version

Summary of OsREG459 (All List)

OrganismOryza sativa  
IDOsREG459  
SequenceAGCCCAAG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count988  

Entry Sequences (988 entries)

LocusGene modelSequenceDescription
Os01g0142500AK067964CAAGCCCAAGHomeodomain-like containing protein. 
Os01g0157900AK072658CTTGGGCTGGGCCGGCTGGGCCTTProtein of unknown function Cys-rich family protein. 
Os01g0214300AK060604GAAGCCCAAGConserved hypothetical protein. 
Os01g0276000009-162-D08AGCCCAAGCCCAACANONE 
AK058917AGCCCAAGCCCAACASimilar to 60S ribosomal protein L30. 
AK119715AGCCCAAGCCCAACANONE 
AK122128AGCCCAAGCCCAACANONE 
J033132L17AGCCCAAGCCCAACANONE 
J065019G15AGCCCAAGCCCAACANONE 
J065033O12AGCCCAAGCCCAACANONE 
J065058J19AGCCCAAGCCCAACANONE 
J065069L03AGCCCAAGCCCAACANONE 
J065072E03AGCCCAAGCCCAACANONE 
J065112J06AGCCCAAGCCCAACANONE 
J065163C18AGCCCAAGCCCAACANONE 
J065170L20AGCCCAAGCCCAACANONE 
J065184O11AGCCCAAGCCCAACANONE 
J065199M19AGCCCAAGCCCAACANONE 
J065207P22AGCCCAAGCCCAACANONE 
J065211C12AGCCCAAGCCCAACANONE 
J075072K20AGCCCAAGCCCAACANONE 
J075100B16AGCCCAAGCCCAACANONE 
J075173F02AGCCCAAGCCCAACANONE 
J090083E15AGCCCAAGCCCAACANONE 
J100022F06AGCCCAAGCCCAACANONE 
J100064C04AGCCCAAGCCCAACANONE 
J100068F11AGCCCAAGCCCAACANONE 
Os01g0549400AK122104CTTGGGCTSimilar to RNA helicase-like protein DB10. 
Os01g0613900014-018-D04AGCCCAAGNONE 
AK119181AGCCCAAGProtein of unknown function UPF0052 and CofD family protein. 
J023119M14AGCCCAAGNONE 
J065019A15AGCCCAAGNONE 
J075090J10AGCCCAAGNONE 
J075195H12AGCCCAAGNONE 
Os01g0618900AK099329CTTGGGCTNONE 
Os01g0750900AK111087CTTGGGCTConserved hypothetical protein. 
J100042H18CTTGGGCTNONE 
J100044L13CTTGGGCTNONE 
Os01g0829266J065010C18CTTGGGCTNONE 
J065037A22CTTGGGCTNONE 
J065044B02CTTGGGCTConserved hypothetical protein. 
J065044B10CTTGGGCTNONE 
J065051A06CTTGGGCTNONE 
J065073E06CTTGGGCTNONE 
J065074I11CTTGGGCTNONE 
J065086D22CTTGGGCTNONE 
J065104H10CTTGGGCTNONE 
J065107C05CTTGGGCTNONE 
J065124H16CTTGGGCTNONE 
J065165F22CTTGGGCTNONE 
J065169B11CTTGGGCTNONE 
J065172G21CTTGGGCTNONE 
J065191E05CTTGGGCTNONE 
J065191F18CTTGGGCTNONE 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
J065013G01CAGCCCAGCCCAAGGCCCACCANONE 
J065063D03CAGCCCAGCCCAAGGCCCACCANONE 
J065143H01CAGCCCAGCCCAAGGCCCACCANONE 
J065146F08CAGCCCAGCCCAAGGCCCACCANONE 
J065153D14CAGCCCAGCCCAAGGCCCACCANONE 
J065170E02CAGCCCAGCCCAAGGCCCACCANONE 
J065175M22CAGCCCAGCCCAAGGCCCACCANONE 
J065186E13CAGCCCAGCCCAAGGCCCACCANONE 
J075023J16CAGCCCAGCCCAAGGCCCACCANONE 
J075176J06CAGCCCAGCCCAAGGCCCACCANONE 
Os01g0972000006-090-C11AAAGCCCAAGNONE 
AK106003AAAGCCCAAGZinc finger, RING-type domain containing protein. 
