version

Summary of OsREG458 (All List)

OrganismOryza sativa  
IDOsREG458  
SequenceAGCCCAAC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
CCAACGG  function unknown  
PLACE Motif 
Total Entry Count1449  

Entry Sequences (1449 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0132800AK068422CCAGCCCAACAPeptidyl-tRNA hydrolase family protein. 
Os01g0134200AK102394TTGGCCCAAGCAAGCCCAACAConserved hypothetical protein. 
Os01g0188200015-013-B12GGTTGGGCTGGCCGGGCCGNONE 
Os01g0190400AK064011AAAAGCCCAACSimilar to Hexokinase. 
AK099119AAAAGCCCAACNONE 
Os01g0224500AK109225GCAGCCCAGCCCAACTCCCACCTGTConserved hypothetical protein. 
Os01g0225400J080301M15TGTTGGGCTKetopantoate hydroxymethyltransferase family protein. 
J080315B20TGTTGGGCTNONE 
Os01g0257100J100030B03CCAGCCCAACCAACGGTCNONE 
J100046K16CCAGCCCAACCAACGGTCRapid ALkalinization Factor family protein. 
Os01g0276000009-162-D08AGCCCAAGCCCAACANONE 
009-162-D08GAAGCCCAACANONE 
AK058917AGCCCAAGCCCAACASimilar to 60S ribosomal protein L30. 
AK058917GAAGCCCAACASimilar to 60S ribosomal protein L30. 
AK119715AGCCCAAGCCCAACANONE 
AK119715GAAGCCCAACANONE 
AK122128AGCCCAAGCCCAACANONE 
AK122128GAAGCCCAACANONE 
J033132L17AGCCCAAGCCCAACANONE 
J033132L17GAAGCCCAACANONE 
J065019G15AGCCCAAGCCCAACANONE 
J065019G15GAAGCCCAACANONE 
J065033O12AGCCCAAGCCCAACANONE 
J065033O12GAAGCCCAACANONE 
J065058J19AGCCCAAGCCCAACANONE 
J065058J19GAAGCCCAACANONE 
J065069L03AGCCCAAGCCCAACANONE 
J065069L03GAAGCCCAACANONE 
J065072E03AGCCCAAGCCCAACANONE 
J065072E03GAAGCCCAACANONE 
J065112J06AGCCCAAGCCCAACANONE 
J065112J06GAAGCCCAACANONE 
J065163C18AGCCCAAGCCCAACANONE 
J065163C18GAAGCCCAACANONE 
J065170L20AGCCCAAGCCCAACANONE 
J065170L20GAAGCCCAACANONE 
J065184O11AGCCCAAGCCCAACANONE 
J065184O11GAAGCCCAACANONE 
J065199M19AGCCCAAGCCCAACANONE 
J065199M19GAAGCCCAACANONE 
J065207P22AGCCCAAGCCCAACANONE 
J065207P22GAAGCCCAACANONE 
J065211C12AGCCCAAGCCCAACANONE 
J065211C12GAAGCCCAACANONE 
J075072K20AGCCCAAGCCCAACANONE 
J075072K20GAAGCCCAACANONE 
J075100B16AGCCCAAGCCCAACANONE 
J075100B16GAAGCCCAACANONE 
J075173F02AGCCCAAGCCCAACANONE 
J075173F02GAAGCCCAACANONE 
J090083E15AGCCCAAGCCCAACANONE 
J090083E15GAAGCCCAACANONE 
J100022F06AGCCCAAGCCCAACANONE 
J100022F06GAAGCCCAACANONE 
J100064C04AGCCCAAGCCCAACANONE 
J100064C04GAAGCCCAACANONE 
J100068F11AGCCCAAGCCCAACANONE 
J100068F11GAAGCCCAACANONE 
Os01g0277500AK066984AGTTGGGCTCTTGGGCCTCSimilar to Dof3 gene (Fragment). 
J013074F19AGTTGGGCTCTTGGGCCTCNONE 
J013091E10AGTTGGGCTCTTGGGCCTCNONE 
J023077C19AGTTGGGCTCTTGGGCCTCNONE 
J033068A02AGTTGGGCTCTTGGGCCTCNONE 
J065137O05AGTTGGGCTCTTGGGCCTCNONE 
Os01g0303300J053035N19AAAGCCCAACCNONE 
J075042F02AAAGCCCAACCNONE 
J075068E10AAAGCCCAACCNONE 
J075116E19AAAGCCCAACCNONE 
J075131C10AAAGCCCAACCNONE 
J075145J11AAAGCCCAACCNONE 
J075157P20AAAGCCCAACCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12AAAGCCCAACCNONE 
Os01g0327600AK120216AGTTGGGCTNONE 
AK121799AGTTGGGCTConserved hypothetical protein. 
J065081I07AGTTGGGCTNONE 
J065082D04AGTTGGGCTNONE 
J065082G10AGTTGGGCTNONE 
J065085G24AGTTGGGCTNONE 
J065105J24AGTTGGGCTNONE 
J065128D18AGTTGGGCTNONE 
J065155D13AGTTGGGCTNONE 
J065200C11AGTTGGGCTNONE 
Os01g0350900AK070217GGTTGGGCTTGSimilar to VIP2 protein. 
J065165D23GGTTGGGCTTGNONE 
Os01g0367100AK068655TGTTGGGCTNONE 
AK101540TGTTGGGCTNONE 
AK101542TGTTGGGCTNONE 
AK119785TGTTGGGCTConserved hypothetical protein. 
Os01g0511600012-053-F10AGCCCAACANONE 
AK059042AGCCCAACANONE 
AK072161AGCCCAACAConserved hypothetical protein. 
J013132P06AGCCCAACANONE 
Os01g0512200J013067C10ATCCCCCACAAGCCCAACTNONE 
Os01g0590300014-089-E04AGCCCAACANONE 
AK063740AGCCCAACAConserved hypothetical protein. 
Os01g0604100AK099765AAATGGGCCGAGCCCAACTUspA domain containing protein. 
J013094O21AAATGGGCCGAGCCCAACTNONE 
Os01g0620100AK070122ACAGCCCAACTWD40-like domain containing protein. 
J023044A10ACAGCCCAACTNONE 
J033023C13ACAGCCCAACTNONE 
J033045E16ACAGCCCAACTNONE 
J033111H03ACAGCCCAACTNONE 
Os01g0707300AK059962TAAGCCCAACANONE 
AK104463TAAGCCCAACASimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0708600AK111377AGCCCAACTTransport protein particle (TRAPP) component, Bet3 family protein. 
J065006D07AGCCCAACTNONE 
J065007E03AGCCCAACTNONE 
J065015A13AGCCCAACTNONE 
J065093J17AGCCCAACTNONE 
J065116C09AGCCCAACTNONE 
J065120E04AGCCCAACTNONE 
J065197I17AGCCCAACTNONE 
J065208L13AGCCCAACTNONE 
J065213P07AGCCCAACTNONE 
J075056K07AGCCCAACTNONE 
J090036L08AGCCCAACTNONE 
Os01g0710800013-097-E05GGTTGGGCTTGAAGCCCAACNONE 
AK069973GGTTGGGCTTGAAGCCCAACNONE 
AK071099GGTTGGGCTTGAAGCCCAACConserved hypothetical protein. 
J023081K01GGTTGGGCTTGAAGCCCAACNONE 
J023123E16GGTTGGGCTTGAAGCCCAACNONE 
J033066B11GGTTGGGCTTGAAGCCCAACNONE 
J065144G11GGTTGGGCTTGAAGCCCAACNONE 
Os01g0749400AK064990AGCCCAACCNONE 
AK067731AGCCCAACCHAD-superfamily hydrolase subfamily IIB protein. 
AK103775AGCCCAACCNONE 
J023001B06AGCCCAACCNONE 
Os01g0765000AK101905AGCCCAACGGCCSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
AK101905TCAGCCCAGCCCAACSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0781000006-077-C12GTTGGGCTTANONE 
009-156-E02GTTGGGCTTANONE 
AK059870GTTGGGCTTAVacuolar protein sorting-associated, VPS28 family protein. 
AK099116GTTGGGCTTANONE 
AK104274GTTGGGCTTANONE 
J023034E12GTTGGGCTTANONE 
J075074G06GTTGGGCTTANONE 
J090041H03GTTGGGCTTANONE 
J100045K08GTTGGGCTTANONE 
Os01g0798500006-106-C11AGTTGGGCTNONE 
AK061244AGTTGGGCTNONE 
AK068219AGTTGGGCTMalate synthase-like family protein. 
J065199O16AGTTGGGCTNONE 
Os01g0813400006-025-B06TGTTGGGCTGGGCCGGGNONE 
006-030-C07TGTTGGGCTGGGCCGGGNONE 
006-068-F06TGTTGGGCTGGGCCGGGNONE 
006-096-E09TGTTGGGCTGGGCCGGGNONE 
006-097-B11TGTTGGGCTGGGCCGGGNONE 
006-104-H02TGTTGGGCTGGGCCGGGNONE 
AK062251TGTTGGGCTGGGCCGGGNONE 
AK065370TGTTGGGCTGGGCCGGGSimilar to ADP-ribosylation factor 1. 
J013022G24TGTTGGGCTGGGCCGGGNONE 
J013104C07TGTTGGGCTGGGCCGGGNONE 
J023074M17TGTTGGGCTGGGCCGGGNONE 
J043027C07TGTTGGGCTGGGCCGGGNONE 
J065026K05TGTTGGGCTGGGCCGGGNONE 
J065103I01TGTTGGGCTGGGCCGGGNONE 
J090025M17TGTTGGGCTGGGCCGGGNONE 
J100027L03TGTTGGGCTGGGCCGGGNONE 
J100054I20TGTTGGGCTGGGCCGGGNONE 
Os01g0825500AK060613AGTTGGGCTGGNONE 
AK072321AGTTGGGCTGGNONE 
AK103941AGTTGGGCTGGNodulin-like domain containing protein. 
J075053A14AGTTGGGCTGGNONE 
J075151J22AGTTGGGCTGGNONE 
J075174K14AGTTGGGCTGGNONE 
Os01g0833000AK067226CCAGCCCAACAProtein prenyltransferase domain containing protein. 
