version

Summary of OsREG454 (All List)

OrganismOryza sativa  
IDOsREG454  
SequenceACTGGGCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1414  

Entry Sequences (1414 entries)

LocusGene modelSequenceDescription
Os01g0104800AK067602TACTGGGCCAGSas10/Utp3 family protein. 
J013109E04TACTGGGCCAGNONE 
J033057M05TACTGGGCCAGNONE 
J043021M24TACTGGGCCAGNONE 
J090014N05TACTGGGCCAGNONE 
J090077H23TACTGGGCCAGNONE 
J090084H08TACTGGGCCAGNONE 
Os01g0138900AK058378TGTGGGGCCCAGTAMandelate racemase/muconate lactonizing enzyme family protein. 
Os01g0145200J100017K24CAAGTGGGCCCAGTANONE 
Os01g0158000AK058679TCCGGCCCAGTNONE 
AK103127TCCGGCCCAGTImportin alpha-2 subunit. 
D78504TCCGGCCCAGTNONE 
Os01g0191800AK061360TCTCGGCCCAGTANONE 
Os01g0218700J065010O15TGGGGCCCAGTNONE 
Os01g0283000AK073165CTGGCCCATTTGCGGCCCAGTConserved hypothetical protein. 
J033023G08CTGGCCCATTTGCGGCCCAGTNONE 
Os01g0283100004-018-B01ACTGGGCCGCAAATGGGCCAGNONE 
AK060908ACTGGGCCGCAAATGGGCCAGNONE 
AK071713ACTGGGCCGCAAATGGGCCAGSimilar to Ferripyochelin-binding protein-like. 
AK104205ACTGGGCCGCAAATGGGCCAGNONE 
AK122051ACTGGGCCGCAAATGGGCCAGNONE 
J023109L19ACTGGGCCGCAAATGGGCCAGNONE 
Os01g0530366J075001P06AACGGGCCCAGTTNONE 
J075006K21AACGGGCCCAGTTRNA polymerase Rbp10 domain containing protein. 
J075030G13AACGGGCCCAGTTNONE 
Os01g0596300016-083-D09AGTGGGCCCAGTNONE 
AK069151AGTGGGCCCAGTCyclin-like F-box domain containing protein. 
J023007D17AGTGGGCCCAGTNONE 
J065141M02AGTGGGCCCAGTNONE 
Os01g0633400AK108988TTGGCCCATCGTGGCCCAGTACBS domain containing protein. 
Os01g0660100AK108487AACTGGGCCTTConserved hypothetical protein. 
Os01g0662600009-056-E10AAGGCCCAGTNONE 
009-056-E10GAGGCCCAGTANONE 
AK062234AAGGCCCAGTNONE 
AK062234GAGGCCCAGTANONE 
AK098887AAGGCCCAGTNONE 
AK098887GAGGCCCAGTANONE 
AK099656AAGGCCCAGTNONE 
AK099656GAGGCCCAGTANONE 
AK119723AAGGCCCAGTSimilar to NifU-like protein. 
AK119723GAGGCCCAGTASimilar to NifU-like protein. 
J013001K01AAGGCCCAGTNONE 
J013001K01GAGGCCCAGTANONE 
J013090F20AAGGCCCAGTNONE 
J013090F20GAGGCCCAGTANONE 
J013119A14AAGGCCCAGTNONE 
J013119A14GAGGCCCAGTANONE 
J013121P12AAGGCCCAGTNONE 
J013121P12GAGGCCCAGTANONE 
J033132I15AAGGCCCAGTNONE 
J033132I15GAGGCCCAGTANONE 
J075023F22AAGGCCCAGTNONE 
J075023F22GAGGCCCAGTANONE 
J075023M13AAGGCCCAGTNONE 
J075023M13GAGGCCCAGTANONE 
J100024D10AAGGCCCAGTNONE 
J100024D10GAGGCCCAGTANONE 
J100024N01AAGGCCCAGTNONE 
J100024N01GAGGCCCAGTANONE 
J100026H09AAGGCCCAGTNONE 
J100026H09GAGGCCCAGTANONE 
J100027H07AAGGCCCAGTNONE 
J100027H07GAGGCCCAGTANONE 
J100045K07AAGGCCCAGTNONE 
J100045K07GAGGCCCAGTANONE 
J100057K18AAGGCCCAGTNONE 
J100057K18GAGGCCCAGTANONE 
J100085C22AAGGCCCAGTNONE 
J100085C22GAGGCCCAGTANONE 
Os01g0688200AK120982ACTGGGCCCAATAlpha/beta hydrolase family protein. 
Os01g0702700009-179-G10CTGGCCCAGTNONE 
AK111782CTGGCCCAGTSimilar to Transcription factor MYB86 (Myb-related protein 86) (AtMYB86) (Myb homolog 4) (AtMyb4). 
J023084H22CTGGCCCAGTNONE 
J100021C12CTGGCCCAGTNONE 
J100025N10CTGGCCCAGTNONE 
J100043F22CTGGCCCAGTNONE 
Os01g0773200015-072-C12CCAGGCCCAAATAGGCCCAGTNONE 
Os01g0833200AK121629ACTGGGCCTGGConserved hypothetical protein. 
J023093N07ACTGGGCCTGGNONE 
J033050C20ACTGGGCCTGGNONE 
J080302F22ACTGGGCCTGGNONE 
J080303H06ACTGGGCCTGGNONE 
J080306J04ACTGGGCCTGGNONE 
J080309K06ACTGGGCCTGGNONE 
J080311E18ACTGGGCCTGGNONE 
J080318A20ACTGGGCCTGGNONE 
J100031F20ACTGGGCCTGGNONE 
J100034P21ACTGGGCCTGGNONE 
J100042K08ACTGGGCCTGGNONE 
J100047H24ACTGGGCCTGGNONE 
J100065C14ACTGGGCCTGGNONE 
J100074E23ACTGGGCCTGGNONE 
Os01g0839300AK064685GAGGCCCACTGGGCCGAAASimilar to 50S ribosomal protein L17. 
J065060I21GAGGCCCACTGGGCCGAAANONE 
Os01g0844800AK099801CCACCAACTGGGCCCCACASimilar to Pumilio RBD (Fragment). 
AK102882CCACCAACTGGGCCCCACANONE 
AK103686CCACCAACTGGGCCCCACANONE 
Os01g0856500AK103981TGGATGGGCTACTGGGCCCGNONE 
Os01g0871800AK064787GTGGCCCAGTTNONE 
AK067087GTGGCCCAGTTTGF-beta receptor, type I/II extracellular region family protein. 
AK120109GTGGCCCAGTTNONE 
J013023O17GTGGCCCAGTTNONE 
J013108P12GTGGCCCAGTTNONE 
J013110E18GTGGCCCAGTTNONE 
J013110E22GTGGCCCAGTTNONE 
J013132E24GTGGCCCAGTTNONE 
J013160C03GTGGCCCAGTTNONE 
Os01g0874800016-042-F01TACTGGGCCAANONE 
AK065916TACTGGGCCAANONE 
AK065991TACTGGGCCAANONE 
AK103577TACTGGGCCAANONE 
AK105063TACTGGGCCAA5'-3' exonuclease domain containing protein. 
AK119315TACTGGGCCAANONE 
J023106C06TACTGGGCCAANONE 
J053023A11TACTGGGCCAANONE 
J053068H13TACTGGGCCAANONE 
J053071O13TACTGGGCCAANONE 
J053074M10TACTGGGCCAANONE 
Os01g0888700AK073376ACTGGGCCGGCCCAATProtein of unknown function RIO1 family protein. 
J033030B16ACTGGGCCGGCCCAATNONE 
J033098D06ACTGGGCCGGCCCAATNONE 
J033112A12ACTGGGCCGGCCCAATNONE 
J043003L24ACTGGGCCGGCCCAATNONE 
Os01g0908100AK072293GCTGGGCCGAAATTTCGGCCCAGTARabGAP/TBC domain containing protein. 
J065010B13GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065010M12GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065047C19GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065069B18GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065071K24GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065142P04GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065170E11GCTGGGCCGAAATTTCGGCCCAGTANONE 
Os01g0913800011-060-B02AACTGGGCCCACCANONE 
016-088-H02AACTGGGCCCACCAProtein prenyltransferase domain containing protein. 
Os01g0916300011-018-B12TACTGGGCCTTNONE 
AK063922TACTGGGCCTTSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
AK103107TACTGGGCCTTNONE 
AK121061TACTGGGCCTTNONE 
AK121997TACTGGGCCTTNONE 
J033118P14TACTGGGCCTTNONE 
J065002N16TACTGGGCCTTNONE 
J065079B04TACTGGGCCTTNONE 
J065102J07TACTGGGCCTTNONE 
J065128F16TACTGGGCCTTNONE 
J065184D11TACTGGGCCTTNONE 
J065186A07TACTGGGCCTTNONE 
J075115C07TACTGGGCCTTNONE 
J075147C04TACTGGGCCTTNONE 
Os01g0920200AK120182TCAGGCCCAGTASimilar to E(Y)2 homolog (DC6) (Enhancer of yellow 2 homolog). 
J013034A14TCAGGCCCAGTANONE 
J013063O14TCAGGCCCAGTANONE 
J023023D20TCAGGCCCAGTANONE 
J075121J02TCAGGCCCAGTANONE 
Os01g0929500AK111399AGTTGGGCCTTACTGGGCCGGTSimilar to Carbonyl reductase-like protein. 
AK120263AGTTGGGCCTTACTGGGCCGGTNONE 
Os01g0949200AK102412AACTGGGCCAGANONE 
J033093A04AACTGGGCCAGANONE 
J065053P06AACTGGGCCAGANONE 
J100086D18AACTGGGCCAGANONE 
Os01g0959900AK058375TCAGGCCCAGTConserved hypothetical protein. 
AK066497TCAGGCCCAGTNONE 
Os01g0960800AK073977TAGGCCCAGTAProtein Transporter, Pam16 family protein. 
AY313247TAGGCCCAGTANONE 
J033075P16TAGGCCCAGTANONE 
J065051H06TAGGCCCAGTANONE 
J065167L02TAGGCCCAGTANONE 
J090083C22TAGGCCCAGTANONE 
Os01g0965800AK107795AACTGGGCCCCACTCTConserved hypothetical protein. 
