version

Summary of OsREG456 (All List)

OrganismOryza sativa  
IDOsREG456  
SequenceAGATGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2256  

Entry Sequences (2256 entries)

LocusGene modelSequenceDescription
Os01g0155600006-048-F03AGATGGGCCTCNONE 
AK060171AGATGGGCCTCNONE 
AK071635AGATGGGCCTCSimilar to Splicing factor RSZ33. 
J023080A03AGATGGGCCTCNONE 
J023100L15AGATGGGCCTCNONE 
J033075I17AGATGGGCCTCNONE 
J033085O09AGATGGGCCTCNONE 
J033105E15AGATGGGCCTCNONE 
J033132N10AGATGGGCCTCNONE 
J033132P12AGATGGGCCTCNONE 
J033149H12AGATGGGCCTCNONE 
J043026M03AGATGGGCCTCNONE 
J080305J10AGATGGGCCTCNONE 
J080308K03AGATGGGCCTCNONE 
J090023M04AGATGGGCCTCNONE 
J090078F24AGATGGGCCTCNONE 
J100066P05AGATGGGCCTCNONE 
Os01g0200400006-024-C04AGATGGGCCCACCTGTCAGTGGNONE 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK104558AGATGGGCCCACCTGTCAGTGGNONE 
J023043M23AGATGGGCCCACCTGTCAGTGGNONE 
J043001A15AGATGGGCCCACCTGTCAGTGGNONE 
J065155O20AGATGGGCCCACCTGTCAGTGGNONE 
J065183G02AGATGGGCCCACCTGTCAGTGGNONE 
J090007F17AGATGGGCCCACCTGTCAGTGGNONE 
J090034P12AGATGGGCCCACCTGTCAGTGGNONE 
Os01g0203300015-045-F03ACCGGCCCATCTNONE 
AK106329ACCGGCCCATCTConserved hypothetical protein. 
Os01g0283000AK073165TAGGCCCATCTConserved hypothetical protein. 
J033023G08TAGGCCCATCTNONE 
Os01g0283100004-018-B01AGATGGGCCTANONE 
AK060908AGATGGGCCTANONE 
AK071713AGATGGGCCTASimilar to Ferripyochelin-binding protein-like. 
AK104205AGATGGGCCTANONE 
AK122051AGATGGGCCTANONE 
J023109L19AGATGGGCCTANONE 
Os01g0286000AK109824AGATGGGCCGGGCCCSnf7 family protein. 
Os01g0314300AK073419TAGGCCCATCTUncharacterized domain 2 containing protein. 
AK104939TAGGCCCATCTNONE 
J033044B03TAGGCCCATCTNONE 
J033060E12TAGGCCCATCTNONE 
J043037E21TAGGCCCATCTNONE 
J065019O18TAGGCCCATCTNONE 
J065025P22TAGGCCCATCTNONE 
J065042P06TAGGCCCATCTNONE 
J065074C19TAGGCCCATCTNONE 
J065074E13TAGGCCCATCTNONE 
J065094E05TAGGCCCATCTNONE 
J065108N08TAGGCCCATCTNONE 
J065134L13TAGGCCCATCTNONE 
J065152N24TAGGCCCATCTNONE 
J065162N24TAGGCCCATCTNONE 
J065170P16TAGGCCCATCTNONE 
J065177M20TAGGCCCATCTNONE 
J065187N01TAGGCCCATCTNONE 
J075012N12TAGGCCCATCTNONE 
J075046C17TAGGCCCATCTNONE 
J075055N06TAGGCCCATCTNONE 
J075141H03TAGGCCCATCTNONE 
J075150M11TAGGCCCATCTNONE 
J090005B16TAGGCCCATCTNONE 
J090079L11TAGGCCCATCTNONE 
J100039F16TAGGCCCATCTNONE 
Os01g0328400006-092-H09GCGGCCCATCTNONE 
009-085-A02GCGGCCCATCTNONE 
012-078-B03GCGGCCCATCTNONE 
AK061988GCGGCCCATCTUbiquitin. 
J013073B13GCGGCCCATCTNONE 
J023135L09GCGGCCCATCTNONE 
J023135O07GCGGCCCATCTNONE 
J033027B12GCGGCCCATCTNONE 
J033084P17GCGGCCCATCTNONE 
J065010M05GCGGCCCATCTNONE 
J065021N11GCGGCCCATCTNONE 
J065021N12GCGGCCCATCTNONE 
J065031K11GCGGCCCATCTNONE 
J065072P04GCGGCCCATCTNONE 
J065098D05GCGGCCCATCTNONE 
J065122N23GCGGCCCATCTNONE 
J065129L13GCGGCCCATCTNONE 
J065135N13GCGGCCCATCTNONE 
J065215N10GCGGCCCATCTNONE 
J075120N22GCGGCCCATCTNONE 
J090011G23GCGGCCCATCTNONE 
J090014F06GCGGCCCATCTNONE 
J090040G23GCGGCCCATCTNONE 
J090075I20GCGGCCCATCTNONE 
J090075N01GCGGCCCATCTNONE 
J090089B04GCGGCCCATCTNONE 
J090090F08GCGGCCCATCTNONE 
J090091M17GCGGCCCATCTNONE 
J090094L03GCGGCCCATCTNONE 
J090099L06GCGGCCCATCTNONE 
J100018A18GCGGCCCATCTNONE 
J100027H13GCGGCCCATCTNONE 
J100069C05GCGGCCCATCTNONE 
J100086L10GCGGCCCATCTNONE 
Os01g0513800012-032-E11AGATGGGCCGAANONE 
AK100776AGATGGGCCGAASimilar to Brix domain containing protein 1 homolog. 
J023120C10AGATGGGCCGAANONE 
J033044A22AGATGGGCCGAANONE 
J033048H13AGATGGGCCGAANONE 
J033118F03AGATGGGCCGAANONE 
J065176B05AGATGGGCCGAANONE 
J075026B19AGATGGGCCGAANONE 
J075048I23AGATGGGCCGAANONE 
J075141A19AGATGGGCCGAANONE 
J075148E05AGATGGGCCGAANONE 
J090031M12AGATGGGCCGAANONE 
Os01g0633200AK069077AGATGGGCCCTSimilar to X1 (Fragment). 
Os01g0658500AK058491AGATGGGCProtein of unknown function DUF852, eukaryotic family protein. 
AK069050AGATGGGCNONE 
J043036P22AGATGGGCNONE 
Os01g0661400AK073113TAGGCCCATCTNucleic acid-binding, OB-fold domain containing protein. 
J023014C20TAGGCCCATCTNONE 
J033022G03TAGGCCCATCTNONE 
J065050H15TAGGCCCATCTNONE 
J065059J19TAGGCCCATCTNONE 
J065085I24TAGGCCCATCTNONE 
J065166G12TAGGCCCATCTNONE 
J065182C18TAGGCCCATCTNONE 
Os01g0688200AK120982TAAGCCCATCTGGGCCCAACAAlpha/beta hydrolase family protein. 
Os01g0699600009-111-F06GCCCATCTNONE 
AK105196GCCCATCTProtein kinase-like domain containing protein. 
J065128A07GCCCATCTNONE 
Os01g0705300AK102719AGATGGGCCGTGGGCCGTGConserved hypothetical protein. 
AK102719CACGGCCCATCTConserved hypothetical protein. 
AK103903AGATGGGCCGTGGGCCGTGNONE 
AK103903CACGGCCCATCTNONE 
J013146O16AGATGGGCCGTGGGCCGTGNONE 
J013146O16CACGGCCCATCTNONE 
J023024O09AGATGGGCCGTGGGCCGTGNONE 
J023024O09CACGGCCCATCTNONE 
J033105F22AGATGGGCCGTGGGCCGTGNONE 
J033105F22CACGGCCCATCTNONE 
J033150L19AGATGGGCCGTGGGCCGTGNONE 
J033150L19CACGGCCCATCTNONE 
J075008G14AGATGGGCCGTGGGCCGTGNONE 
J075008G14CACGGCCCATCTNONE 
J090089L03AGATGGGCCGTGGGCCGTGNONE 
J090089L03CACGGCCCATCTNONE 
J100040H18AGATGGGCCGTGGGCCGTGNONE 
J100040H18CACGGCCCATCTNONE 
Os01g0705500AK063120AGATGGGCCGTGConserved hypothetical protein. 
AK063120CACGGCCCACGGCCCATCTConserved hypothetical protein. 
J065063M12AGATGGGCCGTGNONE 
J065063M12CACGGCCCACGGCCCATCTNONE 
J065165C11AGATGGGCCGTGNONE 
J065165C11CACGGCCCACGGCCCATCTNONE 
Os01g0707300AK059962AGATGGGCCCTNONE 
AK104463AGATGGGCCCTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0714100AK060399AGATGGGCTConserved hypothetical protein. 
Os01g0729600011-008-A05GCCCATCTNONE 
AK073549GCCCATCTAminotransferase, class V family protein. 
J023044N23GCCCATCTNONE 
J023131K18GCCCATCTNONE 
J033046C16GCCCATCTNONE 
J033070I08GCCCATCTNONE 
J033088G01GCCCATCTNONE 
J033094P03GCCCATCTNONE 
J033103L06GCCCATCTNONE 
J075005F13GCCCATCTNONE 
Os01g0749200006-074-H04AAGGCCCATCTNONE 
AK072760AAGGCCCATCTNONE 
AK099041AAGGCCCATCTNONE 
AK104146AAGGCCCATCTSimilar to 50S ribosomal protein L13. 
AK119189AAGGCCCATCTNONE 
Os01g0749400AK064990GGGGCCCATCTCTGTCAGTGGNONE 
AK067731GGGGCCCATCTCTGTCAGTGGHAD-superfamily hydrolase subfamily IIB protein. 
AK103775GGGGCCCATCTCTGTCAGTGGNONE 
J023001B06GGGGCCCATCTCTGTCAGTGGNONE 
Os01g0754000014-081-F07CCAGGCCCATCTNONE 
AK063730CCAGGCCCATCTConserved hypothetical protein. 
J065219A11CCAGGCCCATCTNONE 
J075136N13CCAGGCCCATCTNONE 
J100051G01CCAGGCCCATCTNONE 
J100053M22CCAGGCCCATCTNONE 
Os01g0801000AK064082AGATGGGCCATNONE 
AK101426AGATGGGCCATSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0830500006-117-F06AGATGGGCCCACACTGACAGNONE 
AK061475AGATGGGCCCACACTGACAGNONE 
AK105801AGATGGGCCCACACTGACAG2OG-Fe(II) oxygenase domain containing protein. 
J065168H17AGATGGGCCCACACTGACAGNONE 
J065211O10AGATGGGCCCACACTGACAGNONE 
Os01g0884400AK072566AGATGGGCCCTU box domain containing protein. 
Os01g0901000AK065658AGATGGGCTNONE 
J013038N12AGATGGGCTNONE 
Os01g0907300015-031-F03AGATGGGCTTTNONE 
AK103626AGATGGGCTTTConserved hypothetical protein. 
AK108617AGATGGGCTTTNONE 
J013094D23AGATGGGCTTTNONE 
J013106G24AGATGGGCTTTNONE 
J013120M13AGATGGGCTTTNONE 
J023056M16AGATGGGCTTTNONE 
J023092M24AGATGGGCTTTNONE 
J033133N22AGATGGGCTTTNONE 
J043010O12AGATGGGCTTTNONE 
Os01g0910500003-113-F02GCCCATCTNONE 
011-011-A03GCCCATCTNONE 
013-058-C03GCCCATCTNONE 
013-073-G01GCCCATCTNONE 
014-010-E07GCCCATCTNONE 
AK072044GCCCATCTNONE 
AK099048GCCCATCTConserved hypothetical protein. 
Os01g0921600AK071344AGATGGGCTSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22AGATGGGCTNONE 
J013109E03AGATGGGCTNONE 
J023081J12AGATGGGCTNONE 
J023091E24AGATGGGCTNONE 
J033022A01AGATGGGCTNONE 
J033074C13AGATGGGCTNONE 
J065199E03AGATGGGCTNONE 
J075172O04AGATGGGCTNONE 
J090007G18AGATGGGCTNONE 
J090052B17AGATGGGCTNONE 
J090074H01AGATGGGCTNONE 
J100043J09AGATGGGCTNONE 
J100059J05AGATGGGCTNONE 
Os01g0934500AK073211CAGGCCCATCTConserved hypothetical protein. 
Os01g0939700AK059803AGCCCATCTNONE 
AK070588AGCCCATCTSimilar to Esterase D (EC 3.1.1.1). 
AK111469AGCCCATCTNONE 
J090021L11AGCCCATCTNONE 
Os01g0948300009-023-A03AGATGGGCCTTGNONE 
AK102153AGATGGGCCTTGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J013090K24AGATGGGCCTTGNONE 
J023019C13AGATGGGCCTTGNONE 
J023049L21AGATGGGCCTTGNONE 
J023066H02AGATGGGCCTTGNONE 
J033050A07AGATGGGCCTTGNONE 
J033086E01AGATGGGCCTTGNONE 
J033086F11AGATGGGCCTTGNONE 
J090047I04AGATGGGCCTTGNONE 
J100035E10AGATGGGCCTTGNONE 
J100040L06AGATGGGCCTTGNONE 
J100044G21AGATGGGCCTTGNONE 
J100045F13AGATGGGCCTTGNONE 
J100046G12AGATGGGCCTTGNONE 
J100075N10AGATGGGCCTTGNONE 
J100077I01AGATGGGCCTTGNONE 
Os01g0950900AK101121AGATGGGCCTTGGCCCATGAProtein of unknown function DUF221 domain containing protein. 
J023036H24AGATGGGCCTTGGCCCATGANONE 
J023084G23AGATGGGCCTTGGCCCATGANONE 
J033025J04AGATGGGCCTTGGCCCATGANONE 
J033139J18AGATGGGCCTTGGCCCATGANONE 
J090006A09AGATGGGCCTTGGCCCATGANONE 
J090036D02AGATGGGCCTTGGCCCATGANONE 
Os01g0953100AK064981CGGGCCCATCTNONE 
AK068882CGGGCCCATCTProtein of unknown function DUF594 family protein. 
J013001C07CGGGCCCATCTNONE 
J013169K14CGGGCCCATCTNONE 
J033114G07CGGGCCCATCTNONE 
J065035K15CGGGCCCATCTNONE 
J065082E12CGGGCCCATCTNONE 
Os01g0964000AK073599GCCCATCTSimilar to VAMP-like protein YKT61 (AtYKT61) (Geranylgeranylated protein 1) (AtGP1). 
AK104012GCCCATCTNONE 
AK104190GCCCATCTNONE 
Os01g0970900011-018-A07GAGGCCCAGCCCATCTNONE 
011-022-E12GAGGCCCAGCCCATCTNONE 
AK063285GAGGCCCAGCCCATCTNONE 
AK101688GAGGCCCAGCCCATCTProtein prenyltransferase domain containing protein. 
J100042L01GAGGCCCAGCCCATCTNONE 
J100053B11GAGGCCCAGCCCATCTNONE 
Os01g0973400AK060011AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK068879AGATGGGCCGGGCCGGGCCGAGCCGConserved hypothetical protein 48 family protein. 
AK099210AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK104863AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J013170C09AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J033106K13AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075018P18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075039C18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075104L18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
Os02g0107000AK059539GCCCATCTSimilar to U5 small nuclear ribonucleoprotein 200 kDa helicase (EC 3.6.1.-) (U5 snRNP-specific 200 kDa protein) (U5-200KD) (Activating signal cointegrator 1 complex subunit 3-like 1). 
J090052A12GCCCATCTNONE 
Os02g0169000AK101628AGATGGGCCAAConserved hypothetical protein. 
Os02g0178400009-151-B08AGATGGGCTTANONE 
AK063815AGATGGGCTTAProtein transport protein SEC61 gamma subunit. 
AK121516AGATGGGCTTANONE 
J033026A17AGATGGGCTTANONE 
J065011K14AGATGGGCTTANONE 
J065056D01AGATGGGCTTANONE 
J065061L22AGATGGGCTTANONE 
J065076M01AGATGGGCTTANONE 
J075092E14AGATGGGCTTANONE 
Os02g0208200J023104K09AGATGGGCCTGANONE 
J033080L20AGATGGGCCTGANONE 
J033105D08AGATGGGCCTGANONE 
J090079N16AGATGGGCCTGANONE 
Os02g0241100Os02g0241100AGATGGGCTGAProtein kinase-like domain containing protein. 