J013098M23CCAGCCCAACANONE 
Os01g0838300J090017B22CCAAGCCCAACTNONE 
J090061B04CCAAGCCCAACTNONE 
Os01g0840100006-095-C03GGTTGGGCTGCNONE 
011-075-F07GGTTGGGCTGCNONE 
012-010-A08GGTTGGGCTGCNONE 
012-035-A09GGTTGGGCTGCNONE 
014-010-B01GGTTGGGCTGCNONE 
014-011-H07GGTTGGGCTGCNONE 
014-040-F03GGTTGGGCTGCNONE 
014-077-C11GGTTGGGCTGCNONE 
014-078-C11GGTTGGGCTGCNONE 
014-097-A10GGTTGGGCTGCNONE 
014-097-D02GGTTGGGCTGCNONE 
014-100-D02GGTTGGGCTGCNONE 
015-012-H01GGTTGGGCTGCNONE 
015-049-G07GGTTGGGCTGCNONE 
015-066-C09GGTTGGGCTGCNONE 
016-033-C09GGTTGGGCTGCHeat shock protein Hsp70 family protein. 
016-084-F08GGTTGGGCTGCNONE 
J023037O13GGTTGGGCTGCNONE 
J033116B07GGTTGGGCTGCNONE 
J033121N13GGTTGGGCTGCNONE 
J065057F16GGTTGGGCTGCNONE 
J065112D05GGTTGGGCTGCNONE 
J065157G17GGTTGGGCTGCNONE 
J090014O03GGTTGGGCTGCNONE 
J090015K13GGTTGGGCTGCNONE 
J090021I21GGTTGGGCTGCNONE 
J090048D02GGTTGGGCTGCNONE 
J090054D14GGTTGGGCTGCNONE 
J090060J03GGTTGGGCTGCNONE 
J090063G01GGTTGGGCTGCNONE 
J090063H04GGTTGGGCTGCNONE 
J090063L13GGTTGGGCTGCNONE 
J090074E03GGTTGGGCTGCNONE 
J090096A03GGTTGGGCTGCNONE 
J090096I11GGTTGGGCTGCNONE 
J090099E16GGTTGGGCTGCNONE 
J100050G20GGTTGGGCTGCNONE 
Os01g0848300AK120668TCAGCCCAACAProtein prenyltransferase domain containing protein. 
Os01g0868300AB004461AGCCCAACSimilar to DNA polymerase alpha catalytic subunit (EC 2.7.7.7). 
Os01g0908100AK072293TGTTGGGCTTGRabGAP/TBC domain containing protein. 
J065010B13TGTTGGGCTTGNONE 
J065010M12TGTTGGGCTTGNONE 
J065047C19TGTTGGGCTTGNONE 
J065069B18TGTTGGGCTTGNONE 
J065071K24TGTTGGGCTTGNONE 
J065142P04TGTTGGGCTTGNONE 
J065170E11TGTTGGGCTTGNONE 
Os01g0960400AK111512CCAAGCCCAACTProtein kinase-like domain containing protein. 
Os01g0962400AK059165AGCCCAACCProtein of unknown function UPF0185 family protein. 
J013157N02AGCCCAACCNONE 
J065169F13AGCCCAACCNONE 
J065192L21AGCCCAACCNONE 
J075016P11AGCCCAACCNONE 
J075023M14AGCCCAACCNONE 
J075051K17AGCCCAACCNONE 
J075053O05AGCCCAACCNONE 
J075080D08AGCCCAACCNONE 
J075080P04AGCCCAACCNONE 
J075088B19AGCCCAACCNONE 
J075137L06AGCCCAACCNONE 
J100029C08AGCCCAACCNONE 
J100067J09AGCCCAACCNONE 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
Os01g0976100AK069646AGTTGGGCTTGABC transporter, transmembrane region domain containing protein. 
Os02g0119700AK108777AAAGCCCAACAProtein prenyltransferase domain containing protein. 
Os02g0121000AK099931TGTTGGGCTSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0167700AK069128AAAAGCCCAACCGCCCACCTArmadillo-like helical domain containing protein. 
Os02g0175800009-083-C02AGCCCAGCCCAACCNONE 
009-184-H07AGCCCAGCCCAACCNONE 
009-199-D07AGCCCAGCCCAACCNONE 
AK058292AGCCCAGCCCAACCNONE 
AK120215AGCCCAGCCCAACCConserved hypothetical protein. 
J013040G12AGCCCAGCCCAACCNONE 
J065050N21AGCCCAGCCCAACCNONE 
J065077O07AGCCCAGCCCAACCNONE 
J065102G05AGCCCAGCCCAACCNONE 
J065197A04AGCCCAGCCCAACCNONE 
J075024L24AGCCCAGCCCAACCNONE 
J075038K01AGCCCAGCCCAACCNONE 
J075044L04AGCCCAGCCCAACCNONE 
J075063D23AGCCCAGCCCAACCNONE 
J075079P13AGCCCAGCCCAACCNONE 
J075084G03AGCCCAGCCCAACCNONE 
J075135G07AGCCCAGCCCAACCNONE 
J075148D17AGCCCAGCCCAACCNONE 
J075150F13AGCCCAGCCCAACCNONE 
J075157F06AGCCCAGCCCAACCNONE 
J090054A05AGCCCAGCCCAACCNONE 
J090085O04AGCCCAGCCCAACCNONE 
J100023C04AGCCCAGCCCAACCNONE 
J100023H23AGCCCAGCCCAACCNONE 
J100026A16AGCCCAGCCCAACCNONE 
J100035K13AGCCCAGCCCAACCNONE 
Os02g0176300AK066588TGTTGGGCTTGGGCCTCGGCCCAGGConserved hypothetical protein. 
J013072N24TGTTGGGCTTGGGCCTCGGCCCAGGNONE 
Os02g0176400009-099-H11ACAGCCCAACCNONE 
009-099-H11AGCCCAACCAGGGCCCAAATNONE 
AK062746ACAGCCCAACCProtein of unknown function DUF872, eukaryotic family protein. 
AK062746AGCCCAACCAGGGCCCAAATProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0186700AK064492AAAGCCCAACTConserved hypothetical protein. 
J065210K09AAAGCCCAACTNONE 
J075006A17AAAGCCCAACTNONE 
J075108C18AAAGCCCAACTNONE 
J075153E08AAAGCCCAACTNONE 
Os02g0193600AK060499CCAAGCCCAACTMad3/BUB1 homology region 1 domain containing protein. 
Os02g0205000AK060003TGTTGGGCTTTNONE 
AK073514TGTTGGGCTTTRibosomal protein L19 family protein. 
J065106I07TGTTGGGCTTTNONE 
Os02g0220600AK103901AAGGCCCATTTCAGCCCAACANONE 
AK103901GGCCCGTTACAGCCCAACANONE 
J013058O03AAGGCCCATTTCAGCCCAACANONE 
J013058O03GGCCCGTTACAGCCCAACANONE 
J013124E21AAGGCCCATTTCAGCCCAACANONE 
J013124E21GGCCCGTTACAGCCCAACANONE 
J023023L03AAGGCCCATTTCAGCCCAACANONE 
J023023L03GGCCCGTTACAGCCCAACANONE 
J023023L21AAGGCCCATTTCAGCCCAACANONE 
J023023L21GGCCCGTTACAGCCCAACANONE 
J023061N01AAGGCCCATTTCAGCCCAACANONE 
J023061N01GGCCCGTTACAGCCCAACANONE 
J023065O09AAGGCCCATTTCAGCCCAACANONE 
J023065O09GGCCCGTTACAGCCCAACANONE 
J023106J17AAGGCCCATTTCAGCCCAACANONE 
J023106J17GGCCCGTTACAGCCCAACANONE 
J023119N08AAGGCCCATTTCAGCCCAACANONE 
J023119N08GGCCCGTTACAGCCCAACANONE 
J033058A19AAGGCCCATTTCAGCCCAACANONE 
J033058A19GGCCCGTTACAGCCCAACANONE 
J033098O13AAGGCCCATTTCAGCCCAACANONE 
J033098O13GGCCCGTTACAGCCCAACANONE 
J033100M18AAGGCCCATTTCAGCCCAACANONE 
J033100M18GGCCCGTTACAGCCCAACANONE 
J033125A21AAGGCCCATTTCAGCCCAACANONE 
J033125A21GGCCCGTTACAGCCCAACANONE 
J033148C12AAGGCCCATTTCAGCCCAACANONE 
J033148C12GGCCCGTTACAGCCCAACANONE 
J043017F03AAGGCCCATTTCAGCCCAACANONE 
J043017F03GGCCCGTTACAGCCCAACANONE 
J043032J02AAGGCCCATTTCAGCCCAACANONE 
J043032J02GGCCCGTTACAGCCCAACANONE 
J053047N10AAGGCCCATTTCAGCCCAACANONE 
J053047N10GGCCCGTTACAGCCCAACANONE 
J053089P04AAGGCCCATTTCAGCCCAACANONE 
J053089P04GGCCCGTTACAGCCCAACANONE 
J065051K09AAGGCCCATTTCAGCCCAACANONE 
J065051K09GGCCCGTTACAGCCCAACANONE 
J065064H24AAGGCCCATTTCAGCCCAACANONE 
J065064H24GGCCCGTTACAGCCCAACANONE 
J090001L06AAGGCCCATTTCAGCCCAACANONE 
J090001L06GGCCCGTTACAGCCCAACANONE 
J090017C24AAGGCCCATTTCAGCCCAACANONE 
J090017C24GGCCCGTTACAGCCCAACANONE 
J090058G15AAGGCCCATTTCAGCCCAACANONE 
J090058G15GGCCCGTTACAGCCCAACANONE 
J090058H23AAGGCCCATTTCAGCCCAACANONE 
J090058H23GGCCCGTTACAGCCCAACANONE 
J090061G20AAGGCCCATTTCAGCCCAACANONE 
J090061G20GGCCCGTTACAGCCCAACANONE 
J090069N23AAGGCCCATTTCAGCCCAACANONE 
J090069N23GGCCCGTTACAGCCCAACANONE 
J090071A08AAGGCCCATTTCAGCCCAACANONE 
J090071A08GGCCCGTTACAGCCCAACANONE 
J090074A08AAGGCCCATTTCAGCCCAACANONE 
J090074A08GGCCCGTTACAGCCCAACANONE 
J090077B15AAGGCCCATTTCAGCCCAACANONE 
J090077B15GGCCCGTTACAGCCCAACANONE 
J090081K06AAGGCCCATTTCAGCCCAACANONE 
J090081K06GGCCCGTTACAGCCCAACANONE 
J090083I05AAGGCCCATTTCAGCCCAACANONE 
J090083I05GGCCCGTTACAGCCCAACANONE 
J090091O22AAGGCCCATTTCAGCCCAACANONE 
J090091O22GGCCCGTTACAGCCCAACANONE 
J090097L10AAGGCCCATTTCAGCCCAACANONE 
J090097L10GGCCCGTTACAGCCCAACANONE 
J100026B11AAGGCCCATTTCAGCCCAACANONE 
J100026B11GGCCCGTTACAGCCCAACANONE 
J100044M01AAGGCCCATTTCAGCCCAACANONE 
J100044M01GGCCCGTTACAGCCCAACANONE 
J100046F10AAGGCCCATTTCAGCCCAACANONE 
J100046F10GGCCCGTTACAGCCCAACANONE 
J100051K14AAGGCCCATTTCAGCCCAACANONE 
J100051K14GGCCCGTTACAGCCCAACANONE 
J100060D22AAGGCCCATTTCAGCCCAACANONE 
J100060D22GGCCCGTTACAGCCCAACANONE 
J100060H18AAGGCCCATTTCAGCCCAACANONE 
J100060H18GGCCCGTTACAGCCCAACANONE 
J100070I06AAGGCCCATTTCAGCCCAACANONE 
J100070I06GGCCCGTTACAGCCCAACANONE 
J100071C04AAGGCCCATTTCAGCCCAACANONE 
J100071C04GGCCCGTTACAGCCCAACANONE 
J100078M13AAGGCCCATTTCAGCCCAACANONE 
J100078M13GGCCCGTTACAGCCCAACANONE 
J100080E17AAGGCCCATTTCAGCCCAACANONE 
J100080E17GGCCCGTTACAGCCCAACANONE 
J100083I09AAGGCCCATTTCAGCCCAACANONE 
J100083I09GGCCCGTTACAGCCCAACANONE 
Os02g0321000AK121840ACAGCCCAACCTetratricopeptide-like helical domain containing protein. 
