONE 
J065139B14CACTGACAGNONE 
J065193K21CACTGACAGNONE 
J075005D01CACTGACAGNONE 
J075057B19CACTGACAGNONE 
J075061A15CACTGACAGNONE 
J075105N16CACTGACAGNONE 
J075146K15CACTGACAGNONE 
J100026B22CACTGACAGNONE 
Os12g0297500AK072331CCTGTCAGTGlycoside hydrolase, starch-binding domain containing protein. 
Os12g0500700AK073408CCCACCTGTCAGTSimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os12g0503200014-087-C11CCTGTCAGTGGNONE 
AK105377CCTGTCAGTGGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.