version

Summary of OsREG455 (All List)

OrganismOryza sativa  
IDOsREG455  
SequenceAGAGTGGG  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count709  

Entry Sequences (709 entries)

LocusGene modelSequenceDescription
Os01g0136200009-086-D11AGAGTGGGTCCNONE 
013-096-H06AGAGTGGGTCCNONE 
014-003-F08AGAGTGGGTCCNONE 
014-010-A11AGAGTGGGTCCNONE 
014-041-G02AGAGTGGGTCCNONE 
014-071-E12AGAGTGGGTCCNONE 
014-079-A06AGAGTGGGTCCNONE 
AK121025AGAGTGGGTCC16.9 kDa class I heat shock protein. 
J023050A14AGAGTGGGTCCNONE 
J023061F18AGAGTGGGTCCNONE 
J053050H23AGAGTGGGTCCNONE 
J075018E12AGAGTGGGTCCNONE 
J075018G01AGAGTGGGTCCNONE 
J075050P17AGAGTGGGTCCNONE 
J075057E02AGAGTGGGTCCNONE 
J075155F14AGAGTGGGTCCNONE 
J075183C11AGAGTGGGTCCNONE 
J075186P15AGAGTGGGTCCNONE 
Os01g0283000AK073165CCCACTCTConserved hypothetical protein. 
J033023G08CCCACTCTNONE 
Os01g0283100004-018-B01AGAGTGGGNONE 
AK060908AGAGTGGGNONE 
AK071713AGAGTGGGSimilar to Ferripyochelin-binding protein-like. 
AK104205AGAGTGGGNONE 
AK122051AGAGTGGGNONE 
J023109L19AGAGTGGGNONE 
Os01g0382450J065084M05AGAGTGGGHypothetical protein. 
J065155G18AGAGTGGGNONE 
Os01g0558700Os01g0558700CCCACTCTConserved hypothetical protein. 
Os01g0564300AK064825AGAGTGGGPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os01g0655300AK062870CCCACTCTSimilar to Trithorax 4 (Fragment). 
Os01g0720600016-050-G11AGAGTGGGCCGGTNONE 
AK066808AGAGTGGGCCGGTNONE 
AK100976AGAGTGGGCCGGTNONE 
AK106541AGAGTGGGCCGGTStarch synthase IVa (Glycogen (Starch) synthase-like). 
AY373257AGAGTGGGCCGGTNONE 
J100039H11AGAGTGGGCCGGTNONE 
J100072K02AGAGTGGGCCGGTNONE 
Os01g0761100AK122112AGAGTGGGTesmin/TSO1-like, CXC domain containing protein. 
Os01g0810300009-073-E02CCCACTCTNONE 
AF231026CCCACTCTSimilar to Calmodulin-like protein. 
AK070889CCCACTCTNONE 
J013123F15CCCACTCTNONE 
J023074P12CCCACTCTNONE 
U37936CCCACTCTNONE 
Os01g0819700006-061-E11AGAGTGGGNONE 
AK059227AGAGTGGGNONE 
AK106919AGAGTGGGHelix-turn-helix, Fis-type domain containing protein. 
J065182N23AGAGTGGGNONE 
Os01g0823500016-059-D03ATCCCCCACTCTNONE 
AK064237ATCCCCCACTCTProtein of unknown function DUF623, plant domain containing protein. 
Os01g0829266J065010C18TGTGGGGCCCCACTCTNONE 
J065037A22TGTGGGGCCCCACTCTNONE 
J065044B02TGTGGGGCCCCACTCTConserved hypothetical protein. 
J065044B10TGTGGGGCCCCACTCTNONE 
J065051A06TGTGGGGCCCCACTCTNONE 
J065073E06TGTGGGGCCCCACTCTNONE 
J065074I11TGTGGGGCCCCACTCTNONE 
J065086D22TGTGGGGCCCCACTCTNONE 
J065104H10TGTGGGGCCCCACTCTNONE 
J065107C05TGTGGGGCCCCACTCTNONE 
J065124H16TGTGGGGCCCCACTCTNONE 
J065165F22TGTGGGGCCCCACTCTNONE 
J065169B11TGTGGGGCCCCACTCTNONE 
J065172G21TGTGGGGCCCCACTCTNONE 
J065191E05TGTGGGGCCCCACTCTNONE 
J065191F18TGTGGGGCCCCACTCTNONE 
Os01g0840100006-095-C03CCCACTCTNONE 
011-075-F07CCCACTCTNONE 
012-010-A08CCCACTCTNONE 
012-035-A09CCCACTCTNONE 
014-010-B01CCCACTCTNONE 
014-011-H07CCCACTCTNONE 
014-040-F03CCCACTCTNONE 
014-077-C11CCCACTCTNONE 
014-078-C11CCCACTCTNONE 
014-097-A10CCCACTCTNONE 
014-097-D02CCCACTCTNONE 
014-100-D02CCCACTCTNONE 
015-012-H01CCCACTCTNONE 
015-049-G07CCCACTCTNONE 
015-066-C09CCCACTCTNONE 
016-033-C09CCCACTCTHeat shock protein Hsp70 family protein. 
