version

Summary of OsREG457 (All List)

OrganismOryza sativa  
IDOsREG457  
SequenceAGCCCAAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1915  

Entry Sequences (1915 entries)

LocusGene modelSequenceDescription
Os01g0206700J023047B12TTTGGGCTGANONE 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
AK069972CCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075090M12CCAAGCCCAAAANONE 
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075146A12CCAAGCCCAAAANONE 
Os01g0246100AK120732AGCCCAAACProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0295900J065076G19TCAGCCCAAACNONE 
Os01g0305900Os01g0305900ACAGCCCAAAASimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0332100AK120720AGCCCAAAASimilar to Neutral invertase-like protein (Fragment). 
AY187621AGCCCAAAANONE 
J080021I24AGCCCAAAANONE 
Os01g0349000AK108540TAAGCCCAAAAConserved hypothetical protein. 
J065059M15TAAGCCCAAAANONE 
Os01g0358300AK060388GTGGTGGGCCGGTTTGGGCTTTTNONE 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-C09AAAAGCCCAAACCGGCCCACCACNONE 
006-088-H03AAAAGCCCAAACCGGCCCACCACNONE 
006-102-H05AAAAGCCCAAACCGGCCCACCACNONE 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
J013105M07AAAAGCCCAAACCGGCCCACCACNONE 
J013155A16AAAAGCCCAAACCGGCCCACCACNONE 
J033025C03AAAAGCCCAAACCGGCCCACCACNONE 
J033072L20AAAAGCCCAAACCGGCCCACCACNONE 
J033095I15AAAAGCCCAAACCGGCCCACCACNONE 
J033105E03AAAAGCCCAAACCGGCCCACCACNONE 
J033112G18AAAAGCCCAAACCGGCCCACCACNONE 
J033125D09AAAAGCCCAAACCGGCCCACCACNONE 
J065100L16AAAAGCCCAAACCGGCCCACCACNONE 
J065176I05AAAAGCCCAAACCGGCCCACCACNONE 
J090001C14AAAAGCCCAAACCGGCCCACCACNONE 
J090058E15AAAAGCCCAAACCGGCCCACCACNONE 
J090068F07AAAAGCCCAAACCGGCCCACCACNONE 
Os01g0527700006-102-G07GTTTGGGCTGGNONE 
012-094-B11GTTTGGGCTGGNONE 
015-096-C04GTTTGGGCTGGNONE 
AK061861GTTTGGGCTGGProtoheme IX farnesyltransferase family protein. 
AK099005GTTTGGGCTGGNONE 
J013109B04GTTTGGGCTGGNONE 
J033057L14GTTTGGGCTGGNONE 
J090072H04GTTTGGGCTGGNONE 
J100030A14GTTTGGGCTGGNONE 
Os01g0541900AK069784AGCCCAAAProtein kinase-like domain containing protein. 
J013033M01AGCCCAAANONE 
J013159H24AGCCCAAANONE 
J023008E13AGCCCAAANONE 
J023030I11AGCCCAAANONE 
J065137G08AGCCCAAANONE 
J065139H16AGCCCAAANONE 
J065154K13AGCCCAAANONE 
J075176C02AGCCCAAANONE 
Os01g0555100AK111255TCAGCCCAAAASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os01g0574400AK072509AGCCCAAACSimilar to Cell division protein ftsH (EC 3.4.24.-). 
Os01g0585400AK103584AGCCCAAAGCCCAATConserved hypothetical protein. 
J033133B01AGCCCAAAGCCCAATNONE 
Os01g0626300016-070-G04CCAGCCCAAACNONE 
AK122071CCAGCCCAAACSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04CCAGCCCAAACNONE 
J033117J08CCAGCCCAAACNONE 
J065007O12CCAGCCCAAACNONE 
J065020K12CCAGCCCAAACNONE 
J065142D24CCAGCCCAAACNONE 
J065157K19CCAGCCCAAACNONE 
J080307H19CCAGCCCAAACNONE 
J080311D16CCAGCCCAAACNONE 
J080316C12CCAGCCCAAACNONE 
J080316E03CCAGCCCAAACNONE 
J100033K16CCAGCCCAAACNONE 
J100042J21CCAGCCCAAACNONE 
J100051E06CCAGCCCAAACNONE 
J100071E22CCAGCCCAAACNONE 
Os01g0633000006-075-A01TCAGCCCAAACNONE 
009-064-A11TCAGCCCAAACNONE 
009-153-F07TCAGCCCAAACNONE 
AK062051TCAGCCCAAACSimilar to 50S ribosomal protein L31. 
J013073B08TCAGCCCAAACNONE 
J065006K19TCAGCCCAAACNONE 
J065053P08TCAGCCCAAACNONE 
J065057D08TCAGCCCAAACNONE 
J065086P07TCAGCCCAAACNONE 
J065095C14TCAGCCCAAACNONE 
J065116B05TCAGCCCAAACNONE 
J065164L20TCAGCCCAAACNONE 
J065185K19TCAGCCCAAACNONE 
J065191E21TCAGCCCAAACNONE 
J065199P21TCAGCCCAAACNONE 
J065216M12TCAGCCCAAACNONE 
J075002M09TCAGCCCAAACNONE 
J075016N10TCAGCCCAAACNONE 
J075041K05TCAGCCCAAACNONE 
J075094E04TCAGCCCAAACNONE 
J075154O04TCAGCCCAAACNONE 
J075176D22TCAGCCCAAACNONE 
J075186M09TCAGCCCAAACNONE 
J075191H20TCAGCCCAAACNONE 
Os01g0639600005-018-A02GAAGCCCAAACNONE 
AK067056GAAGCCCAAACProtein of unknown function DUF1645 family protein. 
J013066M03GAAGCCCAAACNONE 
J013066O05GAAGCCCAAACNONE 
J013088M21GAAGCCCAAACNONE 
J065045F04GAAGCCCAAACNONE 
J080018F22GAAGCCCAAACNONE 
J080037B10GAAGCCCAAACNONE 
J080042G23GAAGCCCAAACNONE 
J080052B21GAAGCCCAAACNONE 
J080060H13GAAGCCCAAACNONE 
J100024A05GAAGCCCAAACNONE 
J100071A09GAAGCCCAAACNONE 
J100080K14GAAGCCCAAACNONE 
Os01g0643900AK108288ATTTGGGCTOleosin family protein. 
Os01g0644200014-007-H12ATTTGGGCTNONE 
AK063634ATTTGGGCTConserved hypothetical protein. 
AY549310ATTTGGGCTNONE 
J075068F10ATTTGGGCTNONE 
J075082A11ATTTGGGCTNONE 
Os01g0649900AK068077TTTTGGGCTTTTLipolytic enzyme, G-D-S-L family protein. 
Os01g0661400AK073113AGCCCAGCCCAAACNucleic acid-binding, OB-fold domain containing protein. 
J023014C20AGCCCAGCCCAAACNONE 
J033022G03AGCCCAGCCCAAACNONE 
J065050H15AGCCCAGCCCAAACNONE 
J065059J19AGCCCAGCCCAAACNONE 
J065085I24AGCCCAGCCCAAACNONE 
J065166G12AGCCCAGCCCAAACNONE 
J065182C18AGCCCAGCCCAAACNONE 
Os01g0736100011-091-H04TTTTGGGCTTTTNONE 
015-004-D10TTTTGGGCTTTTNONE 
AK064298TTTTGGGCTTTTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK099365TTTTGGGCTTTTNONE 
AK103355TTTTGGGCTTTTNONE 
J033044B20TTTTGGGCTTTTNONE 
J033094G06TTTTGGGCTTTTNONE 
J033111N02TTTTGGGCTTTTNONE 
J033111P10TTTTGGGCTTTTNONE 
J033126K03TTTTGGGCTTTTNONE 
J043034D12TTTTGGGCTTTTNONE 
Os01g0736900AK062151GTTTGGGCTNONE 
AK065226GTTTGGGCTNONE 
AK121245GTTTGGGCTReticulon family protein. 
J013070F01GTTTGGGCTNONE 
J013156J22GTTTGGGCTNONE 
J023067B03GTTTGGGCTNONE 
J023082O14GTTTGGGCTNONE 
J023087F01GTTTGGGCTNONE 
J023099G09GTTTGGGCTNONE 
J023147M08GTTTGGGCTNONE 
J033028C13GTTTGGGCTNONE 
J033060K07GTTTGGGCTNONE 
J033140C08GTTTGGGCTNONE 
J033142C08GTTTGGGCTNONE 
J043005M06GTTTGGGCTNONE 
J043010C19GTTTGGGCTNONE 
J043030H20GTTTGGGCTNONE 
J065006K03GTTTGGGCTNONE 
J065056E13GTTTGGGCTNONE 
J065067O06GTTTGGGCTNONE 
J065117P05GTTTGGGCTNONE 
J065169I07GTTTGGGCTNONE 
J080304L01GTTTGGGCTNONE 
J080319G10GTTTGGGCTNONE 
J090002N09GTTTGGGCTNONE 
J090008E16GTTTGGGCTNONE 
J090010L14GTTTGGGCTNONE 
J090033C23GTTTGGGCTNONE 
J090038D19GTTTGGGCTNONE 
J090051E24GTTTGGGCTNONE 
J090051H09GTTTGGGCTNONE 
J090058A20GTTTGGGCTNONE 
J090058B16GTTTGGGCTNONE 
J090081I15GTTTGGGCTNONE 
J090083P18GTTTGGGCTNONE 
J090089J07GTTTGGGCTNONE 
J090096D13GTTTGGGCTNONE 
J100036N19GTTTGGGCTNONE 
J100043M11GTTTGGGCTNONE 
J100046C12GTTTGGGCTNONE 
J100072C01GTTTGGGCTNONE 
J100088P11GTTTGGGCTNONE 
Os01g0798800016-068-H08TTTGGGCTTTNONE 
AK064257TTTGGGCTTTProtein of unknown function DUF594 family protein. 
Os01g0805400AK105954ATTTGGGCTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os01g0810000AK102143GTTTGGGCTGGGCTGCNONE 
AK120752GTTTGGGCTGGGCTGCUtp11 family protein. 
J023006E09GTTTGGGCTGGGCTGCNONE 
J033086A13GTTTGGGCTGGGCTGCNONE 
J033133K07GTTTGGGCTGGGCTGCNONE 
J065066L16GTTTGGGCTGGGCTGCNONE 
J065161C01GTTTGGGCTGGGCTGCNONE 
J100027D18GTTTGGGCTGGGCTGCNONE 
J100063J12GTTTGGGCTGGGCTGCNONE 
Os01g0813400006-025-B06CATCCACCAGCCCAAANONE 
006-030-C07CATCCACCAGCCCAAANONE 
006-068-F06CATCCACCAGCCCAAANONE 
006-096-E09CATCCACCAGCCCAAANONE 
006-097-B11CATCCACCAGCCCAAANONE 
006-104-H02CATCCACCAGCCCAAANONE 
AK062251CATCCACCAGCCCAAANONE 
AK065370CATCCACCAGCCCAAASimilar to ADP-ribosylation factor 1. 
J013022G24CATCCACCAGCCCAAANONE 
J013104C07CATCCACCAGCCCAAANONE 
J023074M17CATCCACCAGCCCAAANONE 
J043027C07CATCCACCAGCCCAAANONE 
J065026K05CATCCACCAGCCCAAANONE 
J065103I01CATCCACCAGCCCAAANONE 
J090025M17CATCCACCAGCCCAAANONE 
J100027L03CATCCACCAGCCCAAANONE 
J100054I20CATCCACCAGCCCAAANONE 
Os01g0827400AK108526ATTTGGGCTPrenylated rab acceptor PRA1 family protein. 
J065099C03ATTTGGGCTNONE 
J075090E23ATTTGGGCTNONE 
Os01g0829400AK109566AAAAGCCCAAAAGlutaredoxin domain containing protein. 
Os01g0832200004-009-E08ATTTGGGCTGGNONE 
009-103-F06ATTTGGGCTGGNONE 
AK060017ATTTGGGCTGGNONE 
AK068980ATTTGGGCTGGConserved hypothetical protein. 
J023085I24ATTTGGGCTGGNONE 
J090016I03ATTTGGGCTGGNONE 
J090078K06ATTTGGGCTGGNONE 
Os01g0836400AK073540TTTTGGGCTSAC3/GANP family protein. 
J023019D11TTTTGGGCTNONE 
J023139O22TTTTGGGCTNONE 
J033042J20TTTTGGGCTNONE 
J033046M18TTTTGGGCTNONE 
J033124J09TTTTGGGCTNONE 
J090015E05TTTTGGGCTNONE 
J090076J09TTTTGGGCTNONE 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0850900009-089-D11AAAGCCCAAANONE 
AK063822AAAGCCCAAANONE 
AK102887AAAGCCCAAASOUL heme-binding protein family protein. 
J033112K22AAAGCCCAAANONE 
J065087B10AAAGCCCAAANONE 
J065100A05AAAGCCCAAANONE 
J075077M10AAAGCCCAAANONE 
Os01g0867900AK061366CCAGCCCAAACProtein of unknown function DUF502 family protein. 
Os01g0869600AK060596TTTGGGCTGGGGCCCACATGTCAGTGTRAM, LAG1 and CLN8 homology domain containing protein. 
AK070678TTTGGGCTGGGGCCCACATGTCAGTGNONE 
Os01g0894700009-177-F04AGCCCAAAGGCCCATTTNONE 
AK067623AGCCCAAAGGCCCATTTConserved hypothetical protein. 