Os02g0452800J043024P15AGCCCAACCConserved hypothetical protein. 
Os02g0580700AK073664AGTTGGGCTTCConserved hypothetical protein. 
J090060F24AGTTGGGCTTCNONE 
Os02g0618250009-115-E10CCAGCCCAACCNONE 
014-076-A03CCAGCCCAACCNONE 
J065096D10CCAGCCCAACCSimilar to H/ACA ribonucleoprotein complex subunit 3-like protein. 
J075045G01CCAGCCCAACCNONE 
J075092J11CCAGCCCAACCNONE 
J075134F02CCAGCCCAACCNONE 
Os02g0625500AK059188AGCCCAACTNONE 
Os02g0634700AK071869AGCCCAACCNONE 
J013129B13AGCCCAACCNONE 
J013134D24AGCCCAACCNONE 
Os02g0639800006-081-G07GGTTGGGCTTTNONE 
012-042-E02GGTTGGGCTTTNONE 
AK070367GGTTGGGCTTTNONE 
AK071904GGTTGGGCTTTZinc finger, RING-type domain containing protein. 
AK105980GGTTGGGCTTTNONE 
Os02g0651500AK066333ACAGCCCAACTNONE 
AK121865ACAGCCCAACTHypothetical protein. 
J090038J11ACAGCCCAACTNONE 
Os02g0672700AK059611AAGGCCCAACAAGCCCAACTDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179AAGGCCCAACAAGCCCAACTNONE 
J023098L23AAGGCCCAACAAGCCCAACTNONE 
J065042J21AAGGCCCAACAAGCCCAACTNONE 
J065187L09AAGGCCCAACAAGCCCAACTNONE 
J065190O10AAGGCCCAACAAGCCCAACTNONE 
J080041G14AAGGCCCAACAAGCCCAACTNONE 
J080078K08AAGGCCCAACAAGCCCAACTNONE 
J080089D20AAGGCCCAACAAGCCCAACTNONE 
J080094D04AAGGCCCAACAAGCCCAACTNONE 
Os02g0686600AK102917AGCCCAACAMetal-dependent protein hydrolase family protein. 
Os02g0688900AK066093GAAGCCCAACTGPI transamidase subunit PIG-U family protein. 
J065007D18GAAGCCCAACTNONE 
J065040G21GAAGCCCAACTNONE 
J065103G03GAAGCCCAACTNONE 
J065175F18GAAGCCCAACTNONE 
J065202A07GAAGCCCAACTNONE 
J075006C01GAAGCCCAACTNONE 
J075178F24GAAGCCCAACTNONE 
Os02g0697500AK105680AGCCCAACCSimilar to Selenium-binding protein-like. 
Os02g0721100AK108167TAAGCCCAACASimilar to E2 ubiquitin-conjugating enzyme UbcH5B (Fragment). 
Os02g0734300006-027-C05AGTTGGGCTNONE 
006-027-C11AGTTGGGCTNONE 
006-039-E12AGTTGGGCTNONE 
006-095-H04AGTTGGGCTNONE 
009-112-G07AGTTGGGCTNONE 
AK059780AGTTGGGCTSimilar to Nudix hydrolase 18, mitochondrial precursor (EC 3.6.1.-) (AtNUDT18). 
AK104571AGTTGGGCTNONE 
J065079N09AGTTGGGCTNONE 
J065188A17AGTTGGGCTNONE 
J065209B17AGTTGGGCTNONE 
Os02g0736500AK065166AAGGCCCATAAAAGCCCAACNicastrin family protein. 
J013099D16AAGGCCCATAAAAGCCCAACNONE 
Os02g0758200AK111266GCGCGCGAGCCCAACCConserved hypothetical protein. 
Os02g0761200011-009-C07AGCCCAACNONE 
AK073828AGCCCAACArmadillo-like helical domain containing protein. 
J033046N18AGCCCAACNONE 
J033068P04AGCCCAACNONE 
Os02g0762400AK103084GCAGCCCAACGGCCCyclin-dependent kinase inhibitor family protein. 
Os02g0772500AK100349AGCCCAACAProtein prenyltransferase domain containing protein. 
J023082M21AGCCCAACANONE 
J065047H11AGCCCAACANONE 
J065055F20AGCCCAACANONE 
J065082I22AGCCCAACANONE 
J100074B04AGCCCAACANONE 
Os02g0774300AK065228GCAGCCCAACASimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os02g0782200AK070439AGCCCAACTNONE 
AK101869AGCCCAACTNOT2/NOT3/NOT5 domain containing protein. 
Os02g0796900009-121-E06AGCCCAACANONE 
D29725AGCCCAACASimilar to 60S ribosomal protein L39. 
J075016N24AGCCCAACANONE 
J075085F03AGCCCAACANONE 
J075147P11AGCCCAACANONE 
J075180E16AGCCCAACANONE 
J075182A19AGCCCAACANONE 
Os02g0799300AK064917GCCACGTGGGCAGCCCAACAConserved hypothetical protein. 
Os02g0821200AK062099AGCCCAACARibosomal L28e protein family protein. 
J013108I22AGCCCAACANONE 
J023064L18AGCCCAACANONE 
J023115G17AGCCCAACANONE 
J033093D09AGCCCAACANONE 
J053025G17AGCCCAACANONE 
J053054J01AGCCCAACANONE 
J065095B03AGCCCAACANONE 
J065110E08AGCCCAACANONE 
J065114F23AGCCCAACANONE 
J065152G14AGCCCAACANONE 
J080022M24AGCCCAACANONE 
J080041G10AGCCCAACANONE 
J080043E22AGCCCAACANONE 
J080046G15AGCCCAACANONE 
J090018A08AGCCCAACANONE 
J090067B05AGCCCAACANONE 
J090088G12AGCCCAACANONE 
J100042G06AGCCCAACANONE 
J100066H17AGCCCAACANONE 
J100068M21AGCCCAACANONE 
Os02g0827300AK069159GGCCCGGCCCACGAGCCCAACCProtein of unknown function DUF382 domain containing protein. 
Os02g0829900009-044-G07GCCGGCCCAGCCCAACANONE 
AK120917GCCGGCCCAGCCCAACASimilar to BRICK1. 
AY224582GCCGGCCCAGCCCAACANONE 
J023034L01GCCGGCCCAGCCCAACANONE 
J023034M01GCCGGCCCAGCCCAACANONE 
J090010G06GCCGGCCCAGCCCAACANONE 
J090020D07GCCGGCCCAGCCCAACANONE 
J100041L04GCCGGCCCAGCCCAACANONE 
J100061D05GCCGGCCCAGCCCAACANONE 
J100070L18GCCGGCCCAGCCCAACANONE 
Os02g0830000011-075-D11TGTTGGGCTGGGCCGGCNONE 
AK101841TGTTGGGCTGGGCCGGCProtein prenyltransferase domain containing protein. 
J033069G13TGTTGGGCTGGGCCGGCNONE 
Os03g0121300AK120047TCAGCCCAACTNONE 
Os03g0124300AK069148CAAGCCCAACCConserved hypothetical protein. 
AK106076CAAGCCCAACCNONE 
J023003G19CAAGCCCAACCNONE 
Os03g0151800AK064955AGCCCAACCNONE 
AK098874AGCCCAACCNONE 
AK098980AGCCCAACCNONE 
AK099712AGCCCAACCNONE 
AK099889AGCCCAACCNONE 
AK121641AGCCCAACCSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05AGCCCAACCNONE 
J013001D04AGCCCAACCNONE 
J013121O12AGCCCAACCNONE 
Os03g0152800AK066205AGTTGGGCTProtein kinase-like domain containing protein. 
AK100518AGTTGGGCTNONE 
Os03g0172200AK069130AGCCCAACTArmadillo-like helical domain containing protein. 
Os03g0198400AK059522GGTTGGGCTGTNONE 
AK103101GGTTGGGCTGTSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19GGTTGGGCTGTNONE 
J075036K08GGTTGGGCTGTNONE 
J075040J23GGTTGGGCTGTNONE 
J075041H18GGTTGGGCTGTNONE 
J075053H18GGTTGGGCTGTNONE 
J075055K15GGTTGGGCTGTNONE 
J075111K03GGTTGGGCTGTNONE 
J075125B22GGTTGGGCTGTNONE 
J075195L10GGTTGGGCTGTNONE 
Os03g0220100006-023-B05GCAGCCCAACNONE 
006-034-F08GCAGCCCAACNONE 
006-093-A02GCAGCCCAACNONE 
006-093-A06GCAGCCCAACNONE 
011-078-E04GCAGCCCAACNONE 
012-092-C04GCAGCCCAACNONE 
AK066587GCAGCCCAACSimilar to Very-long-chain fatty acid condensing enzyme CUT1. 
AK104714GCAGCCCAACNONE 
AK106150GCAGCCCAACNONE 
J013067C12GCAGCCCAACNONE 
J013074H08GCAGCCCAACNONE 
J013124K13GCAGCCCAACNONE 
J065007A03GCAGCCCAACNONE 
J065037H21GCAGCCCAACNONE 
J065081F03GCAGCCCAACNONE 
J090074C06GCAGCCCAACNONE 
Os03g0240700009-086-G10AATGGGCCTAGCCCAACANONE 
AK071799AATGGGCCTAGCCCAACAConserved hypothetical protein. 