016-084-F08CCCACTCTNONE 
J023037O13CCCACTCTNONE 
J033116B07CCCACTCTNONE 
J033121N13CCCACTCTNONE 
J065057F16CCCACTCTNONE 
J065112D05CCCACTCTNONE 
J065157G17CCCACTCTNONE 
J090014O03CCCACTCTNONE 
J090015K13CCCACTCTNONE 
J090021I21CCCACTCTNONE 
J090048D02CCCACTCTNONE 
J090054D14CCCACTCTNONE 
J090060J03CCCACTCTNONE 
J090063G01CCCACTCTNONE 
J090063H04CCCACTCTNONE 
J090063L13CCCACTCTNONE 
J090074E03CCCACTCTNONE 
J090096A03CCCACTCTNONE 
J090096I11CCCACTCTNONE 
J090099E16CCCACTCTNONE 
J100050G20CCCACTCTNONE 
Os01g0938400009-025-F11CCCACTCTNONE 
AK062398CCCACTCTConserved hypothetical protein. 
Os01g0953100AK064981AGAGTGGGNONE 
AK068882AGAGTGGGProtein of unknown function DUF594 family protein. 
J013001C07AGAGTGGGNONE 
J013169K14AGAGTGGGNONE 
J033114G07AGAGTGGGNONE 
J065035K15AGAGTGGGNONE 
J065082E12AGAGTGGGNONE 
Os01g0965800AK107795AACTGGGCCCCACTCTConserved hypothetical protein. 
Os02g0137100015-082-A12AGAGTGGGNONE 
016-013-D11AGAGTGGGNONE 
AK073353AGAGTGGGConserved hypothetical protein 1589, plant family protein. 
J013026D20AGAGTGGGNONE 
J013111M05AGAGTGGGNONE 
J023099B09AGAGTGGGNONE 
J033025E21AGAGTGGGNONE 
J033082H04AGAGTGGGNONE 
J065110E11AGAGTGGGNONE 
Os02g0199300AK064726AGAGTGGGPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os02g0208100011-077-C09CCCACTCTSimilar to Chloroplast ADP,ATP carrier protein 2, chloroplast precursor (ADP/ATP translocase 2) (Adenine nucleotide translocase 2). 
Os02g0686300AK066567AGAGTGGGCCCGConserved hypothetical protein. 
Os02g0833900003-009-D08AGAGTGGGNONE 
006-021-A06AGAGTGGGNONE 
006-021-C05AGAGTGGGNONE 
006-026-E10AGAGTGGGNONE 
006-030-E06AGAGTGGGNONE 
006-057-B10AGAGTGGGNONE 
006-063-H09AGAGTGGGNONE 
006-068-H02AGAGTGGGNONE 
006-074-H10AGAGTGGGNONE 
006-077-F08AGAGTGGGNONE 
006-078-F01AGAGTGGGNONE 
006-079-A12AGAGTGGGNONE 
006-086-F02AGAGTGGGNONE 
006-086-G01AGAGTGGGNONE 
006-101-A03AGAGTGGGNONE 
006-108-C11AGAGTGGGNONE 
006-113-G12AGAGTGGGNONE 
006-117-F12AGAGTGGGNONE 
006-119-D10AGAGTGGGNONE 
006-119-F09AGAGTGGGNONE 
009-106-G05AGAGTGGGNONE 
009-126-B08AGAGTGGGNONE 
009-166-F06AGAGTGGGNONE 
AK060083AGAGTGGGNONE 
AK099584AGAGTGGGNONE 
AK106092AGAGTGGGNONE 
AK106171AGAGTGGGSimilar to Peroxidase 64 precursor (EC 1.11.1.7) (Atperox P64) (PRXR4) (ATP17a). 
J013042D08AGAGTGGGNONE 
J013042E08AGAGTGGGNONE 
J075002G19AGAGTGGGNONE 
J075030K18AGAGTGGGNONE 
J075065P19AGAGTGGGNONE 
J075091B17AGAGTGGGNONE 
Os03g0122000AK101458AGAGTGGGCCCATCGTGTCAGTGProtein kinase-like domain containing protein. 
J013035K10AGAGTGGGCCCATCGTGTCAGTGNONE 
J013050E10AGAGTGGGCCCATCGTGTCAGTGNONE 
J033040C13AGAGTGGGCCCATCGTGTCAGTGNONE 
Os03g0138200AK105857CCCACTCTCytochrome P450 family protein. 
Os03g0160200AK064836CCCACTCTConserved hypothetical protein. 