J065184F12AAAGCCCAAGNONE 
J075085O21AAAGCCCAAGNONE 
Os01g0972300009-034-G05AGCCCAAGNONE 
AK062432AGCCCAAGDVL family protein. 
Os02g0102600AK060523CCAGCCCAAGNONE 
AK103103CCAGCCCAAGAnkyrin repeat containing protein. 
J033118O11CCAGCCCAAGNONE 
J033133B21CCAGCCCAAGNONE 
J033145O05CCAGCCCAAGNONE 
J065001D20CCAGCCCAAGNONE 
J065028P14CCAGCCCAAGNONE 
J065054G04CCAGCCCAAGNONE 
J065058L16CCAGCCCAAGNONE 
J065063K15CCAGCCCAAGNONE 
J065102A18CCAGCCCAAGNONE 
J065174B01CCAGCCCAAGNONE 
J065175C10CCAGCCCAAGNONE 
J065205O04CCAGCCCAAGNONE 
J075018I16CCAGCCCAAGNONE 
J075067G03CCAGCCCAAGNONE 
J075087G10CCAGCCCAAGNONE 
J075166J07CCAGCCCAAGNONE 
J075179O17CCAGCCCAAGNONE 
J090004K08CCAGCCCAAGNONE 
J090029D14CCAGCCCAAGNONE 
J090066G23CCAGCCCAAGNONE 
J090075M15CCAGCCCAAGNONE 
J090090C06CCAGCCCAAGNONE 
Os02g0168500011-010-B05TAAGCCCAAGNONE 
AJ831493TAAGCCCAAGNONE 
AK073338TAAGCCCAAGNONE 
AK073486TAAGCCCAAGConserved hypothetical protein. 
J100059F05TAAGCCCAAGNONE 
J100082K14TAAGCCCAAGNONE 
J100090P09TAAGCCCAAGNONE 
Os02g0186700AK064492CTTGGGCTTGConserved hypothetical protein. 
J065210K09CTTGGGCTTGNONE 
J075006A17CTTGGGCTTGNONE 
J075108C18CTTGGGCTTGNONE 
J075153E08CTTGGGCTTGNONE 
Os02g0241100Os02g0241100CCAGCCCAAGProtein kinase-like domain containing protein. 
Os02g0287000006-107-B10CTTGGGCTTANONE 
006-120-E07CTTGGGCTTANONE 
AF052503CTTGGGCTTANONE 
AK059647CTTGGGCTTASimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK099131CTTGGGCTTANONE 
J023048M05CTTGGGCTTANONE 
J033107L10CTTGGGCTTANONE 
J065019A12CTTGGGCTTANONE 
J065064J21CTTGGGCTTANONE 
J065071D15CTTGGGCTTANONE 
J065094L12CTTGGGCTTANONE 
J065095L06CTTGGGCTTANONE 
J065097J11CTTGGGCTTANONE 
J065099M08CTTGGGCTTANONE 
J065104D01CTTGGGCTTANONE 
J065107L02CTTGGGCTTANONE 
J065110D14CTTGGGCTTANONE 
J065135J07CTTGGGCTTANONE 
J065137C16CTTGGGCTTANONE 
J065150C07CTTGGGCTTANONE 
J065165I10CTTGGGCTTANONE 
J065189F07CTTGGGCTTANONE 
J065205L22CTTGGGCTTANONE 
J065214C09CTTGGGCTTANONE 
J065217G17CTTGGGCTTANONE 
J075029E17CTTGGGCTTANONE 
J075054O16CTTGGGCTTANONE 
J075068N23CTTGGGCTTANONE 
J075135N18CTTGGGCTTANONE 
J075152G09CTTGGGCTTANONE 
J075162D10CTTGGGCTTANONE 
J075164F11CTTGGGCTTANONE 
J080036L12CTTGGGCTTANONE 
J080049K18CTTGGGCTTANONE 
J080060P03CTTGGGCTTANONE 
J080062G16CTTGGGCTTANONE 
J080062G21CTTGGGCTTANONE 
J080064N07CTTGGGCTTANONE 
J080075I22CTTGGGCTTANONE 
J080086F20CTTGGGCTTANONE 
J080087G07CTTGGGCTTANONE 
J080088I06CTTGGGCTTANONE 
J080302B20CTTGGGCTTANONE 
J080303L14CTTGGGCTTANONE 
J080309O12CTTGGGCTTANONE 
J080317F12CTTGGGCTTANONE 
J080317P18CTTGGGCTTANONE 
J090013L15CTTGGGCTTANONE 
J090043N04CTTGGGCTTANONE 
J090085G01CTTGGGCTTANONE 
J090085G19CTTGGGCTTANONE 
Os02g0499300AK106994CTTGGGCTConserved hypothetical protein. 