Os02g0605600016-017-B02AGCCCATCCAGCCCATCTGGACCNONE 
AK066104AGCCCATCCAGCCCATCTGGACCLUC7 related family protein. 
J013052G16AGCCCATCCAGCCCATCTGGACCNONE 
J043022E03AGCCCATCCAGCCCATCTGGACCNONE 
J065105P10AGCCCATCCAGCCCATCTGGACCNONE 
Os02g0634800003-004-F03TCTGGCCCATCTNONE 
AK059694TCTGGCCCATCTUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17TCTGGCCCATCTNONE 
J053077G20TCTGGCCCATCTNONE 
J075195F14TCTGGCCCATCTNONE 
Os02g0634900006-032-G12AGATGGGCCAGANONE 
006-033-E09AGATGGGCCAGANONE 
006-117-F10AGATGGGCCAGANONE 
006-118-E01AGATGGGCCAGANONE 
013-056-G08AGATGGGCCAGANONE 
AK059769AGATGGGCCAGANONE 
AK068583AGATGGGCCAGANONE 
AK072855AGATGGGCCAGAProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210AGATGGGCCAGANONE 
J023138P05AGATGGGCCAGANONE 
J023143J07AGATGGGCCAGANONE 
J033022O09AGATGGGCCAGANONE 
J033111L02AGATGGGCCAGANONE 
J033135O03AGATGGGCCAGANONE 
J065005K19AGATGGGCCAGANONE 
J065044C17AGATGGGCCAGANONE 
J065116K09AGATGGGCCAGANONE 
J065119O21AGATGGGCCAGANONE 
J075014L05AGATGGGCCAGANONE 
J075109H16AGATGGGCCAGANONE 
J075117D04AGATGGGCCAGANONE 
Os02g0636700AK069779AGATGGGCGRAM domain containing protein. 
Os02g0637800AK072512GCCCATCTProtein of unknown function DUF639 family protein. 
J075067G22GCCCATCTNONE 
J075067K06GCCCATCTNONE 
J075197G02GCCCATCTNONE 
Os02g0638000AK103830AGATGGGCCCAGCNONE 
AK106548AGATGGGCCCAGCConserved hypothetical protein. 
Os02g0638400AK060633AGCCCAATGGCCCAGATGGGCCGABRO1 domain containing protein. 
J065083J17AGCCCAATGGCCCAGATGGGCCGANONE 
Os02g0671200J065152N20AGATGGGCNONE 
J075053E22AGATGGGCConserved hypothetical protein. 
Os02g0679200AK110789AGATGGGCCTCTGGGCCTCTetratricopeptide-like helical domain containing protein. 
Os02g0681100AK100584AGCCCATCTProtein of unknown function DUF604 family protein. 
J023106A15AGCCCATCTNONE 
Os02g0686300AK066567GTGGCCCATCTConserved hypothetical protein. 
Os02g0700500014-021-A12AGATGGGCNONE 
AK068055AGATGGGCAmino acid/polyamine transporter I family protein. 
J013132E09AGATGGGCNONE 
Os02g0707100AK062096AGCCCATCTNONE 
Os02g0708000AK109110AGATGGGCConserved hypothetical protein. 
J065061F11AGATGGGCNONE 
J065084I10AGATGGGCNONE 
J065144F07AGATGGGCNONE 
Os02g0757800AK107806GCCCATCTConserved hypothetical protein. 
Os02g0757900006-114-B06AGATGGGCCGANONE 
AK061269AGATGGGCCGASimilar to Poly(A)-binding protein II-like. 
AK071146AGATGGGCCGANONE 
J023081D16AGATGGGCCGANONE 
J043034B17AGATGGGCCGANONE 
J065027M09AGATGGGCCGANONE 
J065043F02AGATGGGCCGANONE 
J065086G05AGATGGGCCGANONE 
J065093A05AGATGGGCCGANONE 
J065109F16AGATGGGCCGANONE 
J065130N09AGATGGGCCGANONE 
J065154D24AGATGGGCCGANONE 
J065199L11AGATGGGCCGANONE 
J075166H22AGATGGGCCGANONE 
Os02g0758000013-065-E04TCGGCCCATCTNONE 
014-002-E03TCGGCCCATCTNONE 
014-004-B07TCGGCCCATCTNONE 
014-038-F03TCGGCCCATCTNONE 
014-072-G02TCGGCCCATCTNONE 
014-078-E02TCGGCCCATCTNONE 
014-081-H11TCGGCCCATCTNONE 
016-060-C11TCGGCCCATCTNONE 
AK064389TCGGCCCATCTSimilar to Low molecular weight heat shock protein precursor (Mitochondrial small heat shock protein 22). 
AK074003TCGGCCCATCTNONE 
AK105464TCGGCCCATCTNONE 
J033076P21TCGGCCCATCTNONE 
Os02g0767100011-054-E05AGATGGGCCGAGNONE 
AK063351AGATGGGCCGAGNONE 
AK103640AGATGGGCCGAGConserved hypothetical protein. 
J090022G11AGATGGGCCGAGNONE 
J090072L18AGATGGGCCGAGNONE 
Os02g0771200011-006-B07AGATGGGCTTTNONE 
AK066823AGATGGGCTTTConserved hypothetical protein. 
AK071059AGATGGGCTTTNONE 
J013075K03AGATGGGCTTTNONE 
Os02g0776800AB042415AGATGGGCCGGCCCACCCGNONE 
AK072308AGATGGGCCGGCCCACCCGReplication protein A 70kDa. 
AK101212AGATGGGCCGGCCCACCCGNONE 
J033031B02AGATGGGCCGGCCCACCCGNONE 
J090004E18AGATGGGCCGGCCCACCCGNONE 
J090084C24AGATGGGCCGGCCCACCCGNONE 
Os02g0788500006-024-A02AGATGGGCCGAGNONE 
006-031-G02AGATGGGCCGAGNONE 
006-081-F11AGATGGGCCGAGNONE 
006-082-H05AGATGGGCCGAGNONE 
AK061452AGATGGGCCGAGConserved hypothetical protein. 
AK104117AGATGGGCCGAGNONE 
AK104526AGATGGGCCGAGNONE 
J075024D11AGATGGGCCGAGNONE 
J075056B12AGATGGGCCGAGNONE 
J075108H12AGATGGGCCGAGNONE 
J075156P10AGATGGGCCGAGNONE 
J075197A19AGATGGGCCGAGNONE 
Os02g0794400AK065845AGATGGGCCCCAInitiation factor 3 family protein. 
J013042M03AGATGGGCCCCANONE 
Os02g0803200AK063404AGATGGGCCGGASimilar to 30S ribosomal protein S15. 
Os02g0805600006-054-D07CCAGGCCCAAGGCCCATCTNONE 
AK059822CCAGGCCCAAGGCCCATCTNONE 
AK099516CCAGGCCCAAGGCCCATCTSimilar to Alcohol dehydrogenase, zinc-containing. 
AK104587CCAGGCCCAAGGCCCATCTNONE 
J065037H22CCAGGCCCAAGGCCCATCTNONE 
J090015P17CCAGGCCCAAGGCCCATCTNONE 
Os02g0823000AK122065GCCCATCTPeptidase A22B, minor histocompatibility antigen H13 family protein. 
Os02g0832200AK108268TTGGCCCATCTConserved hypothetical protein. 
J065053F07TTGGCCCATCTNONE 
J065095B09TTGGCCCATCTNONE 
J065137I11TTGGCCCATCTNONE 
J065187O12TTGGCCCATCTNONE 
J075193O05TTGGCCCATCTNONE 
Os03g0135300004-017-A10AGCCCATCTGTCAGTGNONE 
006-046-A11AGCCCATCTGTCAGTGNONE 
006-110-B05AGCCCATCTGTCAGTGNONE 
AF309384AGCCCATCTGTCAGTGNONE 
AK071745AGCCCATCTGTCAGTGSimilar to Glutathione S-transferase GST 10 (EC 2.5.1.18). 
AK104680AGCCCATCTGTCAGTGNONE 
J013100M12AGCCCATCTGTCAGTGNONE 
J023107J18AGCCCATCTGTCAGTGNONE 
J033081B13AGCCCATCTGTCAGTGNONE 
J033087L03AGCCCATCTGTCAGTGNONE 
J065120N18AGCCCATCTGTCAGTGNONE 
J075032C15AGCCCATCTGTCAGTGNONE 
J075172P14AGCCCATCTGTCAGTGNONE 
J090049B05AGCCCATCTGTCAGTGNONE 
Os03g0138600Os03g0138600AGATGGGCCATProtein of unknown function DUF810 family protein. 
Os03g0139000006-059-C06TACGGCCCATCTNONE 
009-055-F07TACGGCCCATCTNONE 
AK060973TACGGCCCATCTConserved hypothetical protein. 
AK103850TACGGCCCATCTNONE 
Os03g0142900011-054-A05GAAGCCCATCTNONE 
AK067103GAAGCCCATCTNONE 
AK120438GAAGCCCATCTProtein of unknown function DUF946, plant family protein. 
J013097D18GAAGCCCATCTNONE 
J013098E18GAAGCCCATCTNONE 
J013099I17GAAGCCCATCTNONE 
J013108C09GAAGCCCATCTNONE 
J023045J15GAAGCCCATCTNONE 
J033034E13GAAGCCCATCTNONE 
J033095F07GAAGCCCATCTNONE 
J033102N22GAAGCCCATCTNONE 
J065016C14GAAGCCCATCTNONE 
J065034E13GAAGCCCATCTNONE 
J065065F21GAAGCCCATCTNONE 
J065159M09GAAGCCCATCTNONE 
J075012C13GAAGCCCATCTNONE 
J075017P18GAAGCCCATCTNONE 
J075018M03GAAGCCCATCTNONE 
J075021H19GAAGCCCATCTNONE 
J075070K23GAAGCCCATCTNONE 
J075077B18GAAGCCCATCTNONE 
J075085E20GAAGCCCATCTNONE 
J075090N23GAAGCCCATCTNONE 
J075137M16GAAGCCCATCTNONE 
J075151E03GAAGCCCATCTNONE 
J090042L02GAAGCCCATCTNONE 
J090060C21GAAGCCCATCTNONE 
J090089I17GAAGCCCATCTNONE 
J100024L19GAAGCCCATCTNONE 
J100025A06GAAGCCCATCTNONE 
J100033C24GAAGCCCATCTNONE 
J100052J17GAAGCCCATCTNONE 
J100063H10GAAGCCCATCTNONE 
J100073P04GAAGCCCATCTNONE 
J100075D01GAAGCCCATCTNONE 
J100077J17GAAGCCCATCTNONE 
J100087F03GAAGCCCATCTNONE 
J100087F09GAAGCCCATCTNONE 
Os03g0145600015-010-B10CGGACGGCCCATCTNONE 
AK106243CGGACGGCCCATCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os03g0171700J065192H12GGTGGGCCCATCTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0192600006-033-B01AGATGGGCTNONE 
006-079-H12AGATGGGCTNONE 
009-092-E03AGATGGGCTNONE 
AK061461AGATGGGCTNONE 
AK105970AGATGGGCTPlant lipid transfer protein/Par allergen family protein. 
J065152D05AGATGGGCTNONE 
J100056I22AGATGGGCTNONE 
Os03g0213800AK103114AGATGGGCTGGMitochondrial substrate carrier family protein. 
Os03g0214100AB111916CGGCCCGGCCCATCTNONE 
AF009179CGGCCCGGCCCATCTReplication protein A1. 
AK060582CGGCCCGGCCCATCTNONE 
Os03g0233800AK072396AGATGGGCTProtein of unknown function DUF547 domain containing protein. 
AK108855AGATGGGCTNONE 
Os03g0244000006-048-F02GGTCCAGATGGGCNONE 
006-049-E12GGTCCAGATGGGCNONE 
006-049-G12GGTCCAGATGGGCNONE 
006-058-C05GGTCCAGATGGGCNONE 
006-115-B08GGTCCAGATGGGCNONE 
009-072-G08GGTCCAGATGGGCNONE 
009-178-E05GGTCCAGATGGGCNONE 
AK061036GGTCCAGATGGGCConserved hypothetical protein. 
AK104109GGTCCAGATGGGCNONE 
J065036J06GGTCCAGATGGGCNONE 
J065052H12GGTCCAGATGGGCNONE 
J065071O22GGTCCAGATGGGCNONE 
J065120M19GGTCCAGATGGGCNONE 
J065140G07GGTCCAGATGGGCNONE 
J065148B11GGTCCAGATGGGCNONE 
J075031N24GGTCCAGATGGGCNONE 
J075062G05GGTCCAGATGGGCNONE 
Os03g0255900009-164-C12GGCGTGGAGATGGGCNONE 
AK063057GGCGTGGAGATGGGCConserved hypothetical protein. 
Os03g0283300AK070169ATGGCCCATCTConserved hypothetical protein. 
Os03g0336000AK100067CTCGGCCCATCTProtein prenyltransferase domain containing protein. 
AK100067TCAGCCCATCTProtein prenyltransferase domain containing protein. 
J065161K02CTCGGCCCATCTNONE 
J065161K02TCAGCCCATCTNONE 
J065162C21CTCGGCCCATCTNONE 
J065162C21TCAGCCCATCTNONE 
Os03g0349000011-089-G05AGATGGGCCGANONE 
011-089-G05TAGGCCCAGGCCCATCTNONE 
AK099999AGATGGGCCGANucleoporin interacting component family protein. 
AK099999TAGGCCCAGGCCCATCTNucleoporin interacting component family protein. 
J013134K18AGATGGGCCGANONE 
J013134K18TAGGCCCAGGCCCATCTNONE 
J033024G23AGATGGGCCGANONE 
J033024G23TAGGCCCAGGCCCATCTNONE 
J033098A12AGATGGGCCGANONE 
J033098A12TAGGCCCAGGCCCATCTNONE 
J090001N18AGATGGGCCGANONE 
J090001N18TAGGCCCAGGCCCATCTNONE 
J090058F11AGATGGGCCGANONE 
J090058F11TAGGCCCAGGCCCATCTNONE 
J090065C04AGATGGGCCGANONE 
J090065C04TAGGCCCAGGCCCATCTNONE 
J100067M17AGATGGGCCGANONE 
J100067M17TAGGCCCAGGCCCATCTNONE 
J100083P13AGATGGGCCGANONE 
J100083P13TAGGCCCAGGCCCATCTNONE 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0405000AK070839AGATGGGCCCACAReticulon family protein. 
Os03g0411500AK058696AGATGGGCTNONE 
AK071057AGATGGGCTPeptidase S14, ClpP family protein. 
Os03g0411800009-042-G11AGATGGGCCCCCACGTNONE 
AK121551AGATGGGCCCCCACGTSimilar to Metal transport protein. 
AY302059AGATGGGCCCCCACGTNONE 
J013095L05AGATGGGCCCCCACGTNONE 
J033033B06AGATGGGCCCCCACGTNONE 
J033118G11AGATGGGCCCCCACGTNONE 
Os03g0604600J090093K23CCAGCCCAGATGGGCTConserved hypothetical protein. 
Os03g0606200009-030-E09GAGGCCCATCTNONE 
009-076-H10GAGGCCCATCTNONE 
009-122-H12GAGGCCCATCTNONE 
009-153-F09GAGGCCCATCTNONE 
AB055076GAGGCCCATCTMitochondrial ATP synthase 6 KD subunit. 