AK071081CCCACTCTNONE 
AK100712CCCACTCTNONE 
AK104859CCCACTCTNONE 
J013000F21CCCACTCTNONE 
J013024G05CCCACTCTNONE 
J013035E12CCCACTCTNONE 
J013041A17CCCACTCTNONE 
J013045D10CCCACTCTNONE 
J013045F04CCCACTCTNONE 
J013046F04CCCACTCTNONE 
J013047F10CCCACTCTNONE 
J013051E10CCCACTCTNONE 
J013059J07CCCACTCTNONE 
J013059O17CCCACTCTNONE 
J013060A20CCCACTCTNONE 
J013063J23CCCACTCTNONE 
J013066D19CCCACTCTNONE 
J013069O08CCCACTCTNONE 
J013088K24CCCACTCTNONE 
J013098G04CCCACTCTNONE 
J013100I15CCCACTCTNONE 
J013102E18CCCACTCTNONE 
J013102O09CCCACTCTNONE 
J013119M18CCCACTCTNONE 
J013123I19CCCACTCTNONE 
J013146H15CCCACTCTNONE 
J013149A14CCCACTCTNONE 
J023003A05CCCACTCTNONE 
J023013O19CCCACTCTNONE 
J023044M05CCCACTCTNONE 
J023048O03CCCACTCTNONE 
J023049L17CCCACTCTNONE 
J023060D22CCCACTCTNONE 
J023060F20CCCACTCTNONE 
J023069G09CCCACTCTNONE 
J023086E11CCCACTCTNONE 
J023091I09CCCACTCTNONE 
J023091M19CCCACTCTNONE 
J023101D06CCCACTCTNONE 
J023109B03CCCACTCTNONE 
J023113B14CCCACTCTNONE 
J023114B19CCCACTCTNONE 
J023115H16CCCACTCTNONE 
J023134F22CCCACTCTNONE 
J023139I06CCCACTCTNONE 
J023150C02CCCACTCTNONE 
J033033A14CCCACTCTNONE 
J033058O11CCCACTCTNONE 
J033060H13CCCACTCTNONE 
J033075P14CCCACTCTNONE 
J033084O05CCCACTCTNONE 
J033087G04CCCACTCTNONE 
J033092E18CCCACTCTNONE 
J033101G23CCCACTCTNONE 
J033112I05CCCACTCTNONE 
J033118E14CCCACTCTNONE 
J033118P04CCCACTCTNONE 
J033123C07CCCACTCTNONE 
J043003C01CCCACTCTNONE 
J043024B21CCCACTCTNONE 
J043030N04CCCACTCTNONE 
J043039J02CCCACTCTNONE 
J043039N08CCCACTCTNONE 
J075006N21CCCACTCTNONE 
J075008A16CCCACTCTNONE 
J075018J16CCCACTCTNONE 
J075023G04CCCACTCTNONE 
J075134F18CCCACTCTNONE 
J075181B05CCCACTCTNONE 
J090014O14CCCACTCTNONE 
J090020H22CCCACTCTNONE 
J090022G17CCCACTCTNONE 
J090023J24CCCACTCTNONE 
J090033H01CCCACTCTNONE 
J090038A03CCCACTCTNONE 
J090041O22CCCACTCTNONE 
J090049E10CCCACTCTNONE 
J090063E24CCCACTCTNONE 
J090080N12CCCACTCTNONE 
J100021G23CCCACTCTNONE 
J100028P06CCCACTCTNONE 
J100060L21CCCACTCTNONE 
J100077D16CCCACTCTNONE 
J100088I09CCCACTCTNONE 
Os03g0177000AK071368CCCACCCGGACCCACTCTCCAGGCCCACAGCN5-related N-acetyltransferase domain containing protein. 
Os03g0192400009-081-A03CAAGCCCACTCTNONE 
009-159-B02CAAGCCCACTCTNONE 
AK070573CAAGCCCACTCTGRIM-19 family protein. 
J023056B01CAAGCCCACTCTNONE 
J023075G06CAAGCCCACTCTNONE 
J033048K16CAAGCCCACTCTNONE 
J033048L16CAAGCCCACTCTNONE 
J053031H23CAAGCCCACTCTNONE 
J065002H14CAAGCCCACTCTNONE 
J065006G22CAAGCCCACTCTNONE 
J065032G13CAAGCCCACTCTNONE 
J065056A09CAAGCCCACTCTNONE 
J065078I01CAAGCCCACTCTNONE 
J065095G01CAAGCCCACTCTNONE 
J065095I18CAAGCCCACTCTNONE 
J065134M18CAAGCCCACTCTNONE 
J065158P07CAAGCCCACTCTNONE 
J065165K17CAAGCCCACTCTNONE 
J065181J12CAAGCCCACTCTNONE 
J065189N09CAAGCCCACTCTNONE 
J065200D13CAAGCCCACTCTNONE 
J065202H20CAAGCCCACTCTNONE 
J065215K20CAAGCCCACTCTNONE 
J075049N19CAAGCCCACTCTNONE 
J075147J16CAAGCCCACTCTNONE 
J090081E19CAAGCCCACTCTNONE 
J100017C16CAAGCCCACTCTNONE 
J100039M16CAAGCCCACTCTNONE 
J100043E23CAAGCCCACTCTNONE 
J100063L12CAAGCCCACTCTNONE 
J100079F22CAAGCCCACTCTNONE 
Os03g0232600AK068218CCCACTCTU box domain containing protein. 