Os02g0501350J090074D10CCAGCCCAAGGCCCAGCNONE 
J090080M08CCAGCCCAAGGCCCAGCNONE 
J090083F07CCAGCCCAAGGCCCAGCConserved hypothetical protein. 
Os02g0520800AK102815AGCCCAAGGCCCAGCSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09AGCCCAAGGCCCAGCNONE 
J100038E09AGCCCAAGGCCCAGCNONE 
J100076G11AGCCCAAGGCCCAGCNONE 
Os02g0522000AK101294ATTTGGGCCTTGGGCTGTRetrotransposon gag protein family protein. 
Os02g0591700AK072777AGCCCAAGSimilar to Candida glabrata strain CBS138 chromosome L complete sequence. 
AK072777AGCCCAAGSimilar to Candida glabrata strain CBS138 chromosome L complete sequence. 
J013096O06AGCCCAAGNONE 
J013096O06AGCCCAAGNONE 
J023139B06AGCCCAAGNONE 
J023139B06AGCCCAAGNONE 
J065114F05AGCCCAAGNONE 
J065114F05AGCCCAAGNONE 
J090059C21AGCCCAAGNONE 
J090059C21AGCCCAAGNONE 
Os02g0616600AK106681CTTGGGCTGCCGGCCCAGCConserved hypothetical protein. 
J065062G16CTTGGGCTGCCGGCCCAGCNONE 
Os02g0673000AK108650TAAGCCCAAGProtein of unknown function UPF0005 family protein. 
Os02g0738200J100040B06AGCCCAAGNONE 
J100050N02AGCCCAAGU box domain containing protein. 
J100056J12AGCCCAAGNONE 
Os02g0754700AK066904TCAGCCCAAGCCCAAGSimilar to Histidyl-tRNA synthetase (EC 6.1.1.21). 
AK099136TCAGCCCAAGCCCAAGNONE 
Os02g0756800013-074-D12ACAGCCCAAGNONE 
AK063605ACAGCCCAAGPhosphate-induced protein 1 conserved region family protein. 
J053100E11ACAGCCCAAGNONE 
J065045H15ACAGCCCAAGNONE 
J065099D22ACAGCCCAAGNONE 
J065142N08ACAGCCCAAGNONE 
Os02g0759800012-036-G11CCAGCCCAAGNONE 
AK067153CCAGCCCAAGSimilar to GAMYB-binding protein (Fragment). 
AK071666CCAGCCCAAGNONE 
J013098N03CCAGCCCAAGNONE 
J023100L02CCAGCCCAAGNONE 
J023106G20CCAGCCCAAGNONE 
J033057G09CCAGCCCAAGNONE 
J100043H19CCAGCCCAAGNONE 
J100061H16CCAGCCCAAGNONE 
J100079O17CCAGCCCAAGNONE 
Os02g0771700011-075-D10CCAGCCCAAGNONE 
011-086-E10CCAGCCCAAGNONE 
AK058571CCAGCCCAAGGlycoside hydrolase, family 17 protein. 
AK102185CCAGCCCAAGNONE 
J023001D03CCAGCCCAAGNONE 
J023041N11CCAGCCCAAGNONE 
J033086N13CCAGCCCAAGNONE 
J033106K14CCAGCCCAAGNONE 
J033125P22CCAGCCCAAGNONE 
Os02g0775300AK111093CCAAGCCCAAGConserved hypothetical protein. 
J100039N18CCAAGCCCAAGNONE 
Os02g0791400009-106-F11CTTGGGCTTANONE 
AK062787CTTGGGCTTACytochrome oxidase c, subunit VIb family protein. 