Os01g0966200009-079-H11GAGGCCCAGTANONE 
009-124-G10GAGGCCCAGTANONE 
AK058564GAGGCCCAGTAProtein of unknown function YGGT family protein. 
AK098935GAGGCCCAGTANONE 
Os02g0106100AK072245AACTGGGCCAASimilar to Fructosyltransferase. 
Os02g0120000AK067383AACTGGGCCCCAProtein prenyltransferase domain containing protein. 
AK101590AACTGGGCCCCANONE 
J013100B15AACTGGGCCCCANONE 
Os02g0135600AK069843GCCGGCCCAGTTAGGCCCACAConserved hypothetical protein. 
J023034H09GCCGGCCCAGTTAGGCCCACANONE 
J033090D08GCCGGCCCAGTTAGGCCCACANONE 
J100025N07GCCGGCCCAGTTAGGCCCACANONE 
J100075G18GCCGGCCCAGTTAGGCCCACANONE 
Os02g0135700AK100570TGTGGGCCTAACTGGGCCGGCDNA polymerase V family protein. 
Os02g0175100AB053473ACTGGGCCGGCSimilar to Transcriptional activator protein. 
AK069575ACTGGGCCGGCNONE 
J023025A18ACTGGGCCGGCNONE 
J065001E07ACTGGGCCGGCNONE 
J065171A13ACTGGGCCGGCNONE 
J065208N04ACTGGGCCGGCNONE 
J075098H14ACTGGGCCGGCNONE 
J090026G03ACTGGGCCGGCNONE 
J100031K15ACTGGGCCGGCNONE 
J100032K19ACTGGGCCGGCNONE 
J100041D18ACTGGGCCGGCNONE 
J100061K06ACTGGGCCGGCNONE 
Os02g0178400009-151-B08AACTGGGCCCACTNONE 
009-151-B08AACTGGGCCGCNONE 
AK063815AACTGGGCCCACTProtein transport protein SEC61 gamma subunit. 
AK063815AACTGGGCCGCProtein transport protein SEC61 gamma subunit. 
AK121516AACTGGGCCCACTNONE 
AK121516AACTGGGCCGCNONE 
J033026A17AACTGGGCCCACTNONE 
J033026A17AACTGGGCCGCNONE 
J065011K14AACTGGGCCCACTNONE 
J065011K14AACTGGGCCGCNONE 
J065056D01AACTGGGCCCACTNONE 
J065056D01AACTGGGCCGCNONE 
J065061L22AACTGGGCCCACTNONE 
J065061L22AACTGGGCCGCNONE 
J065076M01AACTGGGCCCACTNONE 
J065076M01AACTGGGCCGCNONE 
J075092E14AACTGGGCCCACTNONE 
J075092E14AACTGGGCCGCNONE 
Os02g0187600AK069783TTGGCCCAGTNONE 
AK109387TTGGCCCAGTConserved hypothetical protein. 
J090029C18TTGGCCCAGTNONE 
Os02g0188500AK102004AGCCCATACAACTGGGCCTCGGCCCATCANONE 
AK106917AGCCCATACAACTGGGCCTCGGCCCATCAUbiquitin domain containing protein. 
J090039N13AGCCCATACAACTGGGCCTCGGCCCATCANONE 
Os02g0202600AK068376ACTGGGCCCCACCTGNONE 
AK099277ACTGGGCCCCACCTGNONE 
AK101844ACTGGGCCCCACCTGTetratricopeptide-like helical domain containing protein. 
J080001G13ACTGGGCCCCACCTGNONE 
J080011J23ACTGGGCCCCACCTGNONE 
J080015F12ACTGGGCCCCACCTGNONE 
J080017J03ACTGGGCCCCACCTGNONE 
J080030J24ACTGGGCCCCACCTGNONE 
J080038H02ACTGGGCCCCACCTGNONE 
J080041G13ACTGGGCCCCACCTGNONE 
J080044B13ACTGGGCCCCACCTGNONE 
J080044L10ACTGGGCCCCACCTGNONE 
J080046H11ACTGGGCCCCACCTGNONE 
J080057J01ACTGGGCCCCACCTGNONE 
J080062E13ACTGGGCCCCACCTGNONE 
J080062N11ACTGGGCCCCACCTGNONE 
J080063C17ACTGGGCCCCACCTGNONE 
J080064K11ACTGGGCCCCACCTGNONE 
J080064N09ACTGGGCCCCACCTGNONE 
J080067C17ACTGGGCCCCACCTGNONE 
J080067C23ACTGGGCCCCACCTGNONE 
J080069J21ACTGGGCCCCACCTGNONE 
J080070L23ACTGGGCCCCACCTGNONE 
J080085N15ACTGGGCCCCACCTGNONE 
J080094F03ACTGGGCCCCACCTGNONE 
Os02g0520800AK102815TACTGGGCCTGGGCCAGSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09TACTGGGCCTGGGCCAGNONE 
J100038E09TACTGGGCCTGGGCCAGNONE 
J100076G11TACTGGGCCTGGGCCAGNONE 
Os02g0622400005-010-C04TACTGGGCCTCNONE 
AK061679TACTGGGCCTCConserved hypothetical protein. 
J013058H01TACTGGGCCTCNONE 
J013095D07TACTGGGCCTCNONE 
J023054G05TACTGGGCCTCNONE 
J023093A17TACTGGGCCTCNONE 
J023146P16TACTGGGCCTCNONE 
J033089D16TACTGGGCCTCNONE 
J033099G12TACTGGGCCTCNONE 
J033131N10TACTGGGCCTCNONE 
J053073J04TACTGGGCCTCNONE 
J053074P03TACTGGGCCTCNONE 
J053075M06TACTGGGCCTCNONE 
J053088K13TACTGGGCCTCNONE 
J090039F18TACTGGGCCTCNONE 
J090045M03TACTGGGCCTCNONE 
Os02g0633200012-053-F09TAGGCCCAGTANONE 
015-051-C09TAGGCCCAGTANONE 
AK063500TAGGCCCAGTAProtein prenyltransferase domain containing protein. 
J065019K23TAGGCCCAGTANONE 
J065205C16TAGGCCCAGTANONE 
Os02g0673600009-071-C12AAGGCCCAGTANONE 
J023037G24AAGGCCCAGTANONE 
J023038E07AAGGCCCAGTAORMDL family protein. 
J023142L24AAGGCCCAGTANONE 
J033115B14AAGGCCCAGTANONE 
J075004B15AAGGCCCAGTANONE 
J075067J21AAGGCCCAGTANONE 
J075072K07AAGGCCCAGTANONE 
J075147H21AAGGCCCAGTANONE 
J075154F03AAGGCCCAGTANONE 
Os02g0717800009-009-B02TAGGCCCAGTANONE 
J065185P06TAGGCCCAGTANONE 
J100061J04TAGGCCCAGTANONE 
J100064M21TAGGCCCAGTANONE 
Os02g0725300AK120054GCCGGCCCAGTNONE 
J013000L05GCCGGCCCAGTNONE 
J065194M19GCCGGCCCAGTNONE 
Os02g0773200AK108499ACTGGGCCACUniversal stress protein (Usp) family protein. 
J075062A04ACTGGGCCACNONE 
J075150C10ACTGGGCCACNONE 
J090086A09ACTGGGCCACNONE 
Os02g0775200AB038319AAGGCCCAGTTNONE 
AK069984AAGGCCCAGTTSimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAGGCCCAGTTNONE 
Os02g0791800AK066282TACTGGGCCGTCCNONE 
AK099697TACTGGGCCGTCCWD-40 repeat containing protein. 
AY445625TACTGGGCCGTCCNONE 
J053065H07TACTGGGCCGTCCNONE 
J065108P05TACTGGGCCGTCCNONE 
J065154P22TACTGGGCCGTCCNONE 
J100037P04TACTGGGCCGTCCNONE 
J100068K05TACTGGGCCGTCCNONE 
Os02g0795200AK059349AACTGGGCCACConserved hypothetical protein. 
Os02g0796900009-121-E06TAGGCCCAGTNONE 
D29725TAGGCCCAGTSimilar to 60S ribosomal protein L39. 
J075016N24TAGGCCCAGTNONE 
J075085F03TAGGCCCAGTNONE 
J075147P11TAGGCCCAGTNONE 
J075180E16TAGGCCCAGTNONE 
J075182A19TAGGCCCAGTNONE 
Os02g0810300AK059363TCGGCCCAAGGCCCAGTASimilar to NBD-like protein. 
AK099203TCGGCCCAAGGCCCAGTANONE 
Os02g0819100AK100156TTGGCCCAGTTZinc finger, DHHC-type domain containing protein. 
J013088C21TTGGCCCAGTTNONE 
Os02g0819700AK067374CTCGGCCCAGTTZinc finger, Zim17-type family protein. 
AK099160CTCGGCCCAGTTNONE 
J100086K17CTCGGCCCAGTTNONE 
Os02g0824400AK121390AACTGGGCCTTTGATGGGCTTTConserved hypothetical protein. 
J023128P21AACTGGGCCTTTGATGGGCTTTNONE 
J053097O16AACTGGGCCTTTGATGGGCTTTNONE 
J065012I02AACTGGGCCTTTGATGGGCTTTNONE 
J065049C06AACTGGGCCTTTGATGGGCTTTNONE 
J065051H02AACTGGGCCTTTGATGGGCTTTNONE 
J065069A13AACTGGGCCTTTGATGGGCTTTNONE 
J065082E04AACTGGGCCTTTGATGGGCTTTNONE 
J065102N09AACTGGGCCTTTGATGGGCTTTNONE 
J065157O10AACTGGGCCTTTGATGGGCTTTNONE 
J065188N23AACTGGGCCTTTGATGGGCTTTNONE 
J065190J11AACTGGGCCTTTGATGGGCTTTNONE 
J065202M09AACTGGGCCTTTGATGGGCTTTNONE 
Os02g0829900009-044-G07AACTGGGCCGAANONE 
AK120917AACTGGGCCGAASimilar to BRICK1. 