J023112A13AATGGGCCTAGCCCAACANONE 
J043022A01AATGGGCCTAGCCCAACANONE 
J065106A01AATGGGCCTAGCCCAACANONE 
J075023P22AATGGGCCTAGCCCAACANONE 
J075138I21AATGGGCCTAGCCCAACANONE 
J075173L02AATGGGCCTAGCCCAACANONE 
Os03g0240800006-092-D05TGTTGGGCTAGGCCCATTNONE 
AK059292TGTTGGGCTAGGCCCATTNONE 
AK061178TGTTGGGCTAGGCCCATTSimilar to AGL157Cp. 
AK121552TGTTGGGCTAGGCCCATTNONE 
J023131D06TGTTGGGCTAGGCCCATTNONE 
J033033E14TGTTGGGCTAGGCCCATTNONE 
J033105B01TGTTGGGCTAGGCCCATTNONE 
J033114L18TGTTGGGCTAGGCCCATTNONE 
J033132N24TGTTGGGCTAGGCCCATTNONE 
J065032H03TGTTGGGCTAGGCCCATTNONE 
J065115J20TGTTGGGCTAGGCCCATTNONE 
J065150C05TGTTGGGCTAGGCCCATTNONE 
J080302A11TGTTGGGCTAGGCCCATTNONE 
J080302H16TGTTGGGCTAGGCCCATTNONE 
J080305M12TGTTGGGCTAGGCCCATTNONE 
J080306F13TGTTGGGCTAGGCCCATTNONE 
J080312A06TGTTGGGCTAGGCCCATTNONE 
J090088P09TGTTGGGCTAGGCCCATTNONE 
Os03g0255200AK058212GGTTGGGCTGGGCCCAATTNONE 
AK071625GGTTGGGCTGGGCCCAATTHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0260100AK066143TCAGCCCAACAConserved hypothetical protein. 
Os03g0268300AK102684TAGGCCCAAGCCCAACCSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22TAGGCCCAAGCCCAACCNONE 
J013057J23TAGGCCCAAGCCCAACCNONE 
J013149I10TAGGCCCAAGCCCAACCNONE 
J013149M20TAGGCCCAAGCCCAACCNONE 
J013151D14TAGGCCCAAGCCCAACCNONE 
J013162O11TAGGCCCAAGCCCAACCNONE 
J023001F12TAGGCCCAAGCCCAACCNONE 
J023031B21TAGGCCCAAGCCCAACCNONE 
J023080A07TAGGCCCAAGCCCAACCNONE 
J023081N04TAGGCCCAAGCCCAACCNONE 
J023090C08TAGGCCCAAGCCCAACCNONE 
J023134G05TAGGCCCAAGCCCAACCNONE 
J023139G17TAGGCCCAAGCCCAACCNONE 
J023143I10TAGGCCCAAGCCCAACCNONE 
J023147D04TAGGCCCAAGCCCAACCNONE 
J023147O15TAGGCCCAAGCCCAACCNONE 
J033102K23TAGGCCCAAGCCCAACCNONE 
J033106C17TAGGCCCAAGCCCAACCNONE 
J075033G19TAGGCCCAAGCCCAACCNONE 
J075039J18TAGGCCCAAGCCCAACCNONE 
J075050K20TAGGCCCAAGCCCAACCNONE 
J075075J03TAGGCCCAAGCCCAACCNONE 
J075080E16TAGGCCCAAGCCCAACCNONE 
J075086L08TAGGCCCAAGCCCAACCNONE 
J075091K19TAGGCCCAAGCCCAACCNONE 
J075099O20TAGGCCCAAGCCCAACCNONE 
J075104I06TAGGCCCAAGCCCAACCNONE 
J075137C16TAGGCCCAAGCCCAACCNONE 
J075152G03TAGGCCCAAGCCCAACCNONE 
J075176N12TAGGCCCAAGCCCAACCNONE 
J100086K11TAGGCCCAAGCCCAACCNONE 
Os03g0287900009-074-B07TCCGGGCCAGCCCAACCNONE 
014-027-E07TCCGGGCCAGCCCAACCNONE 
AK063663TCCGGGCCAGCCCAACCSimilar to Protein disulfide isomerase. 
J065009N21TCCGGGCCAGCCCAACCNONE 
Os03g0297400AK060653ACAGCCCAACNONE 
AK061403ACAGCCCAACNONE 
AK101597ACAGCCCAACMalonyl CoA-acyl carrier protein transacylase family protein. 
Os03g0309800004-019-H07CTTGGGCCCAAGCCCAACNONE 
AK060922CTTGGGCCCAAGCCCAACNONE 
AK098942CTTGGGCCCAAGCCCAACNONE 
AK106141CTTGGGCCCAAGCCCAACNONE 
AK111530CTTGGGCCCAAGCCCAACNONE 
AK111624CTTGGGCCCAAGCCCAACSimilar to PPR2. 
J013024C10CTTGGGCCCAAGCCCAACNONE 
J013043D15CTTGGGCCCAAGCCCAACNONE 
J013108I11CTTGGGCCCAAGCCCAACNONE 
J100058L07CTTGGGCCCAAGCCCAACNONE 
J100071I19CTTGGGCCCAAGCCCAACNONE 
Os03g0335300AK098846TAAGCCCAACCNONE 
AK098891TAAGCCCAACCNONE 
AK111509TAAGCCCAACCSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847TAAGCCCAACCNONE 
AK121413TAAGCCCAACCNONE 
Os03g0372700AK064323AGTTGGGCTTANONE 
AK073312AGTTGGGCTTALow temperature viability protein family protein. 
Os03g0388000009-082-H03TGTTGGGCTGCNONE 
AK062658TGTTGGGCTGCNONE 
Os03g0411500AK058696CCCAGCCCAGCCCAACCNONE 
AK071057CCCAGCCCAGCCCAACCPeptidase S14, ClpP family protein. 
Os03g0566800AK103270GCAGCCCAACTSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18GCAGCCCAACTNONE 
J023136P06GCAGCCCAACTNONE 
J033081A22GCAGCCCAACTNONE 
J033109N12GCAGCCCAACTNONE 
J033124H10GCAGCCCAACTNONE 
J033141B09GCAGCCCAACTNONE 
J090026G23GCAGCCCAACTNONE 
J090077J20GCAGCCCAACTNONE 
Os03g0579000AK061586AGCCCAACANONE 
AK072995AGCCCAACAPeptidase M50, putative membrane-associated zinc metallopeptidase family protein. 
Os03g0588200011-005-E04AGCCCAACTNONE 
AK120221AGCCCAACTFrigida-like family protein. 
J100086E17AGCCCAACTNONE 
Os03g0612600009-073-H01CCAAGCCCAACTNONE 
AK071403CCAAGCCCAACTRibosomal protein L25-like domain containing protein. 
Os03g0625900AK101109AAAAGCCCAACAGGGCCCATATWD40-like domain containing protein. 
Os03g0626250J075100A11AGTTGGGCTTTNONE 
J075134H15AGTTGGGCTTTNONE 
J075142J02AGTTGGGCTTTNONE 
J075181A14AGTTGGGCTTTNONE 
J075192K17AGTTGGGCTTTNONE 
J090046B06AGTTGGGCTTTNONE 
Os03g0647500015-025-E10AGTTGGGCTGGGCCGTANONE 
AK064308AGTTGGGCTGGGCCGTAConserved hypothetical protein. 
AK103649AGTTGGGCTGGGCCGTANONE 
J033135D01AGTTGGGCTGGGCCGTANONE 
Os03g0647800003-103-H03ACAGCCCAACANONE 
003-103-H03TCAGCCCAACCNONE 
006-104-G09ACAGCCCAACANONE 
006-104-G09TCAGCCCAACCNONE 
AK070243ACAGCCCAACAConserved hypothetical protein. 
AK070243TCAGCCCAACCConserved hypothetical protein. 
J100056F22ACAGCCCAACANONE 
J100056F22TCAGCCCAACCNONE 
Os03g0668900AK108369AGTTGGGCTConserved hypothetical protein. 
Os03g0698900013-074-A08AAAGCCCAACANONE 
AK073303AAAGCCCAACAAlkaline phytoceramidase family protein. 
AK103953AAAGCCCAACANONE 
J033024P22AAAGCCCAACANONE 
J065194N16AAAGCCCAACANONE 
J065195O11AAAGCCCAACANONE 
J075020F03AAAGCCCAACANONE 
J075032P18AAAGCCCAACANONE 
J075037H13AAAGCCCAACANONE 
J075147I01AAAGCCCAACANONE 
J075187B13AAAGCCCAACANONE 
J100043G08AAAGCCCAACANONE 
J100060L06AAAGCCCAACANONE 
J100063O21AAAGCCCAACANONE 
J100066O13AAAGCCCAACANONE 
J100072K20AAAGCCCAACANONE 
J100083G21AAAGCCCAACANONE 
J100085D07AAAGCCCAACANONE 
Os03g0699200005-016-G07TCAGCCCAACCCAAGGCCCNONE 
AK066652TCAGCCCAACCCAAGGCCCPescadillo, N-terminal domain containing protein. 
AK099383TCAGCCCAACCCAAGGCCCNONE 
J013069A12TCAGCCCAACCCAAGGCCCNONE 
J033085M11TCAGCCCAACCCAAGGCCCNONE 
J033111P09TCAGCCCAACCCAAGGCCCNONE 
J033128H17TCAGCCCAACCCAAGGCCCNONE 
Os03g0719100AK065127TAGGCCCATCCAAGCCCAACADNA-binding SAP domain containing protein. 
J013001P07TAGGCCCATCCAAGCCCAACANONE 
J065102J01TAGGCCCATCCAAGCCCAACANONE 
J065205K05TAGGCCCATCCAAGCCCAACANONE 
Os03g0725400015-060-D03AAAAGCCCAACTNONE 
AK105499AAAAGCCCAACTSimilar to WD-repeat protein 5 (BMP2-induced 3-kb gene protein) (WD-repeat protein BIG-3). 
AK111860AAAAGCCCAACTNONE 
AK112085AAAAGCCCAACTNONE 
J100068K06AAAAGCCCAACTNONE 
J100073K24AAAAGCCCAACTNONE 
J100084M24AAAAGCCCAACTNONE 
Os03g0746400AK063445TGTTGGGCTTGProtein prenyltransferase domain containing protein. 
AK070923TGTTGGGCTTGNONE 
J065008K24TGTTGGGCTTGNONE 
Os03g0758700AK106620AAAGCCCAACAWD40-like domain containing protein. 