Os02g0794700003-103-F03CTTGGGCTGCNONE 
003-129-E08CTTGGGCTGCNONE 
006-086-A10CTTGGGCTGCNONE 
AK058513CTTGGGCTGCSimilar to Cytosol aminopeptidase (EC 3.4.11.1) (Leucine aminopeptidase) (LAP) (Leucyl aminopeptidase) (Proline aminopeptidase) (EC 3.4.11.5) (Prolyl aminopeptidase). 
AK104150CTTGGGCTGCNONE 
Os02g0800000J100043O08GCTGGGCCTTGGGCCTTGGGCTNONE 
J100064O18GCTGGGCCTTGGGCCTTGGGCTNONE 
Os02g0819600AK062188AGCCCAAGProtein kinase domain containing protein. 
AK098868AGCCCAAGNONE 
Os02g0819700AK067374CTTGGGCTZinc finger, Zim17-type family protein. 
AK099160CTTGGGCTNONE 
J100086K17CTTGGGCTNONE 
Os03g0111800AK121627AAAGCCCAAAGCCCAAGWD40-like domain containing protein. 
Os03g0119900AK058741CCAGCCCAAGhistone H4 [Oryza sativa (japonica cultivar-group)]. 
J065035O07CCAGCCCAAGNONE 
J065165C24CCAGCCCAAGNONE 
J075039M05CCAGCCCAAGNONE 
Os03g0149400AK111396AAGGCCCAACCAGCCCAAGProtein prenyltransferase domain containing protein. 
AK111396CTTGGGCTTTCAAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os03g0175600AK059981AAAGCCCAAGSimilar to Nit protein 2 (CUA002). 
Os03g0181600AK067807AGCCCAAGCGGCCCACCASimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197AGCCCAAGCGGCCCACCANONE 
Os03g0192500AK068957ACAGCCCAAGProtein phosphatase 2C-like domain containing protein. 
AY603974ACAGCCCAAGNONE 
Os03g0244200003-114-A11AGCCCAAGNONE 
015-089-B03AGCCCAAGNONE 
016-048-G01AGCCCAAGNONE 
AK101837AGCCCAAGSimilar to Thaumatin-like protein. 
AK105771AGCCCAAGNONE 
AK107182AGCCCAAGNONE 
J065054I12AGCCCAAGNONE 
J065208F20AGCCCAAGNONE 
J075088F18AGCCCAAGNONE 
J075092G13AGCCCAAGNONE 
J075120G01AGCCCAAGNONE 
J075147M20AGCCCAAGNONE 
J075151J03AGCCCAAGNONE 
J100064H21AGCCCAAGNONE 
Os03g0248000AK070612CAAGCCCAAGCCCNONE 
AK071419CAAGCCCAAGCCCNONE 
AK100304CAAGCCCAAGCCCAutophagy protein Apg9 family protein. 
Os03g0263900AK121215AGCCCAAGCalcium-binding EF-hand domain containing protein. 
J075115D02AGCCCAAGNONE 
J090095P20AGCCCAAGNONE 
Os03g0266900013-080-C12AGCCCAAGNONE 
014-010-A09AGCCCAAGNONE 
014-013-G10AGCCCAAGNONE 
014-019-D06AGCCCAAGNONE 
014-030-F08AGCCCAAGNONE 
014-039-C05AGCCCAAGNONE 
014-053-H08AGCCCAAGNONE 
014-089-F06AGCCCAAGNONE 
014-094-A05AGCCCAAGNONE 
014-098-C12AGCCCAAGNONE 
AK119243AGCCCAAGLow molecular mass heat shock protein Oshsp17.3. 
AK119717AGCCCAAGNONE 
D12635AGCCCAAGNONE 
M80186AGCCCAAGNONE 
Os03g0274000AK060769AAAAGCCCAAGOxysterol-binding protein family protein. 
Os03g0282900006-088-H05ACAGCCCAAGAAGGCCCATGTNONE 
AK061166ACAGCCCAAGAAGGCCCATGTNONE 
AK102161ACAGCCCAAGAAGGCCCATGTConserved hypothetical protein. 
AK104514ACAGCCCAAGAAGGCCCATGTNONE 
Os03g0284000Os03g0284000CTTGGGCCGTGCTTGGGCTGCConserved hypothetical protein. 
Os03g0336100AK105307AGCCCAAG11-S plant seed storage protein family protein. 