AK072384GAGGCCCATCTNONE 
AK107928GAGGCCCATCTNONE 
J023078E13GAGGCCCATCTNONE 
J053031N01GAGGCCCATCTNONE 
J053046K19GAGGCCCATCTNONE 
J053062P07GAGGCCCATCTNONE 
J053091C23GAGGCCCATCTNONE 
J053099N19GAGGCCCATCTNONE 
J065005E06GAGGCCCATCTNONE 
J065030N03GAGGCCCATCTNONE 
J065138O21GAGGCCCATCTNONE 
J065159K03GAGGCCCATCTNONE 
J075030M08GAGGCCCATCTNONE 
J080006E23GAGGCCCATCTNONE 
J080010D10GAGGCCCATCTNONE 
J080016N17GAGGCCCATCTNONE 
J080024N09GAGGCCCATCTNONE 
J080028E23GAGGCCCATCTNONE 
J080035I11GAGGCCCATCTNONE 
J080038D15GAGGCCCATCTNONE 
J080040H08GAGGCCCATCTNONE 
J080043L04GAGGCCCATCTNONE 
J080047C06GAGGCCCATCTNONE 
J080061G04GAGGCCCATCTNONE 
J080066E10GAGGCCCATCTNONE 
J080067P03GAGGCCCATCTNONE 
J080082D07GAGGCCCATCTNONE 
J080089M13GAGGCCCATCTNONE 
J080094O09GAGGCCCATCTNONE 
J080095C24GAGGCCCATCTNONE 
J080309E21GAGGCCCATCTNONE 
J090016G15GAGGCCCATCTNONE 
J090031C20GAGGCCCATCTNONE 
J090033A15GAGGCCCATCTNONE 
J090037L07GAGGCCCATCTNONE 
J090038I10GAGGCCCATCTNONE 
J090072P19GAGGCCCATCTNONE 
J100040J02GAGGCCCATCTNONE 
J100047N05GAGGCCCATCTNONE 
J100048M10GAGGCCCATCTNONE 
J100076C02GAGGCCCATCTNONE 
J100077G23GAGGCCCATCTNONE 
J100080O08GAGGCCCATCTNONE 
J100085C06GAGGCCCATCTNONE 
J100085F16GAGGCCCATCTNONE 
Os03g0634000014-034-A03ACAGCCCATCTGGACCNONE 
AK063673ACAGCCCATCTGGACCSimilar to THA4. 
Os03g0640800AK060584GCCCATCTNONE 
Os03g0647800003-103-H03GACGGCCCATCTNONE 
006-104-G09GACGGCCCATCTNONE 
AK070243GACGGCCCATCTConserved hypothetical protein. 
J100056F22GACGGCCCATCTNONE 
Os03g0648400005-003-D07ACAGCCCATCTNONE 
006-048-C12ACAGCCCATCTNONE 
006-049-A03ACAGCCCATCTNONE 
011-008-F07ACAGCCCATCTNONE 
011-039-A07ACAGCCCATCTNONE 
011-044-D10ACAGCCCATCTNONE 
011-099-C01ACAGCCCATCTNONE 
012-051-B09ACAGCCCATCTNONE 
012-051-D08ACAGCCCATCTNONE 
012-056-G07ACAGCCCATCTNONE 
012-062-A01ACAGCCCATCTNONE 
012-079-C03ACAGCCCATCTNONE 
014-003-A06ACAGCCCATCTNONE 
015-010-D02ACAGCCCATCTNONE 
AK102263ACAGCCCATCTSimilar to DnaJ protein homolog (DNAJ-1). 
AK103763ACAGCCCATCTNONE 
AK105028ACAGCCCATCTNONE 
AY224432ACAGCCCATCTNONE 
J013043H01ACAGCCCATCTNONE 
J013134K10ACAGCCCATCTNONE 
J023037D18ACAGCCCATCTNONE 
J023077K20ACAGCCCATCTNONE 
J023105M19ACAGCCCATCTNONE 
J023131M09ACAGCCCATCTNONE 
J033022F05ACAGCCCATCTNONE 
J033051J22ACAGCCCATCTNONE 
J033061D03ACAGCCCATCTNONE 
J033084H04ACAGCCCATCTNONE 
J033088M01ACAGCCCATCTNONE 
J033119H12ACAGCCCATCTNONE 
J033131C18ACAGCCCATCTNONE 
J043030C06ACAGCCCATCTNONE 
J080032A08ACAGCCCATCTNONE 
J090008C11ACAGCCCATCTNONE 
J090014D24ACAGCCCATCTNONE 
J090024C20ACAGCCCATCTNONE 
J090024H08ACAGCCCATCTNONE 
J090029F10ACAGCCCATCTNONE 
J090032K16ACAGCCCATCTNONE 
J090034L14ACAGCCCATCTNONE 
J090035C20ACAGCCCATCTNONE 
J090044H05ACAGCCCATCTNONE 
J090048M09ACAGCCCATCTNONE 
J090056I15ACAGCCCATCTNONE 
J090062B01ACAGCCCATCTNONE 
J090076F06ACAGCCCATCTNONE 
J090077A02ACAGCCCATCTNONE 
J090084E21ACAGCCCATCTNONE 
J090084J09ACAGCCCATCTNONE 
J090086G11ACAGCCCATCTNONE 
J090092C20ACAGCCCATCTNONE 
J100018G14ACAGCCCATCTNONE 
J100018I22ACAGCCCATCTNONE 
J100024N14ACAGCCCATCTNONE 
J100032K09ACAGCCCATCTNONE 
J100036F09ACAGCCCATCTNONE 
J100041M04ACAGCCCATCTNONE 
J100042H05ACAGCCCATCTNONE 
J100043P19ACAGCCCATCTNONE 
J100044B04ACAGCCCATCTNONE 
J100049L24ACAGCCCATCTNONE 
J100050M21ACAGCCCATCTNONE 
J100057F24ACAGCCCATCTNONE 
J100063I11ACAGCCCATCTNONE 
J100064J24ACAGCCCATCTNONE 
J100070B13ACAGCCCATCTNONE 
J100076A13ACAGCCCATCTNONE 
J100081C20ACAGCCCATCTNONE 
J100081L09ACAGCCCATCTNONE 
J100084G23ACAGCCCATCTNONE 
J100088H02ACAGCCCATCTNONE 
Os03g0656900AK066416AGATGGGCTTGNusB/RsmB/TIM44 domain containing protein. 
J065157L23AGATGGGCTTGNONE 
J065166P22AGATGGGCTTGNONE 
Os03g0683700AK065067AGATGGGCCAAProtein of unknown function DUF810 family protein. 
Os03g0737600014-094-E01GAGGCCCATCTNONE 
AB038234GAGGCCCATCTNONE 
AK101854GAGGCCCATCTCyclin H-1. 
AK105468GAGGCCCATCTNONE 
J033069N12GAGGCCCATCTNONE 
J043017A22GAGGCCCATCTNONE 
J065154A20GAGGCCCATCTNONE 
Os03g0769600AK100054ACCGGCCCATCTResB-like family protein. 
Os03g0771500AB028884AGATGGGCCATKnotted1-type homeobox protein OSH43. 
AK107296AGATGGGCCATNONE 
Os03g0774200AK065851AGATGGGCCAGANONE 
AK119532AGATGGGCCAGASimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AGATGGGCCAGANONE 
J023107I03AGATGGGCCAGANONE 
J065156I19AGATGGGCCAGANONE 
J065176L07AGATGGGCCAGANONE 
J100066F15AGATGGGCCAGANONE 
Os03g0785500AK067718AGATGGGCCGGGCProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0786500016-056-D08AGATGGGCCGANONE 
016-056-D08AGCCCATCTNONE 
AK106487AGATGGGCCGASimilar to Glycine-rich protein 2. 
AK106487AGCCCATCTSimilar to Glycine-rich protein 2. 
J080001C23AGATGGGCCGANONE 
J080001C23AGCCCATCTNONE 
J080005A02AGATGGGCCGANONE 
J080005A02AGCCCATCTNONE 
J080009A14AGATGGGCCGANONE 
J080009A14AGCCCATCTNONE 
J080009B11AGATGGGCCGANONE 
J080009B11AGCCCATCTNONE 
J080011L03AGATGGGCCGANONE 
J080011L03AGCCCATCTNONE 
J080017E21AGATGGGCCGANONE 
J080017E21AGCCCATCTNONE 
J080018H08AGATGGGCCGANONE 
J080018H08AGCCCATCTNONE 
J080021E11AGATGGGCCGANONE 
J080021E11AGCCCATCTNONE 
J080025O20AGATGGGCCGANONE 
J080025O20AGCCCATCTNONE 
J080026H21AGATGGGCCGANONE 
J080026H21AGCCCATCTNONE 
J080029I10AGATGGGCCGANONE 
J080029I10AGCCCATCTNONE 
J080036L01AGATGGGCCGANONE 
J080036L01AGCCCATCTNONE 
J080038M15AGATGGGCCGANONE 
J080038M15AGCCCATCTNONE 
J080051H09AGATGGGCCGANONE 
J080051H09AGCCCATCTNONE 
J080053E18AGATGGGCCGANONE 
J080053E18AGCCCATCTNONE 
J080054I12AGATGGGCCGANONE 
J080054I12AGCCCATCTNONE 
J080055B14AGATGGGCCGANONE 
J080055B14AGCCCATCTNONE 
J080060L16AGATGGGCCGANONE 
J080060L16AGCCCATCTNONE 
J080067G06AGATGGGCCGANONE 
J080067G06AGCCCATCTNONE 
J080069K14AGATGGGCCGANONE 
J080069K14AGCCCATCTNONE 
J080070N14AGATGGGCCGANONE 
J080070N14AGCCCATCTNONE 
J080071G10AGATGGGCCGANONE 
J080071G10AGCCCATCTNONE 
J080076D08AGATGGGCCGANONE 
J080076D08AGCCCATCTNONE 
J080076O11AGATGGGCCGANONE 
J080076O11AGCCCATCTNONE 
J080078E10AGATGGGCCGANONE 
J080078E10AGCCCATCTNONE 
J080079B15AGATGGGCCGANONE 
J080079B15AGCCCATCTNONE 
J080079K03AGATGGGCCGANONE 
J080079K03AGCCCATCTNONE 
J080079O15AGATGGGCCGANONE 
J080079O15AGCCCATCTNONE 
J080087B18AGATGGGCCGANONE 
J080087B18AGCCCATCTNONE 
Os03g0795900012-092-G05AGATGGGCCGANONE 
015-043-D09AGATGGGCCGANONE 
016-078-G11AGATGGGCCGANONE 
AK068660AGATGGGCCGASimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14AGATGGGCCGANONE 
J023001L04AGATGGGCCGANONE 
J053032K11AGATGGGCCGANONE 
J065059E10AGATGGGCCGANONE 
J065095H19AGATGGGCCGANONE 
J065181M06AGATGGGCCGANONE 
J100047D11AGATGGGCCGANONE 
J100068G04AGATGGGCCGANONE 
Os03g0808300006-053-B11GCCCATCTNONE 
006-057-A01GCCCATCTNONE 
006-090-F05GCCCATCTNONE 
006-106-G01GCCCATCTNONE 
006-120-D10GCCCATCTNONE 
009-139-H09GCCCATCTNONE 
AK109389GCCCATCTRemorin, C-terminal region domain containing protein. 
J033065F13GCCCATCTNONE 
J053045H15GCCCATCTNONE 
J065021C02GCCCATCTNONE 
J065021D01GCCCATCTNONE 
J065039B14GCCCATCTNONE 
J065064J22GCCCATCTNONE 
J065167I09GCCCATCTNONE 
J065170A13GCCCATCTNONE 
J065183J10GCCCATCTNONE 
J065202K10GCCCATCTNONE 
J065218F21GCCCATCTNONE 
J075028D07GCCCATCTNONE 
J100048J08GCCCATCTNONE 
J100050H06GCCCATCTNONE 
J100054M24GCCCATCTNONE 
J100068G07GCCCATCTNONE 
J100079F23GCCCATCTNONE 
Os03g0826000AK072695AAGGCCCATCTConserved hypothetical protein. 
Os03g0851900AK102145AAGGCCCAGGCCCATCTAFG1-like ATPase family protein. 
J033086B08AAGGCCCAGGCCCATCTNONE 
Os03g0852400006-021-C11AGATGGGCCGAAANONE 
006-048-D09AGATGGGCCGAAANONE 
006-059-C05AGATGGGCCGAAANONE 
006-078-E01AGATGGGCCGAAANONE 
006-082-H09AGATGGGCCGAAANONE 
AK060985AGATGGGCCGAAANONE 
AK109338AGATGGGCCGAAAConserved hypothetical protein. 
Os04g0107900013-017-E10AGATGGGCTGCNONE 
014-025-A02AGATGGGCTGCNONE 
014-100-C01AGATGGGCTGCNONE 
AK063568AGATGGGCTGCNONE 
AK063698AGATGGGCTGCNONE 
AK063751AGATGGGCTGCSimilar to Heat shock protein 80. 
J013118G22AGATGGGCTGCNONE 
J033131C17AGATGGGCTGCNONE 
J065036G05AGATGGGCTGCNONE 
J065106E24AGATGGGCTGCNONE 
J065171K16AGATGGGCTGCNONE 
J065213C11AGATGGGCTGCNONE 
J065218L17AGATGGGCTGCNONE 
Os04g0223500AK120831AGATGGGCNONE 
Os04g0428900009-068-A06AGATGGGCCAGANONE 
AK061355AGATGGGCCAGASimilar to CSN8. 
AK099153AGATGGGCCAGANONE 
AY336991AGATGGGCCAGANONE 
J023069F08AGATGGGCCAGANONE 
J065112H12AGATGGGCCAGANONE 
J075022F23AGATGGGCCAGANONE 
J090045D23AGATGGGCCAGANONE 
J090067E18AGATGGGCCAGANONE 
J090099H14AGATGGGCCAGANONE 
Os04g0451100AK106764GAAGCCCATCTConserved hypothetical protein. 
Os04g0459600006-039-H09AGATGGGCNONE 
006-039-H09AGATGGGCCGCNONE 
AK061516AGATGGGCRan-interacting Mog1 protein family protein. 
AK061516AGATGGGCCGCRan-interacting Mog1 protein family protein. 
J065112J03AGATGGGCNONE 
J065112J03AGATGGGCCGCNONE 
Os04g0462600AK111125AGATGGGCTDynein light chain, type 1 family protein. 
Os04g0470300AK059742AGCCCATCTNONE 
AK070483AGCCCATCTProtein of unknown function UPF0136, Transmembrane family protein. 
J065200F06AGCCCATCTNONE 
J090047A18AGCCCATCTNONE 
Os04g0502300009-116-F02TCAGGCCCATCTCGGCCCACTCTNONE 
009-130-H06TCAGGCCCATCTCGGCCCACTCTNONE 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
J013124K01TCAGGCCCATCTCGGCCCACTCTNONE 
J023102F03TCAGGCCCATCTCGGCCCACTCTNONE 
J033094F17TCAGGCCCATCTCGGCCCACTCTNONE 
J053054C22TCAGGCCCATCTCGGCCCACTCTNONE 
J065024N13TCAGGCCCATCTCGGCCCACTCTNONE 
J065083J18TCAGGCCCATCTCGGCCCACTCTNONE 
J065132O14TCAGGCCCATCTCGGCCCACTCTNONE 
J065156M09TCAGGCCCATCTCGGCCCACTCTNONE 
J065176N15TCAGGCCCATCTCGGCCCACTCTNONE 
J065208H08TCAGGCCCATCTCGGCCCACTCTNONE 
J075054B03TCAGGCCCATCTCGGCCCACTCTNONE 
J090053E20TCAGGCCCATCTCGGCCCACTCTNONE 
J100075B09TCAGGCCCATCTCGGCCCACTCTNONE 
J100089H12TCAGGCCCATCTCGGCCCACTCTNONE 
Os04g0514500AK073502AGATGGGCTNONE 
J090058N12AGATGGGCTNONE 
Os04g0525000AK067753TCAGGCCCAGCCCATCTConserved hypothetical protein. 
J013118G14TCAGGCCCAGCCCATCTNONE 
J065026J15TCAGGCCCAGCCCATCTNONE 
J065184H21TCAGGCCCAGCCCATCTNONE 
J065186H22TCAGGCCCAGCCCATCTNONE 
J065193D20TCAGGCCCAGCCCATCTNONE 
J075060D12TCAGGCCCAGCCCATCTNONE 
J075179L24TCAGGCCCAGCCCATCTNONE 
Os04g0528100009-090-G06AGCCCATCTNONE 
009-168-C11AGCCCATCTNONE 
AK065957AGCCCATCTConserved hypothetical protein. 
J013039G20AGCCCATCTNONE 
J013044D08AGCCCATCTNONE 
J065013L14AGCCCATCTNONE 
J065143H08AGCCCATCTNONE 
J065146C14AGCCCATCTNONE 
J065149K22AGCCCATCTNONE 
J065156B18AGCCCATCTNONE 
J065201A04AGCCCATCTNONE 
J065209A04AGCCCATCTNONE 
Os04g0559400AK106376AGATGGGCCCCACCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0570600AK106747AGATGGGCCAGACytochrome P450 family protein. 