AK104876AGCCCAAAGGCCCATTTNONE 
J013095G01AGCCCAAAGGCCCATTTNONE 
J013108L20AGCCCAAAGGCCCATTTNONE 
J013120P13AGCCCAAAGGCCCATTTNONE 
Os01g0908800AK065889ATTTGGGCTProtein prenyltransferase domain containing protein. 
Os01g0915800AK103859AAAGCCCAAAASimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20AAAGCCCAAAANONE 
J090056H03AAAGCCCAAAANONE 
J090058L14AAAGCCCAAAANONE 
J090058P16AAAGCCCAAAANONE 
J090076C19AAAGCCCAAAANONE 
J100086P14AAAGCCCAAAANONE 
Os02g0120000AK067383GTGGTGGGCCTATTTGGGCTGAProtein prenyltransferase domain containing protein. 
AK101590GTGGTGGGCCTATTTGGGCTGANONE 
J013100B15GTGGTGGGCCTATTTGGGCTGANONE 
Os02g0136800011-089-E11AGCCCAAACNONE 
AK070727AGCCCAAACNONE 
AK103485AGCCCAAACProtein of unknown function DUF1677, Oryza sativa family protein. 
J023058D10AGCCCAAACNONE 
J033140H14AGCCCAAACNONE 
J033142H14AGCCCAAACNONE 
J065151O09AGCCCAAACNONE 
J090076K09AGCCCAAACNONE 
J090085K04AGCCCAAACNONE 
Os02g0138200AK062066ATTTGGGCTNONE 
AK068239ATTTGGGCTNONE 
J013147K19ATTTGGGCTNONE 
Os02g0174100006-035-F12AGCCCAAAANONE 
AK061484AGCCCAAAANONE 
AK062651AGCCCAAAANONE 
AK066057AGCCCAAAASBP domain containing protein. 
AK068702AGCCCAAAANONE 
J075009H13AGCCCAAAANONE 
J075031O22AGCCCAAAANONE 
J075128E09AGCCCAAAANONE 
Os02g0184200J075194A02TTTGGGCTGGNONE 
Os02g0196600AK100988AGCCCAAATATPase, P-type, K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter family protein. 
Os02g0198600005-012-D12TTTTGGGCTTGNONE 
AK058299TTTTGGGCTTGNONE 
Os02g0209900Os02g0209900AAAGCCCAAAASyntaxin/epimorphin family protein. 
Os02g0235600009-009-H04ATTTGGGCTTTTGGCCCATTTNONE 
009-165-G06ATTTGGGCTTTTGGCCCATTTNONE 
AK120417ATTTGGGCTTTTGGCCCATTTSimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14ATTTGGGCTTTTGGCCCATTTNONE 
J023106P11ATTTGGGCTTTTGGCCCATTTNONE 
J033080L09ATTTGGGCTTTTGGCCCATTTNONE 
J033123O05ATTTGGGCTTTTGGCCCATTTNONE 
J065197A18ATTTGGGCTTTTGGCCCATTTNONE 
J065216P16ATTTGGGCTTTTGGCCCATTTNONE 
J075017F02ATTTGGGCTTTTGGCCCATTTNONE 
J075025L16ATTTGGGCTTTTGGCCCATTTNONE 
J075027P04ATTTGGGCTTTTGGCCCATTTNONE 
J075039N01ATTTGGGCTTTTGGCCCATTTNONE 
J075101F24ATTTGGGCTTTTGGCCCATTTNONE 
J075132J15ATTTGGGCTTTTGGCCCATTTNONE 
J075164K16ATTTGGGCTTTTGGCCCATTTNONE 
J075174E19ATTTGGGCTTTTGGCCCATTTNONE 
J100043C23ATTTGGGCTTTTGGCCCATTTNONE 
J100067B11ATTTGGGCTTTTGGCCCATTTNONE 
Os02g0468200AK103767CCAGGCCCATCAAAGCCCAAATProtein of unknown function DUF652 family protein. 
J033071N12CCAGGCCCATCAAAGCCCAAATNONE 
J033143I02CCAGGCCCATCAAAGCCCAAATNONE 
J100019J22CCAGGCCCATCAAAGCCCAAATNONE 
J100075O13CCAGGCCCATCAAAGCCCAAATNONE 
Os02g0510200AK058963ATTTGGGCTGCNONE 
Os02g0517333AK105573TCAGCCCAAAANONE 
AK111331TCAGCCCAAAAConserved hypothetical protein. 
Os02g0525400011-008-B01TAGGCCCACAGCCCAAACNONE 
AK065368TAGGCCCACAGCCCAAACSimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
J013021B13TAGGCCCACAGCCCAAACNONE 
J033046H10TAGGCCCACAGCCCAAACNONE 
Os02g0618700AK070657GCCCAGCCCAAATLung seven transmembrane receptor family protein. 
J023056H15GCCCAGCCCAAATNONE 
Os02g0627100AK068993AGCCCAAAASimilar to Phenylalanine ammonia-lyase (EC 4.3.1.5). 
D21290AGCCCAAAANONE 
J023001A06AGCCCAAAANONE 
J065156K20AGCCCAAAANONE 
J065187O09AGCCCAAAANONE 
J100036D20AGCCCAAAANONE 
J100089I01AGCCCAAAANONE 
Os02g0629900AK108563AGCCCAAAAACGGCCCConserved hypothetical protein. 
J065138O07AGCCCAAAAACGGCCCNONE 
Os02g0650300012-029-A05AGCCCAAANONE 
AK063464AGCCCAAAOligopeptide transporter OPT superfamily protein. 
Os02g0700100AK102954TTTTGGGCTGCSimilar to WD-repeat protein. 
Os02g0705300006-028-G05GCCCAAAATTTGGGCTNONE 
006-064-H09GCCCAAAATTTGGGCTNONE 
AK062089GCCCAAAATTTGGGCTNONE 
AK064855GCCCAAAATTTGGGCTNONE 
AK106164GCCCAAAATTTGGGCTTubby family protein. 
Os02g0708300009-007-C06TTTGGGCTTTTNONE 
009-162-G06TTTGGGCTTTTNONE 
014-048-F12TTTGGGCTTTTNONE 
AK066348TTTGGGCTTTTConserved hypothetical protein. 
J013059F24TTTGGGCTTTTNONE 
J023104H14TTTGGGCTTTTNONE 
J053052O22TTTGGGCTTTTNONE 
J053063A05TTTGGGCTTTTNONE 
J053093P09TTTGGGCTTTTNONE 
J065012F24TTTGGGCTTTTNONE 
J065063P09TTTGGGCTTTTNONE 
J065088F12TTTGGGCTTTTNONE 
J065094I11TTTGGGCTTTTNONE 
J065099H19TTTGGGCTTTTNONE 
J065116H07TTTGGGCTTTTNONE 
J065137N07TTTGGGCTTTTNONE 
J065137N11TTTGGGCTTTTNONE 
J065159L22TTTGGGCTTTTNONE 
J065159P11TTTGGGCTTTTNONE 
J065178F17TTTGGGCTTTTNONE 
J065181E07TTTGGGCTTTTNONE 
J075014L16TTTGGGCTTTTNONE 
J075030P11TTTGGGCTTTTNONE 
J075042K24TTTGGGCTTTTNONE 
J075077I15TTTGGGCTTTTNONE 
J075087P06TTTGGGCTTTTNONE 
J075089F20TTTGGGCTTTTNONE 
J075093B07TTTGGGCTTTTNONE 
J075115J23TTTGGGCTTTTNONE 
J075176O19TTTGGGCTTTTNONE 
J075178A04TTTGGGCTTTTNONE 
J075178J02TTTGGGCTTTTNONE 
J090027L02TTTGGGCTTTTNONE 
J100033M12TTTGGGCTTTTNONE 
J100065O08TTTGGGCTTTTNONE 
Os02g0720600006-086-D09ATTTGGGCTGTNONE 
AK101967ATTTGGGCTGTPeptidase A1, pepsin family protein. 
AK105989ATTTGGGCTGTNONE 
J023073N17ATTTGGGCTGTNONE 
J033076I21ATTTGGGCTGTNONE 
J065057O13ATTTGGGCTGTNONE 
J065101I01ATTTGGGCTGTNONE 
J065102J23ATTTGGGCTGTNONE 
J065122L12ATTTGGGCTGTNONE 
J065132N22ATTTGGGCTGTNONE 
J065167A04ATTTGGGCTGTNONE 
J065168G11ATTTGGGCTGTNONE 
J065188C07ATTTGGGCTGTNONE 
J100018E15ATTTGGGCTGTNONE 
J100035L14ATTTGGGCTGTNONE 
J100041M01ATTTGGGCTGTNONE 
J100056J07ATTTGGGCTGTNONE 
J100065J09ATTTGGGCTGTNONE 
J100072E07ATTTGGGCTGTNONE 
J100081G12ATTTGGGCTGTNONE 
J100083G22ATTTGGGCTGTNONE 
J100085E19ATTTGGGCTGTNONE 
J100090P18ATTTGGGCTGTNONE 
Os02g0732900AK065796TTTGGGCTProtein of unknown function DUF794, plant family protein. 
AK104342TTTGGGCTNONE 
Os02g0744000AK064898CCAAGCCCAAAAConserved hypothetical protein. 
AK104827CCAAGCCCAAAANONE 
J013000L12CCAAGCCCAAAANONE 
J013156N02CCAAGCCCAAAANONE 
J065001H14CCAAGCCCAAAANONE 
J065038D18CCAAGCCCAAAANONE 
J065039I18CCAAGCCCAAAANONE 
J065047C13CCAAGCCCAAAANONE 
J065053J09CCAAGCCCAAAANONE 
J065064G03CCAAGCCCAAAANONE 
J065066M05CCAAGCCCAAAANONE 
J065068O10CCAAGCCCAAAANONE 
J065090H22CCAAGCCCAAAANONE 
J065113L19CCAAGCCCAAAANONE 
J065121M02CCAAGCCCAAAANONE 
J065122K23CCAAGCCCAAAANONE 
J065138C12CCAAGCCCAAAANONE 
J065153E14CCAAGCCCAAAANONE 
J065156N12CCAAGCCCAAAANONE 
J065158L20CCAAGCCCAAAANONE 
J065166I06CCAAGCCCAAAANONE 
J065174L15CCAAGCCCAAAANONE 
J065175N03CCAAGCCCAAAANONE 
J090092C23CCAAGCCCAAAANONE 
Os02g0759800012-036-G11TCGGCCCAGCCCAAATNONE 
AK067153TCGGCCCAGCCCAAATSimilar to GAMYB-binding protein (Fragment). 
AK071666TCGGCCCAGCCCAAATNONE 
J013098N03TCGGCCCAGCCCAAATNONE 
J023100L02TCGGCCCAGCCCAAATNONE 
J023106G20TCGGCCCAGCCCAAATNONE 
J033057G09TCGGCCCAGCCCAAATNONE 
J100043H19TCGGCCCAGCCCAAATNONE 
J100061H16TCGGCCCAGCCCAAATNONE 
J100079O17TCGGCCCAGCCCAAATNONE 
Os02g0762300AK106684TCAGCCCAAATProtein of unknown function UPF0021 family protein. 
AK106684TTTGGGCTProtein of unknown function UPF0021 family protein. 
J090060M09TCAGCCCAAATNONE 
J090060M09TTTGGGCTNONE 
J100083E05TCAGCCCAAATNONE 
J100083E05TTTGGGCTNONE 
Os02g0769800009-140-D12TTTTGGGCTTGNONE 
AK062956TTTTGGGCTTGSimilar to Mitogen-activated protein kinase kinase kinase 1 (EC 2.7.1.-) (Arabidospsis NPK1-related protein kinase 1). Splice isoform 1S. 
Os02g0770000006-065-A12AGCCCAAAANONE 
AB026563AGCCCAAAANONE 
AK059837AGCCCAAAANONE 
AK103425AGCCCAAAABeta 1 subunit of 20S proteasome. 
AK104505AGCCCAAAANONE 
J023150K14AGCCCAAAANONE 
J033128K18AGCCCAAAANONE 
J043022N12AGCCCAAAANONE 
J065007E07AGCCCAAAANONE 
J065029G17AGCCCAAAANONE 
J065137H11AGCCCAAAANONE 
J065138C23AGCCCAAAANONE 
J065187H11AGCCCAAAANONE 
J065203L18AGCCCAAAANONE 
J090041B22AGCCCAAAANONE 
Os02g0782500013-043-A07ATTTGGGCTTTNONE 
013-068-B10ATTTGGGCTTTNONE 
013-093-A08ATTTGGGCTTTNONE 
014-083-C12ATTTGGGCTTTNONE 
AK063602ATTTGGGCTTTNONE 
AK119261ATTTGGGCTTTSimilar to Small heat stress protein class CIII. 
J065013N12ATTTGGGCTTTNONE 
J075136E01ATTTGGGCTTTNONE 
J075149G04ATTTGGGCTTTNONE 
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein. 
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE 
Os02g0830100J013032G02TAAGCCCAAAANONE 
J013052O21TAAGCCCAAAANONE 
J023078A05TAAGCCCAAAANONE 
J033114C07TAAGCCCAAAANONE 
J033125M07TAAGCCCAAAANONE 
J053045C11TAAGCCCAAAANONE 
J100055G05TAAGCCCAAAANONE 
J100080J22TAAGCCCAAAANONE 
Os02g0832700AK099439TGTTGGGCCTTTGGGCTTCSimilar to Metal tolerance protein C2 (AtMTPc2). 
Os03g0108600AK065776CAAGCCCAAACDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013038N14CAAGCCCAAACNONE 
Os03g0111800AK121627AAAGCCCAAAGCCCAAGWD40-like domain containing protein. 