AY224582AACTGGGCCGAANONE 
J023034L01AACTGGGCCGAANONE 
J023034M01AACTGGGCCGAANONE 
J090010G06AACTGGGCCGAANONE 
J090020D07AACTGGGCCGAANONE 
J100041L04AACTGGGCCGAANONE 
J100061D05AACTGGGCCGAANONE 
J100070L18AACTGGGCCGAANONE 
Os02g0830000011-075-D11TTCGGCCCAGTTNONE 
AK101841TTCGGCCCAGTTProtein prenyltransferase domain containing protein. 
J033069G13TTCGGCCCAGTTNONE 
Os02g0830700AK101172AAGGCCCAGTTLeucine rich repeat, N-terminal domain containing protein. 
Os03g0102200AK120183TAGGCCCAGTTSimilar to DNA-directed RNA polymerase II 14.5 kDa polypeptide (EC 2.7.7.6) (RPB9) (RPB14.5). 
J013034D10TAGGCCCAGTTNONE 
J065116C05TAGGCCCAGTTNONE 
J065120N21TAGGCCCAGTTNONE 
J090049D24TAGGCCCAGTTNONE 
Os03g0127000AK068479TTGGCCCAGTTConserved hypothetical protein. 
J013152D10TTGGCCCAGTTNONE 
J075167I20TTGGCCCAGTTNONE 
J090067O04TTGGCCCAGTTNONE 
Os03g0160200AK064836CACGGCCCAGTConserved hypothetical protein. 
AK071081CACGGCCCAGTNONE 
AK100712CACGGCCCAGTNONE 
AK104859CACGGCCCAGTNONE 
J013000F21CACGGCCCAGTNONE 
J013024G05CACGGCCCAGTNONE 
J013035E12CACGGCCCAGTNONE 
J013041A17CACGGCCCAGTNONE 
J013045D10CACGGCCCAGTNONE 
J013045F04CACGGCCCAGTNONE 
J013046F04CACGGCCCAGTNONE 
J013047F10CACGGCCCAGTNONE 
J013051E10CACGGCCCAGTNONE 
J013059J07CACGGCCCAGTNONE 
J013059O17CACGGCCCAGTNONE 
J013060A20CACGGCCCAGTNONE 
J013063J23CACGGCCCAGTNONE 
J013066D19CACGGCCCAGTNONE 
J013069O08CACGGCCCAGTNONE 
J013088K24CACGGCCCAGTNONE 
J013098G04CACGGCCCAGTNONE 
J013100I15CACGGCCCAGTNONE 
J013102E18CACGGCCCAGTNONE 
J013102O09CACGGCCCAGTNONE 
J013119M18CACGGCCCAGTNONE 
J013123I19CACGGCCCAGTNONE 
J013146H15CACGGCCCAGTNONE 
J013149A14CACGGCCCAGTNONE 
J023003A05CACGGCCCAGTNONE 
J023013O19CACGGCCCAGTNONE 
J023044M05CACGGCCCAGTNONE 
J023048O03CACGGCCCAGTNONE 
J023049L17CACGGCCCAGTNONE 
J023060D22CACGGCCCAGTNONE 
J023060F20CACGGCCCAGTNONE 
J023069G09CACGGCCCAGTNONE 
J023086E11CACGGCCCAGTNONE 
J023091I09CACGGCCCAGTNONE 
J023091M19CACGGCCCAGTNONE 
J023101D06CACGGCCCAGTNONE 
J023109B03CACGGCCCAGTNONE 
J023113B14CACGGCCCAGTNONE 
J023114B19CACGGCCCAGTNONE 
J023115H16CACGGCCCAGTNONE 
J023134F22CACGGCCCAGTNONE 
J023139I06CACGGCCCAGTNONE 
J023150C02CACGGCCCAGTNONE 
J033033A14CACGGCCCAGTNONE 
J033058O11CACGGCCCAGTNONE 
J033060H13CACGGCCCAGTNONE 
J033075P14CACGGCCCAGTNONE 
J033084O05CACGGCCCAGTNONE 
J033087G04CACGGCCCAGTNONE 
J033092E18CACGGCCCAGTNONE 
J033101G23CACGGCCCAGTNONE 
J033112I05CACGGCCCAGTNONE 
J033118E14CACGGCCCAGTNONE 
J033118P04CACGGCCCAGTNONE 
J033123C07CACGGCCCAGTNONE 
J043003C01CACGGCCCAGTNONE 
J043024B21CACGGCCCAGTNONE 
J043030N04CACGGCCCAGTNONE 
J043039J02CACGGCCCAGTNONE 
J043039N08CACGGCCCAGTNONE 
J075006N21CACGGCCCAGTNONE 
J075008A16CACGGCCCAGTNONE 
J075018J16CACGGCCCAGTNONE 
J075023G04CACGGCCCAGTNONE 
J075134F18CACGGCCCAGTNONE 
J075181B05CACGGCCCAGTNONE 
J090014O14CACGGCCCAGTNONE 
J090020H22CACGGCCCAGTNONE 
J090022G17CACGGCCCAGTNONE 
J090023J24CACGGCCCAGTNONE 
J090033H01CACGGCCCAGTNONE 
J090038A03CACGGCCCAGTNONE 
J090041O22CACGGCCCAGTNONE 
J090049E10CACGGCCCAGTNONE 
J090063E24CACGGCCCAGTNONE 
J090080N12CACGGCCCAGTNONE 
J100021G23CACGGCCCAGTNONE 
J100028P06CACGGCCCAGTNONE 
J100060L21CACGGCCCAGTNONE 
J100077D16CACGGCCCAGTNONE 
J100088I09CACGGCCCAGTNONE 
Os03g0162200009-031-E05ATGGCCCAGTNONE 
013-049-D04ATGGCCCAGTNONE 
013-082-E03ATGGCCCAGTNONE 
014-039-G04ATGGCCCAGTNONE 
014-098-G11ATGGCCCAGTNONE 
AK061605ATGGCCCAGTNONE 
AK121533ATGGCCCAGTSimilar to Histone H2A. 
J033024D06ATGGCCCAGTNONE 
J033030P21ATGGCCCAGTNONE 
J065063C20ATGGCCCAGTNONE 
J065064A18ATGGCCCAGTNONE 
J065147G02ATGGCCCAGTNONE 
J065204K06ATGGCCCAGTNONE 
J090004C22ATGGCCCAGTNONE 
J090014K02ATGGCCCAGTNONE 
J090074E10ATGGCCCAGTNONE 
J090086L09ATGGCCCAGTNONE 
Os03g0186800AK100356CCACGGCCCAGTModifier of rudimentary, Modr family protein. 
AK100356GGGGCCCAGTModifier of rudimentary, Modr family protein. 
Os03g0205500Os03g0205500CCCGGGCCCGGCCCACTGGCCCAGTCytochrome b5 domain containing protein. 
Os03g0266000AK068775AACTGGGCCCCOvarian tumour, otubain domain containing protein. 
AK104949AACTGGGCCCCNONE 
J075149K24AACTGGGCCCCNONE 
J075184C19AACTGGGCCCCNONE 
Os03g0337600AF119232CTCGGCCCAGTNONE 
AK070859CTCGGCCCAGTSimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18CTCGGCCCAGTNONE 
J013147M17CTCGGCCCAGTNONE 
J065083M01CTCGGCCCAGTNONE 
J065199H24CTCGGCCCAGTNONE 
Os03g0360500009-103-B05ATTTGGGCCCAAAGTGGCCCAGTNONE 
AK059166ATTTGGGCCCAAAGTGGCCCAGTNONE 
AK101285ATTTGGGCCCAAAGTGGCCCAGTProtein of unknown function DUF1077 family protein. 
J033061G19ATTTGGGCCCAAAGTGGCCCAGTNONE 
J065169P12ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075104C18ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075166G07ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075170J04ATTTGGGCCCAAAGTGGCCCAGTNONE 
Os03g0405500AK104893ATGGCCCAGTANONE 
Os03g0410700J065102A22AACTGGGCCCGNONE 
J065102A22AACTGGGCCGTGNONE 
Os03g0410900J065067F10CACGGCCCAGTTNONE 
J065067F10CGGGCCCAGTTNONE 
J065073D08CACGGCCCAGTTNONE 
J065073D08CGGGCCCAGTTNONE 
J065176C06CACGGCCCAGTTNONE 
J065176C06CGGGCCCAGTTNONE 
J065189O13CACGGCCCAGTTNONE 
J065189O13CGGGCCCAGTTNONE 
J065214E05CACGGCCCAGTTNONE 
J065214E05CGGGCCCAGTTNONE 
J080007H09CACGGCCCAGTTNONE 
J080007H09CGGGCCCAGTTNONE 
J080012B19CACGGCCCAGTTNONE 
J080012B19CGGGCCCAGTTNONE 
J080020J16CACGGCCCAGTTNONE 
J080020J16CGGGCCCAGTTNONE 
J080038J22CACGGCCCAGTTNONE 
J080038J22CGGGCCCAGTTNONE 
J080045I09CACGGCCCAGTTNONE 
J080045I09CGGGCCCAGTTNONE 
J080059M16CACGGCCCAGTTNONE 
J080059M16CGGGCCCAGTTNONE 
J080060C19CACGGCCCAGTTNONE 
J080060C19CGGGCCCAGTTNONE 
J080080P22CACGGCCCAGTTNONE 
J080080P22CGGGCCCAGTTNONE 
J080083C03CACGGCCCAGTTNONE 
J080083C03CGGGCCCAGTTNONE 
J080093M17CACGGCCCAGTTNONE 
J080093M17CGGGCCCAGTTNONE 
J100029F12CACGGCCCAGTTLike-Sm ribonucleoprotein, core family protein. 
J100029F12CGGGCCCAGTTLike-Sm ribonucleoprotein, core family protein. 
Os03g0439800009-197-D03GACGGCCCAGTTNONE 
AK058503GACGGCCCAGTTNONE 
AK066154GACGGCCCAGTTConserved hypothetical protein. 