Os03g0786000AK061286AGCCCAACTConserved hypothetical protein. 
AK073187AGCCCAACTNONE 
Os03g0786600AK109838AGCCCAACAProtein of unknown function DUF860, plant family protein. 
Os03g0787100006-022-G04AGCCCAACANONE 
AK110858AGCCCAACAConserved hypothetical protein. 
J065197C24AGCCCAACANONE 
J075147E03AGCCCAACANONE 
J100065K06AGCCCAACANONE 
Os03g0794800AK070933AGCCCAACCSimilar to XRN3. 
Os03g0797700005-001-F11GCCCACGCGGCCCAGCCCAACCNONE 
AK061648GCCCACGCGGCCCAGCCCAACCConserved hypothetical protein. 
AK098876GCCCACGCGGCCCAGCCCAACCNONE 
J013001D18GCCCACGCGGCCCAGCCCAACCNONE 
J033070I21GCCCACGCGGCCCAGCCCAACCNONE 
J065124F13GCCCACGCGGCCCAGCCCAACCNONE 
J065218D02GCCCACGCGGCCCAGCCCAACCNONE 
J090080A22GCCCACGCGGCCCAGCCCAACCNONE 
J100032P18GCCCACGCGGCCCAGCCCAACCNONE 
Os03g0844100AK067164CCAGCCCAACCSimilar to Pti1 kinase-like protein. 
Os03g0845700009-075-D05AGTTGGGCTGGNONE 
AK062622AGTTGGGCTGGSimilar to RPB17 (Fragment). 
J065068H03AGTTGGGCTGGNONE 
J065075A18AGTTGGGCTGGNONE 
J065118C19AGTTGGGCTGGNONE 
J075001B15AGTTGGGCTGGNONE 
J075048D11AGTTGGGCTGGNONE 
J075056D01AGTTGGGCTGGNONE 
J075092P03AGTTGGGCTGGNONE 
J075111I04AGTTGGGCTGGNONE 
Os03g0847500AK073859AGCCCAACTSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0848100J013028M09TGTTGGGCTGGGCTTCNONE 
J065080L17TGTTGGGCTGGGCTTCNONE 
J065083C11TGTTGGGCTGGGCTTCNONE 
Os03g0855700AK070400AGCCCAACANucleic acid-binding, OB-fold domain containing protein. 
Os04g0329500015-081-E12TCAGCCCAACANONE 
AK064343TCAGCCCAACAProtein of unknown function DUF295 family protein. 
AK073994TCAGCCCAACANONE 
J033072H16TCAGCCCAACANONE 
Os04g0337500AK061807GGTTGGGCTTANONE 
Os04g0389800AK109628GAAGCCCAACASimilar to Acetohydroxyacid synthase. 
Os04g0459500003-112-C04GTTGGGCTNONE 
005-007-G12GTTGGGCTNONE 
006-024-D09GTTGGGCTNONE 
006-029-A05GTTGGGCTNONE 
006-034-D04GTTGGGCTNONE 
006-035-A02GTTGGGCTNONE 
006-050-A04GTTGGGCTNONE 
006-055-D10GTTGGGCTNONE 
006-080-D10GTTGGGCTNONE 
006-087-F05GTTGGGCTNONE 
006-100-C06GTTGGGCTNONE 
006-101-H02GTTGGGCTNONE 
006-104-F04GTTGGGCTNONE 
006-106-G10GTTGGGCTNONE 
006-109-H05GTTGGGCTNONE 
006-111-E04GTTGGGCTNONE 
006-120-B05GTTGGGCTNONE 
013-002-F12GTTGGGCTNONE 
013-056-G09GTTGGGCTNONE 
013-089-G12GTTGGGCTNONE 
013-096-D05GTTGGGCTNONE 
014-045-E08GTTGGGCTNONE 
014-047-D08GTTGGGCTNONE 
AF010582GTTGGGCTNONE 
AF022730GTTGGGCTNONE 
AK067817GTTGGGCTNONE 
AK071685GTTGGGCTSimilar to GADPH (383 AA) (Fragment). 
AK103922GTTGGGCTNONE 
AK103932GTTGGGCTNONE 
AK103994GTTGGGCTNONE 
AK104690GTTGGGCTNONE 
AK119220GTTGGGCTNONE 
AK119522GTTGGGCTNONE 
J013089O16GTTGGGCTNONE 
J013091G09GTTGGGCTNONE 
J013154K22GTTGGGCTNONE 
J023001G11GTTGGGCTNONE 
J023012E14GTTGGGCTNONE 
J023087K19GTTGGGCTNONE 
J023108H17GTTGGGCTNONE 
J065001P05GTTGGGCTNONE 
J065001P20GTTGGGCTNONE 
J065005D17GTTGGGCTNONE 
J065005E14GTTGGGCTNONE 
J065009H11GTTGGGCTNONE 
J065017E02GTTGGGCTNONE 
J065021C13GTTGGGCTNONE 
J065021K14GTTGGGCTNONE 
J065023K19GTTGGGCTNONE 
J065039F09GTTGGGCTNONE 
J065039F13GTTGGGCTNONE 
J065043D11GTTGGGCTNONE 
J065055I15GTTGGGCTNONE 
J065055L02GTTGGGCTNONE 
J065059E24GTTGGGCTNONE 
J065059O20GTTGGGCTNONE 
J065062E22GTTGGGCTNONE 
J065093F24GTTGGGCTNONE 
J065097B02GTTGGGCTNONE 
J065099J02GTTGGGCTNONE 
J065102P12GTTGGGCTNONE 
J065104I07GTTGGGCTNONE 
J065118A15GTTGGGCTNONE 
J065118F09GTTGGGCTNONE 
J065122J12GTTGGGCTNONE 
J065124F06GTTGGGCTNONE 
J065124G17GTTGGGCTNONE 
J065132K22GTTGGGCTNONE 
J065157C08GTTGGGCTNONE 
J065162K20GTTGGGCTNONE 
J065163D15GTTGGGCTNONE 
J065171K06GTTGGGCTNONE 
J065180G19GTTGGGCTNONE 
J065182H17GTTGGGCTNONE 
J065182O14GTTGGGCTNONE 
J065186H16GTTGGGCTNONE 
J065191B03GTTGGGCTNONE 
J065196I19GTTGGGCTNONE 
J065198E21GTTGGGCTNONE 
J065198M07GTTGGGCTNONE 
J065210M16GTTGGGCTNONE 
J065218M12GTTGGGCTNONE 
J075001K03GTTGGGCTNONE 
J075002E04GTTGGGCTNONE 
J075003K20GTTGGGCTNONE 
J075004D03GTTGGGCTNONE 
J075005G14GTTGGGCTNONE 
J075015K12GTTGGGCTNONE 
J075021B19GTTGGGCTNONE 
J075026J17GTTGGGCTNONE 
J075027I04GTTGGGCTNONE 
J075035E15GTTGGGCTNONE 
J075038I04GTTGGGCTNONE 
J075040F02GTTGGGCTNONE 
J075041G10GTTGGGCTNONE 
J075045H10GTTGGGCTNONE 
J075048M01GTTGGGCTNONE 
J075048P09GTTGGGCTNONE 
J075055P04GTTGGGCTNONE 
J075056H01GTTGGGCTNONE 
J075063P11GTTGGGCTNONE 
J075067E11GTTGGGCTNONE 
J075072N21GTTGGGCTNONE 
J075076C07GTTGGGCTNONE 
J075081G19GTTGGGCTNONE 
J075092C11GTTGGGCTNONE 
J075092E20GTTGGGCTNONE 
J075093K19GTTGGGCTNONE 
J075094E17GTTGGGCTNONE 
J075094H19GTTGGGCTNONE 
J075095M01GTTGGGCTNONE 
J075098B01GTTGGGCTNONE 
J075106G19GTTGGGCTNONE 
J075112B05GTTGGGCTNONE 
J075114C05GTTGGGCTNONE 
J075114H06GTTGGGCTNONE 
J075114P03GTTGGGCTNONE 
J075115D19GTTGGGCTNONE 
J075121B06GTTGGGCTNONE 
J075123B08GTTGGGCTNONE 
J075126A06GTTGGGCTNONE 
J075127C21GTTGGGCTNONE 
J075127O10GTTGGGCTNONE 
J075130C17GTTGGGCTNONE 
J075132M23GTTGGGCTNONE 
J075136M23GTTGGGCTNONE 
J075142B11GTTGGGCTNONE 
J075144A21GTTGGGCTNONE 
J075151O07GTTGGGCTNONE 
J075161F16GTTGGGCTNONE 
J075166O12GTTGGGCTNONE 
J075173C13GTTGGGCTNONE 
J075178H13GTTGGGCTNONE 
J075181N24GTTGGGCTNONE 
J075186B02GTTGGGCTNONE 
J075191N15GTTGGGCTNONE 
J075193E05GTTGGGCTNONE 
J075197G18GTTGGGCTNONE 
J080305C13GTTGGGCTNONE 
J080310D22GTTGGGCTNONE 
J090010A06GTTGGGCTNONE 
J090046C20GTTGGGCTNONE 
J090070D07GTTGGGCTNONE 
J100035D02GTTGGGCTNONE 
J100050N01GTTGGGCTNONE 
Os04g0480900AK109889AGTTGGGCTTTGGGCCCCAGlycoside hydrolase, family 5 protein. 
Os04g0520900AK068793AGTTGGGCTProtein prenyltransferase domain containing protein. 
AK105606AGTTGGGCTNONE 
Os04g0521800006-043-D11AGTTGGGCTGCNONE 
AK061536AGTTGGGCTGCNONE 
AK102934AGTTGGGCTGCPeptidase M20 family protein. 
AK103369AGTTGGGCTGCNONE 
Os04g0542900AK068610TCAGCCCAACConserved hypothetical protein. 
Os04g0552700AK121993GGTTGGGCTTGGZinc finger, C2H2-type domain containing protein. 
J053047K15GGTTGGGCTTGGNONE 
Os04g0577500006-039-C03ACAGCCCAACNONE 
006-043-H01ACAGCCCAACNONE 
AK061538ACAGCCCAACNONE 
AK065648ACAGCCCAACTatD-related deoxyribonuclease family protein. 
AK104763ACAGCCCAACNONE 
J013035E21ACAGCCCAACNONE 
J013066M11ACAGCCCAACNONE 
J100026B02ACAGCCCAACNONE 
Os04g0628400AK066078AGTTGGGCTZinc finger, BED-type predicted domain containing protein. 