J080319G08AGATGGGCCAGANONE 
Os04g0573200AK065277CAAGGCCCATCTNONE 
AK120348CAAGGCCCATCTHeavy metal transport/detoxification protein domain containing protein. 
Os04g0584100012-063-E01AGATGGGCCTCNONE 
AK105292AGATGGGCCTCConserved hypothetical protein. 
Os04g0600200AB004864AAAGCCCATCTNONE 
AB007452AAAGCCCATCTNONE 
AK064040AAAGCCCATCTSimilar to Alternative oxidase 1a (Fragment). 
Os04g0606800009-159-H11AGATGGGCCCACATGTCAGTGNONE 
AK072824AGATGGGCCCACATGTCAGTGConserved hypothetical protein. 
J033070J06AGATGGGCCCACATGTCAGTGNONE 
J033119D03AGATGGGCCCACATGTCAGTGNONE 
J100043F05AGATGGGCCCACATGTCAGTGNONE 
J100050A01AGATGGGCCCACATGTCAGTGNONE 
Os04g0611300009-006-G08AGATGGGCCGAGATNONE 
009-011-C01AGATGGGCCGAGATNONE 
009-036-B09AGATGGGCCGAGATNONE 
009-116-G09AGATGGGCCGAGATNONE 
009-126-E09AGATGGGCCGAGATNONE 
009-132-F09AGATGGGCCGAGATNONE 
009-151-G07AGATGGGCCGAGATNONE 
009-155-C07AGATGGGCCGAGATNONE 
009-163-G01AGATGGGCCGAGATNONE 
009-169-G08AGATGGGCCGAGATNONE 
009-191-B02AGATGGGCCGAGATNONE 
009-196-A08AGATGGGCCGAGATNONE 
009-198-E07AGATGGGCCGAGATNONE 
014-015-F04AGATGGGCCGAGATNONE 
015-087-H04AGATGGGCCGAGATNONE 
AK062605AGATGGGCCGAGATNONE 
AK063022AGATGGGCCGAGATConserved hypothetical protein. 
AK066749AGATGGGCCGAGATNONE 
AK104924AGATGGGCCGAGATNONE 
J065002M20AGATGGGCCGAGATNONE 
J065045L23AGATGGGCCGAGATNONE 
J065101E05AGATGGGCCGAGATNONE 
J065140J23AGATGGGCCGAGATNONE 
J065179G11AGATGGGCCGAGATNONE 
J065191B18AGATGGGCCGAGATNONE 
J065192E03AGATGGGCCGAGATNONE 
J065199H21AGATGGGCCGAGATNONE 
J075067F01AGATGGGCCGAGATNONE 
J075089L01AGATGGGCCGAGATNONE 
J075147K22AGATGGGCCGAGATNONE 
J080069G23AGATGGGCCGAGATNONE 
J100053D10AGATGGGCCGAGATNONE 
J100078C10AGATGGGCCGAGATNONE 
Os04g0674350J065104O14AGATGGGCCGCNONE 
J065118J19AGATGGGCCGCNONE 
J065167I12AGATGGGCCGCHypothetical protein. 
Os04g0674400015-042-B08GCGGCCCATCTNONE 
AK102124GCGGCCCATCTSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2. 
J013129O22GCGGCCCATCTNONE 
J023022I24GCGGCCCATCTNONE 
J023120A15GCGGCCCATCTNONE 
J023123P20GCGGCCCATCTNONE 
J033068P09GCGGCCCATCTNONE 
J033107G22GCGGCCCATCTNONE 
J033116G12GCGGCCCATCTNONE 
J033133F03GCGGCCCATCTNONE 
J033143B20GCGGCCCATCTNONE 
J043006G12GCGGCCCATCTNONE 
J043027M18GCGGCCCATCTNONE 
J043034H17GCGGCCCATCTNONE 
J090091E20GCGGCCCATCTNONE 
J100035H09GCGGCCCATCTNONE 
J100037J04GCGGCCCATCTNONE 
J100047J24GCGGCCCATCTNONE 
J100059G06GCGGCCCATCTNONE 
J100066O12GCGGCCCATCTNONE 
J100074G23GCGGCCCATCTNONE 
J100077M12GCGGCCCATCTNONE 
Os04g0683900004-009-A11GCCCATCTNONE 
014-076-H12GCCCATCTNONE 
AK060880GCCCATCTNONE 
AK099749GCCCATCTHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309GCCCATCTNONE 
J013050K21GCCCATCTNONE 
J013092E09GCCCATCTNONE 
J013095N06GCCCATCTNONE 
J013095P07GCCCATCTNONE 
J013130D22GCCCATCTNONE 
J013134O15GCCCATCTNONE 
J023022I06GCCCATCTNONE 
J023062L11GCCCATCTNONE 
J023078J11GCCCATCTNONE 
J023086J01GCCCATCTNONE 
J033125A20GCCCATCTNONE 
J065023K13GCCCATCTNONE 
J065045N02GCCCATCTNONE 
J065129F01GCCCATCTNONE 
J065164H14GCCCATCTNONE 
J065192H09GCCCATCTNONE 
J075064P15GCCCATCTNONE 
J075088G17GCCCATCTNONE 
J075199D20GCCCATCTNONE 
Os04g0685100AK065262ATGGCCCATCTRibosomal biogenesis regulatory protein family protein. 
J013002J24ATGGCCCATCTNONE 
J013030M11ATGGCCCATCTNONE 
J033139J12ATGGCCCATCTNONE 
J065013D12ATGGCCCATCTNONE 
J065117J01ATGGCCCATCTNONE 
J065143K20ATGGCCCATCTNONE 
J065181E12ATGGCCCATCTNONE 
J065184A17ATGGCCCATCTNONE 
J065193B13ATGGCCCATCTNONE 
J065196H01ATGGCCCATCTNONE 
J075072G17ATGGCCCATCTNONE 
J075077B02ATGGCCCATCTNONE 
J075088A06ATGGCCCATCTNONE 
J075099H13ATGGCCCATCTNONE 
J075111O04ATGGCCCATCTNONE 
J075131F20ATGGCCCATCTNONE 
J075139K01ATGGCCCATCTNONE 
J075194I16ATGGCCCATCTNONE 
Os05g0102900006-056-A01AGATGGGCCTTNONE 
AK061764AGATGGGCCTTNONE 
AK065749AGATGGGCCTTSnf7 family protein. 
AK104101AGATGGGCCTTNONE 
J013042C01AGATGGGCCTTNONE 
J033038P15AGATGGGCCTTNONE 
J065032F16AGATGGGCCTTNONE 
J065039I22AGATGGGCCTTNONE 
J065150F19AGATGGGCCTTNONE 
J075079I21AGATGGGCCTTNONE 
J075082F14AGATGGGCCTTNONE 
J075098G16AGATGGGCCTTNONE 
J075167I08AGATGGGCCTTNONE 
Os05g0111000AK073598CAGGCCCATCTSimilar to Gag polyprotein [Contains: Core protein p15 (Matrix protein); Core protein p24; Core protein p12]. 
Os05g0118000AK110694TCTGGCCCATCTSRR1 domain containing protein. 
Os05g0126200AK059554CCCGGCCCATCTConserved hypothetical protein. 
AK121734CCCGGCCCATCTNONE 
J033084B09CCCGGCCCATCTNONE 
J090010I10CCCGGCCCATCTNONE 
Os05g0128100009-051-B07CTTGGGCCGCCGGCCCATCTNONE 
009-127-B08CTTGGGCCGCCGGCCCATCTNONE 
009-144-H03CTTGGGCCGCCGGCCCATCTNONE 
009-176-B05CTTGGGCCGCCGGCCCATCTNONE 
AK108556CTTGGGCCGCCGGCCCATCTNONE 
AK119308CTTGGGCCGCCGGCCCATCTNONE 
AK120934CTTGGGCCGCCGGCCCATCTConserved hypothetical protein. 
J023036J15CTTGGGCCGCCGGCCCATCTNONE 
J065122L01CTTGGGCCGCCGGCCCATCTNONE 
J075104P10CTTGGGCCGCCGGCCCATCTNONE 
Os05g0144800AK099724CCAGCCCATCTSimilar to TFIIH basal transcription factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementing XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). 
Os05g0148300009-031-A08AGATGGGCCTGANONE 
AK062421AGATGGGCCTGARibosomal protein S27, mitochondrial family protein. 
Os05g0304900AK105545AGATGGGCGlycoside hydrolase, family 10 protein. 
Os05g0310500003-003-G10GCCCATCTNONE 
J013000E23GCCCATCTNONE 
J013050D04GCCCATCTNONE 
J013071L24GCCCATCTNONE 
J013105A18GCCCATCTNONE 
J013105O14GCCCATCTNONE 
J013112J17GCCCATCTNONE 
J023013N13GCCCATCTNONE 
J023085M05GCCCATCTNONE 
J023105N09GCCCATCTNONE 
J023118H10GCCCATCTNONE 
J023133F06GCCCATCTNONE 
J033028I11GCCCATCTNONE 
J033072O16GCCCATCTNONE 
J033106F24GCCCATCTNONE 
J033109E11GCCCATCTNONE 
J033136E15GCCCATCTNONE 
J033138J07GCCCATCTNONE 
J043001M12GCCCATCTNONE 
J043013K23GCCCATCTNONE 
J043022J02GCCCATCTNONE 
J043026H19GCCCATCTNONE 
J043030D07GCCCATCTNONE 
J043036C05GCCCATCTNONE 
Os05g0316200AK060608GCGACGCGCCCATCTNONE 
AK101705GCGACGCGCCCATCTConserved hypothetical protein. 
AK111481GCGACGCGCCCATCTNONE 
Os05g0346300009-033-C06AGATGGGCTTGGGCTTTNONE 
AF529175AGATGGGCTTGGGCTTTNONE 
AK061627AGATGGGCTTGGGCTTTSimilar to 40S ribosomal protein S7. 
AK103081AGATGGGCTTGGGCTTTNONE 
AK104191AGATGGGCTTGGGCTTTNONE 
J013049B09AGATGGGCTTGGGCTTTNONE 
J023142E24AGATGGGCTTGGGCTTTNONE 
J033052M14AGATGGGCTTGGGCTTTNONE 
J033089N04AGATGGGCTTGGGCTTTNONE 
J033118F01AGATGGGCTTGGGCTTTNONE 
J065054E07AGATGGGCTTGGGCTTTNONE 
J065066L18AGATGGGCTTGGGCTTTNONE 
J065078C21AGATGGGCTTGGGCTTTNONE 
J065127G23AGATGGGCTTGGGCTTTNONE 
J065128N24AGATGGGCTTGGGCTTTNONE 
J065144P17AGATGGGCTTGGGCTTTNONE 
J065147P14AGATGGGCTTGGGCTTTNONE 
J065170E16AGATGGGCTTGGGCTTTNONE 
J065175D17AGATGGGCTTGGGCTTTNONE 
J065176M05AGATGGGCTTGGGCTTTNONE 
J065218G20AGATGGGCTTGGGCTTTNONE 
J090074J12AGATGGGCTTGGGCTTTNONE 
J100019H16AGATGGGCTTGGGCTTTNONE 
J100031N24AGATGGGCTTGGGCTTTNONE 
J100072G08AGATGGGCTTGGGCTTTNONE 
J100086I23AGATGGGCTTGGGCTTTNONE 
Os05g0346400AK058872CCAAGCCCATCTNONE 
AK102727CCAAGCCCATCTProtein of unknown function DUF538 family protein. 
J033105N07CCAAGCCCATCTNONE 
J100077I17CCAAGCCCATCTNONE 
Os05g0377000Os05g0377000GCTGGGCCAGATGGGCCGGASimilar to Acyl carrier protein (ACP). 
Os05g0378900AK103841AGATGGGCCTAConserved hypothetical protein. 
AK103841ATGGCCCATCTConserved hypothetical protein. 
J033148I18AGATGGGCCTANONE 
J033148I18ATGGCCCATCTNONE 
J065085F12AGATGGGCCTANONE 
J065085F12ATGGCCCATCTNONE 
J075041H24AGATGGGCCTANONE 
J075041H24ATGGCCCATCTNONE 
J075180P06AGATGGGCCTANONE 
J075180P06ATGGCCCATCTNONE 
Os05g0379300AK109293GACGGCCCATCTConserved hypothetical protein. 
Os05g0424700AK107848GCCCATCTSimilar to Copper transporter 1. 
Os05g0437800015-045-B10AGATGGGCTNONE 
AK106328AGATGGGCTConserved hypothetical protein. 
Os05g0458100006-084-A05AGATGGGCCGTGNONE 
009-091-H05AGATGGGCCGTGNONE 
AJ557547AGATGGGCCGTGNONE 
AK059467AGATGGGCCGTGNONE 
AK061127AGATGGGCCGTGNONE 
AK101652AGATGGGCCGTGSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06AGATGGGCCGTGNONE 
J033057B20AGATGGGCCGTGNONE 
J033087A05AGATGGGCCGTGNONE 
J043009C05AGATGGGCCGTGNONE 
J090009E10AGATGGGCCGTGNONE 
Os05g0470800011-027-A06AGATGGGCNONE 
AK069780AGATGGGCBacterial surface antigen (D15) family protein. 
J023007A20AGATGGGCNONE 
J023028F19AGATGGGCNONE 
J023081E20AGATGGGCNONE 
J023089D13AGATGGGCNONE 
J023115D18AGATGGGCNONE 
J033087E22AGATGGGCNONE 
J033143O14AGATGGGCNONE 
Os05g0480700AK100850GGTTGGGCCCATCTSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11GGTTGGGCCCATCTNONE 
Os05g0490000011-076-C07AGATGGGCCTTNONE 
015-026-D07AGATGGGCCTTNONE 
015-074-A08AGATGGGCCTTNONE 
AK064335AGATGGGCCTTNONE 
AK101340AGATGGGCCTTKrr1 family protein. 
J033034J18AGATGGGCCTTNONE 
Os05g0535200AK070696AGATGGGCCTCCyclin-like F-box domain containing protein. 
J023057L12AGATGGGCCTCNONE 
Os05g0536900009-033-D11AGATGGGCCGGGCCGGTNONE 
AK105140AGATGGGCCGGGCCGGTSimilar to RAB7A. 
Os05g0539300Os05g0539300AGATGGGCCGGAProtein of unknown function DUF295 family protein. 
Os05g0541500AK101190AGATGGGCTGGCyclin-like F-box domain containing protein. 
AK101190TCAGGCCCATCTCyclin-like F-box domain containing protein. 
AK101531AGATGGGCTGGNONE 
AK101531TCAGGCCCATCTNONE 
J033030F10AGATGGGCTGGNONE 
J033030F10TCAGGCCCATCTNONE 
Os05g0547850009-102-F03AGATGGGCCTTGGGCCGAAANONE 
013-076-H08AGATGGGCCTTGGGCCGAAANONE 
AK058330AGATGGGCCTTGGGCCGAAANONE 
AK122158AGATGGGCCTTGGGCCGAAADNA-binding TFAR19-related protein family protein. 
AY626826AGATGGGCCTTGGGCCGAAANONE 
J043012O19AGATGGGCCTTGGGCCGAAANONE 
J043038O15AGATGGGCCTTGGGCCGAAANONE 
J053094L06AGATGGGCCTTGGGCCGAAANONE 
Os05g0565100011-013-H02AGCCCATCTNONE 
AK063277AGCCCATCTCytochrome b561 / ferric reductase transmembrane domain containing protein. 
Os05g0571300AK072262TTGGCCCATCTGGCCCATAConserved hypothetical protein. 
AK109853TTGGCCCATCTGGCCCATANONE 
AK111014TTGGCCCATCTGGCCCATANONE 
Os05g0587400AK102121AGCCCATCTPrefoldin domain containing protein. 
J033084N12AGCCCATCTNONE 
Os06g0116600AK103500AAAAGCCCATCTProteinase inhibitor, propeptide domain containing protein. 
J033131B10AAAAGCCCATCTNONE 
J075154F17AAAAGCCCATCTNONE 
J075169L23AAAAGCCCATCTNONE 
Os06g0137500AK072896AAAGCCCATCTBrix domain containing protein. 