J013114N10CCCACTCTNONE 
J013146E12CCCACTCTNONE 
J023034C23CCCACTCTNONE 
J033030J03CCCACTCTNONE 
J033050L03CCCACTCTNONE 
J033122E16CCCACTCTNONE 
J090018C20CCCACTCTNONE 
J090053P15CCCACTCTNONE 
J090096C17CCCACTCTNONE 
Os03g0244200003-114-A11TAGGCCCACTCTNONE 
015-089-B03TAGGCCCACTCTNONE 
016-048-G01TAGGCCCACTCTNONE 
AK101837TAGGCCCACTCTSimilar to Thaumatin-like protein. 
AK105771TAGGCCCACTCTNONE 
AK107182TAGGCCCACTCTNONE 
J065054I12TAGGCCCACTCTNONE 
J065208F20TAGGCCCACTCTNONE 
J075088F18TAGGCCCACTCTNONE 
J075092G13TAGGCCCACTCTNONE 
J075120G01TAGGCCCACTCTNONE 
J075147M20TAGGCCCACTCTNONE 
J075151J03TAGGCCCACTCTNONE 
J100064H21TAGGCCCACTCTNONE 
Os03g0308000016-023-H09CCCACTCTNONE 
AK100355CCCACTCTUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CCCACTCTNONE 
J023043K04CCCACTCTNONE 
J023083I20CCCACTCTNONE 
J033068F22CCCACTCTNONE 
J033125P21CCCACTCTNONE 
J065207A22CCCACTCTNONE 
J100018D20CCCACTCTNONE 
J100026L17CCCACTCTNONE 
J100055D14CCCACTCTNONE 
J100060P03CCCACTCTNONE 
J100078A20CCCACTCTNONE 
Os03g0343700AK060603AGAGTGGGBrix domain containing protein. 
AK102274AGAGTGGGNONE 
J033089C06AGAGTGGGNONE 
J090089A17AGAGTGGGNONE 
Os03g0413100006-092-C09AGAGTGGGNONE 
AK061832AGAGTGGGNONE 
Os03g0666200AK102364GCGGGCCCACTCTPleckstrin homology-type domain containing protein. 
J033097E16GCGGGCCCACTCTNONE 
Os03g0666500006-096-G10AGAGTGGGNONE 
AK061203AGAGTGGGSimilar to Ras-related protein RHA1. 
AK067459AGAGTGGGNONE 
AK100036AGAGTGGGNONE 
J065052B08AGAGTGGGNONE 
J065075N17AGAGTGGGNONE 
J065106A10AGAGTGGGNONE 
J100065N16AGAGTGGGNONE 
J100073A22AGAGTGGGNONE 
J100084H04AGAGTGGGNONE 
J100090P16AGAGTGGGNONE 
Os03g0796600003-113-D10CCCACTCTNONE 
011-076-B12CCCACTCTNONE 
AK105257CCCACTCTProtein of unknown function DUF506, plant family protein. 
J075105C03CCCACTCTNONE 
J080036O17CCCACTCTNONE 
J080064E16CCCACTCTNONE 
J080069E03CCCACTCTNONE 
J080079E23CCCACTCTNONE 
J090036H20CCCACTCTNONE 
J100029L10CCCACTCTNONE 
J100055G09CCCACTCTNONE 
Os03g0856700006-039-C11AGAGTGGGNONE 
AK061017AGAGTGGGNONE 
AK099111AGAGTGGGNONE 
U50333AGAGTGGGGibberellin 20 oxidase 1 (EC 1.14.11.-) (Gibberellin C-20 oxidase 1) (GA 20-oxidase 1) (Os20ox). 
Os04g0103300006-046-F12AGAGTGGGNONE 
006-047-F11AGAGTGGGNONE 
013-078-H06AGAGTGGGNONE 
AK061755AGAGTGGGNONE 
AK066103AGAGTGGGNONE 
AK073274AGAGTGGGConserved hypothetical protein. 
J013047N19AGAGTGGGNONE 
J013052I07AGAGTGGGNONE 
J013064I19AGAGTGGGNONE 
J013067D09AGAGTGGGNONE 
J013070G24AGAGTGGGNONE 
J013096G03AGAGTGGGNONE 
J013107M01AGAGTGGGNONE 
J013170J05AGAGTGGGNONE 
J023012K05AGAGTGGGNONE 
J023026H07AGAGTGGGNONE 
J033070K24AGAGTGGGNONE 
J033075E24AGAGTGGGNONE 
J033141P06AGAGTGGGNONE 
J043027N16AGAGTGGGNONE 
J043029I08AGAGTGGGNONE 
J043035B15AGAGTGGGNONE 
J043038K21AGAGTGGGNONE 
J065065E09AGAGTGGGNONE 
J090018C07AGAGTGGGNONE 
J100042N17AGAGTGGGNONE 
J100054N07AGAGTGGGNONE 
J100058A15AGAGTGGGNONE 
J100073A08AGAGTGGGNONE 
Os04g0175000AK101746CCCACTCTConserved hypothetical protein. 