AK066646AGTTGGGCTNONE 
AK072594AGTTGGGCTNONE 
AK099285AGTTGGGCTNONE 
J013038N11AGTTGGGCTNONE 
J013050K18AGTTGGGCTNONE 
J013071L19AGTTGGGCTNONE 
J013073C07AGTTGGGCTNONE 
J023010K10AGTTGGGCTNONE 
J023038B03AGTTGGGCTNONE 
J023102J09AGTTGGGCTNONE 
J023125J12AGTTGGGCTNONE 
J023125K02AGTTGGGCTNONE 
J023128I11AGTTGGGCTNONE 
J033023L05AGTTGGGCTNONE 
J033024K18AGTTGGGCTNONE 
J033042O09AGTTGGGCTNONE 
J033067N22AGTTGGGCTNONE 
J033090M03AGTTGGGCTNONE 
J033109I15AGTTGGGCTNONE 
J043005H11AGTTGGGCTNONE 
J043005M07AGTTGGGCTNONE 
J075135F23AGTTGGGCTNONE 
J075146I06AGTTGGGCTNONE 
J090018O03AGTTGGGCTNONE 
J090055C24AGTTGGGCTNONE 
J090060F07AGTTGGGCTNONE 
J090062K21AGTTGGGCTNONE 
J090074G05AGTTGGGCTNONE 
J090079L20AGTTGGGCTNONE 
J090087I23AGTTGGGCTNONE 
Os04g0636900011-028-G03TTGTGGGCTGTTGGGCTNONE 
012-040-G03TTGTGGGCTGTTGGGCTNONE 
AK058405TTGTGGGCTGTTGGGCTNONE 
AK065789TTGTGGGCTGTTGGGCTNONE 
AK101408TTGTGGGCTGTTGGGCTNONE 
AK119286TTGTGGGCTGTTGGGCTNONE 
J013042J24TTGTGGGCTGTTGGGCTNONE 
J033037I12TTGTGGGCTGTTGGGCTNONE 
J043031B12TTGTGGGCTGTTGGGCTNONE 
J065152N10TTGTGGGCTGTTGGGCTNONE 
J090060K17TTGTGGGCTGTTGGGCTNONE 
J090083K14TTGTGGGCTGTTGGGCTNONE 
J100046O13TTGTGGGCTGTTGGGCTNONE 
J100066G22TTGTGGGCTGTTGGGCTNONE 
Os04g0637500AK108202AGCCCAACCMitochodrial transcription termination factor-related family protein. 
J065163A11AGCCCAACCNONE 
Os04g0641300AK071780TAAGCCCAACTGlutaredoxin domain containing protein. 
J023114E02TAAGCCCAACTNONE 
Os04g0661300AK070723ACAGCCCAACACGGCCCATGGConserved hypothetical protein. 
AK103942ACAGCCCAACACGGCCCATGGNONE 
Os04g0661900006-090-F11GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J053077D04GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J090095N01GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J100039F24GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
Os04g0665000009-149-A12TGTTGGGCTGGNONE 
AK062995TGTTGGGCTGGCHCH domain containing protein. 
J065017G19TGTTGGGCTGGNONE 
J080301G12TGTTGGGCTGGNONE 
Os04g0665700013-084-D06GAGGCCCAAAGCCCAACTNONE 
AK121951GAGGCCCAAAGCCCAACTZinc finger, CCCH-type domain containing protein. 
J013020L20GAGGCCCAAAGCCCAACTNONE 
J033034K12GAGGCCCAAAGCCCAACTNONE 
J033107K04GAGGCCCAAAGCCCAACTNONE 
J065044C03GAGGCCCAAAGCCCAACTNONE 
J065103I10GAGGCCCAAAGCCCAACTNONE 
J065106P15GAGGCCCAAAGCCCAACTNONE 
J075061O20GAGGCCCAAAGCCCAACTNONE 
J075091P11GAGGCCCAAAGCCCAACTNONE 
J075095A18GAGGCCCAAAGCCCAACTNONE 
J075117C22GAGGCCCAAAGCCCAACTNONE 
J075166B22GAGGCCCAAAGCCCAACTNONE 
J075198L04GAGGCCCAAAGCCCAACTNONE 
J090032K13GAGGCCCAAAGCCCAACTNONE 
J090045E22GAGGCCCAAAGCCCAACTNONE 
Os04g0669300AK071148GAAGCCCAACADynamin family protein. 
Os04g0674100J080097J12AGTTGGGCTThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965AGCCCAACTNONE 
AK103795AGCCCAACTCoenzyme Q biosynthesis Coq4 family protein. 
J033076F14AGCCCAACTNONE 
J065020P20AGCCCAACTNONE 
J065057I21AGCCCAACTNONE 
J065059P11AGCCCAACTNONE 
J065083A22AGCCCAACTNONE 
J065093K10AGCCCAACTNONE 
J065097D03AGCCCAACTNONE 
J065103P05AGCCCAACTNONE 
J065113K09AGCCCAACTNONE 
J065118F23AGCCCAACTNONE 
J065119M06AGCCCAACTNONE 
J065146K17AGCCCAACTNONE 
J065161N12AGCCCAACTNONE 
J065169L02AGCCCAACTNONE 
J065189H12AGCCCAACTNONE 
J065192E24AGCCCAACTNONE 
J065193K17AGCCCAACTNONE 
J065197O21AGCCCAACTNONE 
J065214D09AGCCCAACTNONE 
J065217B11AGCCCAACTNONE 
J075132K07AGCCCAACTNONE 
J100059D14AGCCCAACTNONE 
Os05g0101400009-126-G06AGTTGGGCTTGGGCCGCNONE 
AK067481AGTTGGGCTTGGGCCGCSimilar to 50S ribosomal protein L28, chloroplast precursor. 
J065124O10AGTTGGGCTTGGGCCGCNONE 
J065186D05AGTTGGGCTTGGGCCGCNONE 
J065193A14AGTTGGGCTTGGGCCGCNONE 
J075082A02AGTTGGGCTTGGGCCGCNONE 
J075100F11AGTTGGGCTTGGGCCGCNONE 
J075111O16AGTTGGGCTTGGGCCGCNONE 
J075172I24AGTTGGGCTTGGGCCGCNONE 
Os05g0137600AK099427TGTTGGGCTTCConserved hypothetical protein. 
Os05g0140800AK110652CCAGCCCAACCSimilar to Dormancy related protein (Fragment). 
J075019K14CCAGCCCAACCNONE 
J075020O11CCAGCCCAACCNONE 
J075028P06CCAGCCCAACCNONE 
J075050A16CCAGCCCAACCNONE 
J075051F18CCAGCCCAACCNONE 
J075085K03CCAGCCCAACCNONE 
J075112P22CCAGCCCAACCNONE 
J075118I09CCAGCCCAACCNONE 
J075144H09CCAGCCCAACCNONE 
J075166I07CCAGCCCAACCNONE 
J075191J02CCAGCCCAACCNONE 
J075195I23CCAGCCCAACCNONE 
Os05g0148300009-031-A08CCCAGCCCAACCNONE 
AK062421CCCAGCCCAACCRibosomal protein S27, mitochondrial family protein. 
Os05g0152400Os05g0152400AGTTGGGCTGlycosyl transferase, family 14 protein. 
Os05g0161400AK105485AAAAGCCCAACTPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0227700AK067567AGTTGGGCTTGGACCGGCCCGTTConserved hypothetical protein. 
AK068760AGTTGGGCTTGGACCGGCCCGTTNONE 
J013108C14AGTTGGGCTTGGACCGGCCCGTTNONE 
Os05g0335800AK108393CCAAGCCCAACATGF-beta receptor, type I/II extracellular region family protein. 
Os05g0348100006-028-F04ATCGGACGGCCCATGTAGCCCAACTNONE 
009-036-C03ATCGGACGGCCCATGTAGCCCAACTNONE 
009-040-H02ATCGGACGGCCCATGTAGCCCAACTNONE 
009-173-H12ATCGGACGGCCCATGTAGCCCAACTNONE 
AK061434ATCGGACGGCCCATGTAGCCCAACTConserved hypothetical protein. 
J065137N04ATCGGACGGCCCATGTAGCCCAACTNONE 
J065164C10ATCGGACGGCCCATGTAGCCCAACTNONE 
J065210H22ATCGGACGGCCCATGTAGCCCAACTNONE 
Os05g0377000Os05g0377000GCCCATGAAGTTGGGCTSimilar to Acyl carrier protein (ACP). 
Os05g0427200AK070830ACAGCCCAACANONE 
AK106896ACAGCCCAACAGlycosyl transferase, family 31 protein. 
Os05g0443300Os05g0443300AGTTGGGCTGCSec23/Sec24 trunk region domain containing protein. 
Os05g0453500012-003-F05ACAGCCCAACNONE 
AK102175ACAGCCCAACConserved hypothetical protein. 
J033086K19ACAGCCCAACNONE 
Os05g0456000AK058420AGCCCAACAMitochondrial glycoprotein family protein. 
AK102036AGCCCAACANONE 
J065066F02AGCCCAACANONE 
Os05g0458400AK069936AGCCCAACASimilar to AAA-metalloprotease FtsH. 
Os05g0461000006-113-A06GAAGCCCAACNONE 
AB042259GAAGCCCAACNONE 
AK059189GAAGCCCAACNONE 
AK066739GAAGCCCAACClathrin adaptor complex, small chain family protein. 
AK099044GAAGCCCAACNONE 
AK104166GAAGCCCAACNONE 
Os05g0465100AK065821AGCCCAACCRabGAP/TBC domain containing protein. 
Os05g0467300006-113-H02AGCCCAACNONE 
AK061873AGCCCAACSelT/selW/selH selenoprotein family protein. 
AK098945AGCCCAACNONE 
J013050H09AGCCCAACNONE 
J023108B17AGCCCAACNONE 
J065189J01AGCCCAACNONE 
J075011H05AGCCCAACNONE 
J075019G20AGCCCAACNONE 
Os05g0482400AK109526GCAGCCCAACCCytochrome P450 family protein. 
Os05g0486200009-099-B03CCAGCCCAACTNONE 
AK121022CCAGCCCAACTConserved hypothetical protein. 
J023049I09CCAGCCCAACTNONE 
J033029N07CCAGCCCAACTNONE 
J075074I18CCAGCCCAACTNONE 
Os05g0490200016-097-B03CCAGCCCAACCNONE 
AK101147CCAGCCCAACCProtein of unknown function DUF1692 domain containing protein. 
AK105601CCAGCCCAACCNONE 
J033026P06CCAGCCCAACCNONE 
Os05g0524400AK063963AGCCCAACCNONE 
AK072857AGCCCAACCPhosphofructokinase family protein. 