Os03g0116500AF106844TAGGCCCATGAAAGCCCAAACNONE 
AK101870TAGGCCCATGAAAGCCCAAACConstitutive photomorphogenic 11. 
J023055L16TAGGCCCATGAAAGCCCAAACNONE 
J023088I16TAGGCCCATGAAAGCCCAAACNONE 
J033070E21TAGGCCCATGAAAGCCCAAACNONE 
J065124N22TAGGCCCATGAAAGCCCAAACNONE 
J075152A19TAGGCCCATGAAAGCCCAAACNONE 
J075181J21TAGGCCCATGAAAGCCCAAACNONE 
J090011F23TAGGCCCATGAAAGCCCAAACNONE 
Os03g0124300AK069148ACAGCCCAAACConserved hypothetical protein. 
AK106076ACAGCCCAAACNONE 
J023003G19ACAGCCCAAACNONE 
Os03g0148000AK110468ATTTGGGCTTCProtein of unknown function DUF677 family protein. 
Os03g0148400AK072852GAAGCCCAAAProtein of unknown function DUF740 family protein. 
J023138H13GAAGCCCAAANONE 
Os03g0151900009-084-F09AGCCCAAATNONE 
AB032761AGCCCAAATNONE 
AK105389AGCCCAAATNONE 
AK121527AGCCCAAATSimilar to Small GTP-binding protein. 
J075028M03AGCCCAAATNONE 
J075031H15AGCCCAAATNONE 
J075045L24AGCCCAAATNONE 
J075055K14AGCCCAAATNONE 
J075100O08AGCCCAAATNONE 
J075112B20AGCCCAAATNONE 
J075188D21AGCCCAAATNONE 
Os03g0152100AY224589TTTGGGCTE2F dimerization factor. 
J075118G09TTTGGGCTNONE 
J075172D06TTTGGGCTNONE 
J075175O16TTTGGGCTNONE 
Os03g0159100AK065635AAAAGCCCAAAASimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
Os03g0167600AK121254TAAGCCCAAAASimilar to Male sterility protein 2. 
Os03g0174300AK067994TTTTGGGCTExostosin-like family protein. 
Os03g0181400012-051-B05AGCCCAAACNONE 
015-065-E09AGCCCAAACNONE 
AK064006AGCCCAAACProtein of unknown function DUF860, plant family protein. 
Os03g0185700AK108939AGCCCAAAATransferase family protein. 
J100089D02AGCCCAAAANONE 
Os03g0259600AK108532AGCCCAAAUbiquitin domain containing protein. 
J065064G04AGCCCAAANONE 
J065116I06AGCCCAAANONE 
J065165C14AGCCCAAANONE 
J075173K24AGCCCAAANONE 
Os03g0262400014-013-D09AAAAGCCCAAAAGGCCGAAANONE 
AK059989AAAAGCCCAAAAGGCCGAAASimilar to Eukaryotic translation initiation factor 4E type 3 (eIF4E type 3) (eIF-4E type 3) (mRNA cap-binding protein type 3) (Novel cap-binding protein) (nCBP). 
J023036I18AAAAGCCCAAAAGGCCGAAANONE 
J033025J23AAAAGCCCAAAAGGCCGAAANONE 
J065047G10AAAAGCCCAAAAGGCCGAAANONE 
J065153H03AAAAGCCCAAAAGGCCGAAANONE 
J065155J08AAAAGCCCAAAAGGCCGAAANONE 
J075025C05AAAAGCCCAAAAGGCCGAAANONE 
Os03g0263500006-112-E09GTTTGGGCTGANONE 
009-122-C01GTTTGGGCTGANONE 
AK106060GTTTGGGCTGASimilar to Splicing factor 3A subunit 2 (Spliceosome associated protein 62) (SAP 62) (SF3a66). 
Os03g0288400Os03g0288400GAAGCCCAAACConserved hypothetical protein. 
Os03g0300600003-125-G06AGCCCAAATNONE 
006-048-C04AGCCCAAATNONE 
009-044-A09AGCCCAAATNONE 
AK059801AGCCCAAATNONE 
AK066250AGCCCAAATSimilar to Chaperone protein dnaJ. 
AK069897AGCCCAAATNONE 
AK104186AGCCCAAATNONE 
J065197D15AGCCCAAATNONE 
J090031C11AGCCCAAATNONE 
J100024C23AGCCCAAATNONE 
J100030B16AGCCCAAATNONE 
J100033K12AGCCCAAATNONE 
J100043M19AGCCCAAATNONE 
J100056N09AGCCCAAATNONE 
J100058E12AGCCCAAATNONE 
J100084J08AGCCCAAATNONE 
Os03g0306800AK103722AGCCCAAASimilar to CP12 (Fragment). 
J065066F15AGCCCAAANONE 
J065166I10AGCCCAAANONE 
J075018L02AGCCCAAANONE 
J075122B12AGCCCAAANONE 
J075152C16AGCCCAAANONE 
J075178L24AGCCCAAANONE 
J090045H23AGCCCAAANONE 
Os03g0331900AK063044ATTTGGGCTTGNONE 
AK099570ATTTGGGCTTGConserved hypothetical protein. 
J065064G01ATTTGGGCTTGNONE 
Os03g0335100AK107094CCAGCCCAAATConserved hypothetical protein. 
Os03g0372700AK064323TTTTGGGCTGGNONE 
AK073312TTTTGGGCTGGLow temperature viability protein family protein. 
Os03g0383100AK107106TCAGCCCAAAAConserved hypothetical protein. 
Os03g0395000AK073283CCAAGCCCAAAASimilar to Heme oxygenase 2 (Fragment). 
Os03g0628900009-062-G01TTTTGGGCTGGGCTNONE 
AK103619TTTTGGGCTGGGCTPrefoldin domain containing protein. 
J033133L23TTTTGGGCTGGGCTNONE 
J100039C17TTTTGGGCTGGGCTNONE 
J100048I07TTTTGGGCTGGGCTNONE 
J100062E19TTTTGGGCTGGGCTNONE 
J100063B11TTTTGGGCTGGGCTNONE 
Os03g0689300AK068765CCCAGCCCAAAAPlasma membrane H+ ATPase (EC 3.6.3.6) (H-ATPase). 
AK100996CCCAGCCCAAAANONE 
D10207CCCAGCCCAAAANONE 
J013162E15CCCAGCCCAAAANONE 
J033116I16CCCAGCCCAAAANONE 
J043027N09CCCAGCCCAAAANONE 
J075112N21CCCAGCCCAAAANONE 
J090035D23CCCAGCCCAAAANONE 
J090095G13CCCAGCCCAAAANONE 
Os03g0708600AK069199CAAGCCCAAACDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069658CAAGCCCAAACNONE 
J023008E04CAAGCCCAAACNONE 
J023030D22CAAGCCCAAACNONE 
J033027E16CAAGCCCAAACNONE 
J033046D09CAAGCCCAAACNONE 
J033068I10CAAGCCCAAACNONE 
J033135A12CAAGCCCAAACNONE 
J065027E22CAAGCCCAAACNONE 
J065191K23CAAGCCCAAACNONE 
J090054D15CAAGCCCAAACNONE 
J090058J15CAAGCCCAAACNONE 
Os03g0712600015-008-G03TCAGCCCAAAANONE 
AK103705TCAGCCCAAAAHypothetical protein. 
J033136N14TCAGCCCAAAANONE 
Os03g0719500AK106321AGCCCAAACNONE 
Os03g0732100Os03g0732100GTTTGGGCTSimilar to Homeodomain protein JUBEL1. 
Os03g0736700006-022-F08AAAGCCCAAAANONE 
006-042-H09AAAGCCCAAAANONE 
006-053-H02AAAGCCCAAAANONE 
009-127-A06AAAGCCCAAAANONE 
013-089-C06AAAGCCCAAAANONE 
AK060947AAAGCCCAAAAGRAM domain containing protein. 
AK073026AAAGCCCAAAANONE 
AK104415AAAGCCCAAAANONE 
AK104642AAAGCCCAAAANONE 
J065027H19AAAGCCCAAAANONE 
J065059K06AAAGCCCAAAANONE 
J065065I02AAAGCCCAAAANONE 
J065085E10AAAGCCCAAAANONE 
J065140M09AAAGCCCAAAANONE 
J075115M21AAAGCCCAAAANONE 
Os03g0744700AK071178GAAGCCCAAACConserved hypothetical protein. 
J075006D24GAAGCCCAAACNONE 
J075165F21GAAGCCCAAACNONE 
Os03g0744800AK059983TCTCGGCCCAGCCCAAATemp24/gp25L/p24 family protein. 
J065067D01TCTCGGCCCAGCCCAAATNONE 
J065122L19TCTCGGCCCAGCCCAAATNONE 
J090041I03TCTCGGCCCAGCCCAAATNONE 
J100039H03TCTCGGCCCAGCCCAAATNONE 
Os03g0758700AK106620AGCCCAAACWD40-like domain containing protein. 
Os03g0803800012-043-D10AGCCCAAACNONE 
AK063484AGCCCAAACConserved hypothetical protein. 
Os03g0819300AK072873AGCCCAAAASimilar to Annexin A7 (Annexin VII) (Synexin) (Fragment). 
J023027N16AGCCCAAAANONE 
J023105J17AGCCCAAAANONE 
J023145D16AGCCCAAAANONE 
J023149I08AGCCCAAAANONE 
Os03g0861300AK109024TTTGGGCTTTSimilar to Aquaporin. 
Os04g0117200AK107523TCAGCCCAAASpectrin repeat containing protein. 
Os04g0196600AK121999ACAGCCCAAAProtein of unknown function DUF563 family protein. 
Os04g0259200AK119366CGGGCCCAGCCCAAATHypothetical protein. 
Os04g0316200AK110725GCAGCCCAAAAProtein of unknown function DUF26 domain containing protein. 
AY576676GCAGCCCAAAANONE 
J100043J22GCAGCCCAAAANONE 
J100049F15GCAGCCCAAAANONE 
J100081M23GCAGCCCAAAANONE 
Os04g0322100J075093H10GCAGCCCAAAAProtein of unknown function DUF26 domain containing protein. 
J100044L06GCAGCCCAAAANONE 
J100048J12GCAGCCCAAAANONE 
J100073D10GCAGCCCAAAANONE 
Os04g0481100AK119297ATTTGGGCTTGNONE 
Os04g0483200AK069389AGCCCAAAASteroid nuclear receptor, ligand-binding domain containing protein. 
AK121909AGCCCAAAANONE 
J043031E24AGCCCAAAANONE 
J043032N20AGCCCAAAANONE 
J090078C11AGCCCAAAANONE 
Os04g0496600AK065058AGCCCAAAConserved hypothetical protein. 
AK065058TTTGGGCTGTConserved hypothetical protein. 
J013001J09AGCCCAAANONE 
J013001J09TTTGGGCTGTNONE 
J013037C18AGCCCAAANONE 
J013037C18TTTGGGCTGTNONE 
J013126H05AGCCCAAANONE 
J013126H05TTTGGGCTGTNONE 
J090062G17AGCCCAAANONE 
J090062G17TTTGGGCTGTNONE 
Os04g0531300016-006-E10ACAGCCCAAATNONE 
AK072647ACAGCCCAAATDihydrouridine synthase, DuS family protein. 
AK103911ACAGCCCAAATNONE 
J013038P22ACAGCCCAAATNONE 
J023130D01ACAGCCCAAATNONE 
J033150P13ACAGCCCAAATNONE 
J043026L14ACAGCCCAAATNONE 
J065049A08ACAGCCCAAATNONE 
J065215C17ACAGCCCAAATNONE 
Os04g0543900012-032-H05AGCCCAAANONE 
AK063467AGCCCAAASimilar to Glutamate dehydrogenase (EC 1.4.1.3) (GDH). 
J053047F04AGCCCAAANONE 
J065009D12AGCCCAAANONE 
J065056A19AGCCCAAANONE 
J090048F06AGCCCAAANONE 
J090066D14AGCCCAAANONE 
J090081G17AGCCCAAANONE 
Os04g0555900009-154-G03AGCCCAAACNONE 
AK063168AGCCCAAACPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
J065012D11AGCCCAAACNONE 
Os04g0566900AK072344AAAGCCCAAACConserved hypothetical protein. 
Os04g0581000AK061337TTTTGGGCTTTSimilar to Flavanone 3-hydroxylase-like protein. 
AK104142TTTTGGGCTTTNONE 
Os04g0607200J065082C16AGCCCAAAANONE 
J065167I02AGCCCAAAANONE 
Os04g0609200AK103652ATTTGGGCTMajor facilitator superfamily protein. 
Os04g0611300009-006-G08TTTTGGGCTNONE 
009-011-C01TTTTGGGCTNONE 
009-036-B09TTTTGGGCTNONE 
009-116-G09TTTTGGGCTNONE 
009-126-E09TTTTGGGCTNONE 
009-132-F09TTTTGGGCTNONE 
009-151-G07TTTTGGGCTNONE 
009-155-C07TTTTGGGCTNONE 
009-163-G01TTTTGGGCTNONE 
009-169-G08TTTTGGGCTNONE 
009-191-B02TTTTGGGCTNONE 
009-196-A08TTTTGGGCTNONE 
009-198-E07TTTTGGGCTNONE 
014-015-F04TTTTGGGCTNONE 
015-087-H04TTTTGGGCTNONE 
AK062605TTTTGGGCTNONE 
AK063022TTTTGGGCTConserved hypothetical protein. 