Os03g0343900009-077-C03ACAGCCCAAGGCCCAAGNONE 
AK105813ACAGCCCAAGGCCCAAGPhotosystem II protein PsbX family protein. 
J100059N03ACAGCCCAAGGCCCAAGNONE 
J100079C20ACAGCCCAAGGCCCAAGNONE 
Os03g0441000AK108726ACAGCCCAAGTranscription initiation factor TFIID component TAF4 domain containing protein. 
Os03g0566600011-071-A08AGCCCAAGNONE 
AK063379AGCCCAAGMethyltransferase FkbM domain containing protein. 
Os03g0576900AK064861CTTGGGCTGCNONE 
J013000I01CTTGGGCTGCNONE 
J013169P21CTTGGGCTGCNONE 
J023001P03CTTGGGCTGCNONE 
J023009M10CTTGGGCTGCNONE 
J023025G11CTTGGGCTGCNONE 
J033046B19CTTGGGCTGCNONE 
J033149I10CTTGGGCTGCNONE 
J090081C04CTTGGGCTGCNONE 
Os03g0588200011-005-E04AAAAGCCCAAGNONE 
AK120221AAAAGCCCAAGFrigida-like family protein. 
J100086E17AAAAGCCCAAGNONE 
Os03g0655600AK073458AGCCCAAGNONE 
J033042J10AGCCCAAGNONE 
Os03g0655700AK120254AAAGCCCAAGCCCACCACSimilar to 3-isopropylmalate dehydrogenase, chloroplast precursor (EC 1.1.1.85) (Beta-IPM dehydrogenase) (IMDH) (3-IPM-DH). 
Os03g0683700AK065067AGCCCAAGProtein of unknown function DUF810 family protein. 
Os03g0685700AK066043CGATGGGCCTTGGGCTTTProtein prenyltransferase domain containing protein. 
J013048F08CGATGGGCCTTGGGCTTTNONE 
Os03g0727100AK068587AGCCCAAGConserved hypothetical protein. 
J013153F04AGCCCAAGNONE 
J065165J09AGCCCAAGNONE 
Os03g0803800012-043-D10TCAGCCCAAGNONE 
AK063484TCAGCCCAAGConserved hypothetical protein. 
Os03g0807200011-031-F07GAAGCCCAAGNONE 
AK063932GAAGCCCAAGNONE 
AK103496GAAGCCCAAGProtein of unknown function DUF1639 family protein. 
J033131A04GAAGCCCAAGNONE 
J065109O03GAAGCCCAAGNONE 
J080001M11GAAGCCCAAGNONE 
J080002H18GAAGCCCAAGNONE 
J080005I08GAAGCCCAAGNONE 
J080006B05GAAGCCCAAGNONE 
J080006D17GAAGCCCAAGNONE 
J080007M19GAAGCCCAAGNONE 
J080011E07GAAGCCCAAGNONE 
J080012H06GAAGCCCAAGNONE 
J080014D08GAAGCCCAAGNONE 
J080017D06GAAGCCCAAGNONE 
J080017K17GAAGCCCAAGNONE 
J080020B17GAAGCCCAAGNONE 
J080021O05GAAGCCCAAGNONE 
J080021O15GAAGCCCAAGNONE 
J080023I18GAAGCCCAAGNONE 
J080025A21GAAGCCCAAGNONE 
J080027P22GAAGCCCAAGNONE 
J080028M22GAAGCCCAAGNONE 
J080029B09GAAGCCCAAGNONE 
J080029M07GAAGCCCAAGNONE 
J080029M17GAAGCCCAAGNONE 
J080030H23GAAGCCCAAGNONE 
J080030K16GAAGCCCAAGNONE 
J080030L19GAAGCCCAAGNONE 
J080031A12GAAGCCCAAGNONE 
J080031N21GAAGCCCAAGNONE 
J080032G05GAAGCCCAAGNONE 
J080032P20GAAGCCCAAGNONE 