AK121945AAAGCCCATCTNONE 
Os06g0140100011-063-A02TGCGGCCCATCTNONE 
AK063371TGCGGCCCATCTLeucine carboxyl methyltransferase family protein. 
Os06g0150100AK068890GCCCATCTConserved hypothetical protein. 
J100061N17GCCCATCTNONE 
Os06g0226600006-083-D04AGATGGGCCGAGANONE 
AK061806AGATGGGCCGAGANONE 
AK102752AGATGGGCCGAGATB2/DP1 and HVA22 related protein family protein. 
J013089J11AGATGGGCCGAGANONE 
J033106M05AGATGGGCCGAGANONE 
J100044M21AGATGGGCCGAGANONE 
J100056E06AGATGGGCCGAGANONE 
J100059F06AGATGGGCCGAGANONE 
Os06g0274200009-090-A02GAGGCCCATCTNONE 
AK073155GAGGCCCATCTSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065001C08GAGGCCCATCTNONE 
J065061C07GAGGCCCATCTNONE 
J065105L08GAGGCCCATCTNONE 
J075013C12GAGGCCCATCTNONE 
J090010N17GAGGCCCATCTNONE 
J090068K07GAGGCCCATCTNONE 
J100058A21GAGGCCCATCTNONE 
J100066C07GAGGCCCATCTNONE 
Os06g0487900AK064330AGATGGGCTPeptidase C48, SUMO/Sentrin/Ubl1 family protein. 
J033045C16AGATGGGCTNONE 
J090071I20AGATGGGCTNONE 
Os06g0547900AK100950TTTCGGCCCATCTSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665TTTCGGCCCATCTNONE 
J023139I22TTTCGGCCCATCTNONE 
J090066J10TTTCGGCCCATCTNONE 
Y13437TTTCGGCCCATCTNONE 
Os06g0564700AK070508AGCCCATCTSimilar to Cysteine synthase (EC 4.2.99.8). 
J023050D23AGCCCATCTNONE 
Os06g0590500AK107080AGATGGGCSimilar to Syntaxin 121 (AtSYP121) (Syntaxin-related protein At-Syr1). 
Os06g0608500AK060097CCAGCCCATCTTGGCCCACCNONE 
AK070667CCAGCCCATCTTGGCCCACCSnf7 family protein. 
Os06g0647900AK073750CCAGCCCAGATGGGCCACConserved hypothetical protein. 
J033029K17CCAGCCCAGATGGGCCACNONE 
J033070L21CCAGCCCAGATGGGCCACNONE 
Os06g0663600AK100787AGATGGGCCGAGATEndonuclease V family protein. 
Os06g0681000009-105-G11AGATGGGCCTGNONE 
009-105-G11AGATGGGCTNONE 
009-105-G11AGATGGGCTGTNONE 
009-105-G11AGATGGGCTTGNONE 
AK062780AGATGGGCCTGConserved hypothetical protein. 
AK062780AGATGGGCTConserved hypothetical protein. 
AK062780AGATGGGCTGTConserved hypothetical protein. 
AK062780AGATGGGCTTGConserved hypothetical protein. 
J100021E01AGATGGGCCTGNONE 
J100021E01AGATGGGCTNONE 
J100021E01AGATGGGCTGTNONE 
J100021E01AGATGGGCTTGNONE 
Os06g0688100AK063450AGATGGGCCCTNONE 
AK101144AGATGGGCCCTRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0694500AK067484GCCGGCCCATCTCGGCCCATGASimilar to Nitrogen fixation like protein. 
AK103983GCCGGCCCATCTCGGCCCATGANONE 
Os06g0727400AK069558AGATGGGCCAGSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os07g0108800AK109604AGCCCATCTSimilar to Calcium-activated outward-rectifying potassium channel 1 (AtKCO1). 
J100055H18AGCCCATCTNONE 
Os07g0150200009-152-C07AGATGGGCCGGCCCATGTNONE 
AK058680AGATGGGCCGGCCCATGTNONE 
AK121635AGATGGGCCGGCCCATGTSimilar to 40S ribosomal protein S12-1. 
J033051C16AGATGGGCCGGCCCATGTNONE 
J033123H15AGATGGGCCGGCCCATGTNONE 
J065093I01AGATGGGCCGGCCCATGTNONE 
J065197C05AGATGGGCCGGCCCATGTNONE 
J075037B11AGATGGGCCGGCCCATGTNONE 
J075114B08AGATGGGCCGGCCCATGTNONE 
J075123N01AGATGGGCCGGCCCATGTNONE 
J075129O04AGATGGGCCGGCCCATGTNONE 
J075160H17AGATGGGCCGGCCCATGTNONE 
J075166H17AGATGGGCCGGCCCATGTNONE 
J080310F11AGATGGGCCGGCCCATGTNONE 
J080315P11AGATGGGCCGGCCCATGTNONE 
J090025A22AGATGGGCCGGCCCATGTNONE 
Os07g0169600006-027-F04AGATGGGCCGTTGNONE 
006-043-C10AGATGGGCCGTTGNONE 
006-070-A04AGATGGGCCGTTGNONE 
006-081-F03AGATGGGCCGTTGNONE 
006-104-F02AGATGGGCCGTTGNONE 
012-006-D12AGATGGGCCGTTGNONE 
AK060318AGATGGGCCGTTGNONE 
AK121818AGATGGGCCGTTG2OG-Fe(II) oxygenase domain containing protein. 
J023065K01AGATGGGCCGTTGNONE 
J023086G17AGATGGGCCGTTGNONE 
J023093G16AGATGGGCCGTTGNONE 
J033024N04AGATGGGCCGTTGNONE 
J033099A15AGATGGGCCGTTGNONE 
J033107B14AGATGGGCCGTTGNONE 
J043026F14AGATGGGCCGTTGNONE 
J065043P20AGATGGGCCGTTGNONE 
J075118L16AGATGGGCCGTTGNONE 
J075162M22AGATGGGCCGTTGNONE 
J080004K13AGATGGGCCGTTGNONE 
J080024D10AGATGGGCCGTTGNONE 
J080037C21AGATGGGCCGTTGNONE 
J080039M17AGATGGGCCGTTGNONE 
J080040A03AGATGGGCCGTTGNONE 
J080044A07AGATGGGCCGTTGNONE 
J080045I07AGATGGGCCGTTGNONE 
J080052L06AGATGGGCCGTTGNONE 
J080053A20AGATGGGCCGTTGNONE 
J080060L15AGATGGGCCGTTGNONE 
J080060N22AGATGGGCCGTTGNONE 
J080062L23AGATGGGCCGTTGNONE 
J080069B19AGATGGGCCGTTGNONE 
J080086K15AGATGGGCCGTTGNONE 
J080089H16AGATGGGCCGTTGNONE 
J080089I23AGATGGGCCGTTGNONE 
J080094P07AGATGGGCCGTTGNONE 
J090032L18AGATGGGCCGTTGNONE 
J100044E09AGATGGGCCGTTGNONE 
J100045O03AGATGGGCCGTTGNONE 
J100066B11AGATGGGCCGTTGNONE 
J100069J24AGATGGGCCGTTGNONE 
Os07g0180900006-055-B11GACGGCCCATCTNONE 
006-103-F09GACGGCCCATCTNONE 
011-009-E03GACGGCCCATCTNONE 
011-035-H08GACGGCCCATCTNONE 
014-043-F08GACGGCCCATCTNONE 
AK060711GACGGCCCATCTRibosomal protein L4/L1e family protein. 
AK060963GACGGCCCATCTNONE 
AK104447GACGGCCCATCTNONE 
AK104504GACGGCCCATCTNONE 
AK104629GACGGCCCATCTNONE 
J023003P15GACGGCCCATCTNONE 
J023075H14GACGGCCCATCTNONE 
J033101N17GACGGCCCATCTNONE 
J033132M11GACGGCCCATCTNONE 
J065081C24GACGGCCCATCTNONE 
J080004L10GACGGCCCATCTNONE 
J080009H21GACGGCCCATCTNONE 
J080013F01GACGGCCCATCTNONE 
J080022K24GACGGCCCATCTNONE 
J080023C22GACGGCCCATCTNONE 
J080024M16GACGGCCCATCTNONE 
J080026K06GACGGCCCATCTNONE 
J080030J23GACGGCCCATCTNONE 
J080030L05GACGGCCCATCTNONE 
J080031G03GACGGCCCATCTNONE 
J080033C03GACGGCCCATCTNONE 
J080033D02GACGGCCCATCTNONE 
J080035A11GACGGCCCATCTNONE 
J080035A14GACGGCCCATCTNONE 
J080039E08GACGGCCCATCTNONE 
J080040L15GACGGCCCATCTNONE 
J080040M03GACGGCCCATCTNONE 
J080041L21GACGGCCCATCTNONE 
J080043E09GACGGCCCATCTNONE 
J080048B14GACGGCCCATCTNONE 
J080048O09GACGGCCCATCTNONE 
J080051H01GACGGCCCATCTNONE 
J080052H06GACGGCCCATCTNONE 
J080065K05GACGGCCCATCTNONE 
J080066D10GACGGCCCATCTNONE 
J080066E23GACGGCCCATCTNONE 
J080069F10GACGGCCCATCTNONE 
J080074M06GACGGCCCATCTNONE 
J080075D13GACGGCCCATCTNONE 
J080076G02GACGGCCCATCTNONE 
J080082G15GACGGCCCATCTNONE 
J080082K06GACGGCCCATCTNONE 
J080082P12GACGGCCCATCTNONE 
J080085F01GACGGCCCATCTNONE 
J080090H22GACGGCCCATCTNONE 
J080092D07GACGGCCCATCTNONE 
J080094M03GACGGCCCATCTNONE 
J080094O10GACGGCCCATCTNONE 
J090008I06GACGGCCCATCTNONE 
J100058N20GACGGCCCATCTNONE 
J100060M07GACGGCCCATCTNONE 
J100062M08GACGGCCCATCTNONE 
J100064L07GACGGCCCATCTNONE 
J100073H16GACGGCCCATCTNONE 
J100074C10GACGGCCCATCTNONE 
J100075N06GACGGCCCATCTNONE 
J100087P11GACGGCCCATCTNONE 
J100088B13GACGGCCCATCTNONE 
J100088J16GACGGCCCATCTNONE 
J100088L17GACGGCCCATCTNONE 
J100088O12GACGGCCCATCTNONE 
Os07g0187300AK103069GCAGCCCATCTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12GCAGCCCATCTNONE 
J033117P16GCAGCCCATCTNONE 
Os07g0205000009-018-A12AGATGGGCCGGCCCATCGGCCCATCANONE 
AK103963AGATGGGCCGGCCCATCGGCCCATCANONE 
AK121368AGATGGGCCGGCCCATCGGCCCATCANONE 
J023001M20AGATGGGCCGGCCCATCGGCCCATCANONE 
J023125I03AGATGGGCCGGCCCATCGGCCCATCANONE 
J053034L22AGATGGGCCGGCCCATCGGCCCATCANONE 
J065078A21AGATGGGCCGGCCCATCGGCCCATCANONE 
J065089G24AGATGGGCCGGCCCATCGGCCCATCANONE 
J065096G23AGATGGGCCGGCCCATCGGCCCATCANONE 
J065103N06AGATGGGCCGGCCCATCGGCCCATCANONE 
J065146J22AGATGGGCCGGCCCATCGGCCCATCANONE 
J065159K18AGATGGGCCGGCCCATCGGCCCATCANONE 
J065204L04AGATGGGCCGGCCCATCGGCCCATCANONE 
J065207N07AGATGGGCCGGCCCATCGGCCCATCANONE 
J065208E24AGATGGGCCGGCCCATCGGCCCATCANONE 
J075057F19AGATGGGCCGGCCCATCGGCCCATCANONE 
J075058K01AGATGGGCCGGCCCATCGGCCCATCANONE 
J075072H13AGATGGGCCGGCCCATCGGCCCATCANONE 
J080003D08AGATGGGCCGGCCCATCGGCCCATCANONE 
J080025F02AGATGGGCCGGCCCATCGGCCCATCANONE 
Os07g0410700009-073-A07GCCCATCTNONE 
AK062612GCCCATCTSimilar to Ethylene-responsive element binding protein 1. 
J065205G01GCCCATCTNONE 
Os07g0435400AK111603TTTCGGCCCATCTSimilar to WD40. 
Os07g0520400J065124A13AGATGGGCTGGConserved hypothetical protein. 
Os07g0563800AK067125GCCCATCTNONE 
AK067240GCCCATCTNONE 
AK068892GCCCATCTArf GTPase activating protein family protein. 
J013098K03GCCCATCTNONE 
J013152M17GCCCATCTNONE 
J023001G22GCCCATCTNONE 
J023044F14GCCCATCTNONE 
J023082O10GCCCATCTNONE 
J033073J11GCCCATCTNONE 
J033113F01GCCCATCTNONE 
J043026C21GCCCATCTNONE 
J065071I06GCCCATCTNONE 
J090044E06GCCCATCTNONE 
Os07g0570300AK100076TCCGGCCCAGCCCATCTPeptidase M16, C-terminal domain containing protein. 
J100033J04TCCGGCCCAGCCCATCTNONE 
J100065L10TCCGGCCCAGCCCATCTNONE 
Os07g0582400003-104-B09AGATGGGCCCACACGNONE 
AK059423AGATGGGCCCACACGNONE 
AK102676AGATGGGCCCACACGNONE 
J065001F09AGATGGGCCCACACGNONE 
J065005K22AGATGGGCCCACACGNONE 
J065006D10AGATGGGCCCACACGNONE 
J065006P17AGATGGGCCCACACGNONE 
J065015G23AGATGGGCCCACACGNONE 
J065020F21AGATGGGCCCACACGNONE 
J065028I05AGATGGGCCCACACGNONE 
J065042N09AGATGGGCCCACACGNONE 
J065043P03AGATGGGCCCACACGNONE 
J065059E15AGATGGGCCCACACGNONE 
J065090I12AGATGGGCCCACACGNONE 
J065130I02AGATGGGCCCACACGNONE 
J065131P05AGATGGGCCCACACGNONE 
J065163I24AGATGGGCCCACACGNONE 
J065168I21AGATGGGCCCACACGNONE 
J065174A12AGATGGGCCCACACGNONE 
J065178K16AGATGGGCCCACACGNONE 
J065182P03AGATGGGCCCACACGNONE 
J065186B07AGATGGGCCCACACGNONE 
J065189M13AGATGGGCCCACACGNONE 
J065208J22AGATGGGCCCACACGNONE 
J065211E11AGATGGGCCCACACGNONE 
J075054E08AGATGGGCCCACACGNONE 
J075067K14AGATGGGCCCACACGNONE 
J075104E20AGATGGGCCCACACGNONE 
J075152M07AGATGGGCCCACACGNONE 
Os07g0614100AB032062AGATGGGCTNONE 
AK058885AGATGGGCTNONE 
AK069145AGATGGGCTNONE 
AK102448AGATGGGCTAlpha 1-2 subunit of 20S proteasome. 
J023007E07AGATGGGCTNONE 
J033093O06AGATGGGCTNONE 
Os07g0620200AK099859AGCCCATCTHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04AGCCCATCTNONE 
Os07g0649200AK072510AGATGGGCTGTConserved hypothetical protein. 
Os07g0680300009-195-E06TCCGGCCCATCTNONE 
AK063800TCCGGCCCATCTSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
J065093F19TCCGGCCCATCTNONE 
J075066A20TCCGGCCCATCTNONE 
J075088I17TCCGGCCCATCTNONE 
J075147M19TCCGGCCCATCTNONE 
J075153L02TCCGGCCCATCTNONE 
J080013A21TCCGGCCCATCTNONE 
J080051B13TCCGGCCCATCTNONE 
J080077I24TCCGGCCCATCTNONE 
J080302B14TCCGGCCCATCTNONE 
J080309D22TCCGGCCCATCTNONE 
J100083B16TCCGGCCCATCTNONE 
Os07g0688100AK101635ACAGCCCATCTProtein prenyltransferase domain containing protein. 
J033055B02ACAGCCCATCTNONE 
J090013O08ACAGCCCATCTNONE 
J090074A17ACAGCCCATCTNONE 
Os07g0693000AK069112AGATGGGCSimilar to Ser-thr protein kinase (Fragment). 