AK066749TTTTGGGCTNONE 
AK104924TTTTGGGCTNONE 
J065002M20TTTTGGGCTNONE 
J065045L23TTTTGGGCTNONE 
J065101E05TTTTGGGCTNONE 
J065140J23TTTTGGGCTNONE 
J065179G11TTTTGGGCTNONE 
J065191B18TTTTGGGCTNONE 
J065192E03TTTTGGGCTNONE 
J065199H21TTTTGGGCTNONE 
J075067F01TTTTGGGCTNONE 
J075089L01TTTTGGGCTNONE 
J075147K22TTTTGGGCTNONE 
J080069G23TTTTGGGCTNONE 
J100053D10TTTTGGGCTNONE 
J100078C10TTTTGGGCTNONE 
Os04g0635700009-079-G03TTTTGGGCTNONE 
AK062025TTTTGGGCTRibbon-helix-helix domain containing protein. 
AK098916TTTTGGGCTNONE 
J013002J07TTTTGGGCTNONE 
J013109L20TTTTGGGCTNONE 
J023055C07TTTTGGGCTNONE 
J065036K04TTTTGGGCTNONE 
J065164G12TTTTGGGCTNONE 
Os04g0638800AK070319TTTGGGCTGAProtein of unknown function DUF617, plant family protein. 
AK071753TTTGGGCTGANONE 
Os04g0645100AK100454AGCCCAAATNONE 
J075047L12AGCCCAAATNONE 
J075095P06AGCCCAAATNONE 
J090024C03AGCCCAAATNONE 
J090054E23AGCCCAAATNONE 
Os04g0658300AK067399AAAGCCCAAAASimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
AK067399GTTTGGGCTSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os05g0100500AK071466GCAGCCCAAAAAGCCCAAGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0105300AK069395CCAGCCCACAGCCCAAAACAP-Gly domain containing protein. 
Os05g0106100009-186-E05TTTGGGCTGTNONE 
013-067-H01TTTGGGCTGTNONE 
AK063178TTTGGGCTGTSimilar to Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14) (V- ATPase 16 kDa proteolipid subunit) (Fragment). 
J065010J15TTTGGGCTGTNONE 
J065073M24TTTGGGCTGTNONE 
J065077A22TTTGGGCTGTNONE 
J065167I04TTTGGGCTGTNONE 
J075084F11TTTGGGCTGTNONE 
J075086M18TTTGGGCTGTNONE 
Os05g0123400AK069521CCAGCCCAAACConserved hypothetical protein. 
J023022O05CCAGCCCAAACNONE 
Os05g0170800AK068085TAAGCCCAAACUvrB/UvrC protein domain containing protein. 
J100063G14TAAGCCCAAACNONE 
Os05g0178100AK120915CAAGCCCAAATGA 3beta-hydroxylase. 
Os05g0194600AK102487TTTTGGGCTTAAGGGCCCAATTPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01TTTTGGGCTTAAGGGCCCAATTNONE 
J100041A08TTTTGGGCTTAAGGGCCCAATTNONE 
Os05g0224800AK111685GAAGCCCAAATSimilar to Modification methyltransferase, cytosine-specific. 
J013170M08GAAGCCCAAATNONE 
Os05g0295900AK069962TAGGCCCATTAGCCCAAACConserved hypothetical protein. 
Os05g0388500AK065313AGCCCAAATSimilar to 50S ribosomal protein L1. 
AK098990AGCCCAAATNONE 
AK104689AGCCCAAATNONE 
J013094L23AGCCCAAATNONE 
J065118O04AGCCCAAATNONE 
Os05g0412900006-037-H10AGCCCAAAANONE 
AK061020AGCCCAAAAConserved hypothetical protein. 
Os05g0414300AK120513TTTTGGGCTTGDisease resistance protein family protein. 
AK120791TTTTGGGCTTGNONE 
Os05g0437300AK102760AGCCCAAAAHnRNP-L/PTB/hephaestus splicing factor family protein. 
Os05g0451200AK073037AGCCCAAAConserved hypothetical protein. 
Os05g0459300009-006-D08ATTTGGGCTTCNONE 
AK062312ATTTGGGCTTCNONE 
AK119604ATTTGGGCTTCNONE 
AK121463ATTTGGGCTTCConserved hypothetical protein. 
J023145E12ATTTGGGCTTCNONE 
Os05g0480700AK100850AGCCCAAATSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11AGCCCAAATNONE 
Os05g0490900AK111382TTCGGCCCAGCCCAAAConserved hypothetical protein. 
Os05g0506900AK106697TAAGCCCAAAABrix domain containing protein. 
Os05g0553000015-052-H09ACAGCCCAAAANONE 
AK061681ACAGCCCAAAAATP synthase beta chain, mitochondrial precursor (EC 3.6.3.14). 
AK071143ACAGCCCAAAANONE 
J013068H04ACAGCCCAAAANONE 
J013124C06ACAGCCCAAAANONE 
J033127N11ACAGCCCAAAANONE 
J100056O04ACAGCCCAAAANONE 
Os05g0553700006-100-D08AAAGCCCAAATNONE 
AK099747AAAGCCCAAATNONE 
AK101606AAAGCCCAAATNONE 
AK103396AAAGCCCAAATSimilar to Syntaxin 71 (AtSYP71). 
J033022M23AAAGCCCAAATNONE 
J090086G01AAAGCCCAAATNONE 
Os05g0559900AK067197GCAGCCCAAATtRNA-binding arm domain containing protein. 
J013074C15GCAGCCCAAATNONE 
J013098O16GCAGCCCAAATNONE 
J033030M01GCAGCCCAAATNONE 
J090058H12GCAGCCCAAATNONE 
J090075M06GCAGCCCAAATNONE 
Os05g0561500006-066-D12ATTTGGGCTAGGCCCAGGNONE 
AK061788ATTTGGGCTAGGCCCAGGSimilar to CMP-KDO synthetase (EC 2.7.7.38) (Fragment). 
AK098862ATTTGGGCTAGGCCCAGGNONE 
J013000O09ATTTGGGCTAGGCCCAGGNONE 
J033145C24ATTTGGGCTAGGCCCAGGNONE 
Os05g0592400AB037144GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
AK065508GTTTGGGCTGGGCTGGGCTGGGCTGGUV-damaged DNA binding protein. 
J013069J24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013075H15GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013095H04GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013105L19GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013152P13GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J023072O05GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033024J22GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033030D07GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033041D09GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033051M16GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033126M01GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033145H24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
Os05g0592600011-064-D09GTTTGGGCTTTTNONE 
015-032-B11GTTTGGGCTTTTNONE 
AK073484GTTTGGGCTTTTInitiation factor 2 family protein. 
AK099632GTTTGGGCTTTTNONE 
Os06g0115400AK111656GAAGCCCAAAGCCCACASimilar to Superoxide dismutase [Fe], chloroplast (EC 1.15.1.1) (Fragment). 
Os06g0135340J065061D17ACAGCCCAAACNONE 
J065159A10ACAGCCCAAACConserved hypothetical protein. 
Os06g0136700AK065081AGCCCAAACSteroid nuclear receptor, ligand-binding domain containing protein. 
J013001L08AGCCCAAACNONE 
J013039I03AGCCCAAACNONE 
Os06g0139700006-052-C07AAAGCCCAAACNONE 
009-009-A08AAAGCCCAAACNONE 
015-020-D09AAAGCCCAAACNONE 
015-087-H06AAAGCCCAAACNONE 
016-078-A03AAAGCCCAAACNONE 
AK067884AAAGCCCAAACNONE 
AK103245AAAGCCCAAACConserved hypothetical protein. 
AK106116AAAGCCCAAACNONE 
AK106220AAAGCCCAAACNONE 
Os06g0147600AK107817AGCCCAAAConserved hypothetical protein. 
Os06g0157800AK121504TATTGGGCCGATTTGGGCTGTSimilar to CG7224 (Fragment). 
J033022L20TATTGGGCCGATTTGGGCTGTNONE 
J075033D09TATTGGGCCGATTTGGGCTGTNONE 
Os06g0192800AK070038ACAGCCCAAAASimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
J065057C13ACAGCCCAAAANONE 
J100067A03ACAGCCCAAAANONE 
Os06g0202400009-101-G07CAAGCCCAAAANONE 
AK062755CAAGCCCAAAAConserved hypothetical protein. 
Os06g0217700009-074-A04AGCCCAAATNONE 
AK062617AGCCCAAATConserved hypothetical protein. 
Os06g0219800011-090-C04CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
AK072030CTGGCCCATGGAGCCCATCAGCCCAAACSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3. 
AK100405CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J065063P03CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100032E17CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100081I18CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
Os06g0222900AK109820AAAAGCCCAAAASimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase 2 (EC 3.1.3.56) (At5PTase2). 
Os06g0268700AK120783AAAAGCCCAAACPeptidase A1, pepsin family protein. 
Os06g0286228AK069113AAAGCCCAAATCupredoxin domain containing protein. 
Os06g0335500AK121989TCAGCCCAAAAAUX/IAA protein family protein. 
Os06g0600100AK065619AGCCCAAATSimilar to TAT-binding protein homolog (Fragment). 
Os06g0607800012-010-G03AGCCCAAANONE 
AB070254AGCCCAAANONE 
AK063158AGCCCAAASimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695AGCCCAAANONE 
J013074G13AGCCCAAANONE 
J090015C16AGCCCAAANONE 
J090069H10AGCCCAAANONE 
Os06g0627400J075020B18AGCCCAAANONE 
J090051A21AGCCCAAAConserved hypothetical protein. 
Os06g0670100AK102577GAAGCCCAAACHypothetical protein. 
Os06g0673500J100018J12GCAGCCCAAATNONE 
J100072F13GCAGCCCAAATSimilar to Ubiquitin. 
Os06g0682800011-092-E01GTTTGGGCTTGNONE 
AK064816GTTTGGGCTTGZinc finger, CCCH-type domain containing protein. 
J013000E13GTTTGGGCTTGNONE 
J013035J22GTTTGGGCTTGNONE 
J013045M06GTTTGGGCTTGNONE 
J013120A07GTTTGGGCTTGNONE 
J033144H15GTTTGGGCTTGNONE 
J033145H15GTTTGGGCTTGNONE 
J033145N16GTTTGGGCTTGNONE 
J090019J02GTTTGGGCTTGNONE 
Os06g0694400AK065599AGCCCAAACNONE 
AK120261AGCCCAAACConserved hypothetical protein. 
J075019F13AGCCCAAACNONE 
J075121H11AGCCCAAACNONE 
J075188O15AGCCCAAACNONE 
J075194O13AGCCCAAACNONE 
J100017M20AGCCCAAACNONE 
J100026G05AGCCCAAACNONE 
J100032G09AGCCCAAACNONE 
J100044M02AGCCCAAACNONE 
J100064A07AGCCCAAACNONE 
J100066K20AGCCCAAACNONE 
J100082M20AGCCCAAACNONE 
J100084A14AGCCCAAACNONE 
Os06g0714100AK121079GAAGCCCAAATComplex 1 LYR protein family protein. 
J023062M13GAAGCCCAAATNONE 
J043020D18GAAGCCCAAATNONE 
J065073A17GAAGCCCAAATNONE 
J065158D09GAAGCCCAAATNONE 
J065195H04GAAGCCCAAATNONE 
J065214P13GAAGCCCAAATNONE 
J080079I22GAAGCCCAAATNONE 
J100031M06GAAGCCCAAATNONE 
J100036I12GAAGCCCAAATNONE 
Os07g0110100009-059-D11AAAGCCCAAAANONE 
AK071499AAAGCCCAAAAConserved hypothetical protein. 
J065064P17AAAGCCCAAAANONE 
J065111B09AAAGCCCAAAANONE 
J075099A14AAAGCCCAAAANONE 
J075139C23AAAGCCCAAAANONE 
Os07g0110800009-107-B11ATTTGGGCTTTNONE 
AK062792ATTTGGGCTTTConserved hypothetical protein. 
J053026P09ATTTGGGCTTTNONE 
J053074L17ATTTGGGCTTTNONE 
J065057E24ATTTGGGCTTTNONE 
J065149B18ATTTGGGCTTTNONE 
J075002O20ATTTGGGCTTTNONE 
J090002C13ATTTGGGCTTTNONE 
Os07g0110900AK058987AAAGCCCAAATConserved hypothetical protein. 
J065032L02AAAGCCCAAATNONE 
J065074H06AAAGCCCAAATNONE 
J065168M23AAAGCCCAAATNONE 
Os07g0113200AK108787TTTTGGGCTTTConserved hypothetical protein. 
J065090J04TTTTGGGCTTTNONE 
J065116K24TTTTGGGCTTTNONE 
J065161F14TTTTGGGCTTTNONE 
J065203E23TTTTGGGCTTTNONE 
Os07g0130500AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
Os07g0181000AK060932TCAGCCCAAATNONE 
AK066918ACAGCCCAAATNONE 
AK070512ACAGCCCAAATSimilar to Pyruvate kinase isozyme A, chloroplast precursor (EC 2.7.1.40). 
Os07g0187300AK103069AAAAGCCCAAAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12AAAAGCCCAAAANONE 
J033117P16AAAAGCCCAAAANONE 
Os07g0231500AK109283CAAGCCCAAATCyclin-like domain containing protein. 
J075001D10CAAGCCCAAATNONE 
J075088P14CAAGCCCAAATNONE 
J075115C22CAAGCCCAAATNONE 
J075199L15CAAGCCCAAATNONE 
Os07g0479200005-017-H08ACAGCCCAAANONE 
AK058326ACAGCCCAAASimilar to SL15-like (Fragment). 