J080033H20GAAGCCCAAGNONE 
J080034H22GAAGCCCAAGNONE 
J080034J03GAAGCCCAAGNONE 
J080034J16GAAGCCCAAGNONE 
J080034N01GAAGCCCAAGNONE 
J080035K20GAAGCCCAAGNONE 
J080036I04GAAGCCCAAGNONE 
J080036I19GAAGCCCAAGNONE 
J080036O21GAAGCCCAAGNONE 
J080038D06GAAGCCCAAGNONE 
J080039J15GAAGCCCAAGNONE 
J080039P18GAAGCCCAAGNONE 
J080041H20GAAGCCCAAGNONE 
J080041M11GAAGCCCAAGNONE 
J080042F14GAAGCCCAAGNONE 
J080043G10GAAGCCCAAGNONE 
J080043J02GAAGCCCAAGNONE 
J080044C19GAAGCCCAAGNONE 
J080044G11GAAGCCCAAGNONE 
J080045M03GAAGCCCAAGNONE 
J080045N07GAAGCCCAAGNONE 
J080047K14GAAGCCCAAGNONE 
J080049I21GAAGCCCAAGNONE 
J080050A06GAAGCCCAAGNONE 
J080050I16GAAGCCCAAGNONE 
J080050N16GAAGCCCAAGNONE 
J080052C23GAAGCCCAAGNONE 
J080052D18GAAGCCCAAGNONE 
J080052F20GAAGCCCAAGNONE 
J080052F23GAAGCCCAAGNONE 
J080053M03GAAGCCCAAGNONE 
J080054G13GAAGCCCAAGNONE 
J080054H12GAAGCCCAAGNONE 
J080055N03GAAGCCCAAGNONE 
J080056E07GAAGCCCAAGNONE 
J080057L04GAAGCCCAAGNONE 
J080063O19GAAGCCCAAGNONE 
J080064E21GAAGCCCAAGNONE 
J080065D18GAAGCCCAAGNONE 
J080065F18GAAGCCCAAGNONE 
J080065H14GAAGCCCAAGNONE 
J080065K15GAAGCCCAAGNONE 
J080065M24GAAGCCCAAGNONE 
J080066B18GAAGCCCAAGNONE 
J080066B19GAAGCCCAAGNONE 
J080071H19GAAGCCCAAGNONE 
J080072E18GAAGCCCAAGNONE 
J080074K21GAAGCCCAAGNONE 
J080075B06GAAGCCCAAGNONE 
J080076H07GAAGCCCAAGNONE 
J080079D16GAAGCCCAAGNONE 
J080082B20GAAGCCCAAGNONE 
J080084N16GAAGCCCAAGNONE 
J080085L07GAAGCCCAAGNONE 
J080086L04GAAGCCCAAGNONE 
J080086M07GAAGCCCAAGNONE 
J080087D02GAAGCCCAAGNONE 
J080087D15GAAGCCCAAGNONE 
J080087J19GAAGCCCAAGNONE 
J080088G20GAAGCCCAAGNONE 
J080092M15GAAGCCCAAGNONE 
J080093O10GAAGCCCAAGNONE 
J080095L09GAAGCCCAAGNONE 
J080096A18GAAGCCCAAGNONE 
J080097C03GAAGCCCAAGNONE 
J090019J07GAAGCCCAAGNONE 
J090024N12GAAGCCCAAGNONE 
J090049I09GAAGCCCAAGNONE 
Os03g0822100AK101094TGCGGGCCTTGGGCTGTGGGCTGCSimilar to Transposase (Fragment). 
J033024N05TGCGGGCCTTGGGCTGTGGGCTGCNONE 
Os03g0852600009-174-G04ATATGGGCCCAGCCCAAGNONE 
AK063101ATATGGGCCCAGCCCAAGProtein of unknown function DUF565 family protein. 
J065131H12ATATGGGCCCAGCCCAAGNONE 
J090046K24ATATGGGCCCAGCCCAAGNONE 
Os04g0107900013-017-E10CAAGGCCCAGCCCAAGNONE 
014-025-A02CAAGGCCCAGCCCAAGNONE 
014-100-C01CAAGGCCCAGCCCAAGNONE 
AK063568CAAGGCCCAGCCCAAGNONE 
AK063698CAAGGCCCAGCCCAAGNONE 
AK063751CAAGGCCCAGCCCAAGSimilar to Heat shock protein 80. 