Os07g0695100AB189039AGATGGGCCGGATAGGCCCAGANONE 
AB189042AGATGGGCCGGATAGGCCCAGANONE 
AK059514AGATGGGCCGGATAGGCCCAGANONE 
AK066112AGATGGGCCGGATAGGCCCAGACheY-like domain containing protein. 
J013051N02AGATGGGCCGGATAGGCCCAGANONE 
J013127M02AGATGGGCCGGATAGGCCCAGANONE 
J023007I05AGATGGGCCGGATAGGCCCAGANONE 
Os08g0116500009-007-E05AGGGCCCATCTNONE 
009-074-C07AGGGCCCATCTNONE 
009-098-A07AGGGCCCATCTNONE 
009-100-C03AGGGCCCATCTNONE 
009-136-E04AGGGCCCATCTNONE 
009-138-B08AGGGCCCATCTNONE 
009-144-B06AGGGCCCATCTNONE 
009-184-E04AGGGCCCATCTNONE 
009-189-F01AGGGCCCATCTNONE 
013-006-E05AGGGCCCATCTNONE 
013-015-C10AGGGCCCATCTNONE 
013-019-F09AGGGCCCATCTNONE 
013-020-C01AGGGCCCATCTNONE 
013-021-F05AGGGCCCATCTNONE 
013-035-D08AGGGCCCATCTNONE 
013-038-C09AGGGCCCATCTNONE 
013-054-B07AGGGCCCATCTNONE 
013-061-G10AGGGCCCATCTNONE 
013-074-B01AGGGCCCATCTNONE 
013-079-B06AGGGCCCATCTNONE 
013-099-B09AGGGCCCATCTNONE 
013-099-G11AGGGCCCATCTNONE 
014-023-F04AGGGCCCATCTNONE 
014-032-C07AGGGCCCATCTNONE 
014-045-E02AGGGCCCATCTNONE 
014-085-C02AGGGCCCATCTNONE 
014-087-F04AGGGCCCATCTNONE 
014-089-C04AGGGCCCATCTNONE 
014-090-E01AGGGCCCATCTNONE 
014-094-G11AGGGCCCATCTNONE 
014-097-B07AGGGCCCATCTNONE 
015-024-A12AGGGCCCATCTNONE 
015-032-C06AGGGCCCATCTNONE 
016-053-E09AGGGCCCATCTNONE 
016-081-F10AGGGCCCATCTNONE 
AK058240AGGGCCCATCTSimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09AGGGCCCATCTNONE 
J023107O19AGGGCCCATCTNONE 
J053029K21AGGGCCCATCTNONE 
J053073P11AGGGCCCATCTNONE 
J053074B04AGGGCCCATCTNONE 
J053078M14AGGGCCCATCTNONE 
J065001E12AGGGCCCATCTNONE 
J065006J12AGGGCCCATCTNONE 
J065015C06AGGGCCCATCTNONE 
J065025D13AGGGCCCATCTNONE 
J065029A04AGGGCCCATCTNONE 
J065031D23AGGGCCCATCTNONE 
J065032E24AGGGCCCATCTNONE 
J065034P16AGGGCCCATCTNONE 
J065043B04AGGGCCCATCTNONE 
J065044A15AGGGCCCATCTNONE 
J065062D18AGGGCCCATCTNONE 
J065079G13AGGGCCCATCTNONE 
J065080A19AGGGCCCATCTNONE 
J065080A20AGGGCCCATCTNONE 
J065089N19AGGGCCCATCTNONE 
J065111O07AGGGCCCATCTNONE 
J065115N15AGGGCCCATCTNONE 
J065131A04AGGGCCCATCTNONE 
J065138H02AGGGCCCATCTNONE 
J065139K10AGGGCCCATCTNONE 
J065144A02AGGGCCCATCTNONE 
J065155J17AGGGCCCATCTNONE 
J065159D18AGGGCCCATCTNONE 
J065159I18AGGGCCCATCTNONE 
J065167H12AGGGCCCATCTNONE 
J065174C22AGGGCCCATCTNONE 
J065184A05AGGGCCCATCTNONE 
J065188M15AGGGCCCATCTNONE 
J065191D23AGGGCCCATCTNONE 
J065203C07AGGGCCCATCTNONE 
J065207C23AGGGCCCATCTNONE 
J065207L16AGGGCCCATCTNONE 
J065212F01AGGGCCCATCTNONE 
J065212F05AGGGCCCATCTNONE 
J075037B07AGGGCCCATCTNONE 
J075042F15AGGGCCCATCTNONE 
J075059J03AGGGCCCATCTNONE 
J075068M18AGGGCCCATCTNONE 
J075079E13AGGGCCCATCTNONE 
J075081F12AGGGCCCATCTNONE 
J075083I05AGGGCCCATCTNONE 
J075123K23AGGGCCCATCTNONE 
J075142F16AGGGCCCATCTNONE 
J075156N03AGGGCCCATCTNONE 
J075162K05AGGGCCCATCTNONE 
J075171E08AGGGCCCATCTNONE 
J075177N03AGGGCCCATCTNONE 
J075182K17AGGGCCCATCTNONE 
J075186K02AGGGCCCATCTNONE 
J075191K05AGGGCCCATCTNONE 
J080011E10AGGGCCCATCTNONE 
J080016M21AGGGCCCATCTNONE 
J080017A17AGGGCCCATCTNONE 
J080031O09AGGGCCCATCTNONE 
J080039G21AGGGCCCATCTNONE 
J080041B01AGGGCCCATCTNONE 
J080050G20AGGGCCCATCTNONE 
J080054A12AGGGCCCATCTNONE 
J080058O08AGGGCCCATCTNONE 
J080061N04AGGGCCCATCTNONE 
J080064L23AGGGCCCATCTNONE 
J080064P05AGGGCCCATCTNONE 
J080069I17AGGGCCCATCTNONE 
J080070E07AGGGCCCATCTNONE 
J080071B20AGGGCCCATCTNONE 
J080074L08AGGGCCCATCTNONE 
J080076N08AGGGCCCATCTNONE 
J080081A14AGGGCCCATCTNONE 
J080081J17AGGGCCCATCTNONE 
J080085N14AGGGCCCATCTNONE 
J080090B09AGGGCCCATCTNONE 
J080097L11AGGGCCCATCTNONE 
J080306H13AGGGCCCATCTNONE 
J080307H13AGGGCCCATCTNONE 
J080311F12AGGGCCCATCTNONE 
J080316L23AGGGCCCATCTNONE 
J080318H02AGGGCCCATCTNONE 
J090016L15AGGGCCCATCTNONE 
J090019I02AGGGCCCATCTNONE 
J090031G21AGGGCCCATCTNONE 
J090066C15AGGGCCCATCTNONE 
J100032I02AGGGCCCATCTNONE 
J100032N07AGGGCCCATCTNONE 
J100032N16AGGGCCCATCTNONE 
J100041P21AGGGCCCATCTNONE 
J100048M04AGGGCCCATCTNONE 
J100048M14AGGGCCCATCTNONE 
J100063B08AGGGCCCATCTNONE 
J100088E20AGGGCCCATCTNONE 
J100090I08AGGGCCCATCTNONE 
Os08g0130500006-024-B12AGCCCAATAAGGCCCATCTNONE 
006-032-F11AGCCCAATAAGGCCCATCTNONE 
006-047-B12AGCCCAATAAGGCCCATCTNONE 
006-058-H06AGCCCAATAAGGCCCATCTNONE 
006-062-D07AGCCCAATAAGGCCCATCTNONE 
006-083-F11AGCCCAATAAGGCCCATCTNONE 
006-084-A11AGCCCAATAAGGCCCATCTNONE 
006-096-F12AGCCCAATAAGGCCCATCTNONE 
006-105-A04AGCCCAATAAGGCCCATCTNONE 
006-110-D11AGCCCAATAAGGCCCATCTNONE 
011-022-D11AGCCCAATAAGGCCCATCTNONE 
AK064857AGCCCAATAAGGCCCATCT60S acidic ribosomal protein P0. 
D21130AGCCCAATAAGGCCCATCTNONE 
J013000H12AGCCCAATAAGGCCCATCTNONE 
J013024M17AGCCCAATAAGGCCCATCTNONE 
J013028H09AGCCCAATAAGGCCCATCTNONE 
J013045N22AGCCCAATAAGGCCCATCTNONE 
J013092K19AGCCCAATAAGGCCCATCTNONE 
J013106L12AGCCCAATAAGGCCCATCTNONE 
J013107A03AGCCCAATAAGGCCCATCTNONE 
J013109E12AGCCCAATAAGGCCCATCTNONE 
J013114N08AGCCCAATAAGGCCCATCTNONE 
J013120J12AGCCCAATAAGGCCCATCTNONE 
J013121E21AGCCCAATAAGGCCCATCTNONE 
J013135P20AGCCCAATAAGGCCCATCTNONE 
J023006J08AGCCCAATAAGGCCCATCTNONE 
J023014L16AGCCCAATAAGGCCCATCTNONE 
J023020N03AGCCCAATAAGGCCCATCTNONE 
J023027M24AGCCCAATAAGGCCCATCTNONE 
J023029D18AGCCCAATAAGGCCCATCTNONE 
J023030A14AGCCCAATAAGGCCCATCTNONE 
J023041G23AGCCCAATAAGGCCCATCTNONE 
J023049H05AGCCCAATAAGGCCCATCTNONE 
J023060I23AGCCCAATAAGGCCCATCTNONE 
J023099D07AGCCCAATAAGGCCCATCTNONE 
J023104A20AGCCCAATAAGGCCCATCTNONE 
J023105F18AGCCCAATAAGGCCCATCTNONE 
J023112D21AGCCCAATAAGGCCCATCTNONE 
J023122M18AGCCCAATAAGGCCCATCTNONE 
J023139J20AGCCCAATAAGGCCCATCTNONE 
J023149L20AGCCCAATAAGGCCCATCTNONE 
J023150G04AGCCCAATAAGGCCCATCTNONE 
J033036G02AGCCCAATAAGGCCCATCTNONE 
J033045P13AGCCCAATAAGGCCCATCTNONE 
J033046A22AGCCCAATAAGGCCCATCTNONE 
J033086H16AGCCCAATAAGGCCCATCTNONE 
J033087D07AGCCCAATAAGGCCCATCTNONE 
J033089M14AGCCCAATAAGGCCCATCTNONE 
J033095F14AGCCCAATAAGGCCCATCTNONE 
J033108M01AGCCCAATAAGGCCCATCTNONE 
J033117A17AGCCCAATAAGGCCCATCTNONE 
J033122F03AGCCCAATAAGGCCCATCTNONE 
J033126A04AGCCCAATAAGGCCCATCTNONE 
J033144D13AGCCCAATAAGGCCCATCTNONE 
J033145D13AGCCCAATAAGGCCCATCTNONE 
J043022M09AGCCCAATAAGGCCCATCTNONE 
J053025I11AGCCCAATAAGGCCCATCTNONE 
J053027K06AGCCCAATAAGGCCCATCTNONE 
J053029D15AGCCCAATAAGGCCCATCTNONE 
J053048I22AGCCCAATAAGGCCCATCTNONE 
J053055I01AGCCCAATAAGGCCCATCTNONE 
J053079P07AGCCCAATAAGGCCCATCTNONE 
J053090J23AGCCCAATAAGGCCCATCTNONE 
J053094C24AGCCCAATAAGGCCCATCTNONE 
J065023F18AGCCCAATAAGGCCCATCTNONE 
J065029I12AGCCCAATAAGGCCCATCTNONE 
J065044B18AGCCCAATAAGGCCCATCTNONE 
J065045C07AGCCCAATAAGGCCCATCTNONE 
J065063K22AGCCCAATAAGGCCCATCTNONE 
J065093D11AGCCCAATAAGGCCCATCTNONE 
J065096P09AGCCCAATAAGGCCCATCTNONE 
J065099N04AGCCCAATAAGGCCCATCTNONE 
J065103K24AGCCCAATAAGGCCCATCTNONE 
J065110H12AGCCCAATAAGGCCCATCTNONE 
J065132F24AGCCCAATAAGGCCCATCTNONE 
J065157K16AGCCCAATAAGGCCCATCTNONE 
J065185D11AGCCCAATAAGGCCCATCTNONE 
J065202E16AGCCCAATAAGGCCCATCTNONE 
J065217D07AGCCCAATAAGGCCCATCTNONE 
J075053I19AGCCCAATAAGGCCCATCTNONE 
J075055L24AGCCCAATAAGGCCCATCTNONE 
J075056H24AGCCCAATAAGGCCCATCTNONE 
J075070D02AGCCCAATAAGGCCCATCTNONE 
J075084O15AGCCCAATAAGGCCCATCTNONE 
J075090F24AGCCCAATAAGGCCCATCTNONE 
J075135E03AGCCCAATAAGGCCCATCTNONE 
J075174A01AGCCCAATAAGGCCCATCTNONE 
J075188F05AGCCCAATAAGGCCCATCTNONE 
J075192C17AGCCCAATAAGGCCCATCTNONE 
J080001B02AGCCCAATAAGGCCCATCTNONE 
J080001C08AGCCCAATAAGGCCCATCTNONE 
J080002D15AGCCCAATAAGGCCCATCTNONE 
J080002I03AGCCCAATAAGGCCCATCTNONE 
J080003E24AGCCCAATAAGGCCCATCTNONE 
J080004M10AGCCCAATAAGGCCCATCTNONE 
J080005C18AGCCCAATAAGGCCCATCTNONE 
J080006A12AGCCCAATAAGGCCCATCTNONE 
J080006F04AGCCCAATAAGGCCCATCTNONE 
J080006M11AGCCCAATAAGGCCCATCTNONE 
J080008J11AGCCCAATAAGGCCCATCTNONE 
J080008J22AGCCCAATAAGGCCCATCTNONE 
J080009F14AGCCCAATAAGGCCCATCTNONE 
J080010B12AGCCCAATAAGGCCCATCTNONE 
J080010G14AGCCCAATAAGGCCCATCTNONE 
J080010N07AGCCCAATAAGGCCCATCTNONE 
J080011D04AGCCCAATAAGGCCCATCTNONE 
J080011G10AGCCCAATAAGGCCCATCTNONE 
J080011O19AGCCCAATAAGGCCCATCTNONE 
J080013K23AGCCCAATAAGGCCCATCTNONE 
J080013M09AGCCCAATAAGGCCCATCTNONE 
J080013N12AGCCCAATAAGGCCCATCTNONE 
J080013O15AGCCCAATAAGGCCCATCTNONE 
J080014C13AGCCCAATAAGGCCCATCTNONE 
J080014D21AGCCCAATAAGGCCCATCTNONE 
J080014F08AGCCCAATAAGGCCCATCTNONE 
J080014N08AGCCCAATAAGGCCCATCTNONE 
J080014P19AGCCCAATAAGGCCCATCTNONE 
J080015L09AGCCCAATAAGGCCCATCTNONE 
J080015P15AGCCCAATAAGGCCCATCTNONE 
J080018P10AGCCCAATAAGGCCCATCTNONE 
J080020C06AGCCCAATAAGGCCCATCTNONE 
J080022C14AGCCCAATAAGGCCCATCTNONE 
J080022E01AGCCCAATAAGGCCCATCTNONE 
J080022P04AGCCCAATAAGGCCCATCTNONE 
J080022P10AGCCCAATAAGGCCCATCTNONE 
J080023B20AGCCCAATAAGGCCCATCTNONE 
J080023G19AGCCCAATAAGGCCCATCTNONE 
J080024N15AGCCCAATAAGGCCCATCTNONE 
J080025E11AGCCCAATAAGGCCCATCTNONE 
J080025G24AGCCCAATAAGGCCCATCTNONE 
J080026B01AGCCCAATAAGGCCCATCTNONE 
J080026B05AGCCCAATAAGGCCCATCTNONE 
J080027L17AGCCCAATAAGGCCCATCTNONE 
J080028K02AGCCCAATAAGGCCCATCTNONE 
J080029L23AGCCCAATAAGGCCCATCTNONE 
J080030D08AGCCCAATAAGGCCCATCTNONE 
J080031C03AGCCCAATAAGGCCCATCTNONE 
J080031K02AGCCCAATAAGGCCCATCTNONE 
J080032C16AGCCCAATAAGGCCCATCTNONE 