Os04g0387600009-148-E01GTGGGGGCCCACTCTNONE 
009-155-A11GTGGGGGCCCACTCTNONE 
009-175-F04GTGGGGGCCCACTCTNONE 
AK063862GTGGGGGCCCACTCTConserved hypothetical protein. 
J065035F12GTGGGGGCCCACTCTNONE 
J065162C13GTGGGGGCCCACTCTNONE 
J065169L19GTGGGGGCCCACTCTNONE 
Os04g0397901J065050P16CCCACTCTConserved hypothetical protein. 
Os04g0440100AK101324GCTGGGCCCACTCTNONE 
AK105415GCTGGGCCCACTCTNonsense-mediated decay UPF3 domain containing protein. 
Os04g0465100J100043E04CCCACTCTHaem peroxidase, plant/fungal/bacterial family protein. 
Os04g0502300009-116-F02TCAGGCCCATCTCGGCCCACTCTNONE 
009-130-H06TCAGGCCCATCTCGGCCCACTCTNONE 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
J013124K01TCAGGCCCATCTCGGCCCACTCTNONE 
J023102F03TCAGGCCCATCTCGGCCCACTCTNONE 
J033094F17TCAGGCCCATCTCGGCCCACTCTNONE 
J053054C22TCAGGCCCATCTCGGCCCACTCTNONE 
J065024N13TCAGGCCCATCTCGGCCCACTCTNONE 
J065083J18TCAGGCCCATCTCGGCCCACTCTNONE 
J065132O14TCAGGCCCATCTCGGCCCACTCTNONE 
J065156M09TCAGGCCCATCTCGGCCCACTCTNONE 
J065176N15TCAGGCCCATCTCGGCCCACTCTNONE 
J065208H08TCAGGCCCATCTCGGCCCACTCTNONE 
J075054B03TCAGGCCCATCTCGGCCCACTCTNONE 
J090053E20TCAGGCCCATCTCGGCCCACTCTNONE 
J100075B09TCAGGCCCATCTCGGCCCACTCTNONE 
J100089H12TCAGGCCCATCTCGGCCCACTCTNONE 
Os04g0615200009-051-B10AGAGTGGGNONE 
009-094-H03AGAGTGGGNONE 
AK063824AGAGTGGGConserved hypothetical protein. 
AK101227AGAGTGGGNONE 
J065037I23AGAGTGGGNONE 
J065054G09AGAGTGGGNONE 
J065076I24AGAGTGGGNONE 
J065083M20AGAGTGGGNONE 
J065156E17AGAGTGGGNONE 
J065163J02AGAGTGGGNONE 
J065165B17AGAGTGGGNONE 
J065192B18AGAGTGGGNONE 
J075084G11AGAGTGGGNONE 
J075177H01AGAGTGGGNONE 
J100055G18AGAGTGGGNONE 
J100084D16AGAGTGGGNONE 
J100085G08AGAGTGGGNONE 
Os04g0681400AK071744CCCACTCTProtein of unknown function DUF580 family protein. 
Os04g0682100AK070539AGAGTGGGCCATEukaryotic phosphomannomutase family protein. 
J080303K19AGAGTGGGCCATNONE 
J100044E03AGAGTGGGCCATNONE 
J100063H09AGAGTGGGCCATNONE 
J100072L13AGAGTGGGCCATNONE 
J100089H15AGAGTGGGCCATNONE 
Os05g0112101J065141G20CCCACTCTEpsin, N-terminal domain containing protein. 
Os05g0133100009-194-C06CCCACTCTNONE 
AB119279CCCACTCTNONE 
AK068407CCCACTCTSimilar to PII protein (Fragment). 
AK099152CCCACTCTNONE 
Os05g0163300AK105598CCCACTCTSimilar to Arabinogalactan protein-like. 
Os05g0169400AK073439TAATGGGCCGAAACAGGTGGGACCCACTCTProtein of unknown function DUF1421 family protein. 
J013110E15TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
J033044H02TAATGGGCCGAAACAGGTGGGACCCACTCTNONE 
Os05g0494900006-030-A07CCCACTCTNONE 
006-050-D11CCCACTCTNONE 
012-037-A09CCCACTCTNONE 
015-071-C01CCCACTCTNONE 
AK106169CCCACTCTNONE 
AK106396CCCACTCTEggshell protein family protein. 
Os05g0495900AK069244CTCCCCCACTCTSimilar to Beta-1,3-glucanase precursor (Fragment). 