J065017G24GACGGCCCAGTTNONE 
J090084E18GACGGCCCAGTTNONE 
Os03g0566800AK103270CAAGGCCCAGTSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18CAAGGCCCAGTNONE 
J023136P06CAAGGCCCAGTNONE 
J033081A22CAAGGCCCAGTNONE 
J033109N12CAAGGCCCAGTNONE 
J033124H10CAAGGCCCAGTNONE 
J033141B09CAAGGCCCAGTNONE 
J090026G23CAAGGCCCAGTNONE 
J090077J20CAAGGCCCAGTNONE 
Os03g0587600Os03g0587600TAGGCCCAGTZinc finger, CCHC-type domain containing protein. 
Os03g0604600J090093K23AGGGCCCAGTTConserved hypothetical protein. 
Os03g0626250J075100A11ACTGGGCCTANONE 
J075134H15ACTGGGCCTANONE 
J075142J02ACTGGGCCTANONE 
J075181A14ACTGGGCCTANONE 
J075192K17ACTGGGCCTANONE 
J090046B06ACTGGGCCTANONE 
Os03g0684400AK100086AACTGGGCCCCACCMg2+ transporter protein, CorA-like family protein. 
Os03g0701100014-015-E11AACTGGGCCAANONE 
AK109455AACTGGGCCAANONE 
AK110740AACTGGGCCAANONE 
Os03g0712200AK073205AACTGGGCCCGGTTGGGCCAGZinc finger, RanBP2-type domain containing protein. 
AK098968AACTGGGCCCGGTTGGGCCAGNONE 
Os03g0712600015-008-G03TACTGGGCCTCNONE 
AK103705TACTGGGCCTCHypothetical protein. 
J033136N14TACTGGGCCTCNONE 
Os03g0736600AK060375ACTGGGCCTCTCCGCConserved hypothetical protein. 
Os03g0737600014-094-E01TACTGGGCCGAGCCGNONE 
014-094-E01TACTGGGCCGGGCCGANONE 
AB038234TACTGGGCCGAGCCGNONE 
AB038234TACTGGGCCGGGCCGANONE 
AK101854TACTGGGCCGAGCCGCyclin H-1. 
AK101854TACTGGGCCGGGCCGACyclin H-1. 
AK105468TACTGGGCCGAGCCGNONE 
AK105468TACTGGGCCGGGCCGANONE 
J033069N12TACTGGGCCGAGCCGNONE 
J033069N12TACTGGGCCGGGCCGANONE 
J043017A22TACTGGGCCGAGCCGNONE 
J043017A22TACTGGGCCGGGCCGANONE 
J065154A20TACTGGGCCGAGCCGNONE 
J065154A20TACTGGGCCGGGCCGANONE 
Os03g0746600AK069559TACTGGGCCTAWD40-like domain containing protein. 
J023141K22TACTGGGCCTANONE 
Os03g0758700AK106620TACTGGGCCAAWD40-like domain containing protein. 
Os03g0769600AK100054TCCGGCCCAGTTResB-like family protein. 
Os03g0811800AK063320ACTGGGCCACTAATGGGCTTGGRibosomal protein L36 family protein. 
J065094F18ACTGGGCCACTAATGGGCTTGGNONE 
J090029B04ACTGGGCCACTAATGGGCTTGGNONE 
Os03g0819900006-058-B05ACTGGGCCCTNONE 
AK111912ACTGGGCCCTNONE 
AK112029ACTGGGCCCTSimilar to RAB8C. 
AY576526ACTGGGCCCTNONE 
AY579410ACTGGGCCCTNONE 
J075041G24ACTGGGCCCTNONE 
J100070N08ACTGGGCCCTNONE 
Os03g0829100AK072669TAGGCCCAGTASimilar to Soluble epoxide hydrolase. 
J013073C22TAGGCCCAGTANONE 
J033067O15TAGGCCCAGTANONE 
J065021D04TAGGCCCAGTANONE 
J065102E20TAGGCCCAGTANONE 
Os03g0831100AK103115CTCGGCCCAGTArmadillo-like helical domain containing protein. 
J033119F15CTCGGCCCAGTNONE 
J065011M19CTCGGCCCAGTNONE 
J075019I08CTCGGCCCAGTNONE 
J075047A01CTCGGCCCAGTNONE 
J075096P21CTCGGCCCAGTNONE 
J075121I05CTCGGCCCAGTNONE 
J075121I07CTCGGCCCAGTNONE 
J090063F13CTCGGCCCAGTNONE 
J090068F16CTCGGCCCAGTNONE 
J090094E14CTCGGCCCAGTNONE 
Os03g0850100AK101126TACTGGGCCTGNLI interacting factor domain containing protein. 
Os04g0105500AK068066TACGGCCCAGTANONE 
AK071444TACGGCCCAGTASimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis. 
J013130G18TACGGCCCAGTANONE 
J023093I17TACGGCCCAGTANONE 
J033079J01TACGGCCCAGTANONE 
J043027J02TACGGCCCAGTANONE 
J065135G05TACGGCCCAGTANONE 
Os04g0129300AK109511AACTGGGCCAAYT521-B-like protein family protein. 
Os04g0270100AK063713ATGGCCCAGTNONE 
AK107968ATGGCCCAGTNONE 
Os04g0320200012-089-H09GCGGCCCAGTANONE 
AK069513GCGGCCCAGTAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK104028GCGGCCCAGTANONE 
AK119256GCGGCCCAGTANONE 
J023020H09GCGGCCCAGTANONE 
J065112F21GCGGCCCAGTANONE 
J100036M07GCGGCCCAGTANONE 
Os04g0419100AK107777CACGGCCCAGTConserved hypothetical protein. 
J065037F08CACGGCCCAGTNONE 
Os04g0430100009-125-A01AACTGGGCCTGAAAAGCCCAGCCCNONE 
AK102190AACTGGGCCTGAAAAGCCCAGCCCSimilar to 40S ribosomal protein S10-1. 
J033087A06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J053032M06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065033D05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045D15AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045K10AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065049N05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065064N09AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065068F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065088F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065104N22AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065117B19AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065119O12AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065134G24AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065150G16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065176C03AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065212M23AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075009P18AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075019G06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075037H14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075057C13AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075100E14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075120I16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075130F07AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075156M16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J100043J03AACTGGGCCTGAAAAGCCCAGCCCNONE 
Os04g0443000011-022-G04TACTGGGCCGGNONE 
AK100533TACTGGGCCGGFAR1 domain containing protein. 
J023101L24TACTGGGCCGGNONE 
Os04g0508100009-180-A02AACTGGGCCGAGTCATGGGCCGCANONE 
AK121759AACTGGGCCGAGTCATGGGCCGCAConserved hypothetical protein. 
J023007G10AACTGGGCCGAGTCATGGGCCGCANONE 
J033089A17AACTGGGCCGAGTCATGGGCCGCANONE 
J065193E13AACTGGGCCGAGTCATGGGCCGCANONE 
J075025M02AACTGGGCCGAGTCATGGGCCGCANONE 
J075027J10AACTGGGCCGAGTCATGGGCCGCANONE 
J075030N03AACTGGGCCGAGTCATGGGCCGCANONE 
J075045I20AACTGGGCCGAGTCATGGGCCGCANONE 
J075065E04AACTGGGCCGAGTCATGGGCCGCANONE 
J075134M16AACTGGGCCGAGTCATGGGCCGCANONE 
J075140B10AACTGGGCCGAGTCATGGGCCGCANONE 
Os04g0527700AK072980AACGGGCCGGGCCGGCCCAGTACHCH domain containing protein. 
J023117E20AACGGGCCGGGCCGGCCCAGTANONE 
J023150D11AACGGGCCGGGCCGGCCCAGTANONE 
Os04g0530400AK067634CTCGGCCCAGTt-snare domain containing protein. 
Os04g0564600009-038-A02AACTGGGCCTCNONE 
AK105145AACTGGGCCTCNONE 
AK120614AACTGGGCCTCSimilar to HMG1 protein. 
J013102D16AACTGGGCCTCNONE 
J013151P06AACTGGGCCTCNONE 
J033082C11AACTGGGCCTCNONE 
J065073N13AACTGGGCCTCNONE 
J065142E11AACTGGGCCTCNONE 
J065187I19AACTGGGCCTCNONE 
J065204K02AACTGGGCCTCNONE 
J090089P22AACTGGGCCTCNONE 
J100060B16AACTGGGCCTCNONE 
Os04g0577000AK073711AACTGGGCCGGAUbiquitin fusion degradation protein UFD1 family protein. 
AK119957AACTGGGCCGGANONE 
J013127H04AACTGGGCCGGANONE 
J033035G06AACTGGGCCGGANONE 
J033061G23AACTGGGCCGGANONE 
J033127L07AACTGGGCCGGANONE 
J065015F17AACTGGGCCGGANONE 
J065062G08AACTGGGCCGGANONE 
J065132M07AACTGGGCCGGANONE 
J065155C12AACTGGGCCGGANONE 
J075055I08AACTGGGCCGGANONE 
J075140D07AACTGGGCCGGANONE 
J090055B21AACTGGGCCGGANONE 
J100031D23AACTGGGCCGGANONE 
Os04g0577500006-039-C03TACTGGGCCGATAAGCCCAGNONE 
006-043-H01TACTGGGCCGATAAGCCCAGNONE 
AK061538TACTGGGCCGATAAGCCCAGNONE 
AK065648TACTGGGCCGATAAGCCCAGTatD-related deoxyribonuclease family protein. 
AK104763TACTGGGCCGATAAGCCCAGNONE 
J013035E21TACTGGGCCGATAAGCCCAGNONE 
J013066M11TACTGGGCCGATAAGCCCAGNONE 
J100026B02TACTGGGCCGATAAGCCCAGNONE 
Os04g0589600011-100-F04ATATGGGCTACTGGGCCGTANONE 
AK061833ATATGGGCTACTGGGCCGTAGlycosyl transferase, group 1 domain containing protein. 
AK098964ATATGGGCTACTGGGCCGTANONE 
AK100053ATATGGGCTACTGGGCCGTANONE 
Os04g0591000006-090-E02ACTGGGCCGANONE 
AK072902ACTGGGCCGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065061E23ACTGGGCCGANONE 
Os04g0592500AK066893ACTGGGCCGAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18ACTGGGCCGANONE 
Os04g0636600AK073550GACACGTGACTGGGCCGTGCGGTGConserved hypothetical protein. 