J080033F10AGCCCAATAAGGCCCATCTNONE 
J080033G12AGCCCAATAAGGCCCATCTNONE 
J080033K03AGCCCAATAAGGCCCATCTNONE 
J080034B03AGCCCAATAAGGCCCATCTNONE 
J080034N21AGCCCAATAAGGCCCATCTNONE 
J080034O03AGCCCAATAAGGCCCATCTNONE 
J080035G10AGCCCAATAAGGCCCATCTNONE 
J080038E14AGCCCAATAAGGCCCATCTNONE 
J080039A19AGCCCAATAAGGCCCATCTNONE 
J080039G10AGCCCAATAAGGCCCATCTNONE 
J080039J01AGCCCAATAAGGCCCATCTNONE 
J080039J09AGCCCAATAAGGCCCATCTNONE 
J080040F07AGCCCAATAAGGCCCATCTNONE 
J080040H18AGCCCAATAAGGCCCATCTNONE 
J080041E08AGCCCAATAAGGCCCATCTNONE 
J080041E16AGCCCAATAAGGCCCATCTNONE 
J080041L08AGCCCAATAAGGCCCATCTNONE 
J080042A07AGCCCAATAAGGCCCATCTNONE 
J080044E02AGCCCAATAAGGCCCATCTNONE 
J080045K03AGCCCAATAAGGCCCATCTNONE 
J080046O03AGCCCAATAAGGCCCATCTNONE 
J080047F08AGCCCAATAAGGCCCATCTNONE 
J080048H01AGCCCAATAAGGCCCATCTNONE 
J080048I05AGCCCAATAAGGCCCATCTNONE 
J080048N06AGCCCAATAAGGCCCATCTNONE 
J080050A07AGCCCAATAAGGCCCATCTNONE 
J080050B04AGCCCAATAAGGCCCATCTNONE 
J080050E21AGCCCAATAAGGCCCATCTNONE 
J080051J01AGCCCAATAAGGCCCATCTNONE 
J080051K02AGCCCAATAAGGCCCATCTNONE 
J080051L02AGCCCAATAAGGCCCATCTNONE 
J080052C20AGCCCAATAAGGCCCATCTNONE 
J080052I22AGCCCAATAAGGCCCATCTNONE 
J080052J21AGCCCAATAAGGCCCATCTNONE 
J080052K22AGCCCAATAAGGCCCATCTNONE 
J080055A05AGCCCAATAAGGCCCATCTNONE 
J080055I12AGCCCAATAAGGCCCATCTNONE 
J080056A21AGCCCAATAAGGCCCATCTNONE 
J080056N11AGCCCAATAAGGCCCATCTNONE 
J080057D02AGCCCAATAAGGCCCATCTNONE 
J080058H21AGCCCAATAAGGCCCATCTNONE 
J080058P16AGCCCAATAAGGCCCATCTNONE 
J080059M03AGCCCAATAAGGCCCATCTNONE 
J080059N17AGCCCAATAAGGCCCATCTNONE 
J080060F13AGCCCAATAAGGCCCATCTNONE 
J080060H06AGCCCAATAAGGCCCATCTNONE 
J080060J03AGCCCAATAAGGCCCATCTNONE 
J080060O09AGCCCAATAAGGCCCATCTNONE 
J080060P22AGCCCAATAAGGCCCATCTNONE 
J080061F06AGCCCAATAAGGCCCATCTNONE 
J080061H21AGCCCAATAAGGCCCATCTNONE 
J080061O13AGCCCAATAAGGCCCATCTNONE 
J080062J07AGCCCAATAAGGCCCATCTNONE 
J080063A08AGCCCAATAAGGCCCATCTNONE 
J080063F19AGCCCAATAAGGCCCATCTNONE 
J080063O18AGCCCAATAAGGCCCATCTNONE 
J080065D15AGCCCAATAAGGCCCATCTNONE 
J080066E13AGCCCAATAAGGCCCATCTNONE 
J080068L01AGCCCAATAAGGCCCATCTNONE 
J080068P07AGCCCAATAAGGCCCATCTNONE 
J080069I21AGCCCAATAAGGCCCATCTNONE 
J080070M04AGCCCAATAAGGCCCATCTNONE 
J080071E01AGCCCAATAAGGCCCATCTNONE 
J080071J08AGCCCAATAAGGCCCATCTNONE 
J080071M23AGCCCAATAAGGCCCATCTNONE 
J080072A03AGCCCAATAAGGCCCATCTNONE 
J080072G18AGCCCAATAAGGCCCATCTNONE 
J080075A04AGCCCAATAAGGCCCATCTNONE 
J080075E19AGCCCAATAAGGCCCATCTNONE 
J080075P18AGCCCAATAAGGCCCATCTNONE 
J080076N11AGCCCAATAAGGCCCATCTNONE 
J080077A11AGCCCAATAAGGCCCATCTNONE 
J080077D22AGCCCAATAAGGCCCATCTNONE 
J080077H18AGCCCAATAAGGCCCATCTNONE 
J080077L03AGCCCAATAAGGCCCATCTNONE 
J080078D02AGCCCAATAAGGCCCATCTNONE 
J080078L05AGCCCAATAAGGCCCATCTNONE 
J080078N20AGCCCAATAAGGCCCATCTNONE 
J080079I20AGCCCAATAAGGCCCATCTNONE 
J080081D04AGCCCAATAAGGCCCATCTNONE 
J080082A07AGCCCAATAAGGCCCATCTNONE 
J080082E24AGCCCAATAAGGCCCATCTNONE 
J080084A22AGCCCAATAAGGCCCATCTNONE 
J080084E15AGCCCAATAAGGCCCATCTNONE 
J080084G06AGCCCAATAAGGCCCATCTNONE 
J080086A05AGCCCAATAAGGCCCATCTNONE 
J080086F09AGCCCAATAAGGCCCATCTNONE 
J080087B11AGCCCAATAAGGCCCATCTNONE 
J080087H12AGCCCAATAAGGCCCATCTNONE 
J080088I05AGCCCAATAAGGCCCATCTNONE 
J080088N08AGCCCAATAAGGCCCATCTNONE 
J080088P07AGCCCAATAAGGCCCATCTNONE 
J080089A09AGCCCAATAAGGCCCATCTNONE 
J080089D21AGCCCAATAAGGCCCATCTNONE 
J080089F24AGCCCAATAAGGCCCATCTNONE 
J080089H22AGCCCAATAAGGCCCATCTNONE 
J080089I04AGCCCAATAAGGCCCATCTNONE 
J080090D01AGCCCAATAAGGCCCATCTNONE 
J080091F09AGCCCAATAAGGCCCATCTNONE 
J080091G18AGCCCAATAAGGCCCATCTNONE 
J080091L24AGCCCAATAAGGCCCATCTNONE 
J080091M12AGCCCAATAAGGCCCATCTNONE 
J080091N12AGCCCAATAAGGCCCATCTNONE 
J080093A15AGCCCAATAAGGCCCATCTNONE 
J080093C08AGCCCAATAAGGCCCATCTNONE 
J080093I08AGCCCAATAAGGCCCATCTNONE 
J080093P21AGCCCAATAAGGCCCATCTNONE 
J080094E18AGCCCAATAAGGCCCATCTNONE 
J080094F15AGCCCAATAAGGCCCATCTNONE 
J080094J21AGCCCAATAAGGCCCATCTNONE 
J080095A09AGCCCAATAAGGCCCATCTNONE 
J080096G05AGCCCAATAAGGCCCATCTNONE 
J080096K07AGCCCAATAAGGCCCATCTNONE 
J080097M17AGCCCAATAAGGCCCATCTNONE 
J080097P21AGCCCAATAAGGCCCATCTNONE 
J080302B15AGCCCAATAAGGCCCATCTNONE 
J080306J15AGCCCAATAAGGCCCATCTNONE 
J080306O13AGCCCAATAAGGCCCATCTNONE 
J080307C15AGCCCAATAAGGCCCATCTNONE 
J080307I04AGCCCAATAAGGCCCATCTNONE 
J080307L05AGCCCAATAAGGCCCATCTNONE 
J080308F11AGCCCAATAAGGCCCATCTNONE 
J080311C04AGCCCAATAAGGCCCATCTNONE 
J080311I07AGCCCAATAAGGCCCATCTNONE 
J080312C01AGCCCAATAAGGCCCATCTNONE 
J080312O08AGCCCAATAAGGCCCATCTNONE 
J080315F14AGCCCAATAAGGCCCATCTNONE 
J080318K13AGCCCAATAAGGCCCATCTNONE 
J080319A17AGCCCAATAAGGCCCATCTNONE 
J090001I01AGCCCAATAAGGCCCATCTNONE 
J090002O18AGCCCAATAAGGCCCATCTNONE 
J090007A08AGCCCAATAAGGCCCATCTNONE 
J090007F22AGCCCAATAAGGCCCATCTNONE 
J090008D09AGCCCAATAAGGCCCATCTNONE 
J090008L07AGCCCAATAAGGCCCATCTNONE 
J090008O08AGCCCAATAAGGCCCATCTNONE 
J090012N11AGCCCAATAAGGCCCATCTNONE 
J090013M05AGCCCAATAAGGCCCATCTNONE 
J090020E08AGCCCAATAAGGCCCATCTNONE 
J090020O20AGCCCAATAAGGCCCATCTNONE 
J090021I10AGCCCAATAAGGCCCATCTNONE 
J090023D07AGCCCAATAAGGCCCATCTNONE 
J090023K22AGCCCAATAAGGCCCATCTNONE 
J090023O08AGCCCAATAAGGCCCATCTNONE 
J090028D21AGCCCAATAAGGCCCATCTNONE 
J090029H14AGCCCAATAAGGCCCATCTNONE 
J090029L12AGCCCAATAAGGCCCATCTNONE 
J090030C05AGCCCAATAAGGCCCATCTNONE 
J090031D18AGCCCAATAAGGCCCATCTNONE 
J090032G10AGCCCAATAAGGCCCATCTNONE 
J090034J22AGCCCAATAAGGCCCATCTNONE 
J090034K16AGCCCAATAAGGCCCATCTNONE 
J090036D10AGCCCAATAAGGCCCATCTNONE 
J090037N17AGCCCAATAAGGCCCATCTNONE 
J090043P17AGCCCAATAAGGCCCATCTNONE 
J090044L20AGCCCAATAAGGCCCATCTNONE 
J090045N16AGCCCAATAAGGCCCATCTNONE 
J090048K03AGCCCAATAAGGCCCATCTNONE 
J090048K10AGCCCAATAAGGCCCATCTNONE 
J090049O07AGCCCAATAAGGCCCATCTNONE 
J090055H23AGCCCAATAAGGCCCATCTNONE 
J090056G12AGCCCAATAAGGCCCATCTNONE 
J090056G16AGCCCAATAAGGCCCATCTNONE 
J090059B16AGCCCAATAAGGCCCATCTNONE 
J090066H21AGCCCAATAAGGCCCATCTNONE 
J090067D22AGCCCAATAAGGCCCATCTNONE 
J090072M07AGCCCAATAAGGCCCATCTNONE 
J090073J21AGCCCAATAAGGCCCATCTNONE 
J090075A15AGCCCAATAAGGCCCATCTNONE 
J090079J09AGCCCAATAAGGCCCATCTNONE 
J090080L07AGCCCAATAAGGCCCATCTNONE 
J090084A03AGCCCAATAAGGCCCATCTNONE 
J090085B07AGCCCAATAAGGCCCATCTNONE 
J090088H11AGCCCAATAAGGCCCATCTNONE 
J090090J12AGCCCAATAAGGCCCATCTNONE 
J090091I21AGCCCAATAAGGCCCATCTNONE 
J090091L02AGCCCAATAAGGCCCATCTNONE 
J090093G18AGCCCAATAAGGCCCATCTNONE 
J090094D23AGCCCAATAAGGCCCATCTNONE 
J090098L19AGCCCAATAAGGCCCATCTNONE 
J100017I22AGCCCAATAAGGCCCATCTNONE 
J100018F08AGCCCAATAAGGCCCATCTNONE 
J100018G19AGCCCAATAAGGCCCATCTNONE 
J100019B05AGCCCAATAAGGCCCATCTNONE 
J100019J18AGCCCAATAAGGCCCATCTNONE 
J100019L04AGCCCAATAAGGCCCATCTNONE 
J100023M06AGCCCAATAAGGCCCATCTNONE 
J100024J23AGCCCAATAAGGCCCATCTNONE 
J100024P09AGCCCAATAAGGCCCATCTNONE 
J100027I05AGCCCAATAAGGCCCATCTNONE 
J100029G03AGCCCAATAAGGCCCATCTNONE 
J100029K08AGCCCAATAAGGCCCATCTNONE 
J100031J17AGCCCAATAAGGCCCATCTNONE 
J100037L16AGCCCAATAAGGCCCATCTNONE 
J100038C05AGCCCAATAAGGCCCATCTNONE 
J100039D19AGCCCAATAAGGCCCATCTNONE 
J100041L02AGCCCAATAAGGCCCATCTNONE 
J100045B08AGCCCAATAAGGCCCATCTNONE 
J100045B15AGCCCAATAAGGCCCATCTNONE 
J100047G07AGCCCAATAAGGCCCATCTNONE 
J100047P19AGCCCAATAAGGCCCATCTNONE 
J100048I15AGCCCAATAAGGCCCATCTNONE 
J100049M16AGCCCAATAAGGCCCATCTNONE 
J100049P18AGCCCAATAAGGCCCATCTNONE 
J100050E21AGCCCAATAAGGCCCATCTNONE 
J100051N02AGCCCAATAAGGCCCATCTNONE 
J100052M02AGCCCAATAAGGCCCATCTNONE 
J100055M24AGCCCAATAAGGCCCATCTNONE 
J100056K11AGCCCAATAAGGCCCATCTNONE 
J100059F20AGCCCAATAAGGCCCATCTNONE 
J100059J15AGCCCAATAAGGCCCATCTNONE 
J100068C19AGCCCAATAAGGCCCATCTNONE 
J100068G06AGCCCAATAAGGCCCATCTNONE 
J100069N02AGCCCAATAAGGCCCATCTNONE 
J100073N04AGCCCAATAAGGCCCATCTNONE 
J100074B05AGCCCAATAAGGCCCATCTNONE 
J100080P13AGCCCAATAAGGCCCATCTNONE 
J100083P09AGCCCAATAAGGCCCATCTNONE 
J100084B11AGCCCAATAAGGCCCATCTNONE 
J100085B07AGCCCAATAAGGCCCATCTNONE 
J100086O20AGCCCAATAAGGCCCATCTNONE 
J100087B02AGCCCAATAAGGCCCATCTNONE 
J100089B14AGCCCAATAAGGCCCATCTNONE 
Os08g0137250J075030L12GTGGCCCATCTNONE 
J075037O21GTGGCCCATCTNONE 
J075078E23GTGGCCCATCTNONE 
J075079C23GTGGCCCATCTNONE 
J075092K02GTGGCCCATCTNONE 
J075108M04GTGGCCCATCTNONE 
J075112N13GTGGCCCATCTNONE 
J075132M13GTGGCCCATCTNONE 
J075146E07GTGGCCCATCTNONE 
J075159F16GTGGCCCATCTNONE 
J075166M12GTGGCCCATCTNONE 
J075185B10GTGGCCCATCTNONE 
J075193J10GTGGCCCATCTNONE 
Os08g0139100006-027-E12TAAGCCCATCTNONE 
006-089-E06TAAGCCCATCTNONE 
006-113-G02TAAGCCCATCTNONE 
AK061429TAAGCCCATCTNONE 
AK099590TAAGCCCATCTSimilar to DAG protein, chloroplast precursor. 
AK104727TAAGCCCATCTNONE 
J013043H11TAAGCCCATCTNONE 
J013049N13TAAGCCCATCTNONE 
J065079F01TAAGCCCATCTNONE 
J065122N24TAAGCCCATCTNONE 
J065142J24TAAGCCCATCTNONE 
J065193N03TAAGCCCATCTNONE 
J075041I21TAAGCCCATCTNONE 
J075145E04TAAGCCCATCTNONE 
Os08g0178800009-155-D05AGATGGGCNONE 
AK063025AGATGGGCHypothetical protein. 
Os08g0206600AK064336TTGGCCCATCTAICARFT/IMPCHase bienzyme family protein. 
AK102764TTGGCCCATCTNONE 
Os08g0327700AK107930GCCCATCTLate embryogenesis abundant (LEA) group 1 family protein. 