J013092A08ACAGCCCAAANONE 
J033139E04ACAGCCCAAANONE 
J043016M16ACAGCCCAAANONE 
J053050O18ACAGCCCAAANONE 
J053098B03ACAGCCCAAANONE 
J065068G10ACAGCCCAAANONE 
J065091I17ACAGCCCAAANONE 
J065109A03ACAGCCCAAANONE 
J065168B17ACAGCCCAAANONE 
J065177A05ACAGCCCAAANONE 
J065180J01ACAGCCCAAANONE 
J075006F13ACAGCCCAAANONE 
J075022J03ACAGCCCAAANONE 
J075024N09ACAGCCCAAANONE 
J075114B12ACAGCCCAAANONE 
J080023M06ACAGCCCAAANONE 
J080081N24ACAGCCCAAANONE 
J090060N07ACAGCCCAAANONE 
Os07g0513200015-004-B02TTTGGGCTGANONE 
AK101410TTTGGGCTGANONE 
AK106227TTTGGGCTGANONE 
AK119451TTTGGGCTGAProtein prenyltransferase domain containing protein. 
Os07g0530400AK107269TCAGCCCAAAConserved hypothetical protein. 
Os07g0549200006-072-D03AGCCCAAACNONE 
AK073657AGCCCAAACNONE 
AK109365AGCCCAAACProtein prenyltransferase domain containing protein. 
J033051K19AGCCCAAACNONE 
J100084G13AGCCCAAACNONE 
Os07g0564600AK061125GTTTGGGCTNONE 
AK102110GTTTGGGCTSimilar to Secretory carrier membrane protein. 
Os07g0564700AK059018TTTTGGGCTTGHypothetical protein. 
Os07g0565600AK071983TATTGGGCTTTGGGCTSimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481TATTGGGCTTTGGGCTNONE 
Os07g0568900009-083-H02AACTGGGCCCATTTTGGGCTAAGCCCATCGNONE 
AK062660AACTGGGCCCATTTTGGGCTAAGCCCATCGConserved hypothetical protein. 
Os07g0569000AK073915CGATGGGCTTAGCCCAAAATGGGCCCAGTTConserved hypothetical protein. 
Os07g0586500AK072668AGCCCAAANONE 
AK120683AGCCCAAASimilar to SUMO activating enzyme 2. 
J065033L18AGCCCAAANONE 
J065038H20AGCCCAAANONE 
J065045M20AGCCCAAANONE 
J065046E10AGCCCAAANONE 
J065055A10AGCCCAAANONE 
J065098P14AGCCCAAANONE 
J065156B19AGCCCAAANONE 
J065195P22AGCCCAAANONE 
J075002O06AGCCCAAANONE 
J075003D13AGCCCAAANONE 
J075004K05AGCCCAAANONE 
J075010C10AGCCCAAANONE 
J075011C14AGCCCAAANONE 
J075026E16AGCCCAAANONE 
J075041L23AGCCCAAANONE 
J075044C21AGCCCAAANONE 
J075071M16AGCCCAAANONE 
J075076O13AGCCCAAANONE 
J075080G12AGCCCAAANONE 
J075091A03AGCCCAAANONE 
J075091A21AGCCCAAANONE 
J075106K17AGCCCAAANONE 
J075120G20AGCCCAAANONE 
J075125H10AGCCCAAANONE 
J075129E05AGCCCAAANONE 
J075143B18AGCCCAAANONE 
J075153P22AGCCCAAANONE 
J075156A12AGCCCAAANONE 
J075156E19AGCCCAAANONE 
J075159E16AGCCCAAANONE 
J075165E16AGCCCAAANONE 
J075174L21AGCCCAAANONE 
J075176N06AGCCCAAANONE 
J075176N13AGCCCAAANONE 
J075179L20AGCCCAAANONE 
J075186P20AGCCCAAANONE 
J090044I17AGCCCAAANONE 
J090051K13AGCCCAAANONE 
Os07g0586700AK102792CACGGCCCAAACCCAGCCCAAAAConserved hypothetical protein. 
Os07g0604500009-018-C07ATTTGGGCTGANONE 
009-194-C02ATTTGGGCTGANONE 
011-023-C06ATTTGGGCTGANONE 
015-035-B10ATTTGGGCTGANONE 
AK064312ATTTGGGCTGASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK069085ATTTGGGCTGANONE 
J090050I12ATTTGGGCTGANONE 
J100027C10ATTTGGGCTGANONE 
J100029A05ATTTGGGCTGANONE 
J100031P17ATTTGGGCTGANONE 
J100039E20ATTTGGGCTGANONE 
J100064L15ATTTGGGCTGANONE 
J100066K08ATTTGGGCTGANONE 
Os07g0626600Os07g0626600AAAGCCCAAATSimilar to Embryogenic callus protein-like. 
Os07g0644300AK066726TCAGCCCAAAASimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483TCAGCCCAAAANONE 
Os07g0668200AK059051CAAGCCCAAATNONE 
AK101682CAAGCCCAAATConserved hypothetical protein. 
AK102839CAAGCCCAAATNONE 
Os07g0687300AK073043CAAGCCCAAACSimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os07g0695100AB189039AGCCCAAANONE 
AB189042AGCCCAAANONE 
AK059514AGCCCAAANONE 
AK066112AGCCCAAACheY-like domain containing protein. 
J013051N02AGCCCAAANONE 
J013127M02AGCCCAAANONE 
J023007I05AGCCCAAANONE 
Os08g0135900AK069187GTTTGGGCTGCNONE 
Os08g0158900AK067062TTTTGGGCTGGGTP1/OBG domain containing protein. 
J013089F04TTTTGGGCTGGNONE 
J013092D16TTTTGGGCTGGNONE 
J033120K14TTTTGGGCTGGNONE 
J033133F24TTTTGGGCTGGNONE 
J033145A10TTTTGGGCTGGNONE 
J033145A11TTTTGGGCTGGNONE 
J053048H24TTTTGGGCTGGNONE 
J053075H10TTTTGGGCTGGNONE 
Os08g0159000AK073617CCAGCCCAAAANONE 
AK103973CCAGCCCAAAASimilar to DnaJ homolog subfamily C member 1. 
J023130H14CCAGCCCAAAANONE 
J033051J11CCAGCCCAAAANONE 
J065101C10CCAGCCCAAAANONE 
J065168B04CCAGCCCAAAANONE 
J065184E22CCAGCCCAAAANONE 
J080021D11CCAGCCCAAAANONE 
J080025H10CCAGCCCAAAANONE 
J080026N19CCAGCCCAAAANONE 
J080034A12CCAGCCCAAAANONE 
J080040L02CCAGCCCAAAANONE 
J080042H19CCAGCCCAAAANONE 
J080047B05CCAGCCCAAAANONE 
J080047E09CCAGCCCAAAANONE 
J080047I01CCAGCCCAAAANONE 
J080052H19CCAGCCCAAAANONE 
J080062K13CCAGCCCAAAANONE 
J080063A22CCAGCCCAAAANONE 
J080068G18CCAGCCCAAAANONE 
J080068N19CCAGCCCAAAANONE 
J080076G08CCAGCCCAAAANONE 
J080077H13CCAGCCCAAAANONE 
J080077K06CCAGCCCAAAANONE 
J080093D15CCAGCCCAAAANONE 
J080094D21CCAGCCCAAAANONE 
J080097A20CCAGCCCAAAANONE 
J080097E21CCAGCCCAAAANONE 
J080097N17CCAGCCCAAAANONE 
J100071K18CCAGCCCAAAANONE 
J100072F09CCAGCCCAAAANONE 
Os08g0172300AK111274GCAGCCCAAAHAT dimerisation domain containing protein. 
J065184J06GCAGCCCAAANONE 
Os08g0176800AK111670GTTTGGGCTTASimilar to mRNA-associated protein mrnp 41 (Rae1 protein homolog). 
J013030D15GTTTGGGCTTANONE 
J013157K01GTTTGGGCTTANONE 
J023108A20GTTTGGGCTTANONE 
J033125F09GTTTGGGCTTANONE 
Os08g0192900AK103422AAAAGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645AAAAGCCCAAACNONE 
Os08g0260600AK108529ACAGCCCAAAACD9/CD37/CD63 antigen family protein. 
AK108529GTTTGGGCTCAGCTCD9/CD37/CD63 antigen family protein. 
Os08g0299000AK061379GCAGCCCAAACNONE 
AK099389GCAGCCCAAACNONE 
AK101640GCAGCCCAAACProtein of unknown function DUF52 domain containing protein. 
J013100G13GCAGCCCAAACNONE 
J013153N09GCAGCCCAAACNONE 
J023097N06GCAGCCCAAACNONE 
J023123C12GCAGCCCAAACNONE 
J033088G14GCAGCCCAAACNONE 
J065033G10GCAGCCCAAACNONE 
J065128B01GCAGCCCAAACNONE 
J100085I01GCAGCCCAAACNONE 
Os08g0363000015-090-A07AAAGCCCAAATNONE 
AK103677AAAGCCCAAATNONE 
AK106532AAAGCCCAAATProtein of unknown function DUF295 family protein. 
J033136B21AAAGCCCAAATNONE 
J033136E01AAAGCCCAAATNONE 
J043029N11AAAGCCCAAATNONE 
J065071G13AAAGCCCAAATNONE 
J065105J22AAAGCCCAAATNONE 
J075084B18AAAGCCCAAATNONE 
Os08g0366000AK061683TTTGGGCTGTNONE 
J075038P08TTTGGGCTGTNONE 
J075078A19TTTGGGCTGTNONE 
J075116L15TTTGGGCTGTNONE 
J075117E22TTTGGGCTGTNONE 
J075118D04TTTGGGCTGTNONE 
J075139A08TTTGGGCTGTNONE 
J075175J19TTTGGGCTGTNONE 
J075197N24TTTGGGCTGTNONE 
Os08g0401100AK121508TTTTGGGCTAnkyrin repeat containing protein. 
J023009D05TTTTGGGCTNONE 
J033023C05TTTTGGGCTNONE 
Os08g0423400AK072922TTTGGGCTTAConserved hypothetical protein. 
J023146P06TTTGGGCTTANONE 
Os08g0447200AK067377TAAGCCCAAATSGT1 family protein. 
J013106M17TAAGCCCAAATNONE 
J033133D18TAAGCCCAAATNONE 
J033140B09TAAGCCCAAATNONE 
J100028I17TAAGCCCAAATNONE 
J100086C22TAAGCCCAAATNONE 
Os08g0485900AK110716AAAAGCCCAAAAHaloacid dehalogenase-like hydrolase domain containing protein. 
Os08g0492100AK060178ATTTGGGCTGGNONE 
AK071053ATTTGGGCTGGParaneoplastic encephalomyelitis antigen family protein. 
AK100101ATTTGGGCTGGNONE 
J023004I20ATTTGGGCTGGNONE 
J023067D13ATTTGGGCTGGNONE 
J033028G05ATTTGGGCTGGNONE 
J033060L15ATTTGGGCTGGNONE 
J033103N12ATTTGGGCTGGNONE 
J033125B19ATTTGGGCTGGNONE 
J065132A12ATTTGGGCTGGNONE 
J065161F02ATTTGGGCTGGNONE 
J065162L05ATTTGGGCTGGNONE 
J090093I18ATTTGGGCTGGNONE 
J100061I05ATTTGGGCTGGNONE 
J100081G13ATTTGGGCTGGNONE 
Os08g0494300AK066150GCAGCCCAAATvon Willebrand factor, type A domain containing protein. 
Os08g0496000011-009-D02TCAGCCCAAAANONE 
AK103187TCAGCCCAAAACytochrome oxidase assembly family protein. 
J033121L24TCAGCCCAAAANONE 
J033149A07TCAGCCCAAAANONE 
J065198L20TCAGCCCAAAANONE 
J090096F24TCAGCCCAAAANONE 
Os08g0517900015-019-D06AAAAGCCCAAAAAAGGCCCATATNONE 
AK064304AAAAGCCCAAAAAAGGCCCATATSimilar to 30S ribosomal protein S16. 
Os09g0101800AK102345ATTTGGGCTGGGWD40-like domain containing protein. 
J090030C23ATTTGGGCTGGGNONE 
Os09g0103400016-041-C04GAAGCCCAAANONE 
016-045-D02GAAGCCCAAANONE 
AK064377GAAGCCCAAAConserved hypothetical protein. 
J043010E20GAAGCCCAAANONE 
Os09g0106200009-171-D09GTTTGGGCTNONE 
AK070749GTTTGGGCTSimilar to Ps16 protein. 
J023064A16GTTTGGGCTNONE 
J053084M03GTTTGGGCTNONE 
J075114F07GTTTGGGCTNONE 
J075121E01GTTTGGGCTNONE 
J075138L10GTTTGGGCTNONE 
J075138M14GTTTGGGCTNONE 
J075176B08GTTTGGGCTNONE 
Os09g0115900009-055-E06TAAGCCCAAATNONE 
AK068597TAAGCCCAAATConserved hypothetical protein. 
J065136F11TAAGCCCAAATNONE 
J080023D14TAAGCCCAAATNONE 
Os09g0134500AK065095AGCCCAAAANONE 
AK074022AGCCCAAAASimilar to Trithorax-like protein 1. 
J013001M12AGCCCAAAANONE 
J013122N21AGCCCAAAANONE 
J033024A02AGCCCAAAANONE 
J033039K15AGCCCAAAANONE 
J033074A15AGCCCAAAANONE 
J065032I05AGCCCAAAANONE 
J065087M02AGCCCAAAANONE 
J065182B06AGCCCAAAANONE 
J065183O07AGCCCAAAANONE 
J090036I19AGCCCAAAANONE 
Os09g0324200AK109621TTTCGGCCTTTTGGGCTGACyclin-like F-box domain containing protein. 