AK111077GACACGTGACTGGGCCGTGCGGTGNONE 
J033044F09GACACGTGACTGGGCCGTGCGGTGNONE 
J033091D12GACACGTGACTGGGCCGTGCGGTGNONE 
J043034F06GACACGTGACTGGGCCGTGCGGTGNONE 
J090017C08GACACGTGACTGGGCCGTGCGGTGNONE 
J090027K09GACACGTGACTGGGCCGTGCGGTGNONE 
J090033A12GACACGTGACTGGGCCGTGCGGTGNONE 
Os04g0636900011-028-G03AAACGGCCCAGTTNONE 
012-040-G03AAACGGCCCAGTTNONE 
AK058405AAACGGCCCAGTTNONE 
AK065789AAACGGCCCAGTTNONE 
AK101408AAACGGCCCAGTTNONE 
AK119286AAACGGCCCAGTTNONE 
J013042J24AAACGGCCCAGTTNONE 
J033037I12AAACGGCCCAGTTNONE 
J043031B12AAACGGCCCAGTTNONE 
J065152N10AAACGGCCCAGTTNONE 
J090060K17AAACGGCCCAGTTNONE 
J090083K14AAACGGCCCAGTTNONE 
J100046O13AAACGGCCCAGTTNONE 
J100066G22AAACGGCCCAGTTNONE 
Os04g0670600AK064255AAAAGCCCGGCCCAGTTNONE 
Os04g0678800AK072212CAAGGCCCAGTAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065CAAGGCCCAGTANONE 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os05g0110300AK067116TGCGGCCCAGTANONE 
AK071038TGCGGCCCAGTANAD-dependent epimerase/dehydratase family protein. 
J065060E20TGCGGCCCAGTANONE 
J065093K05TGCGGCCCAGTANONE 
Os05g0112101J065141G20TGGGGCCCAGTEpsin, N-terminal domain containing protein. 
Os05g0129400AK102359ACTGGGCCTCAnkyrin repeat containing protein. 
J033091I05ACTGGGCCTCNONE 
Os05g0168400006-039-A06TAGGCCCAGTANONE 
AK069800TAGGCCCAGTANONE 
AK106195TAGGCCCAGTAConserved hypothetical protein. 
J065086N09TAGGCCCAGTANONE 
J065137B10TAGGCCCAGTANONE 
J075062B04TAGGCCCAGTANONE 
J075193I07TAGGCCCAGTANONE 
J075193K24TAGGCCCAGTANONE 
J075194D10TAGGCCCAGTANONE 
J100037F01TAGGCCCAGTANONE 
J100071E09TAGGCCCAGTANONE 
Os05g0184901Os05g0184901CCTGGGCCCAGTTSigma factor, regions 3 and 4 domain containing protein. 
Os05g0215600AK066642TGCGGCCCAGTConserved hypothetical protein. 
AK099688TGCGGCCCAGTNONE 
Os05g0295900AK069962AACTGGGCCGGTConserved hypothetical protein. 
Os05g0397700AK067298GAGGCCCACTGGGCCGTGSecY protein family protein. 
Os05g0415600AK065818GTGGCCCACAAACTGGGCCCTNONE 
J013042K21GTGGCCCACAAACTGGGCCCTNONE 
J013114E15GTGGCCCACAAACTGGGCCCTNONE 
J013131H02GTGGCCCACAAACTGGGCCCTNONE 
J023041G06GTGGCCCACAAACTGGGCCCTNONE 
J100037M21GTGGCCCACAAACTGGGCCCTNONE 
Os05g0437200014-036-D04TACTGGGCCAGANONE 
AK059283TACTGGGCCAGANONE 
AK121867TACTGGGCCAGAProtein of unknown function DUF502 family protein. 
Os05g0455600AK060152CACGGCCCAGTAPrenylated rab acceptor PRA1 family protein. 
AK103269CACGGCCCAGTANONE 
AK105995CACGGCCCAGTANONE 
J023109E13CACGGCCCAGTANONE 
J023120K13CACGGCCCAGTANONE 
J033124H03CACGGCCCAGTANONE 
Os05g0480700AK100850AACTGGGCCGTCCSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11AACTGGGCCGTCCNONE 
Os05g0502800016-060-H05ATGGCCCAGTNONE 
AK064242ATGGCCCAGTNONE 
AK065486ATGGCCCAGTNAF1 domain containing protein. 
Os05g0509200AK061566ACTGGGCCGGTNADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK099007ACTGGGCCGGTNONE 
AK100226ACTGGGCCGGTNONE 
J013114B12ACTGGGCCGGTNONE 
J023048D09ACTGGGCCGGTNONE 
Os05g0545500AK101095AACTGGGCCACConserved hypothetical protein. 
AK119499AACTGGGCCACNONE 
Os05g0548100AK060333TACTGGGCCTTConserved hypothetical protein. 
AK100682TACTGGGCCTTNONE 
J013151E01TACTGGGCCTTNONE 
J023113L22TACTGGGCCTTNONE 
J043027A19TACTGGGCCTTNONE 
J075093E06TACTGGGCCTTNONE 
J090060D15TACTGGGCCTTNONE 
J090082J03TACTGGGCCTTNONE 
J100050E01TACTGGGCCTTNONE 
Os05g0552900AK102095GCCCGGCCCAGTAMAP65/ASE1 family protein. 
Os05g0558000015-029-G05TAATGGGCCTGACTGGGCCTGANONE 
AK073857TAATGGGCCTGACTGGGCCTGARibosomal protein L1 family protein. 
J033074P11TAATGGGCCTGACTGGGCCTGANONE 
J090060I16TAATGGGCCTGACTGGGCCTGANONE 
Os05g0571400009-019-B04GACGGCCCGGCCCAGTTNONE 
009-043-H02GACGGCCCGGCCCAGTTNONE 
AK062369GACGGCCCGGCCCAGTTConserved hypothetical protein. 
Os05g0589000AK061980AACTGGGCCAANONE 
AK099181AACTGGGCCAAConserved hypothetical protein. 
Os06g0104000AK068490ACTGGGCCGTTConserved hypothetical protein. 
Os06g0105900AK072638ACTGGGCCCCACACConserved hypothetical protein. 
Os06g0111800AK102134GCCGGCCCAGTNONE 
AK105393GCCGGCCCAGTSimilar to CSLD2 (Fragment). 
Os06g0114600015-077-E06TCCGGCCCAGTANONE 
AK067972TCCGGCCCAGTAConserved hypothetical protein. 
Os06g0119300AK067271CAAGGCCCAGTProtein of unknown function DUF594 family protein. 
Os06g0134000AJ417525AACTGGGCCCACTNONE 
AJ417525AACTGGGCCTANONE 
AK062184AACTGGGCCCACTNONE 
AK062184AACTGGGCCTANONE 
AK106717AACTGGGCCCACTSimilar to 40S ribosomal protein S20. 
AK106717AACTGGGCCTASimilar to 40S ribosomal protein S20. 
AK120319AACTGGGCCCACTNONE 
AK120319AACTGGGCCTANONE 
D10402AACTGGGCCCACTNONE 
D10402AACTGGGCCTANONE 
D12632AACTGGGCCCACTNONE 
D12632AACTGGGCCTANONE 
J013056N13AACTGGGCCCACTNONE 
J013056N13AACTGGGCCTANONE 
J023100G01AACTGGGCCCACTNONE 
J023100G01AACTGGGCCTANONE 
J053059F04AACTGGGCCCACTNONE 
J053059F04AACTGGGCCTANONE 
J053068M21AACTGGGCCCACTNONE 
J053068M21AACTGGGCCTANONE 
J053078H15AACTGGGCCCACTNONE 
J053078H15AACTGGGCCTANONE 
J065050O15AACTGGGCCCACTNONE 
J065050O15AACTGGGCCTANONE 
J065060G15AACTGGGCCCACTNONE 
J065060G15AACTGGGCCTANONE 
J065080K10AACTGGGCCCACTNONE 
J065080K10AACTGGGCCTANONE 
J065108G05AACTGGGCCCACTNONE 
J065108G05AACTGGGCCTANONE 
J065186K16AACTGGGCCCACTNONE 
J065186K16AACTGGGCCTANONE 
J075150J12AACTGGGCCCACTNONE 
J075150J12AACTGGGCCTANONE 
J080002I18AACTGGGCCCACTNONE 
J080002I18AACTGGGCCTANONE 
J080005H04AACTGGGCCCACTNONE 
J080005H04AACTGGGCCTANONE 
J080008I06AACTGGGCCCACTNONE 
J080008I06AACTGGGCCTANONE 
J080010G20AACTGGGCCCACTNONE 
J080010G20AACTGGGCCTANONE 
J080010N10AACTGGGCCCACTNONE 
J080010N10AACTGGGCCTANONE 
J080018H02AACTGGGCCCACTNONE 
J080018H02AACTGGGCCTANONE 
J080022O14AACTGGGCCCACTNONE 
J080022O14AACTGGGCCTANONE 
J080023F23AACTGGGCCCACTNONE 
J080023F23AACTGGGCCTANONE 
J080025D16AACTGGGCCCACTNONE 
J080025D16AACTGGGCCTANONE 
J080027L12AACTGGGCCCACTNONE 
J080027L12AACTGGGCCTANONE 
J080030F16AACTGGGCCCACTNONE 
J080030F16AACTGGGCCTANONE 
J080038N04AACTGGGCCCACTNONE 
J080038N04AACTGGGCCTANONE 
J080048O17AACTGGGCCCACTNONE 
J080048O17AACTGGGCCTANONE 
J080056B05AACTGGGCCCACTNONE 
J080056B05AACTGGGCCTANONE 
J080061D02AACTGGGCCCACTNONE 
J080061D02AACTGGGCCTANONE 
J080062H18AACTGGGCCCACTNONE 
J080062H18AACTGGGCCTANONE 
J080064E06AACTGGGCCCACTNONE 
J080064E06AACTGGGCCTANONE 
J080066D23AACTGGGCCCACTNONE 
J080066D23AACTGGGCCTANONE 
J080071F08AACTGGGCCCACTNONE 
J080071F08AACTGGGCCTANONE 
J080089E06AACTGGGCCCACTNONE 
J080089E06AACTGGGCCTANONE 
J080089K22AACTGGGCCCACTNONE 
J080089K22AACTGGGCCTANONE 
J080091C18AACTGGGCCCACTNONE 
J080091C18AACTGGGCCTANONE 
J080095G10AACTGGGCCCACTNONE 
J080095G10AACTGGGCCTANONE 
J090038G01AACTGGGCCCACTNONE 
J090038G01AACTGGGCCTANONE 
J090062K07AACTGGGCCCACTNONE 
J090062K07AACTGGGCCTANONE 
J100051G19AACTGGGCCCACTNONE 
J100051G19AACTGGGCCTANONE 
Os06g0134300AK071534TTGTGGGCTACTGGGCCATConserved hypothetical protein. 