Os08g0398700AK105074AGCCCATCTNONE 
Os08g0447200AK067377GCCCGGCCCATCTGGCCCSGT1 family protein. 
J013106M17GCCCGGCCCATCTGGCCCNONE 
J033133D18GCCCGGCCCATCTGGCCCNONE 
J033140B09GCCCGGCCCATCTGGCCCNONE 
J100028I17GCCCGGCCCATCTGGCCCNONE 
J100086C22GCCCGGCCCATCTGGCCCNONE 
Os08g0476000J065040M11AGATGGGCNONE 
J065051M03AGATGGGCNONE 
J065065F08AGATGGGCNONE 
Os08g0490300011-064-F08AGATGGGCCGGCCCACGAANONE 
015-050-C06AGATGGGCCGGCCCACGAANONE 
AK066895AGATGGGCCGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013090I22AGATGGGCCGGCCCACGAANONE 
J090060F02AGATGGGCCGGCCCACGAANONE 
Os08g0517600009-066-H05TCCGGCCCATCTNONE 
AK073374TCCGGCCCATCTNONE 
AK105385TCCGGCCCATCTSAM (and some other nucleotide) binding motif domain containing protein. 
J065165P07TCCGGCCCATCTNONE 
J075004A12TCCGGCCCATCTNONE 
J075062F16TCCGGCCCATCTNONE 
J075115K05TCCGGCCCATCTNONE 
J075116H09TCCGGCCCATCTNONE 
Os08g0517900015-019-D06GAGGCCCATCTNONE 
AK064304GAGGCCCATCTSimilar to 30S ribosomal protein S16. 
Os08g0521400006-047-C11AGATGGGCCATNONE 
016-014-E07AGATGGGCCATNONE 
AK070148AGATGGGCCATNONE 
AK101704AGATGGGCCATZinc finger, RanBP2-type domain containing protein. 
AK105045AGATGGGCCATNONE 
J013108K14AGATGGGCCATNONE 
J013129E16AGATGGGCCATNONE 
J013159M23AGATGGGCCATNONE 
J023041G22AGATGGGCCATNONE 
J033060G13AGATGGGCCATNONE 
J033060J15AGATGGGCCATNONE 
J065120J24AGATGGGCCATNONE 
J065160I01AGATGGGCCATNONE 
J065179A16AGATGGGCCATNONE 
J065189K04AGATGGGCCATNONE 
J090032O15AGATGGGCCATNONE 
J090045A18AGATGGGCCATNONE 
J090060B21AGATGGGCCATNONE 
J090086F23AGATGGGCCATNONE 
J090098O22AGATGGGCCATNONE 
J100018K20AGATGGGCCATNONE 
J100048P22AGATGGGCCATNONE 
J100052I06AGATGGGCCATNONE 
Os08g0522500006-026-A04ACCGGCCCATCTNONE 
006-037-B02ACCGGCCCATCTNONE 
006-047-E11ACCGGCCCATCTNONE 
015-049-E10ACCGGCCCATCTNONE 
AK060080ACCGGCCCATCTNONE 
AK102814ACCGGCCCATCTNONE 
AK104718ACCGGCCCATCTNONE 
AK106190ACCGGCCCATCTGlycoside hydrolase, family 19 protein. 
J013068H02ACCGGCCCATCTNONE 
J033108M05ACCGGCCCATCTNONE 
J033116M13ACCGGCCCATCTNONE 
J065211H04ACCGGCCCATCTNONE 
J075195H03ACCGGCCCATCTNONE 
J075195I24ACCGGCCCATCTNONE 
Os08g0535600AK121683AGATGGGCTZinc finger, Tim10/DDP-type family protein. 
J065077E05AGATGGGCTNONE 
J075088M24AGATGGGCTNONE 
J075140B03AGATGGGCTNONE 
J090014B14AGATGGGCTNONE 
Os08g0545700Os08g0545700AGCCCATCTTraB determinant family protein. 
Os08g0554000AK111661AGATGGGCCGGGCCGTAWD-40 repeat containing protein. 
AK112044AGATGGGCCGGGCCGTANONE 
J013039N12AGATGGGCCGGGCCGTANONE 
J013134D02AGATGGGCCGGGCCGTANONE 
J013153B06AGATGGGCCGGGCCGTANONE 
J033044L16AGATGGGCCGGGCCGTANONE 
J033073P14AGATGGGCCGGGCCGTANONE 
Os09g0120033AK069069TCTGGCCCATCTConserved hypothetical protein. 
Os09g0342000AK111440AGATGGGCCGACyclin-like F-box domain containing protein. 
Os09g0458700J065112J22TCTGGCCCATCTCalcium-binding EF-hand domain containing protein. 
J065207F05TCTGGCCCATCTNONE 
Os09g0477700AK121644AGATGGGCCGCConserved hypothetical protein. 
Os09g0501100009-126-C12GAGGCCCATCTNONE 
AK063752GAGGCCCATCTSimilar to 60S ribosomal protein L32A. 
AK099282GAGGCCCATCTNONE 
J023130H04GAGGCCCATCTNONE 
J075013C11GAGGCCCATCTNONE 
J075060E07GAGGCCCATCTNONE 
J075106K07GAGGCCCATCTNONE 
J075124L15GAGGCCCATCTNONE 
J075161D15GAGGCCCATCTNONE 
J080311I18GAGGCCCATCTNONE 
J080315G08GAGGCCCATCTNONE 
J080316F09GAGGCCCATCTNONE 
J080318B05GAGGCCCATCTNONE 
J100052O18GAGGCCCATCTNONE 
J100064D07GAGGCCCATCTNONE 
Os09g0512900006-066-A10AGATGGGCTNONE 
006-066-A10TTCGGCCCATCTNONE 
AK061814AGATGGGCTConserved hypothetical protein. 
AK061814TTCGGCCCATCTConserved hypothetical protein. 
AK066925AGATGGGCTNONE 
AK066925TTCGGCCCATCTNONE 
AK104595AGATGGGCTNONE 
AK104595TTCGGCCCATCTNONE 
J013092F14AGATGGGCTNONE 
J013092F14TTCGGCCCATCTNONE 
J023148N20AGATGGGCTNONE 
J023148N20TTCGGCCCATCTNONE 
J033131F06AGATGGGCTNONE 
J033131F06TTCGGCCCATCTNONE 
J053025L20AGATGGGCTNONE 
J053025L20TTCGGCCCATCTNONE 
J075003B20AGATGGGCTNONE 
J075003B20TTCGGCCCATCTNONE 
J075019N18AGATGGGCTNONE 
J075019N18TTCGGCCCATCTNONE 
J075032D10AGATGGGCTNONE 
J075032D10TTCGGCCCATCTNONE 
J075037G14AGATGGGCTNONE 
J075037G14TTCGGCCCATCTNONE 
J075098D24AGATGGGCTNONE 
J075098D24TTCGGCCCATCTNONE 
J075106M13AGATGGGCTNONE 
J075106M13TTCGGCCCATCTNONE 
J075122N14AGATGGGCTNONE 
J075122N14TTCGGCCCATCTNONE 
J075146E22AGATGGGCTNONE 
J075146E22TTCGGCCCATCTNONE 
J075187E06AGATGGGCTNONE 
J075187E06TTCGGCCCATCTNONE 
J075198I17AGATGGGCTNONE 
J075198I17TTCGGCCCATCTNONE 
J090023O05AGATGGGCTNONE 
J090023O05TTCGGCCCATCTNONE 
J100040E10AGATGGGCTNONE 
J100040E10TTCGGCCCATCTNONE 
J100080P12AGATGGGCTNONE 
J100080P12TTCGGCCCATCTNONE 
J100088B06AGATGGGCTNONE 
J100088B06TTCGGCCCATCTNONE 
Os09g0517800012-034-H10AGATGGGCCTTNONE 
AK121391AGATGGGCCTTCyclin-like F-box domain containing protein. 
J023129D04AGATGGGCCTTNONE 
J043012D11AGATGGGCCTTNONE 
Os09g0525500AK107918TACGGCCCATCTYY1 protein precursor. 
D50575TACGGCCCATCTNONE 
Os09g0535500AK108282GCCCATCTSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
Os09g0542200006-092-A09AGATGGGCCCAAATNONE 
AK064887AGATGGGCCCAAATThioredoxin fold domain containing protein. 
AK104804AGATGGGCCCAAATNONE 
J013000K12AGATGGGCCCAAATNONE 
J013170A19AGATGGGCCCAAATNONE 
J033103B02AGATGGGCCCAAATNONE 
J065196J20AGATGGGCCCAAATNONE 
J075037H17AGATGGGCCCAAATNONE 
J075069H14AGATGGGCCCAAATNONE 
J075071C16AGATGGGCCCAAATNONE 
J075095N02AGATGGGCCCAAATNONE 
J075136N03AGATGGGCCCAAATNONE 
J075192L16AGATGGGCCCAAATNONE 
J100057N23AGATGGGCCCAAATNONE 
J100060O07AGATGGGCCCAAATNONE 
J100062F10AGATGGGCCCAAATNONE 
J100077I08AGATGGGCCCAAATNONE 
J100086B07AGATGGGCCCAAATNONE 
J100088L14AGATGGGCCCAAATNONE 
Os09g0552300AK111721CTGGCCCATCTProtein kinase-like domain containing protein. 
J043013E21CTGGCCCATCTNONE 
Os09g0559800AK071542AGATGGGCTGASimilar to Transporter-like protein. 
J013063N24AGATGGGCTGANONE 
Os11g0130500J065119D16GAGGCCCATCTAGGCCCATANONE 
J065169E14GAGGCCCATCTAGGCCCATACyclin-like F-box domain containing protein. 
Os11g0130600AK066342TTATGGGCCTAGATGGGCCTCConserved hypothetical protein. 
J065192M10TTATGGGCCTAGATGGGCCTCNONE 
Os11g0131200J065024D18AGATGGGCMpv17/PMP22 family protein. 
J065206C17AGATGGGCNONE 
Os11g0162200009-059-H04AGCCCAATTCAGCCCATCTNONE 
AK060396AGCCCAATTCAGCCCATCTSimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11AGCCCAATTCAGCCCATCTNONE 
J065105K09AGCCCAATTCAGCCCATCTNONE 
J075024G12AGCCCAATTCAGCCCATCTNONE 
J075040K04AGCCCAATTCAGCCCATCTNONE 
J075066D13AGCCCAATTCAGCCCATCTNONE 
J075108A11AGCCCAATTCAGCCCATCTNONE 
J100031D04AGCCCAATTCAGCCCATCTNONE 
J100060O05AGCCCAATTCAGCCCATCTNONE 
J100075M22AGCCCAATTCAGCCCATCTNONE 
Os11g0210500AK070886GAAGCCCATCTNONE 
J023069O03GAAGCCCATCTNONE 
J100038M22GAAGCCCATCTNONE 
J100066M06GAAGCCCATCTNONE 
Os11g0223000J065060C21AGATGGGCGCGCGAGNONE 
Os11g0244800AK103215AGATGGGCCCTSimilar to Alfin-1. 
J065009E13AGATGGGCCCTNONE 
J065027D16AGATGGGCCCTNONE 
J065085B06AGATGGGCCCTNONE 
J065180O17AGATGGGCCCTNONE 
J090010C16AGATGGGCCCTNONE 
J090039K20AGATGGGCCCTNONE 
Os11g0286800AK072702GCCCATCTTerpene synthase family protein. 
AK100763GCCCATCTNONE 
AK107355GCCCATCTNONE 
J013026O22GCCCATCTNONE 
J013065A14GCCCATCTNONE 
J013129G22GCCCATCTNONE 
J023119J04GCCCATCTNONE 
Os11g0299300AK119915AGCCCATCTLipase, class 3 family protein. 
Os11g0531700006-023-B12GAAGCCCATCTNONE 
AK059751GAAGCCCATCTNUDIX hydrolase domain containing protein. 
AK099204GAAGCCCATCTNONE 
Os11g0549655J065008P04AGATGGGCTAATTGGGCCGGTGGCCCGGCNONE 
J065148G18AGATGGGCTAATTGGGCCGGTGGCCCGGCMaf-like protein family protein. 
Os11g0570000AK111751AGATGGGCSimilar to Receptor kinase-like protein. 
J013060M13AGATGGGCNONE 
J013104G05AGATGGGCNONE 
J013124F03AGATGGGCNONE 
J023002F04AGATGGGCNONE 
J023010B08AGATGGGCNONE 
J023024F23AGATGGGCNONE 
J023026B16AGATGGGCNONE 
J023034L02AGATGGGCNONE 
J023050J11AGATGGGCNONE 
J023098L16AGATGGGCNONE 
J023109B14AGATGGGCNONE 
J023130I24AGATGGGCNONE 
J023132B14AGATGGGCNONE 
J023141A01AGATGGGCNONE 
J090021N24AGATGGGCNONE 
J090061H08AGATGGGCNONE 
Os11g0616200AK069189GCCCATCTConserved hypothetical protein. 
J023004N19GCCCATCTNONE 
Os12g0125200J065062L18AGATGGGCCGAAConserved hypothetical protein. 
Os12g0133600AK103096AGATGGGCTTGConserved hypothetical protein. 
J033118M03AGATGGGCTTGNONE 
Os12g0142600AK067092AGATGGGCDTW domain containing protein. 
J013096C01AGATGGGCNONE 
Os12g0150100009-047-B11TCCGGCCCATCTNONE 
AK105075TCCGGCCCATCTSimilar to 60S ribosomal protein L26A. 
J013067G22TCCGGCCCATCTNONE 
J033103F08TCCGGCCCATCTNONE 
J065029P11TCCGGCCCATCTNONE 
J065043B18TCCGGCCCATCTNONE 
J065123E16TCCGGCCCATCTNONE 
J065141O20TCCGGCCCATCTNONE 
J065161O04TCCGGCCCATCTNONE 
J065201M07TCCGGCCCATCTNONE 
J075058I23TCCGGCCCATCTNONE 
J075172J08TCCGGCCCATCTNONE 
J100040L13TCCGGCCCATCTNONE 
Os12g0277500006-025-D06AGATGGGCTTCNONE 
AK061410AGATGGGCTTCNONE 
AK119217AGATGGGCTTCNONE 
AK119223AGATGGGCTTCNONE 
Os12g0406200004-006-C10GCGGCCCATCTNONE 
AK071037GCGGCCCATCTSimilar to 40S ribosomal protein S3a (CYC07 protein). 
Os12g0442700AK111062AGCCCATCTHypothetical protein. 
J065080H14AGCCCATCTNONE 
J075019H22AGCCCATCTNONE 
J075088M09AGCCCATCTNONE 
Os12g0480000AK061316AGATGGGCCCCACACZinc finger, DHHC-type domain containing protein. 
Os12g0507600009-155-B05GGGTGGGCCCATCTCGGCCCATGANONE 
AK070613GGGTGGGCCCATCTCGGCCCATGAConserved hypothetical protein. 
J023063G03GGGTGGGCCCATCTCGGCCCATGANONE 
Os12g0609800AK101303AGATGGGCTGGGCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01AGATGGGCTGGGNONE 
J033033K21AGATGGGCTGGGNONE 
J033082L13AGATGGGCTGGGNONE 
J043034M20AGATGGGCTGGGNONE 
J065137J24AGATGGGCTGGGNONE 
J065141A11AGATGGGCTGGGNONE 
J065217H09AGATGGGCTGGGNONE 
Os12g0630600J100033A04GCAGCCCATCTConserved hypothetical protein. 
Os12g0638100012-096-H01ATTTGGGCCCATCTNONE 
AK059245ATTTGGGCCCATCTNONE 
J033071D06ATTTGGGCCCATCTNONE 
J033090A15ATTTGGGCCCATCTNONE 
J033090A18ATTTGGGCCCATCTNONE 
J033098M15ATTTGGGCCCATCTNONE 
J033111F01ATTTGGGCCCATCTNONE 
J033111I05ATTTGGGCCCATCTNONE 
J033117B13ATTTGGGCCCATCTNONE 
J033127C21ATTTGGGCCCATCTNONE 
J053025M14ATTTGGGCCCATCTNONE 
J053032E24ATTTGGGCCCATCTNONE 
J053089K20ATTTGGGCCCATCTNONE 
J065010A05ATTTGGGCCCATCTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.