Os09g0343200AK064806GTTTGGGCTTTAnkyrin repeat containing protein. 
AK064994GTTTGGGCTTTNONE 
J013000D17GTTTGGGCTTTNONE 
J013001D17GTTTGGGCTTTNONE 
J013067O17GTTTGGGCTTTNONE 
J013097A16GTTTGGGCTTTNONE 
J013097H22GTTTGGGCTTTNONE 
J090014I04GTTTGGGCTTTNONE 
J090046D15GTTTGGGCTTTNONE 
Os09g0364500J100031B16CAAGCCCAAAGTP-binding protein, HSR1-related domain containing protein. 
J100052H07CAAGCCCAAANONE 
J100078G03CAAGCCCAAANONE 
Os09g0375700AK068295TTTGGGCTCGGCCCATTHypothetical protein. 
Os09g0439600AK100577GAAGCCCAAAExo70 exocyst complex subunit family protein. 
J090071K03GAAGCCCAAANONE 
Os09g0463700016-008-D06AAAGCCCAAATNONE 
AK060708AAAGCCCAAATSimilar to AHM1. 
J090013G05AAAGCCCAAATNONE 
Os09g0465800009-106-E01AAAGCCCAAAANONE 
009-106-E01GCCGGCCCAGCCCAAAANONE 
AK062785AAAGCCCAAAAConserved hypothetical protein. 
AK062785GCCGGCCCAGCCCAAAAConserved hypothetical protein. 
J065122K21AAAGCCCAAAANONE 
J065122K21GCCGGCCCAGCCCAAAANONE 
Os09g0480700009-048-B11AGCCCAAANONE 
AK105156AGCCCAAASimilar to Transcription factor Hap5a-like protein. 
Os09g0497400AK058354AGCCCAAAANONE 
AK068677AGCCCAAAAProtein of unknown function DUF850, transmembrane eukaryotic family protein. 
J013159B19AGCCCAAAANONE 
J023011D22AGCCCAAAANONE 
J023081K05AGCCCAAAANONE 
J033060O14AGCCCAAAANONE 
J075020I08AGCCCAAAANONE 
J075034J03AGCCCAAAANONE 
J075049M15AGCCCAAAANONE 
J075065K02AGCCCAAAANONE 
J075099L06AGCCCAAAANONE 
Os09g0501100009-126-C12CCAGCCCAAACNONE 
AK063752CCAGCCCAAACSimilar to 60S ribosomal protein L32A. 
AK099282CCAGCCCAAACNONE 
J023130H04CCAGCCCAAACNONE 
J075013C11CCAGCCCAAACNONE 
J075060E07CCAGCCCAAACNONE 
J075106K07CCAGCCCAAACNONE 
J075124L15CCAGCCCAAACNONE 
J075161D15CCAGCCCAAACNONE 
J080311I18CCAGCCCAAACNONE 
J080315G08CCAGCCCAAACNONE 
J080316F09CCAGCCCAAACNONE 
J080318B05CCAGCCCAAACNONE 
J100052O18CCAGCCCAAACNONE 
J100064D07CCAGCCCAAACNONE 
Os09g0535500AK108282ACAGCCCAAACSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
Os09g0560600AK071381ATTTGGGCTGCNONE 
J023089I18ATTTGGGCTGCNONE 
J075015L11ATTTGGGCTGCNONE 
J075038B17ATTTGGGCTGCNONE 
J075059J18ATTTGGGCTGCNONE 
J075077H09ATTTGGGCTGCNONE 
J075091F07ATTTGGGCTGCNONE 
J075100O20ATTTGGGCTGCNONE 
J075118G11ATTTGGGCTGCNONE 
J075149F18ATTTGGGCTGCNONE 
J075156B19ATTTGGGCTGCNONE 
J075185L12ATTTGGGCTGCNONE 
J075189N02ATTTGGGCTGCNONE 
J075196A12ATTTGGGCTGCNONE 
J090024N23ATTTGGGCTGCNONE 
Os11g0106700006-055-F11CCAGCCCAAAANONE 
006-099-D08CCAGCCCAAAANONE 
009-155-A12CCAGCCCAAAANONE 
AF519570CCAGCCCAAAANONE 
AK059354CCAGCCCAAAASimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0131200J065024D18AGCCCAAATMpv17/PMP22 family protein. 
J065206C17AGCCCAAATNONE 
Os11g0139500AK121845ATTTGGGCTGGNONE 
Os11g0159000AK065738AAAAGCCCAAAAConserved hypothetical protein. 
Os11g0162200009-059-H04TCATGGGCCAAAAGCCCAAAANONE 
AK060396TCATGGGCCAAAAGCCCAAAASimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11TCATGGGCCAAAAGCCCAAAANONE 
J065105K09TCATGGGCCAAAAGCCCAAAANONE 
J075024G12TCATGGGCCAAAAGCCCAAAANONE 
J075040K04TCATGGGCCAAAAGCCCAAAANONE 
J075066D13TCATGGGCCAAAAGCCCAAAANONE 
J075108A11TCATGGGCCAAAAGCCCAAAANONE 
J100031D04TCATGGGCCAAAAGCCCAAAANONE 
J100060O05TCATGGGCCAAAAGCCCAAAANONE 
J100075M22TCATGGGCCAAAAGCCCAAAANONE 
Os11g0181500006-025-C02GCAGCCCAAANONE 
AK060074GCAGCCCAAANONE 
AK067601GCAGCCCAAASimilar to Nitrogen fixation like protein. 
Os11g0231400AK108047TTTTGGGCTProtein of unknown function DUF295 family protein. 
Os11g0264600J100079I22TCAGCCCAAAANONE 
Os11g0438700012-011-H02TCAGCCCAAAANONE 
AK063434TCAGCCCAAAASimilar to Tropinone reductase-I (EC 1.1.1.206) (TR-I) (Tropine dehydrogenase). 
AK073524TCAGCCCAAAANONE 
J033046I10TCAGCCCAAAANONE 
J043029B09TCAGCCCAAAANONE 
J065033C17TCAGCCCAAAANONE 
J065062D11TCAGCCCAAAANONE 
J065138G10TCAGCCCAAAANONE 
J065184I11TCAGCCCAAAANONE 
J080030B02TCAGCCCAAAANONE 
J090063K06TCAGCCCAAAANONE 
Os11g0484300AK121422TTTTGGGCTTCSimilar to Mcm2-prov protein. 
Os11g0497000AK111924CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATSimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065097A08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065123J10CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J075096F04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J080065C15CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090033J04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090072N23CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100021E08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100063H21CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
Os11g0532600AK060253AGCTGAGCCCAAAALeucine-rich repeat 2 containing protein. 
J023065M14AGCTGAGCCCAAAANONE 
J023101A10AGCTGAGCCCAAAANONE 
Os11g0592500AK067078GAGGCCCAGCCCAAAANONE 
Os11g0616200AK069189ATTTGGGCCGAAAGCCCAAAAConserved hypothetical protein. 
J023004N19ATTTGGGCCGAAAGCCCAAAANONE 
Os11g0660500009-031-D10AAAAGCCCAAACNONE 
009-100-G09AAAAGCCCAAACNONE 
009-162-G10AAAAGCCCAAACNONE 
009-183-H11AAAAGCCCAAACNONE 
013-010-B11AAAAGCCCAAACNONE 
013-050-A05AAAAGCCCAAACNONE 
013-070-E10AAAAGCCCAAACNONE 
AK105453AAAAGCCCAAACSimilar to Translationally controlled tumor protein (Fragment). 
D12626AAAAGCCCAAACNONE 
J013128M15AAAAGCCCAAACNONE 
J023004I19AAAAGCCCAAACNONE 
J033114F08AAAAGCCCAAACNONE 
J033147I20AAAAGCCCAAACNONE 
J065031M04AAAAGCCCAAACNONE 
J065033J03AAAAGCCCAAACNONE 
J065038E01AAAAGCCCAAACNONE 
J065048O06AAAAGCCCAAACNONE 
J065054E01AAAAGCCCAAACNONE 
J065075N08AAAAGCCCAAACNONE 
J065080C07AAAAGCCCAAACNONE 
J065096A12AAAAGCCCAAACNONE 
J065115P22AAAAGCCCAAACNONE 
J065122I21AAAAGCCCAAACNONE 
J065127A13AAAAGCCCAAACNONE 
J065158B06AAAAGCCCAAACNONE 
J065162E04AAAAGCCCAAACNONE 
J065162E05AAAAGCCCAAACNONE 
J065163L06AAAAGCCCAAACNONE 
J065177B16AAAAGCCCAAACNONE 
J065181M15AAAAGCCCAAACNONE 
J065201G15AAAAGCCCAAACNONE 
J065202J06AAAAGCCCAAACNONE 
J075002B19AAAAGCCCAAACNONE 
J075008G19AAAAGCCCAAACNONE 
J075010P05AAAAGCCCAAACNONE 
J075018H23AAAAGCCCAAACNONE 
J075051E18AAAAGCCCAAACNONE 
J075053C24AAAAGCCCAAACNONE 
J075077B06AAAAGCCCAAACNONE 
J075080B11AAAAGCCCAAACNONE 
J075083M04AAAAGCCCAAACNONE 
J075085H01AAAAGCCCAAACNONE 
J075109E11AAAAGCCCAAACNONE 
J075111O09AAAAGCCCAAACNONE 
J075130D13AAAAGCCCAAACNONE 
J075132H13AAAAGCCCAAACNONE 
J075147H19AAAAGCCCAAACNONE 
J075148J01AAAAGCCCAAACNONE 
J075159A18AAAAGCCCAAACNONE 
J075166F03AAAAGCCCAAACNONE 
J075191F09AAAAGCCCAAACNONE 
J075192K09AAAAGCCCAAACNONE 
J080006P15AAAAGCCCAAACNONE 
J080013J18AAAAGCCCAAACNONE 
J080023O06AAAAGCCCAAACNONE 
J080024I17AAAAGCCCAAACNONE 
J080029P03AAAAGCCCAAACNONE 
J080030C14AAAAGCCCAAACNONE 
J080038K15AAAAGCCCAAACNONE 
J080042I15AAAAGCCCAAACNONE 
J080053L07AAAAGCCCAAACNONE 
J080061H12AAAAGCCCAAACNONE 
J080064H24AAAAGCCCAAACNONE 
J080066J20AAAAGCCCAAACNONE 
J080074N07AAAAGCCCAAACNONE 
J080079F16AAAAGCCCAAACNONE 
J080079O07AAAAGCCCAAACNONE 
J080092E15AAAAGCCCAAACNONE 
J080301F19AAAAGCCCAAACNONE 
J080302O21AAAAGCCCAAACNONE 
J080306L02AAAAGCCCAAACNONE 
J080307F16AAAAGCCCAAACNONE 
J080307G01AAAAGCCCAAACNONE 
J080307K01AAAAGCCCAAACNONE 
J080309O22AAAAGCCCAAACNONE 
J080311E17AAAAGCCCAAACNONE 
J080311N08AAAAGCCCAAACNONE 
J080312O12AAAAGCCCAAACNONE 
J080315C08AAAAGCCCAAACNONE 
J080316D07AAAAGCCCAAACNONE 
J080318C17AAAAGCCCAAACNONE 
J090004B08AAAAGCCCAAACNONE 
J090009K02AAAAGCCCAAACNONE 
J090025O15AAAAGCCCAAACNONE 
J090026L03AAAAGCCCAAACNONE 
J090036P17AAAAGCCCAAACNONE 
J090047A21AAAAGCCCAAACNONE 
J090053O03AAAAGCCCAAACNONE 
J090059C04AAAAGCCCAAACNONE 
J090062O21AAAAGCCCAAACNONE 
J090064M11AAAAGCCCAAACNONE 
J090070C14AAAAGCCCAAACNONE 
J090075I03AAAAGCCCAAACNONE 
J090081G22AAAAGCCCAAACNONE 
J090083E18AAAAGCCCAAACNONE 
J090084A05AAAAGCCCAAACNONE 
J100019L11AAAAGCCCAAACNONE 
J100022D16AAAAGCCCAAACNONE 
J100042F09AAAAGCCCAAACNONE 
J100051J12AAAAGCCCAAACNONE 
J100065G21AAAAGCCCAAACNONE 
J100066D08AAAAGCCCAAACNONE 
J100069H04AAAAGCCCAAACNONE 
J100078I16AAAAGCCCAAACNONE 
J100090D15AAAAGCCCAAACNONE 
Os11g0703900011-004-D05ACAGCCCAAAANONE 
011-014-C03ACAGCCCAAAANONE 
011-016-C01ACAGCCCAAAANONE 
011-017-B04ACAGCCCAAAANONE 
011-017-E09ACAGCCCAAAANONE 
011-019-E12ACAGCCCAAAANONE 
011-021-H12ACAGCCCAAAANONE 
011-025-H02ACAGCCCAAAANONE 
011-027-B09ACAGCCCAAAANONE 
011-039-G07ACAGCCCAAAANONE 
011-044-G07ACAGCCCAAAANONE 
011-046-F11ACAGCCCAAAANONE 
011-070-F02ACAGCCCAAAANONE 
011-071-A07ACAGCCCAAAANONE 
011-082-A03ACAGCCCAAAANONE 
011-086-B09ACAGCCCAAAANONE 
011-092-C04ACAGCCCAAAANONE 
012-006-F02ACAGCCCAAAANONE 
012-011-G08ACAGCCCAAAANONE 
012-026-C06ACAGCCCAAAANONE 
012-026-G06ACAGCCCAAAANONE 
012-028-E05ACAGCCCAAAANONE 
012-040-A05ACAGCCCAAAANONE 
012-045-C01ACAGCCCAAAANONE 
012-046-A10ACAGCCCAAAANONE 
012-047-H09ACAGCCCAAAANONE 
012-059-A12ACAGCCCAAAANONE 
012-072-D06ACAGCCCAAAANONE 
012-073-D05ACAGCCCAAAANONE 
012-076-D08ACAGCCCAAAANONE 
012-079-G05ACAGCCCAAAANONE 
012-080-A04ACAGCCCAAAANONE 
012-080-E01ACAGCCCAAAANONE 
012-083-C03ACAGCCCAAAANONE 
012-083-G06ACAGCCCAAAANONE 
012-086-G02ACAGCCCAAAANONE 
012-091-A07ACAGCCCAAAANONE 
012-094-G10ACAGCCCAAAANONE 
012-098-A07ACAGCCCAAAANONE 
012-100-G04ACAGCCCAAAANONE 
015-001-A11ACAGCCCAAAANONE 
015-033-E01ACAGCCCAAAANONE 
015-047-F12ACAGCCCAAAANONE 
015-054-E05ACAGCCCAAAANONE 
015-063-H02ACAGCCCAAAANONE 
015-075-E10ACAGCCCAAAANONE 
015-086-F05ACAGCCCAAAANONE 
016-031-A08ACAGCCCAAAANONE 
016-053-A03ACAGCCCAAAANONE 
016-054-C09ACAGCCCAAAANONE 
016-079-C08ACAGCCCAAAANONE 
AK065431ACAGCCCAAAAHeat shock protein 70. 