J013157P10CTCCCCCACTCTNONE 
J023031M04CTCCCCCACTCTNONE 
J065063H10CTCCCCCACTCTNONE 
Os05g0553000015-052-H09CACCGCACCCACTCTNONE 
AK061681CACCGCACCCACTCTATP synthase beta chain, mitochondrial precursor (EC 3.6.3.14). 
AK071143CACCGCACCCACTCTNONE 
J013068H04CACCGCACCCACTCTNONE 
J013124C06CACCGCACCCACTCTNONE 
J033127N11CACCGCACCCACTCTNONE 
J100056O04CACCGCACCCACTCTNONE 
Os06g0167000AK099780AGAGTGGGSimilar to PRP8 protein (Fragment). 
Os06g0225300AK065224GGGCCCCACTCTNONE 
AK100258GGGCCCCACTCTSimilar to SERK1 (Fragment). 
J013002G23GGGCCCCACTCTNONE 
Os06g0291600AK100261CCCACTCTSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment). 
J023063D14CCCACTCTNONE 
J090041B12CCCACTCTNONE 
Os06g0307900AK119309CCCACTCTProtein of unknown function DUF1618 domain containing protein. 
AK120750CCCACTCTNONE 
J023004O19CCCACTCTNONE 
J033022G01CCCACTCTNONE 
Os06g0332400AK058294AGGGCCCACTCTNONE 
AK101738AGGGCCCACTCTVHS domain containing protein. 
J013119B12AGGGCCCACTCTNONE 
J013132G17AGGGCCCACTCTNONE 
J023034E06AGGGCCCACTCTNONE 
J023039I05AGGGCCCACTCTNONE 
J033024E14AGGGCCCACTCTNONE 
J033039N04AGGGCCCACTCTNONE 
J033048P16AGGGCCCACTCTNONE 
J033069F24AGGGCCCACTCTNONE 
J033071D15AGGGCCCACTCTNONE 
J033106D01AGGGCCCACTCTNONE 
J033106D09AGGGCCCACTCTNONE 
J033106F09AGGGCCCACTCTNONE 
J033107K03AGGGCCCACTCTNONE 
J033129G10AGGGCCCACTCTNONE 
J065016B15AGGGCCCACTCTNONE 
J065022H07AGGGCCCACTCTNONE 
J065048E07AGGGCCCACTCTNONE 
J065068B11AGGGCCCACTCTNONE 
J065157C13AGGGCCCACTCTNONE 
J100042J02AGGGCCCACTCTNONE 
Os06g0555500016-056-B08TTGGCCCACTCTNONE 
AK102375TTGGCCCACTCTNONE 
AK106546TTGGCCCACTCTInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08TTGGCCCACTCTNONE 
J033091P04TTGGCCCACTCTNONE 
J090082P16TTGGCCCACTCTNONE 
Os06g0604600009-064-B08GCCCCCACTCTNONE 
AK069255GCCCCCACTCTConserved hypothetical protein. 
J065168I11GCCCCCACTCTNONE 
J080009E23GCCCCCACTCTNONE 
J080017E13GCCCCCACTCTNONE 
J080026M06GCCCCCACTCTNONE 
J080034J02GCCCCCACTCTNONE 
J080039M21GCCCCCACTCTNONE 
J080042J09GCCCCCACTCTNONE 
J080049A14GCCCCCACTCTNONE 
J080072E05GCCCCCACTCTNONE 
J080097E14GCCCCCACTCTNONE 
J080304H23GCCCCCACTCTNONE 
J100032L07GCCCCCACTCTNONE 
J100037F24GCCCCCACTCTNONE 
Os06g0627400J075020B18AGAGTGGGNONE 
J090051A21AGAGTGGGConserved hypothetical protein. 
Os06g0666800AK103209CCCACTCTCCCACTCCCACTCCNONE 
AK107710CCCACTCTCCCACTCCCACTCCConserved hypothetical protein. 
Os06g0692800AK067440AGAGTGGGProtein of unknown function DUF547 domain containing protein. 
Os06g0714000AK069538CCCACTCTProtein of unknown function UPF0183 family protein. 
J023020A02CCCACTCTNONE 
J023039H03CCCACTCTNONE 
J100042E23CCCACTCTNONE 
J100069N01CCCACTCTNONE 
J100089L13CCCACTCTNONE 
Os07g0181800AK121080AGAGTGGGGGCConserved hypothetical protein. 
J023063D04AGAGTGGGGGCNONE 
J033084A07AGAGTGGGGGCNONE 
J075013C04AGAGTGGGGGCNONE 
J075027H13AGAGTGGGGGCNONE 
J075045P19AGAGTGGGGGCNONE 
J090042L13AGAGTGGGGGCNONE 
J090098E10AGAGTGGGGGCNONE 
Os07g0194800015-063-F04AGAGTGGGNONE 
AK064329AGAGTGGGNONE 
AK100100AGAGTGGGConserved hypothetical protein. 