J023106E03TTGTGGGCTACTGGGCCATNONE 
J075172D02TTGTGGGCTACTGGGCCATNONE 
J100047B13TTGTGGGCTACTGGGCCATNONE 
Os06g0157800AK121504TCGGCCCGGCCCAGTTSimilar to CG7224 (Fragment). 
J033022L20TCGGCCCGGCCCAGTTNONE 
J075033D09TCGGCCCGGCCCAGTTNONE 
Os06g0199500AK060939TACTGGGCCCAAGGCCCAAATNONE 
AK064613TACTGGGCCCAAGGCCCAAATSimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138TACTGGGCCCAAGGCCCAAATNONE 
Os06g0320000009-030-C04ACTGGGCCCTNONE 
009-135-F08ACTGGGCCCTNONE 
J075103B05ACTGGGCCCTProtein of unknown function DUF953, thioredoxin-like family protein. 
J075187J24ACTGGGCCCTNONE 
Os06g0332500009-108-G06ACCGGCCCAGTNONE 
009-119-F06ACCGGCCCAGTNONE 
AK121262ACCGGCCCAGTConserved hypothetical protein. 
J023104L05ACCGGCCCAGTNONE 
J033022F22ACCGGCCCAGTNONE 
Os06g0498500AK099764GCAGCCCACCCGACTGGGCCGGTNONE 
AK103794GCAGCCCACCCGACTGGGCCGGTNucleolar complex-associated family protein. 
AK121899GCAGCCCACCCGACTGGGCCGGTNONE 
Os06g0602600AK121619ACTGGGCCTGAlba, DNA/RNA-binding protein family protein. 
J033044O03ACTGGGCCTGNONE 
J043036G04ACTGGGCCTGNONE 
J075107E08ACTGGGCCTGNONE 
J090060N14ACTGGGCCTGNONE 
J090094K04ACTGGGCCTGNONE 
Os06g0625500006-034-A05TACTGGGCCTCNONE 
AK058459TACTGGGCCTCSimilar to Thioredoxin peroxidase. 
AK068955TACTGGGCCTCNONE 
AK104130TACTGGGCCTCNONE 
J023003C09TACTGGGCCTCNONE 
J033043I02TACTGGGCCTCNONE 
J065063E05TACTGGGCCTCNONE 
J065190D24TACTGGGCCTCNONE 
J065198I01TACTGGGCCTCNONE 
J075107A02TACTGGGCCTCNONE 
Os06g0695900011-023-F07ACTGGGCCCCACCNONE 
J023143A16ACTGGGCCCCACCZinc finger, RING-type domain containing protein. 
Os07g0152800AK065458TACTGGGCCCACGTGTConserved hypothetical protein. 
J013022G05TACTGGGCCCACGTGTNONE 
J013023D18TACTGGGCCCACGTGTNONE 
J013048J16TACTGGGCCCACGTGTNONE 
J013055I03TACTGGGCCCACGTGTNONE 
J013057F12TACTGGGCCCACGTGTNONE 
J023109A22TACTGGGCCCACGTGTNONE 
J023148E09TACTGGGCCCACGTGTNONE 
J033069G17TACTGGGCCCACGTGTNONE 
J033092I18TACTGGGCCCACGTGTNONE 
J033093C02TACTGGGCCCACGTGTNONE 
J033141M17TACTGGGCCCACGTGTNONE 
J043016M18TACTGGGCCCACGTGTNONE 
J090016D12TACTGGGCCCACGTGTNONE 
J090071B10TACTGGGCCCACGTGTNONE 
J090098K07TACTGGGCCCACGTGTNONE 
J100035K14TACTGGGCCCACGTGTNONE 
Os07g0164100AK111557TCTGGCCCAGTTHistone deacetylase superfamily protein. 
Os07g0164200009-038-C11AACTGGGCCAGANONE 
AK059382AACTGGGCCAGATranslation factor domain containing protein. 
AK107096AACTGGGCCAGANONE 
Os07g0205700AK120553CTGGCCCAGTSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
AK120553GCGGCCCAGTTSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24CTGGCCCAGTNONE 
J065022J24GCGGCCCAGTTNONE 
Os07g0225100016-021-E05AACTGGGCCTCNONE 
AK064193AACTGGGCCTCAromatic amino acid permease family protein. 
Os07g0258400AK121534AACTGGGCCCATTNONE 
L41217AACTGGGCCCATTNONE 
S81897AACTGGGCCCATTOsNramp1 (Integral membrane protein). 
Os07g0512100Os07g0512100TTGTGGGCCCGGCCCGGCCCGGCCCAGTTAnkyrin repeat containing protein. 
Os07g0539900AK071889GCCCGGCCCAGTTSimilar to Beta-1,3-glucanase-like protein. 
AK098943GCCCGGCCCAGTTNONE 
J013047P11GCCCGGCCCAGTTNONE 
Os07g0546700009-110-H10TACTGGGCCGTCNONE 
AK058262TACTGGGCCGTCNONE 
J065154I05TACTGGGCCGTCNONE 
J065175P09TACTGGGCCGTCNONE 
J065187F11TACTGGGCCGTCNONE 
J075114K16TACTGGGCCGTCNONE 
J090031L21TACTGGGCCGTCNONE 
U86017TACTGGGCCGTCSimilar to 60S ribosomal protein L38. 
Os07g0549800AK120874AACTGGGCCTASimilar to RGP-3 (Fragment). 
J023026P08AACTGGGCCTANONE 
J065205C05AACTGGGCCTANONE 
J065219M14AACTGGGCCTANONE 
J080010N21AACTGGGCCTANONE 
J080016K09AACTGGGCCTANONE 
J080017M18AACTGGGCCTANONE 
J080024C07AACTGGGCCTANONE 
J080027K09AACTGGGCCTANONE 
J080028E12AACTGGGCCTANONE 
J080028I22AACTGGGCCTANONE 
J080029C01AACTGGGCCTANONE 
J080030I18AACTGGGCCTANONE 
J080030M03AACTGGGCCTANONE 
J080032B11AACTGGGCCTANONE 
J080035B15AACTGGGCCTANONE 
J080038I09AACTGGGCCTANONE 
J080041C15AACTGGGCCTANONE 
J080042B01AACTGGGCCTANONE 
J080042F04AACTGGGCCTANONE 
J080048H05AACTGGGCCTANONE 
J080057F02AACTGGGCCTANONE 
J080069D04AACTGGGCCTANONE 
J080077K01AACTGGGCCTANONE 
J080085N11AACTGGGCCTANONE 
J080093P13AACTGGGCCTANONE 
J080097G10AACTGGGCCTANONE 
J080097L17AACTGGGCCTANONE 
J090026L10AACTGGGCCTANONE 
J090075O05AACTGGGCCTANONE 
Os07g0558300AK120618CGGGCCCAGTInositol monophosphatase family protein. 
J080068G22CGGGCCCAGTNONE 
Os07g0564400Os07g0564400GTGGCCCAGTTNucleic acid-binding, OB-fold domain containing protein. 
Os07g0568900009-083-H02AACTGGGCCCATTTTGGGCTAAGCCCATCGNONE 
AK062660AACTGGGCCCATTTTGGGCTAAGCCCATCGConserved hypothetical protein. 
Os07g0569000AK073915CGATGGGCTTAGCCCAAAATGGGCCCAGTTConserved hypothetical protein. 
Os07g0585800006-106-A05AACTGGGCCCAGCNONE 
006-106-A05ACTGGGCCGAGANONE 
AK066419AACTGGGCCCAGCNONE 
AK066419ACTGGGCCGAGANONE 
AK105064AACTGGGCCCAGCSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
AK105064ACTGGGCCGAGASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01AACTGGGCCCAGCNONE 
J065065N01ACTGGGCCGAGANONE 
J065085B08AACTGGGCCCAGCNONE 
J065085B08ACTGGGCCGAGANONE 
J065099I23AACTGGGCCCAGCNONE 
J065099I23ACTGGGCCGAGANONE 
J065169A01AACTGGGCCCAGCNONE 
J065169A01ACTGGGCCGAGANONE 
J065187N13AACTGGGCCCAGCNONE 
J065187N13ACTGGGCCGAGANONE 
J065191L18AACTGGGCCCAGCNONE 
J065191L18ACTGGGCCGAGANONE 
J065194D04AACTGGGCCCAGCNONE 
J065194D04ACTGGGCCGAGANONE 
J065211M09AACTGGGCCCAGCNONE 
J065211M09ACTGGGCCGAGANONE 
J065212I02AACTGGGCCCAGCNONE 
J065212I02ACTGGGCCGAGANONE 
J090003C10AACTGGGCCCAGCNONE 
J090003C10ACTGGGCCGAGANONE 
J090025O11AACTGGGCCCAGCNONE 
J090025O11ACTGGGCCGAGANONE 
J090092F10AACTGGGCCCAGCNONE 
J090092F10ACTGGGCCGAGANONE 
J100055A04AACTGGGCCCAGCNONE 
J100055A04ACTGGGCCGAGANONE 
J100064A01AACTGGGCCCAGCNONE 
J100064A01ACTGGGCCGAGANONE 
J100080L02AACTGGGCCCAGCNONE 
J100080L02ACTGGGCCGAGANONE 
Os07g0589400AK072501AACTGGGCCGCAQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617AACTGGGCCGCANONE 
AK104756AACTGGGCCGCANONE 
Os07g0621300006-055-E10CTGGCCCAGTTNONE 
AK059824CTGGCCCAGTTNONE 
AK071567CTGGCCCAGTTGRAM domain containing protein. 