AK119255ACAGCCCAAAANONE 
J013021C12ACAGCCCAAAANONE 
J013021C17ACAGCCCAAAANONE 
J023027B08ACAGCCCAAAANONE 
J023078A21ACAGCCCAAAANONE 
J023097M06ACAGCCCAAAANONE 
J023100O04ACAGCCCAAAANONE 
J023107B17ACAGCCCAAAANONE 
J023108L24ACAGCCCAAAANONE 
J023109L05ACAGCCCAAAANONE 
J033022M22ACAGCCCAAAANONE 
J033023K21ACAGCCCAAAANONE 
J033031L11ACAGCCCAAAANONE 
J033034H10ACAGCCCAAAANONE 
J033037B16ACAGCCCAAAANONE 
J033037F16ACAGCCCAAAANONE 
J033037H07ACAGCCCAAAANONE 
J033046E22ACAGCCCAAAANONE 
J033050N12ACAGCCCAAAANONE 
J033064F10ACAGCCCAAAANONE 
J033064N10ACAGCCCAAAANONE 
J033066O09ACAGCCCAAAANONE 
J033068H01ACAGCCCAAAANONE 
J033068J07ACAGCCCAAAANONE 
J033070B10ACAGCCCAAAANONE 
J033070G13ACAGCCCAAAANONE 
J033073O13ACAGCCCAAAANONE 
J033075B07ACAGCCCAAAANONE 
J033079L15ACAGCCCAAAANONE 
J033081J06ACAGCCCAAAANONE 
J033086G13ACAGCCCAAAANONE 
J033086N07ACAGCCCAAAANONE 
J033086O05ACAGCCCAAAANONE 
J033091A15ACAGCCCAAAANONE 
J033091D05ACAGCCCAAAANONE 
J033094C12ACAGCCCAAAANONE 
J033099P03ACAGCCCAAAANONE 
J033107L09ACAGCCCAAAANONE 
J033108D16ACAGCCCAAAANONE 
J033109E12ACAGCCCAAAANONE 
J033109K14ACAGCCCAAAANONE 
J033112P22ACAGCCCAAAANONE 
J033116F12ACAGCCCAAAANONE 
J033116K01ACAGCCCAAAANONE 
J033118F19ACAGCCCAAAANONE 
J033121J10ACAGCCCAAAANONE 
J033126H04ACAGCCCAAAANONE 
J033131G17ACAGCCCAAAANONE 
J033131L05ACAGCCCAAAANONE 
J033136A08ACAGCCCAAAANONE 
J033136H22ACAGCCCAAAANONE 
J033143F01ACAGCCCAAAANONE 
J065040M10ACAGCCCAAAANONE 
J065046F17ACAGCCCAAAANONE 
J065048G20ACAGCCCAAAANONE 
J065071N06ACAGCCCAAAANONE 
J065084I24ACAGCCCAAAANONE 
J065171B01ACAGCCCAAAANONE 
J065191J21ACAGCCCAAAANONE 
J065199I20ACAGCCCAAAANONE 
J075076C02ACAGCCCAAAANONE 
J090002P12ACAGCCCAAAANONE 
J090003A11ACAGCCCAAAANONE 
J090003H11ACAGCCCAAAANONE 
J090009M22ACAGCCCAAAANONE 
J090009O11ACAGCCCAAAANONE 
J090014N09ACAGCCCAAAANONE 
J090015A18ACAGCCCAAAANONE 
J090016E16ACAGCCCAAAANONE 
J090016I07ACAGCCCAAAANONE 
J090017O07ACAGCCCAAAANONE 
J090019E10ACAGCCCAAAANONE 
J090020D24ACAGCCCAAAANONE 
J090021M16ACAGCCCAAAANONE 
J090022F13ACAGCCCAAAANONE 
J090023H03ACAGCCCAAAANONE 
J090024E15ACAGCCCAAAANONE 
J090024G19ACAGCCCAAAANONE 
J090026J19ACAGCCCAAAANONE 
J090030E20ACAGCCCAAAANONE 
J090030I15ACAGCCCAAAANONE 
J090032F04ACAGCCCAAAANONE 
J090033N22ACAGCCCAAAANONE 
J090033O19ACAGCCCAAAANONE 
J090036F08ACAGCCCAAAANONE 
J090039A13ACAGCCCAAAANONE 
J090042N07ACAGCCCAAAANONE 
J090043C15ACAGCCCAAAANONE 
J090043N09ACAGCCCAAAANONE 
J090053J10ACAGCCCAAAANONE 
J090054F14ACAGCCCAAAANONE 
J090057N12ACAGCCCAAAANONE 
J090061P13ACAGCCCAAAANONE 
J090062F17ACAGCCCAAAANONE 
J090065H15ACAGCCCAAAANONE 
J090067P11ACAGCCCAAAANONE 
J090068M09ACAGCCCAAAANONE 
J090069E24ACAGCCCAAAANONE 
J090069K16ACAGCCCAAAANONE 
J090070N07ACAGCCCAAAANONE 
J090072M09ACAGCCCAAAANONE 
J090075I24ACAGCCCAAAANONE 
J090075M04ACAGCCCAAAANONE 
J090077D24ACAGCCCAAAANONE 
J090080M17ACAGCCCAAAANONE 
J090080O14ACAGCCCAAAANONE 
J090081C12ACAGCCCAAAANONE 
J090084N21ACAGCCCAAAANONE 
J090084O21ACAGCCCAAAANONE 
J090087J18ACAGCCCAAAANONE 
J090092L17ACAGCCCAAAANONE 
J090097A08ACAGCCCAAAANONE 
J100017E24ACAGCCCAAAANONE 
J100018K11ACAGCCCAAAANONE 
J100019A16ACAGCCCAAAANONE 
J100023I23ACAGCCCAAAANONE 
J100024D07ACAGCCCAAAANONE 
J100025H12ACAGCCCAAAANONE 
J100027K19ACAGCCCAAAANONE 
J100028C23ACAGCCCAAAANONE 
J100029A14ACAGCCCAAAANONE 
J100029O19ACAGCCCAAAANONE 
J100030I09ACAGCCCAAAANONE 
J100030J16ACAGCCCAAAANONE 
J100031C01ACAGCCCAAAANONE 
J100031N06ACAGCCCAAAANONE 
J100033H04ACAGCCCAAAANONE 
J100034L20ACAGCCCAAAANONE 
J100036K13ACAGCCCAAAANONE 
J100039M02ACAGCCCAAAANONE 
J100040J01ACAGCCCAAAANONE 
J100042O21ACAGCCCAAAANONE 
J100042P20ACAGCCCAAAANONE 
J100047K22ACAGCCCAAAANONE 
J100049B16ACAGCCCAAAANONE 
J100052M10ACAGCCCAAAANONE 
J100053B05ACAGCCCAAAANONE 
J100053B20ACAGCCCAAAANONE 
J100055I11ACAGCCCAAAANONE 
J100056A13ACAGCCCAAAANONE 
J100057C08ACAGCCCAAAANONE 
J100057N11ACAGCCCAAAANONE 
J100057P07ACAGCCCAAAANONE 
J100059E16ACAGCCCAAAANONE 
J100063N14ACAGCCCAAAANONE 
J100069H01ACAGCCCAAAANONE 
J100071C17ACAGCCCAAAANONE 
J100071K09ACAGCCCAAAANONE 
J100077D07ACAGCCCAAAANONE 
J100078P22ACAGCCCAAAANONE 
J100080F11ACAGCCCAAAANONE 
J100081L07ACAGCCCAAAANONE 
J100083B10ACAGCCCAAAANONE 
J100083K17ACAGCCCAAAANONE 
J100085B22ACAGCCCAAAANONE 
J100085L21ACAGCCCAAAANONE 
J100086B11ACAGCCCAAAANONE 
J100087E06ACAGCCCAAAANONE 
J100087P07ACAGCCCAAAANONE 
J100089H24ACAGCCCAAAANONE 
Os12g0100050Os12g0100050TTTTGGGCTTTLight chain 3 (LC3) family protein. 
Os12g0100100006-036-G03AAAGCCCAAAANONE 
AK061492AAAGCCCAAAASimilar to ALY protein. 
AK068452AAAGCCCAAAANONE 
J013153E18AAAGCCCAAAANONE 
J033140D06AAAGCCCAAAANONE 
J065046A19AAAGCCCAAAANONE 
J065061F08AAAGCCCAAAANONE 
J065101I03AAAGCCCAAAANONE 
J065158B05AAAGCCCAAAANONE 
J065162H06AAAGCCCAAAANONE 
J065195I23AAAGCCCAAAANONE 
J065218E07AAAGCCCAAAANONE 
Os12g0106000AF370029CAAGCCCAAAASimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
AF519571CAAGCCCAAAANONE 
AK102242CAAGCCCAAAANONE 
AY324879CAAGCCCAAAANONE 
J053063M21CAAGCCCAAAANONE 
J090080A16CAAGCCCAAAANONE 
Os12g0164300AK120100TTTTGGGCTTGCyclin-like F-box domain containing protein. 
J013022J17TTTTGGGCTTGNONE 
J013040L22TTTTGGGCTTGNONE 
J013041G05TTTTGGGCTTGNONE 
J013096I02TTTTGGGCTTGNONE 
J013156F05TTTTGGGCTTGNONE 
J023122E20TTTTGGGCTTGNONE 
J065008K06TTTTGGGCTTGNONE 
J065073G14TTTTGGGCTTGNONE 
J065105H07TTTTGGGCTTGNONE 
J065117A15TTTTGGGCTTGNONE 
J075025K21TTTTGGGCTTGNONE 
J075051A13TTTTGGGCTTGNONE 
J075119C17TTTTGGGCTTGNONE 
J075143A02TTTTGGGCTTGNONE 
J075149K04TTTTGGGCTTGNONE 
J080304A20TTTTGGGCTTGNONE 
J080305H17TTTTGGGCTTGNONE 
J080306D14TTTTGGGCTTGNONE 
J080306N01TTTTGGGCTTGNONE 
J080308P13TTTTGGGCTTGNONE 
J080310C04TTTTGGGCTTGNONE 
J090048B12TTTTGGGCTTGNONE 
J090092A18TTTTGGGCTTGNONE 
J090099G20TTTTGGGCTTGNONE 
Os12g0168200015-027-H11AGCCCAAANONE 
AK069543AGCCCAAASsu72-like protein family protein. 
J023025N02AGCCCAAANONE 
Os12g0182200AK099737CAAGCCCAAAASimilar to Dihydrolipoamide S-acetyltransferase. 
Os12g0197100AK071816AGCCCAAATPhosphoribosylglycinamide synthetase domain containing protein. 
Os12g0286200AK070088AGCCCAAACConserved hypothetical protein. 
Os12g0479400AK065254AAAGCCCAAANONE 
AK067061AAAGCCCAAASimilar to Auxin response factor 1. 
Os12g0564800AK103886GCGGCCCAGCCCAAATDisease resistance protein family protein. 
Os12g0572400016-084-F04GCAGCCCAAACATATGGGCCGCANONE 
AK065531GCAGCCCAAACATATGGGCCGCASimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03GCAGCCCAAACATATGGGCCGCANONE 
J013034H02GCAGCCCAAACATATGGGCCGCANONE 
J033117N05GCAGCCCAAACATATGGGCCGCANONE 
J065027L09GCAGCCCAAACATATGGGCCGCANONE 
J065037D09GCAGCCCAAACATATGGGCCGCANONE 
J065197I09GCAGCCCAAACATATGGGCCGCANONE 
J090045C01GCAGCCCAAACATATGGGCCGCANONE 
J100031E11GCAGCCCAAACATATGGGCCGCANONE 
Os12g0573200AK111522AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
AK121943AGCCCAAGCCCAGCCCAGCCCAGCCCAAACGRAS transcription factor domain containing protein. 