Os05g0531700AK110982GGTTGGGCTGTConserved hypothetical protein. 
Os05g0539300Os05g0539300AGTTGGGCTTAProtein of unknown function DUF295 family protein. 
Os05g0554400AK102948CCAGCCCAACANONE 
AK107427CCAGCCCAACAPhosphatidyl serine synthase family protein. 
J023089D16CCAGCCCAACANONE 
Os05g0577200AK069756TCAGCCCAACACarboxylesterase, type B family protein. 
Os05g0591600Os05g0591600GTTGGGCTGCSimilar to Lysine decarboxylase-like protein. 
Os06g0113900AK067430CCCAGCCCAACCNONE 
AK102259CCCAGCCCAACCNONE 
AK120464CCCAGCCCAACCConserved hypothetical protein. 
J065144I06CCCAGCCCAACCNONE 
Os06g0124900009-128-B12CCAGGCCCAAGCCCAACCNONE 
009-186-H09CCAGGCCCAAGCCCAACCNONE 
AK062901CCAGGCCCAAGCCCAACCConserved hypothetical protein. 
J013056D13CCAGGCCCAAGCCCAACCNONE 
J013056D17CCAGGCCCAAGCCCAACCNONE 
J013066A13CCAGGCCCAAGCCCAACCNONE 
J013066C03CCAGGCCCAAGCCCAACCNONE 
J013066F01CCAGGCCCAAGCCCAACCNONE 
J023078D03CCAGGCCCAAGCCCAACCNONE 
J033113N02CCAGGCCCAAGCCCAACCNONE 
J065019F09CCAGGCCCAAGCCCAACCNONE 
J065048C21CCAGGCCCAAGCCCAACCNONE 
J065077L13CCAGGCCCAAGCCCAACCNONE 
J065082J09CCAGGCCCAAGCCCAACCNONE 
J065113H16CCAGGCCCAAGCCCAACCNONE 
J065147A20CCAGGCCCAAGCCCAACCNONE 
J065180A13CCAGGCCCAAGCCCAACCNONE 
J065198M18CCAGGCCCAAGCCCAACCNONE 
J065207K19CCAGGCCCAAGCCCAACCNONE 
J075109H13CCAGGCCCAAGCCCAACCNONE 
Os06g0134800014-049-H04AGCCCAACCNONE 
AK063692AGCCCAACCGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0152800003-125-D04AAAGCCCAACANONE 
AK099578AAAGCCCAACAConserved hypothetical protein. 
Os06g0156700AK107226AGCCCAACLipolytic enzyme, G-D-S-L family protein. 
J075021O05AGCCCAACNONE 
J075023M12AGCCCAACNONE 
J075041C14AGCCCAACNONE 
J075041C19AGCCCAACNONE 
J075064F08AGCCCAACNONE 
J075116I03AGCCCAACNONE 
J075123I02AGCCCAACNONE 
Os06g0156900AK110688AGTTGGGCTGlycosyl transferase, family 31 protein. 
Os06g0157800AK121504AGTTGGGCTSimilar to CG7224 (Fragment). 
J033022L20AGTTGGGCTNONE 
J075033D09AGTTGGGCTNONE 
Os06g0159400AK101286GGTTGGGCTTTU box domain containing protein. 
J033033F04GGTTGGGCTTTNONE 
Os06g0160800009-164-H06AGCCCAACANONE 
AK063063AGCCCAACAConserved hypothetical protein. 
AK069662AGCCCAACANONE 
J090005A21AGCCCAACANONE 
J090055M15AGCCCAACANONE 
Os06g0187900009-171-C09CAAGCCCAACCNONE 
AK063879CAAGCCCAACCNONE 
AK071765CAAGCCCAACCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023112N11CAAGCCCAACCNONE 
J033098E13CAAGCCCAACCNONE 
J100036J11CAAGCCCAACCNONE 
J100047B19CAAGCCCAACCNONE 
Os06g0309000AK121021AAGGCCCAGACAGCCCAACZinc finger, FYVE/PHD-type domain containing protein. 
Os06g0343900AK070940CCACGGCCACACGCCTCAGCCCAACTConserved hypothetical protein. 
Os06g0354700AK066777GTTGGGCTEsterase/lipase/thioesterase domain containing protein. 
AK068937GTTGGGCTNONE 
J013056F09GTTGGGCTNONE 
J013065L21GTTGGGCTNONE 
J013069H09GTTGGGCTNONE 
J013070D15GTTGGGCTNONE 
J013073L19GTTGGGCTNONE 
J013075L23GTTGGGCTNONE 
J013088D18GTTGGGCTNONE 
J013095G23GTTGGGCTNONE 
J013097K24GTTGGGCTNONE 
J013106G04GTTGGGCTNONE 
J013132J10GTTGGGCTNONE 
J013135F08GTTGGGCTNONE 
J013156B21GTTGGGCTNONE 
J013159L05GTTGGGCTNONE 
J013170J16GTTGGGCTNONE 
J023007C08GTTGGGCTNONE 
J023062F13GTTGGGCTNONE 
J023085D05GTTGGGCTNONE 
J033046C05GTTGGGCTNONE 
J043015P17GTTGGGCTNONE 
J090029M06GTTGGGCTNONE 
J090035K04GTTGGGCTNONE 
J090066H02GTTGGGCTNONE 
Os06g0598900AK100386TACGGCCCAGCCCAACASimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05TACGGCCCAGCCCAACANONE 
J090043L20TACGGCCCAGCCCAACANONE 
Os06g0600100AK065619AAAAGCCCACGAAGCCCAACASimilar to TAT-binding protein homolog (Fragment). 
Os06g0639000AK102470AGCCCAACCNONE 
J013106M02AGCCCAACCNONE 
J100051K23AGCCCAACCNONE 
Os06g0644800006-051-A11AGTTGGGCTTCNONE 
006-061-C06AGTTGGGCTTCNONE 
006-086-A03AGTTGGGCTTCNONE 
006-091-B11AGTTGGGCTTCNONE 
AK105643AGTTGGGCTTCNONE 
AK109442AGTTGGGCTTCMannose-6-phosphate receptor, binding domain containing protein. 
J065083E17AGTTGGGCTTCNONE 
Os06g0670100AK102577AGTTGGGCTGAHypothetical protein. 
Os06g0683200AK060024AGTTGGGCTGGSimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432AGTTGGGCTGGNONE 
J023002B12AGTTGGGCTGGNONE 
J023054E10AGTTGGGCTGGNONE 
J023123F19AGTTGGGCTGGNONE 
J065035K13AGTTGGGCTGGNONE 
J065129P09AGTTGGGCTGGNONE 
J065184B14AGTTGGGCTGGNONE 
Os06g0710300AK121344TAAGCCCAACAUncharacterized protein UPF0114 family protein. 
J043016B12TAAGCCCAACANONE 
J065104H21TAAGCCCAACANONE 
Os06g0717600AK061850AGCCCAACCNONE 
AK067113AGCCCAACCZinc finger, RING-type domain containing protein. 
Os07g0154300009-070-E08CCCAGCCCAACTNONE 
009-077-E01CCCAGCCCAACTNONE 
009-196-F05CCCAGCCCAACTNONE 
AK105386CCCAGCCCAACTConserved hypothetical protein. 
AK122093CCCAGCCCAACTNONE 
J033124K14CCCAGCCCAACTNONE 
J075006I22CCCAGCCCAACTNONE 
J075185G02CCCAGCCCAACTNONE 
J090039C02CCCAGCCCAACTNONE 
Os07g0240400009-080-C04AGCCCAACANONE 
AK062643AGCCCAACAConserved hypothetical protein. 
Os07g0252400J075050C14GTTGGGCTNONE 
Os07g0290800AK071498GCAGCCCATGGCCGAAAAAGCCCAACTic22-like family protein. 
J075099P10GCAGCCCATGGCCGAAAAAGCCCAACNONE 
Os07g0490300AK068288GCGGCCCACAGCCCAACCSimilar to Preproacrosin. 
J013149P03GCGGCCCACAGCCCAACCNONE 
J065039L14GCGGCCCACAGCCCAACCNONE 
J100024A06GCGGCCCACAGCCCAACCNONE 
Os07g0490400AK067941GGTTGGGCTGTGGGCCGCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22GGTTGGGCTGTGGGCCGCNONE 
Os07g0565700006-106-C01AAAGCCCAACANONE 
AK111937AAAGCCCAACANONE 
AK112115AAAGCCCAACAAlpha/beta hydrolase family protein. 
Os07g0568100AK099778AAAGCCCAACCSimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0602600AK065696CCAGCCCAACSimilar to RNA binding protein. 
J013035K23CCAGCCCAACNONE 
Os07g0604500009-018-C07AGTTGGGCTGANONE 
009-194-C02AGTTGGGCTGANONE 
011-023-C06AGTTGGGCTGANONE 
015-035-B10AGTTGGGCTGANONE 
AK064312AGTTGGGCTGASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK069085AGTTGGGCTGANONE 
J090050I12AGTTGGGCTGANONE 
J100027C10AGTTGGGCTGANONE 
J100029A05AGTTGGGCTGANONE 
J100031P17AGTTGGGCTGANONE 
J100039E20AGTTGGGCTGANONE 
J100064L15AGTTGGGCTGANONE 
J100066K08AGTTGGGCTGANONE 
Os07g0644300AK066726GGTTGGGCTSimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483GGTTGGGCTNONE 
Os07g0667400AK073297TCAGCCCAACTSAM (and some other nucleotide) binding motif domain containing protein. 
AK073297TCAGCCCAACTSAM (and some other nucleotide) binding motif domain containing protein. 
J033027J22TCAGCCCAACTNONE 
J033027J22TCAGCCCAACTNONE 
J033122B17TCAGCCCAACTNONE 
J033122B17TCAGCCCAACTNONE 
J065017H12TCAGCCCAACTNONE 
J065017H12TCAGCCCAACTNONE 
J065106D19TCAGCCCAACTNONE 
J065106D19TCAGCCCAACTNONE 
J065196J16TCAGCCCAACTNONE 
J065196J16TCAGCCCAACTNONE 
J090084F01TCAGCCCAACTNONE 
J090084F01TCAGCCCAACTNONE 
Os08g0161700009-088-D09CCAGCCCAACCNONE 
009-131-H02CCAGCCCAACCNONE 
009-182-D04CCAGCCCAACCNONE 
AK059272CCAGCCCAACCConserved hypothetical protein. 