AK101244AGAGTGGGNONE 
J065176O11AGAGTGGGNONE 
Os07g0242600AK065752CCCACTCTCyclin-like F-box domain containing protein. 
J013037K22CCCACTCTNONE 
Os07g0243200AK121036CCCACTCTTCTCGGCCCATCGSimilar to ADP-glucose pyrophosphorylase large subunit 2 (EC 2.7.7.27) (Fragment). 
D21272CCCACTCTTCTCGGCCCATCGNONE 
Os07g0416100AK063097AGAGTGGGSimilar to WRKY transcription factor 53 (Transcription factor WRKY12). 
Os07g0481000AK071382CCCACTCTSimilar to Pollen-specific kinase partner protein. 
AK101192CCCACTCTNONE 
J023056G13CCCACTCTNONE 
J023106H11CCCACTCTNONE 
J033030H11CCCACTCTNONE 
J033074F11CCCACTCTNONE 
J033130I21CCCACTCTNONE 
J065023H20CCCACTCTNONE 
J065079P18CCCACTCTNONE 
J065121D13CCCACTCTNONE 
J065217L07CCCACTCTNONE 
Os07g0500300006-084-C04AGAGTGGGNONE 
009-135-G04AGAGTGGGNONE 
AK061939AGAGTGGGNONE 
AK120268AGAGTGGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
J013033D11AGAGTGGGNONE 
J013043K24AGAGTGGGNONE 
J013047I20AGAGTGGGNONE 
J023148G02AGAGTGGGNONE 
J033091M05AGAGTGGGNONE 
J033109D13AGAGTGGGNONE 
J033120A18AGAGTGGGNONE 
J053045F06AGAGTGGGNONE 
J053051A20AGAGTGGGNONE 
J053059L01AGAGTGGGNONE 
J053061B17AGAGTGGGNONE 
J053089M02AGAGTGGGNONE 
J065016O03AGAGTGGGNONE 
J065076J09AGAGTGGGNONE 
J065084P13AGAGTGGGNONE 
J065187H20AGAGTGGGNONE 
J065205O10AGAGTGGGNONE 
J065216G08AGAGTGGGNONE 
J075060G14AGAGTGGGNONE 
J075105F17AGAGTGGGNONE 
J075123O11AGAGTGGGNONE 
J090051G07AGAGTGGGNONE 
J100051E03AGAGTGGGNONE 
Os07g0516900AK061900AGAGTGGGSimilar to RNA Binding Protein 45. 
Os07g0557500AK101830AGAGTGGGCCCCACGTZinc finger, RING-type domain containing protein. 
J013075M04AGAGTGGGCCCCACGTNONE 
J033068I24AGAGTGGGCCCCACGTNONE 
Os07g0693600AK119589AGAGTGGGProtein of unknown function DUF231, plant domain containing protein. 
Os08g0163400AB005290GCGCGCGAGAGAGTGGGSigma-70 factor family protein. 
AK065997GCGCGCGAGAGAGTGGGNONE 
AK071725GCGCGCGAGAGAGTGGGNONE 
Os08g0244100012-067-B02CCCACTCTCACGTCTCNONE 
AK064015CCCACTCTCACGTCTCNONE 
AK101898CCCACTCTCACGTCTCNONE 
AK102977CCCACTCTCACGTCTCt-snare domain containing protein. 
J033071B08CCCACTCTCACGTCTCNONE 
J033115N03CCCACTCTCACGTCTCNONE 
J065031I08CCCACTCTCACGTCTCNONE 
J065091O05CCCACTCTCACGTCTCNONE 
J065116E21CCCACTCTCACGTCTCNONE 
J065131F08CCCACTCTCACGTCTCNONE 
J065196N04CCCACTCTCACGTCTCNONE 
J075064N17CCCACTCTCACGTCTCNONE 
J075078P10CCCACTCTCACGTCTCNONE 
J075108N23CCCACTCTCACGTCTCNONE 
J075142C18CCCACTCTCACGTCTCNONE 
J075163I12CCCACTCTCACGTCTCNONE 
J075177B18CCCACTCTCACGTCTCNONE 
J075178A18CCCACTCTCACGTCTCNONE 
J075191N04CCCACTCTCACGTCTCNONE 
Os08g0397900006-033-G02AGAGTGGGCCCCACGCGNONE 
009-131-F03AGAGTGGGCCCCACGCGNONE 
AK060114AGAGTGGGCCCCACGCGNONE 
AK098973AGAGTGGGCCCCACGCGNONE 
AK109817AGAGTGGGCCCCACGCGConserved hypothetical protein. 
J013089E18AGAGTGGGCCCCACGCGNONE 
J100081N17AGAGTGGGCCCCACGCGNONE 
Os08g0425100AK069134CCCACTCTDynamin family protein. 
AK072791CCCACTCTNONE 
Os09g0247500AK109296CCCACTCTConserved hypothetical protein. 