Os07g0623300AK070292AACTGGGCCCGTTSimilar to Splicing factor SC35. 
J023050C05AACTGGGCCCGTTNONE 
J090025O12AACTGGGCCCGTTNONE 
Os07g0667400AK073297ACTGGGCCGGCSAM (and some other nucleotide) binding motif domain containing protein. 
J033027J22ACTGGGCCGGCNONE 
J033122B17ACTGGGCCGGCNONE 
J065017H12ACTGGGCCGGCNONE 
J065106D19ACTGGGCCGGCNONE 
J065196J16ACTGGGCCGGCNONE 
J090084F01ACTGGGCCGGCNONE 
Os07g0681600AK073504AACTGGGCCTCATP-dependent DNA helicase RecQ family protein. 
Os08g0126700AK111805AACTGGGCCAANONE 
AK111902AACTGGGCCAAZinc finger, CCCH-type domain containing protein. 
Os08g0233300AK067421AACTGGGCCGAANONE 
AK067421TACTGGGCCGAANONE 
AK120342AACTGGGCCGAAConserved hypothetical protein. 
AK120342TACTGGGCCGAAConserved hypothetical protein. 
J013061K19AACTGGGCCGAANONE 
J013061K19TACTGGGCCGAANONE 
J013106J20AACTGGGCCGAANONE 
J013106J20TACTGGGCCGAANONE 
J023022P16AACTGGGCCGAANONE 
J023022P16TACTGGGCCGAANONE 
J090015I03AACTGGGCCGAANONE 
J090015I03TACTGGGCCGAANONE 
Os08g0236900AK109597GAGGCGTGGACTGGGCCTGConserved hypothetical protein. 
Os08g0314800AK065167GCGGCCCAGTNONE 
AK098867GCGGCCCAGTSimilar to Poly(A)-binding protein. 
Os08g0439900AK110628AACTGGGCCCATTMitochondrial glycoprotein family protein. 
J065118D13AACTGGGCCCATTNONE 
Os08g0440000006-056-A06TCTCGGCCCAGTTNONE 
AK060959TCTCGGCCCAGTTNONE 
AK102539TCTCGGCCCAGTTVesicle transport v-SNARE family protein. 
J065012O03TCTCGGCCCAGTTNONE 
Os08g0441400011-033-F01TTCGGCCCAGTANONE 
015-084-B04TTCGGCCCAGTANONE 
AK063317TTCGGCCCAGTANONE 
AK064141TTCGGCCCAGTAConserved hypothetical protein. 
J065060F06TTCGGCCCAGTANONE 
J075110A22TTCGGCCCAGTANONE 
J080307P11TTCGGCCCAGTANONE 
J090041E06TTCGGCCCAGTANONE 
Os08g0460800015-094-E01TTGGCCCAAGGCCCAGTTCyclin-like F-box domain containing protein. 
Os08g0465300AK108076AACTGGGCCGTTConserved hypothetical protein. 
Os08g0474700AK064878AACTGGGCCCTGGGCCTGGSimilar to COPII subunit Sec23 (Fragment). 
Os08g0527100AK119411TACTGGGCCGGGCCTTGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J090013J12TACTGGGCCGGGCCTTGNONE 
J090029K18TACTGGGCCGGGCCTTGNONE 
Os08g0532300009-122-A05TCCGGCCCAGTANONE 
009-129-H05TCCGGCCCAGTANONE 
AB011262TCCGGCCCAGTANONE 
AK065141TCCGGCCCAGTANONE 
AK119730TCCGGCCCAGTASimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14TCCGGCCCAGTANONE 
J013042K23TCCGGCCCAGTANONE 
J023057J08TCCGGCCCAGTANONE 
J023057N10TCCGGCCCAGTANONE 
J023113C21TCCGGCCCAGTANONE 
J053054E03TCCGGCCCAGTANONE 
J053062B07TCCGGCCCAGTANONE 
J053075O17TCCGGCCCAGTANONE 
J053075P09TCCGGCCCAGTANONE 
J065024H05TCCGGCCCAGTANONE 
J065049F22TCCGGCCCAGTANONE 
J065063L03TCCGGCCCAGTANONE 
J065102O07TCCGGCCCAGTANONE 
J065104M12TCCGGCCCAGTANONE 
J065119E04TCCGGCCCAGTANONE 
J065153E10TCCGGCCCAGTANONE 
J065168M24TCCGGCCCAGTANONE 
J065173I10TCCGGCCCAGTANONE 
J065181L04TCCGGCCCAGTANONE 
J065184I18TCCGGCCCAGTANONE 
J065203M15TCCGGCCCAGTANONE 
J075004C21TCCGGCCCAGTANONE 
J075047B11TCCGGCCCAGTANONE 
J075055F18TCCGGCCCAGTANONE 
J075065G09TCCGGCCCAGTANONE 
J075094O14TCCGGCCCAGTANONE 
J075143C22TCCGGCCCAGTANONE 
J075153K18TCCGGCCCAGTANONE 
J075164N10TCCGGCCCAGTANONE 
J075197C11TCCGGCCCAGTANONE 
J080001A01TCCGGCCCAGTANONE 
J080003B11TCCGGCCCAGTANONE 
J080006G17TCCGGCCCAGTANONE 
J080007J06TCCGGCCCAGTANONE 
J080010H12TCCGGCCCAGTANONE 
J080014I01TCCGGCCCAGTANONE 
J080015C16TCCGGCCCAGTANONE 
J080016P19TCCGGCCCAGTANONE 
J080020G24TCCGGCCCAGTANONE 
J080021E12TCCGGCCCAGTANONE 
J080023I11TCCGGCCCAGTANONE 
J080024H24TCCGGCCCAGTANONE 
J080025G18TCCGGCCCAGTANONE 
J080028H08TCCGGCCCAGTANONE 
J080030G08TCCGGCCCAGTANONE 
J080031H20TCCGGCCCAGTANONE 
J080034C20TCCGGCCCAGTANONE 
J080040H13TCCGGCCCAGTANONE 
J080044M04TCCGGCCCAGTANONE 
J080047D02TCCGGCCCAGTANONE 
J080049D17TCCGGCCCAGTANONE 
J080049J17TCCGGCCCAGTANONE 
J080050A05TCCGGCCCAGTANONE 
J080051C11TCCGGCCCAGTANONE 
J080051K06TCCGGCCCAGTANONE 
J080053A07TCCGGCCCAGTANONE 
J080053I08TCCGGCCCAGTANONE 
J080056L12TCCGGCCCAGTANONE 
J080061I19TCCGGCCCAGTANONE 
J080075G09TCCGGCCCAGTANONE 
J080078C23TCCGGCCCAGTANONE 
J080080I21TCCGGCCCAGTANONE 
J080084F04TCCGGCCCAGTANONE 
J080085K16TCCGGCCCAGTANONE 
J080097A12TCCGGCCCAGTANONE 
J080097N01TCCGGCCCAGTANONE 
J090027L10TCCGGCCCAGTANONE 
J100034N17TCCGGCCCAGTANONE 
Os08g0532400AK101608TACTGGGCCGGASimilar to AT.I.24-7 protein. 
Os08g0542100AK058490AACTGGGCCACRibosomal protein L7, eukaryotic form family protein. 
AK058490AACTGGGCCACRibosomal protein L7, eukaryotic form family protein. 
AK058490GCCCGGCCCAGTARibosomal protein L7, eukaryotic form family protein. 
AK101416AACTGGGCCACNONE 
AK101416AACTGGGCCACNONE 
AK101416GCCCGGCCCAGTANONE 
J033037N08AACTGGGCCACNONE 
J033037N08AACTGGGCCACNONE 
J033037N08GCCCGGCCCAGTANONE 
J033086B16AACTGGGCCACNONE 
J033086B16AACTGGGCCACNONE 
J033086B16GCCCGGCCCAGTANONE 
J043036J02AACTGGGCCACNONE 
J043036J02AACTGGGCCACNONE 
J043036J02GCCCGGCCCAGTANONE 
J065137E02AACTGGGCCACNONE 
J065137E02AACTGGGCCACNONE 
J065137E02GCCCGGCCCAGTANONE 
J090015L07AACTGGGCCACNONE 
J090015L07AACTGGGCCACNONE 
J090015L07GCCCGGCCCAGTANONE 
J100036D02AACTGGGCCACNONE 
J100036D02AACTGGGCCACNONE 
J100036D02GCCCGGCCCAGTANONE 
Os08g0557100AK070743AATTGGGCCCAGTANONE 
AK101214AATTGGGCCCAGTASimilar to Nucleic acid-binding protein precursor. 