J075002M21CCAGCCCAACCNONE 
J075090H12CCAGCCCAACCNONE 
J075129C21CCAGCCCAACCNONE 
J075146N03CCAGCCCAACCNONE 
J075178P18CCAGCCCAACCNONE 
J075190M03CCAGCCCAACCNONE 
J090030G01CCAGCCCAACCNONE 
J100088M23CCAGCCCAACCNONE 
Os08g0195400006-057-E04TGTTGGGCTGTNONE 
006-060-B10TGTTGGGCTGTNONE 
AK070464TGTTGGGCTGTConserved hypothetical protein. 
AK104389TGTTGGGCTGTNONE 
AK106140TGTTGGGCTGTNONE 
J023013G08TGTTGGGCTGTNONE 
J023054K19TGTTGGGCTGTNONE 
J023089D18TGTTGGGCTGTNONE 
J023092K05TGTTGGGCTGTNONE 
J033025A08TGTTGGGCTGTNONE 
J033067P12TGTTGGGCTGTNONE 
J033098A10TGTTGGGCTGTNONE 
J065219L04TGTTGGGCTGTNONE 
J090021P06TGTTGGGCTGTNONE 
J090062M05TGTTGGGCTGTNONE 
J090079F15TGTTGGGCTGTNONE 
J100041H19TGTTGGGCTGTNONE 
Os08g0271400009-101-A03TGTTGGGCTGGNONE 
AK062750TGTTGGGCTGGConserved hypothetical protein. 
Os08g0375800AK101199AGCCCAACGCGGCCCAGCProtein prenyltransferase domain containing protein. 
J033030L22AGCCCAACGCGGCCCAGCNONE 
Os08g0471900015-099-E10ACAGCCCAACAAGGCCCATCGNONE 
AK069434ACAGCCCAACAAGGCCCATCGZinc finger, ZPR1-type domain containing protein. 
Os08g0517900015-019-D06AAAAGCCCAACANONE 
AK064304AAAAGCCCAACASimilar to 30S ribosomal protein S16. 
Os08g0542100AK058490AAAAGCCCAACAGGCCCACTRibosomal protein L7, eukaryotic form family protein. 
AK101416AAAAGCCCAACAGGCCCACTNONE 
J033037N08AAAAGCCCAACAGGCCCACTNONE 
J033086B16AAAAGCCCAACAGGCCCACTNONE 
J043036J02AAAAGCCCAACAGGCCCACTNONE 
J065137E02AAAAGCCCAACAGGCCCACTNONE 
J090015L07AAAAGCCCAACAGGCCCACTNONE 
J100036D02AAAAGCCCAACAGGCCCACTNONE 
Os09g0100800AK072386TGTTGGGCTGTConserved hypothetical protein. 
J023081P06TGTTGGGCTGTNONE 
J090027B17TGTTGGGCTGTNONE 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0243200AK107718CCCAGCCCAACAZinc finger, RING-type domain containing protein. 
Os09g0364500J100031B16AAAGCCCAACAGTP-binding protein, HSR1-related domain containing protein. 
J100052H07AAAGCCCAACANONE 
J100078G03AAAGCCCAACANONE 
Os09g0370300AK108199TCAGCCCAACCSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
AK101306CAAGCCCAACCSimilar to FEG protein. 
Os09g0412700009-027-C06GGTTGGGCTNONE 
009-190-D10GGTTGGGCTNONE 
AK062405GGTTGGGCTConserved hypothetical protein. 
J065027H04GGTTGGGCTNONE 
J065049P11GGTTGGGCTNONE 
J065204H06GGTTGGGCTNONE 
Os09g0454900011-052-B02CCAAGCCCAACTNONE 
016-025-D09CCAAGCCCAACTNONE 
AK102152CCAAGCCCAACTCurculin-like (mannose-binding) lectin domain containing protein. 
J033086D22CCAAGCCCAACTNONE 
Os09g0462300J065097M23TGTTGGGCTGTEsterase/lipase/thioesterase domain containing protein. 
J065161K12TGTTGGGCTGTNONE 
Os09g0475700AK101979AGTTGGGCTGCNONE 
Os09g0498600AK066995AGCCCAACCCGGCCCNONE 
Os09g0516800009-017-A01AAAGCCCAACAConserved hypothetical protein. 
009-017-A01TAAGCCCAGCCCAACCConserved hypothetical protein. 
Os09g0539100AK071977CCAAGCCCAACCTCTCCGCSimilar to 3-dehydroquinate synthase-like protein. 
AK098959CCAAGCCCAACCTCTCCGCNONE 
Os09g0571400AK103109ACAGCCCAACACyclophilin 1. 
J023011A12ACAGCCCAACANONE 
J033119A20ACAGCCCAACANONE 
J053034N16ACAGCCCAACANONE 
J053045N23ACAGCCCAACANONE 
J053052J12ACAGCCCAACANONE 
J053052K04ACAGCCCAACANONE 
J053099M15ACAGCCCAACANONE 
J065071H23ACAGCCCAACANONE 
J065131B16ACAGCCCAACANONE 
J075003F19ACAGCCCAACANONE 
J075116F02ACAGCCCAACANONE 
J075126G05ACAGCCCAACANONE 
J075145E09ACAGCCCAACANONE 
J075149O22ACAGCCCAACANONE 
J075163A09ACAGCCCAACANONE 
J075194A09ACAGCCCAACANONE 
L29471ACAGCCCAACANONE 
Os09g0572200AK072621GGTTGGGCTConserved hypothetical protein. 
AK109639GGTTGGGCTNONE 
Os11g0131200J065024D18AGCCCAACAMpv17/PMP22 family protein. 
J065206C17AGCCCAACANONE 
Os11g0157900AK108705AGCCCAACCConserved hypothetical protein. 
Os11g0175500015-087-F02TCAGCCCAACANONE 
AK064320TCAGCCCAACAZinc finger, RING-type domain containing protein. 
AK101592TCAGCCCAACANONE 
Os11g0227600AK101375GAAGCCCAACAConserved hypothetical protein. 
AK102193GAAGCCCAACANONE 
J033087C03GAAGCCCAACANONE 
Os11g0231400AK108047GGGCCGTTCCAGCCCAACCProtein of unknown function DUF295 family protein. 
Os11g0298400AK068577AGAGTGGGTTGGGCTTTRibulose bisphosphate carboxylase, small chain family protein. 
Os11g0549690J065085G07CCAGCCCAACAConserved hypothetical protein. 
J065085G07CCAGCCCAACAConserved hypothetical protein. 
J065218B08CCAGCCCAACANONE 
J065218B08CCAGCCCAACANONE 
J090036H16CCAGCCCAACANONE 
J090036H16CCAGCCCAACANONE 
Os11g0558300AK109777AGCCCAACCSimilar to Acyl CoA synthetase (EC 6.2.1.3). 
Os11g0580000AK119421AAGCCCAACTArmadillo-like helical domain containing protein. 
AK121905AAGCCCAACTNONE 
J033105I06AAGCCCAACTNONE 
J090022C10AAGCCCAACTNONE 
J090024J23AAGCCCAACTNONE 
J090044F24AAGCCCAACTNONE 
Os11g0581900AK069449AGCCCAACTProtein of unknown function UPF0005 family protein. 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os11g0621400009-043-B05AGCCCAACGGCTNONE 
AK062468AGCCCAACGGCTConserved hypothetical protein. 
Os11g0645300003-107-E03ATTTGGGCCAGCCCAACCNONE 
006-108-C01ATTTGGGCCAGCCCAACCNONE 
009-015-H10ATTTGGGCCAGCCCAACCNONE 
009-020-G11ATTTGGGCCAGCCCAACCNONE 
009-047-F04ATTTGGGCCAGCCCAACCNONE 
009-053-A12ATTTGGGCCAGCCCAACCNONE 
009-059-B03ATTTGGGCCAGCCCAACCNONE 
009-067-A06ATTTGGGCCAGCCCAACCNONE 
009-084-C03ATTTGGGCCAGCCCAACCNONE 
009-108-G09ATTTGGGCCAGCCCAACCNONE 
009-122-G05ATTTGGGCCAGCCCAACCNONE 
009-124-D08ATTTGGGCCAGCCCAACCNONE 
009-136-C07ATTTGGGCCAGCCCAACCNONE 
013-049-E07ATTTGGGCCAGCCCAACCNONE 
014-056-G04ATTTGGGCCAGCCCAACCNONE 
AK062126ATTTGGGCCAGCCCAACCNONE 
AK120284ATTTGGGCCAGCCCAACCPlant disease resistance response protein family protein. 
J013043F05ATTTGGGCCAGCCCAACCNONE 
J013049N05ATTTGGGCCAGCCCAACCNONE 
J013050H05ATTTGGGCCAGCCCAACCNONE 
J065053N22ATTTGGGCCAGCCCAACCNONE 
J065218J04ATTTGGGCCAGCCCAACCNONE 
J075064K03ATTTGGGCCAGCCCAACCNONE 
J075073L24ATTTGGGCCAGCCCAACCNONE 
J075108C10ATTTGGGCCAGCCCAACCNONE 
Os12g0123900016-031-A06AAAAGCCCAACANONE 
AK061862AAAAGCCCAACAHypothetical protein. 
J013031P10AAAAGCCCAACANONE 
J053034P22AAAAGCCCAACANONE 
J053046O16AAAAGCCCAACANONE 
J053048D20AAAAGCCCAACANONE 
J090031I07AAAAGCCCAACANONE 
J100025B02AAAAGCCCAACANONE 
Os12g0146300J065162K17TGTTGGGCTTTACATGGGCCGAGHypothetical protein. 
Os12g0151500AK058389GCAGCCCAACCACACACCSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865GCAGCCCAACCACACACCNONE 
Os12g0223700J075049J03TGTTGGGCTGGHypothetical protein. 
J075101F23TGTTGGGCTGGNONE 
Os12g0287200009-067-B11ACAGCCCAACTNONE 
009-130-F06ACAGCCCAACTNONE 
009-185-H10ACAGCCCAACTNONE 
AF338343ACAGCCCAACTNONE 
AK063847ACAGCCCAACTSimilar to Mago nashi protein. 
AK121477ACAGCCCAACTNONE 
J023149H05ACAGCCCAACTNONE 
J065019G18ACAGCCCAACTNONE 
J065049J18ACAGCCCAACTNONE 
J065143C22ACAGCCCAACTNONE 
J075130D23ACAGCCCAACTNONE 
J090014I22ACAGCCCAACTNONE 
J090018A06ACAGCCCAACTNONE 
J090053H11ACAGCCCAACTNONE 
J090080N13ACAGCCCAACTNONE 
J100019H19ACAGCCCAACTNONE 
Os12g0479400AK065254AAAGCCCAAGCCCAGCCCAACCNONE 
AK067061AAAGCCCAAGCCCAGCCCAACCSimilar to Auxin response factor 1. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.