J065062D13CCCACTCTNONE 
J075042H17CCCACTCTNONE 
Os09g0311600AK102321AGAGTGGGSimilar to NBS-LRR type resistance protein (Fragment). 
Os09g0321300AK122141AGAGTGGGCCGGGNONE 
Os09g0322300AK107151CCCACTCTHypothetical protein. 
J075023P17CCCACTCTNONE 
J075143O05CCCACTCTNONE 
Os09g0325100J080009O19CCCACTCTNONE 
J080011H14CCCACTCTConserved hypothetical protein. 
J080014F14CCCACTCTNONE 
J080014M09CCCACTCTNONE 
J080014N20CCCACTCTNONE 
J080018K13CCCACTCTNONE 
J080023C08CCCACTCTNONE 
J080023C09CCCACTCTNONE 
J080023K14CCCACTCTNONE 
J080025I09CCCACTCTNONE 
J080030J04CCCACTCTNONE 
J080039D08CCCACTCTNONE 
J080039L17CCCACTCTNONE 
J080041B13CCCACTCTNONE 
J080041P21CCCACTCTNONE 
J080042J21CCCACTCTNONE 
J080042L19CCCACTCTNONE 
J080045F07CCCACTCTNONE 
J080047B10CCCACTCTNONE 
J080051F23CCCACTCTNONE 
J080053D15CCCACTCTNONE 
J080053K02CCCACTCTNONE 
J080058K18CCCACTCTNONE 
J080061M13CCCACTCTNONE 
J080064M24CCCACTCTNONE 
J080067H07CCCACTCTNONE 
J080080B21CCCACTCTNONE 
J080080D18CCCACTCTNONE 
J080082G07CCCACTCTNONE 
J080088B01CCCACTCTNONE 
J080088E09CCCACTCTNONE 
J080093L01CCCACTCTNONE 
Os09g0371700009-122-C11AGAGTGGGNONE 
AK063842AGAGTGGGZinc finger, RING-type domain containing protein. 
Os09g0464000AK060777CCCACTCTNONE 
AK069530CCCACTCTSimilar to Carbonate dehydratase-like protein. 
Os09g0572000J065136G16AGAGTGGGGTGGGTCCCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os11g0127800006-035-E01AGAGTGGGACCNONE 
006-060-G02AGAGTGGGACCNONE 
006-082-D01AGAGTGGGACCNONE 
006-104-F10AGAGTGGGACCNONE 
006-110-B07AGAGTGGGACCNONE 
006-112-D02AGAGTGGGACCNONE 
AK059969AGAGTGGGACCSMAD/FHA domain containing protein. 
AK104015AGAGTGGGACCNONE 
AK104179AGAGTGGGACCNONE 
AK104250AGAGTGGGACCNONE 
J065085P11AGAGTGGGACCNONE 
J065160C07AGAGTGGGACCNONE 
J065172K01AGAGTGGGACCNONE 
J065189L16AGAGTGGGACCNONE 
J065201E06AGAGTGGGACCNONE 
J065209L06AGAGTGGGACCNONE 
J075042M10AGAGTGGGACCNONE 
J075080O12AGAGTGGGACCNONE 
J075087M02AGAGTGGGACCNONE 
J075117O20AGAGTGGGACCNONE 
J075185C03AGAGTGGGACCNONE 
J075188L14AGAGTGGGACCNONE 
Os11g0183700006-030-G09CCCACTCTNONE 
AK061734CCCACTCTNONE 
Os11g0216400Os11g0216400AACGGGCCCCACTCTProteinase inhibitor, propeptide domain containing protein. 
Os11g0242500AK068916AGAGTGGGSimilar to Cyclin dependent kinase C. 
Os11g0298400AK068577AGAGTGGGTTGGGCTTTRibulose bisphosphate carboxylase, small chain family protein. 
Os11g0537400003-126-A11AGAGTGGGNONE 
Os12g0246700AK101415CCCACTCTDisease resistance protein family protein. 
AK101980CCCACTCTNONE 
J100049C16CCCACTCTNONE 
Os12g0263100AK102127CCCACTCTSimilar to Zinc finger, DHHC domain containing 4. 
J090099K03CCCACTCTNONE 
Os12g0264800006-098-D10CATCCACCCACTCTNONE 
AK061213CATCCACCCACTCTConserved hypothetical protein. 
Os12g0562300AK061984AGAGTGGGCTTTSmr protein/MutS2 C-terminal domain containing protein. 
Os12g0616900AK063753CCCACTCTSimilar to Pyruvate dehydrogenase E1 beta subunit (Fragment). 
AK101464CCCACTCTNONE 
J033126J16CCCACTCTNONE 
J065140B05CCCACTCTNONE 
Os12g0641400AB091672CCCACTCTNONE 
AK067030CCCACTCTSimilar to Sucrose transporter. 
J065162A08CCCACTCTNONE 
J065208B12CCCACTCTNONE 
J090058B13CCCACTCTNONE 
J100069K18CCCACTCTNONE 
J100088L05CCCACTCTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.