AK105901AATTGGGCCCAGTANONE 
J033031B04AATTGGGCCCAGTANONE 
J080004F08AATTGGGCCCAGTANONE 
J080004H12AATTGGGCCCAGTANONE 
J080005H08AATTGGGCCCAGTANONE 
J080005I02AATTGGGCCCAGTANONE 
J080008N16AATTGGGCCCAGTANONE 
J080009H23AATTGGGCCCAGTANONE 
J080012H17AATTGGGCCCAGTANONE 
J080012J21AATTGGGCCCAGTANONE 
J080013I20AATTGGGCCCAGTANONE 
J080016E07AATTGGGCCCAGTANONE 
J080018O04AATTGGGCCCAGTANONE 
J080020B18AATTGGGCCCAGTANONE 
J080021I16AATTGGGCCCAGTANONE 
J080022N01AATTGGGCCCAGTANONE 
J080023G08AATTGGGCCCAGTANONE 
J080023N09AATTGGGCCCAGTANONE 
J080024J24AATTGGGCCCAGTANONE 
J080025M12AATTGGGCCCAGTANONE 
J080028A22AATTGGGCCCAGTANONE 
J080028I01AATTGGGCCCAGTANONE 
J080029D22AATTGGGCCCAGTANONE 
J080030M02AATTGGGCCCAGTANONE 
J080031B06AATTGGGCCCAGTANONE 
J080035G08AATTGGGCCCAGTANONE 
J080036F19AATTGGGCCCAGTANONE 
J080038P14AATTGGGCCCAGTANONE 
J080039C17AATTGGGCCCAGTANONE 
J080043A10AATTGGGCCCAGTANONE 
J080044H02AATTGGGCCCAGTANONE 
J080044P12AATTGGGCCCAGTANONE 
J080047L06AATTGGGCCCAGTANONE 
J080050L06AATTGGGCCCAGTANONE 
J080052J11AATTGGGCCCAGTANONE 
J080052M10AATTGGGCCCAGTANONE 
J080053E20AATTGGGCCCAGTANONE 
J080054J01AATTGGGCCCAGTANONE 
J080059N09AATTGGGCCCAGTANONE 
J080064F19AATTGGGCCCAGTANONE 
J080064N22AATTGGGCCCAGTANONE 
J080065K14AATTGGGCCCAGTANONE 
J080065M12AATTGGGCCCAGTANONE 
J080068O07AATTGGGCCCAGTANONE 
J080076P20AATTGGGCCCAGTANONE 
J080087D08AATTGGGCCCAGTANONE 
J080087H16AATTGGGCCCAGTANONE 
J080090N23AATTGGGCCCAGTANONE 
J080091H04AATTGGGCCCAGTANONE 
J080091P13AATTGGGCCCAGTANONE 
J080094O15AATTGGGCCCAGTANONE 
J080094P14AATTGGGCCCAGTANONE 
J080095I07AATTGGGCCCAGTANONE 
J080097E22AATTGGGCCCAGTANONE 
Os08g0558000J080005K14TCCGGCCCAAAAGGCCCAGTANONE 
Os09g0293900Os09g0293900TCGGCCCAGTAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0307800AK060843ACTGGGCCTTGNuclear protein SET domain containing protein. 
Os09g0338400AK059171GTGGCCCAGTTNONE 
AK068798GTGGCCCAGTTNONE 
AK072043GTGGCCCAGTTNONE 
AK098947GTGGCCCAGTTSimilar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1). 
Os09g0360400009-192-H06CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
AK071395CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGConserved hypothetical protein. 
J013045J21CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J023095O09CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J065207K01CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
Os09g0424850J065006K24GGTGGGGCCCAGTConserved hypothetical protein. 
Os09g0434200AK062015ACTGGGCCTCNONE 
AK062015GGACGGCCCAGTANONE 
AK103447ACTGGGCCTCZinc finger, RING-type domain containing protein. 
AK103447GGACGGCCCAGTAZinc finger, RING-type domain containing protein. 
Os09g0451500AK062254GTGTGGGCCCAGTTThioredoxin domain 2 containing protein. 
AK072941GTGTGGGCCCAGTTNONE 
Os09g0479100012-013-H04TACTGGGCCTTNONE 
AK063439TACTGGGCCTTCyclin-like F-box domain containing protein. 
J065042M05TACTGGGCCTTNONE 
J065048D23TACTGGGCCTTNONE 
J065048E20TACTGGGCCTTNONE 
J065097H24TACTGGGCCTTNONE 
J065156P09TACTGGGCCTTNONE 
J065160M11TACTGGGCCTTNONE 
J065209A11TACTGGGCCTTNONE 
J075010M19TACTGGGCCTTNONE 
J075021B22TACTGGGCCTTNONE 
J075033A10TACTGGGCCTTNONE 
J075046B05TACTGGGCCTTNONE 
J075064A21TACTGGGCCTTNONE 
J075083B22TACTGGGCCTTNONE 
J075097F21TACTGGGCCTTNONE 
J075107K10TACTGGGCCTTNONE 
J075108C05TACTGGGCCTTNONE 
J075148C06TACTGGGCCTTNONE 
J075154D09TACTGGGCCTTNONE 
J075196M02TACTGGGCCTTNONE 
J090016F05TACTGGGCCTTNONE 
Os09g0528100009-173-A08ACTGGGCCGAGANONE 
009-190-G12ACTGGGCCGAGANONE 
AK059096ACTGGGCCGAGASimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
Os09g0547200016-021-H03ACTGGGCCCCGCCCACCACNONE 
AK073078ACTGGGCCCCGCCCACCACProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984ACTGGGCCCCGCCCACCACNONE 
J065005L05ACTGGGCCCCGCCCACCACNONE 
J065039C06ACTGGGCCCCGCCCACCACNONE 
J065116H17ACTGGGCCCCGCCCACCACNONE 
J100046A17ACTGGGCCCCGCCCACCACNONE 
Os09g0567000012-071-E09TACTGGGCCTCNONE 
013-099-E05TACTGGGCCTCNONE 
AK065613TACTGGGCCTCConserved hypothetical protein. 
J013026M04TACTGGGCCTCNONE 
J023103F04TACTGGGCCTCNONE 
J033119N04TACTGGGCCTCNONE 
J065011I19TACTGGGCCTCNONE 
J065042A10TACTGGGCCTCNONE 
J100023F16TACTGGGCCTCNONE 
Os11g0132700AK103286TCGGCCCAGTACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0139100009-099-H06AAACGGCCCAGTTNONE 
AK121443AAACGGCCCAGTTSimilar to 50S ribosomal protein L24. 
J023140O18AAACGGCCCAGTTNONE 
J023143M23AAACGGCCCAGTTNONE 
J033079G04AAACGGCCCAGTTNONE 
J043004D20AAACGGCCCAGTTNONE 
J065097F05AAACGGCCCAGTTNONE 
Os11g0484300AK121422AACTGGGCCAGASimilar to Mcm2-prov protein. 
Os12g0124700AK073156AACTGGGCCGGACDC45-like protein family protein. 
J090013O22AACTGGGCCGGANONE 
Os12g0131300J090086B06TCGGCCCAGTAHypothetical protein. 
Os12g0167900005-004-A06GAGGCCCAGTNONE 
006-024-H01GAGGCCCAGTNONE 
006-044-H12GAGGCCCAGTNONE 
006-053-B08GAGGCCCAGTNONE 
015-080-F12GAGGCCCAGTNONE 
AK060925GAGGCCCAGT60S ribosomal protein L3. 
D10403GAGGCCCAGTNONE 
D12630GAGGCCCAGTNONE 
J013046A17GAGGCCCAGTNONE 
J013048A16GAGGCCCAGTNONE 
J013057L14GAGGCCCAGTNONE 
J023058G08GAGGCCCAGTNONE 
J023058I08GAGGCCCAGTNONE 
J023078E17GAGGCCCAGTNONE 
J023087E03GAGGCCCAGTNONE 
J023097D18GAGGCCCAGTNONE 
J023141E14GAGGCCCAGTNONE 
J023150P21GAGGCCCAGTNONE 
J033045K05GAGGCCCAGTNONE 
J033071G03GAGGCCCAGTNONE 
J033071I15GAGGCCCAGTNONE 
J033136D08GAGGCCCAGTNONE 
J043012M21GAGGCCCAGTNONE 
J043015C13GAGGCCCAGTNONE 
J053031L19GAGGCCCAGTNONE 
J053050C01GAGGCCCAGTNONE 
J053055I20GAGGCCCAGTNONE 
J053074B18GAGGCCCAGTNONE 
J053091I08GAGGCCCAGTNONE 
J053097N01GAGGCCCAGTNONE 
J065058A02GAGGCCCAGTNONE 
J065141H11GAGGCCCAGTNONE 
J075019D10GAGGCCCAGTNONE 
J075078G18GAGGCCCAGTNONE 
J075094C12GAGGCCCAGTNONE 
J075165H12GAGGCCCAGTNONE 
J090011E05GAGGCCCAGTNONE 
J090021H18GAGGCCCAGTNONE 
J090027N07GAGGCCCAGTNONE 
J090035F04GAGGCCCAGTNONE 
J090050F21GAGGCCCAGTNONE 
J090051M02GAGGCCCAGTNONE 
J090060F21GAGGCCCAGTNONE 
J090075G15GAGGCCCAGTNONE 
J090092P11GAGGCCCAGTNONE 
J090097B18GAGGCCCAGTNONE 
J100019C17GAGGCCCAGTNONE 
J100022O04GAGGCCCAGTNONE 
J100034G13GAGGCCCAGTNONE 
J100048A13GAGGCCCAGTNONE 
J100050P18GAGGCCCAGTNONE 
J100054B21GAGGCCCAGTNONE 
J100062L01GAGGCCCAGTNONE 
J100065E11GAGGCCCAGTNONE 
J100074P09GAGGCCCAGTNONE 
J100086E10GAGGCCCAGTNONE 
Os12g0168200015-027-H11AACTGGGCCGGCCCAGGNONE 
AK069543AACTGGGCCGGCCCAGGSsu72-like protein family protein. 
J023025N02AACTGGGCCGGCCCAGGNONE 
Os12g0168700AK065708CAGGCCCAGTAMP-dependent synthetase and ligase domain containing protein. 
AK065718CAGGCCCAGTNONE 
Os12g0244500AK102026ACTGGGCCGTGGConserved hypothetical protein. 
J023014D06ACTGGGCCGTGGNONE 
J023060C12ACTGGGCCGTGGNONE 
J033080M18ACTGGGCCGTGGNONE 
J090017I22ACTGGGCCGTGGNONE 
J090023D21ACTGGGCCGTGGNONE 
J090036J05ACTGGGCCGTGGNONE 
J090053M19ACTGGGCCGTGGNONE 
Os12g0477600009-115-E02ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-125-D04ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-152-E11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
013-003-H06ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
AK099534ACCGGGCCCACTGGGCCGGAGGCCCAAAAConserved hypothetical protein. 
J065109J18ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J065115L23ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075002K19ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075034D13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075038B07ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075051A21ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075052J11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075072A08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075080E10ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075101E13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075112F22ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075139O17ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075141K08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075146N01ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075171J24ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
Os12g0533600J065106H15AACTGGGCCTAConserved hypothetical protein. 
J065194D13AACTGGGCCTANONE 
Os12g0556100J065083C21TACTGGGCCTCDrought induced 19 family protein. 
J065124M18TACTGGGCCTCNONE 
J100032P22TACTGGGCCTCNONE 
J100048N01TACTGGGCCTCNONE 
Os12g0569900Os12g0569900ACTGGGCCAGSimilar to Zn finger protein (Fragment). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.