J013002M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013151M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013159J22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J023087F18AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033107F03AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033125L09AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033126E12AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J043022I15AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J065176F05AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090034D17AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090075J06AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058D22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058P04AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
Os12g0596000AK073530AGCCCAAASimilar to Lipoyltransferase (EC 2.3.1.-) (Lipoyl-[acyl-carrier protein]-protein- N-lipoyltransferase) (Lipoate-protein ligase B). 
AK101541AGCCCAAANONE 
Os12g0609800AK101303AGCCCAAACCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01AGCCCAAACNONE 
J033033K21AGCCCAAACNONE 
J033082L13AGCCCAAACNONE 
J043034M20AGCCCAAACNONE 
J065137J24AGCCCAAACNONE 
J065141A11AGCCCAAACNONE 
J065217H09AGCCCAAACNONE 
Os12g0624000AK067726CCCACCACTTTGGGCTGGGNONE 
AK067757CCCACCACTTTGGGCTGGGSimilar to Methionine synthase protein. 
J013039E03CCCACCACTTTGGGCTGGGNONE 
J013040D22CCCACCACTTTGGGCTGGGNONE 
J013047K12CCCACCACTTTGGGCTGGGNONE 
J013056C04CCCACCACTTTGGGCTGGGNONE 
J013062K01CCCACCACTTTGGGCTGGGNONE 
J013108K09CCCACCACTTTGGGCTGGGNONE 
J013126I24CCCACCACTTTGGGCTGGGNONE 
J013128D18CCCACCACTTTGGGCTGGGNONE 
J013147D23CCCACCACTTTGGGCTGGGNONE 
J013154N13CCCACCACTTTGGGCTGGGNONE 
J023003C20CCCACCACTTTGGGCTGGGNONE 
J023003N19CCCACCACTTTGGGCTGGGNONE 
J023007B09CCCACCACTTTGGGCTGGGNONE 
J023008L12CCCACCACTTTGGGCTGGGNONE 
J023037O10CCCACCACTTTGGGCTGGGNONE 
J023044F11CCCACCACTTTGGGCTGGGNONE 
J023062H22CCCACCACTTTGGGCTGGGNONE 
J023064O07CCCACCACTTTGGGCTGGGNONE 
J023067D16CCCACCACTTTGGGCTGGGNONE 
J023082C19CCCACCACTTTGGGCTGGGNONE 
J023090A08CCCACCACTTTGGGCTGGGNONE 
J023102P21CCCACCACTTTGGGCTGGGNONE 
J023122G15CCCACCACTTTGGGCTGGGNONE 
J023123I24CCCACCACTTTGGGCTGGGNONE 
J023134N07CCCACCACTTTGGGCTGGGNONE 
J023140M21CCCACCACTTTGGGCTGGGNONE 
J033023G06CCCACCACTTTGGGCTGGGNONE 
J033025J02CCCACCACTTTGGGCTGGGNONE 
J033025L06CCCACCACTTTGGGCTGGGNONE 
J033026I21CCCACCACTTTGGGCTGGGNONE 
J033028G20CCCACCACTTTGGGCTGGGNONE 
J033028L03CCCACCACTTTGGGCTGGGNONE 
J033030P14CCCACCACTTTGGGCTGGGNONE 
J033031C02CCCACCACTTTGGGCTGGGNONE 
J033031I06CCCACCACTTTGGGCTGGGNONE 
J033037D21CCCACCACTTTGGGCTGGGNONE 
J033037M24CCCACCACTTTGGGCTGGGNONE 
J033040P06CCCACCACTTTGGGCTGGGNONE 
J033046J18CCCACCACTTTGGGCTGGGNONE 
J033048A14CCCACCACTTTGGGCTGGGNONE 
J033048B14CCCACCACTTTGGGCTGGGNONE 
J033051N03CCCACCACTTTGGGCTGGGNONE 
J033060A19CCCACCACTTTGGGCTGGGNONE 
J033060K19CCCACCACTTTGGGCTGGGNONE 
J033065O13CCCACCACTTTGGGCTGGGNONE 
J033067I23CCCACCACTTTGGGCTGGGNONE 
J033068N13CCCACCACTTTGGGCTGGGNONE 
J033070N02CCCACCACTTTGGGCTGGGNONE 
J033072K15CCCACCACTTTGGGCTGGGNONE 
J033073D09CCCACCACTTTGGGCTGGGNONE 
J033075H17CCCACCACTTTGGGCTGGGNONE 
J033076O22CCCACCACTTTGGGCTGGGNONE 
J033086K06CCCACCACTTTGGGCTGGGNONE 
J033086L03CCCACCACTTTGGGCTGGGNONE 
J033088J09CCCACCACTTTGGGCTGGGNONE 
J033091D17CCCACCACTTTGGGCTGGGNONE 
J033096B11CCCACCACTTTGGGCTGGGNONE 
J033099A05CCCACCACTTTGGGCTGGGNONE 
J033101B15CCCACCACTTTGGGCTGGGNONE 
J033101D20CCCACCACTTTGGGCTGGGNONE 
J033105D22CCCACCACTTTGGGCTGGGNONE 
J033106J20CCCACCACTTTGGGCTGGGNONE 
J033107J01CCCACCACTTTGGGCTGGGNONE 
J033111N08CCCACCACTTTGGGCTGGGNONE 
J033112B18CCCACCACTTTGGGCTGGGNONE 
J033113L04CCCACCACTTTGGGCTGGGNONE 
J033114F02CCCACCACTTTGGGCTGGGNONE 
J033118A22CCCACCACTTTGGGCTGGGNONE 
J033119J02CCCACCACTTTGGGCTGGGNONE 
J033120F22CCCACCACTTTGGGCTGGGNONE 
J033120O16CCCACCACTTTGGGCTGGGNONE 
J033127A12CCCACCACTTTGGGCTGGGNONE 
J033127J08CCCACCACTTTGGGCTGGGNONE 
J033127N13CCCACCACTTTGGGCTGGGNONE 
J033131N09CCCACCACTTTGGGCTGGGNONE 
J033135I05CCCACCACTTTGGGCTGGGNONE 
J033140D04CCCACCACTTTGGGCTGGGNONE 
J033142D04CCCACCACTTTGGGCTGGGNONE 
J033145B14CCCACCACTTTGGGCTGGGNONE 
J043007I15CCCACCACTTTGGGCTGGGNONE 
J043021N20CCCACCACTTTGGGCTGGGNONE 
J043037I05CCCACCACTTTGGGCTGGGNONE 
J065008P22CCCACCACTTTGGGCTGGGNONE 
J065038C05CCCACCACTTTGGGCTGGGNONE 
J065060A16CCCACCACTTTGGGCTGGGNONE 
J065111M10CCCACCACTTTGGGCTGGGNONE 
J065112L11CCCACCACTTTGGGCTGGGNONE 
J065114B07CCCACCACTTTGGGCTGGGNONE 
J065116M04CCCACCACTTTGGGCTGGGNONE 
J065152D15CCCACCACTTTGGGCTGGGNONE 
J065171C15CCCACCACTTTGGGCTGGGNONE 
J065173N07CCCACCACTTTGGGCTGGGNONE 
J065185N18CCCACCACTTTGGGCTGGGNONE 
J065187F09CCCACCACTTTGGGCTGGGNONE 
J065188L15CCCACCACTTTGGGCTGGGNONE 
J065190K15CCCACCACTTTGGGCTGGGNONE 
J065214C16CCCACCACTTTGGGCTGGGNONE 
J065215F05CCCACCACTTTGGGCTGGGNONE 
J075108J08CCCACCACTTTGGGCTGGGNONE 
J090002C16CCCACCACTTTGGGCTGGGNONE 
J090002K12CCCACCACTTTGGGCTGGGNONE 
J090003M10CCCACCACTTTGGGCTGGGNONE 
J090007J12CCCACCACTTTGGGCTGGGNONE 
J090010D06CCCACCACTTTGGGCTGGGNONE 
J090010F21CCCACCACTTTGGGCTGGGNONE 
J090014E20CCCACCACTTTGGGCTGGGNONE 
J090014J03CCCACCACTTTGGGCTGGGNONE 
J090017E15CCCACCACTTTGGGCTGGGNONE 
J090019J18CCCACCACTTTGGGCTGGGNONE 
J090021B21CCCACCACTTTGGGCTGGGNONE 
J090021H21CCCACCACTTTGGGCTGGGNONE 
J090021J12CCCACCACTTTGGGCTGGGNONE 
J090022K10CCCACCACTTTGGGCTGGGNONE 
J090024C24CCCACCACTTTGGGCTGGGNONE 
J090026D12CCCACCACTTTGGGCTGGGNONE 
J090034F08CCCACCACTTTGGGCTGGGNONE 
J090036H24CCCACCACTTTGGGCTGGGNONE 
J090036L04CCCACCACTTTGGGCTGGGNONE 
J090040C21CCCACCACTTTGGGCTGGGNONE 
J090045J21CCCACCACTTTGGGCTGGGNONE 
J090052D21CCCACCACTTTGGGCTGGGNONE 
J090053A01CCCACCACTTTGGGCTGGGNONE 
J090057E01CCCACCACTTTGGGCTGGGNONE 
J090059A01CCCACCACTTTGGGCTGGGNONE 
J090059M24CCCACCACTTTGGGCTGGGNONE 
J090062A08CCCACCACTTTGGGCTGGGNONE 
J090065H17CCCACCACTTTGGGCTGGGNONE 
J090073M22CCCACCACTTTGGGCTGGGNONE 
J090074J05CCCACCACTTTGGGCTGGGNONE 
J090074L22CCCACCACTTTGGGCTGGGNONE 
J090077E04CCCACCACTTTGGGCTGGGNONE 
J090077K10CCCACCACTTTGGGCTGGGNONE 
J090088E21CCCACCACTTTGGGCTGGGNONE 
J090088L13CCCACCACTTTGGGCTGGGNONE 
J090089M05CCCACCACTTTGGGCTGGGNONE 
J090092E18CCCACCACTTTGGGCTGGGNONE 
J090092P07CCCACCACTTTGGGCTGGGNONE 
J090096M04CCCACCACTTTGGGCTGGGNONE 
J090099I04CCCACCACTTTGGGCTGGGNONE 
J100023P11CCCACCACTTTGGGCTGGGNONE 
J100024K13CCCACCACTTTGGGCTGGGNONE 
J100026P20CCCACCACTTTGGGCTGGGNONE 
J100027I15CCCACCACTTTGGGCTGGGNONE 
J100027M21CCCACCACTTTGGGCTGGGNONE 
J100029H05CCCACCACTTTGGGCTGGGNONE 
J100030E10CCCACCACTTTGGGCTGGGNONE 
J100030F11CCCACCACTTTGGGCTGGGNONE 
J100031C13CCCACCACTTTGGGCTGGGNONE 
J100032P16CCCACCACTTTGGGCTGGGNONE 
J100034G02CCCACCACTTTGGGCTGGGNONE 
J100037D06CCCACCACTTTGGGCTGGGNONE 
J100050D08CCCACCACTTTGGGCTGGGNONE 
J100051J22CCCACCACTTTGGGCTGGGNONE 
J100055G12CCCACCACTTTGGGCTGGGNONE 
J100056O15CCCACCACTTTGGGCTGGGNONE 
J100057E06CCCACCACTTTGGGCTGGGNONE 
J100061P11CCCACCACTTTGGGCTGGGNONE 
J100064H05CCCACCACTTTGGGCTGGGNONE 
J100066D14CCCACCACTTTGGGCTGGGNONE 
J100067D10CCCACCACTTTGGGCTGGGNONE 
J100070L11CCCACCACTTTGGGCTGGGNONE 
J100071N11CCCACCACTTTGGGCTGGGNONE 
J100073D21CCCACCACTTTGGGCTGGGNONE 
J100074L06CCCACCACTTTGGGCTGGGNONE 
J100081I01CCCACCACTTTGGGCTGGGNONE 
J100083F08CCCACCACTTTGGGCTGGGNONE 
J100083I15CCCACCACTTTGGGCTGGGNONE 
J100084P13CCCACCACTTTGGGCTGGGNONE 
J100086N12CCCACCACTTTGGGCTGGGNONE 
Os12g0630600J100033A04ACAGCCCAAAConserved hypothetical protein. 
Os12g0631100006-045-F12TTTTGGGCTTTTNONE 
006-077-C09TTTTGGGCTTTTNONE 
006-078-B11TTTTGGGCTTTTNONE 
AJ292320TTTTGGGCTTTTNONE 
AK061116TTTTGGGCTTTTNONE 
AK066784TTTTGGGCTTTTNONE 
AY029301TTTTGGGCTTTTRas small GTPase, Ras type family protein. 
J065015G13TTTTGGGCTTTTNONE 
J065035E22TTTTGGGCTTTTNONE 
J065037H03TTTTGGGCTTTTNONE 
J065065F12TTTTGGGCTTTTNONE 
J065078K22TTTTGGGCTTTTNONE 
J065081K09TTTTGGGCTTTTNONE 
J065121I23TTTTGGGCTTTTNONE 
J065127I03TTTTGGGCTTTTNONE 
J065130G24TTTTGGGCTTTTNONE 
J065134E23TTTTGGGCTTTTNONE 
J065154H14TTTTGGGCTTTTNONE 
J065183K16TTTTGGGCTTTTNONE 
J065209P13TTTTGGGCTTTTNONE 
J075087O18TTTTGGGCTTTTNONE 
J090065E06TTTTGGGCTTTTNONE 
Os12g0641500AK065733AGCCCAAAANONE 
AK120333AGCCCAAAANONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.