J013118G22CAAGGCCCAGCCCAAGNONE 
J033131C17CAAGGCCCAGCCCAAGNONE 
J065036G05CAAGGCCCAGCCCAAGNONE 
J065106E24CAAGGCCCAGCCCAAGNONE 
J065171K16CAAGGCCCAGCCCAAGNONE 
J065213C11CAAGGCCCAGCCCAAGNONE 
J065218L17CAAGGCCCAGCCCAAGNONE 
Os04g0111200AK105831AGCCCAAGSimilar to ATP sulfurylase (Fragment). 
Os04g0259200AK119366CCAAGCCCAAGHypothetical protein. 
Os04g0447400AK070858CTTGGGCTTTTATATGGGCCGGTSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09CTTGGGCTTTTATATGGGCCGGTNONE 
J023003G16CTTGGGCTTTTATATGGGCCGGTNONE 
J023006F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023008D10CTTGGGCTTTTATATGGGCCGGTNONE 
J023010A01CTTGGGCTTTTATATGGGCCGGTNONE 
J023012M16CTTGGGCTTTTATATGGGCCGGTNONE 
J023023H17CTTGGGCTTTTATATGGGCCGGTNONE 
J023029B12CTTGGGCTTTTATATGGGCCGGTNONE 
J023030F09CTTGGGCTTTTATATGGGCCGGTNONE 
J023034K03CTTGGGCTTTTATATGGGCCGGTNONE 
J023045A16CTTGGGCTTTTATATGGGCCGGTNONE 
J023048I04CTTGGGCTTTTATATGGGCCGGTNONE 
J023056C09CTTGGGCTTTTATATGGGCCGGTNONE 
J023056F05CTTGGGCTTTTATATGGGCCGGTNONE 
J023058B21CTTGGGCTTTTATATGGGCCGGTNONE 
J023058N06CTTGGGCTTTTATATGGGCCGGTNONE 
J023059F03CTTGGGCTTTTATATGGGCCGGTNONE 
J023059M19CTTGGGCTTTTATATGGGCCGGTNONE 
J023060P05CTTGGGCTTTTATATGGGCCGGTNONE 
J023062D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023063F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023068K15CTTGGGCTTTTATATGGGCCGGTNONE 
J023069L04CTTGGGCTTTTATATGGGCCGGTNONE 
J023075I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023086H01CTTGGGCTTTTATATGGGCCGGTNONE 
J023086I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023091M08CTTGGGCTTTTATATGGGCCGGTNONE 
J023095A07CTTGGGCTTTTATATGGGCCGGTNONE 
J023110K06CTTGGGCTTTTATATGGGCCGGTNONE 
J023113D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023126J05CTTGGGCTTTTATATGGGCCGGTNONE 
J023140F04CTTGGGCTTTTATATGGGCCGGTNONE 
J023141N19CTTGGGCTTTTATATGGGCCGGTNONE 
Os04g0485400AK109290TCAGCCCAAGSimilar to Nucleotide-binding protein. 
AK120649TCAGCCCAAGNONE 
J013156K04TCAGCCCAAGNONE 
J043026O10TCAGCCCAAGNONE 
Os04g0534600AK073835AGCCCAAGPeroxisomal biogenesis factor 11 family protein. 
Os04g0537100AK108118AGCCCAAGSimilar to Auxin-induced protein X15. 
Os04g0556900015-052-H08CTTGGGCTNONE 
AK064112CTTGGGCTConserved hypothetical protein. 
Os04g0605300J065040F14CTTGGGCTNONE 
J065047M16CTTGGGCTNONE 
J065060F03CTTGGGCTNONE 
J065084O17CTTGGGCTNONE 
J065094G21CTTGGGCTNONE 
J065146E01CTTGGGCTNONE 
J100057P05CTTGGGCTNONE 
Os04g0609200AK103652TAAGCCCAAGMajor facilitator superfamily protein. 
Os04g0665700013-084-D06GTGGCCCAAAGCCCAAGNONE 
AK121951GTGGCCCAAAGCCCAAGZinc finger, CCCH-type domain containing protein. 
J013020L20GTGGCCCAAAGCCCAAGNONE 
J033034K12GTGGCCCAAAGCCCAAGNONE 
J033107K04GTGGCCCAAAGCCCAAGNONE 
J065044C03GTGGCCCAAAGCCCAAGNONE 
J065103I10GTGGCCCAAAGCCCAAGNONE 
J065106P15GTGGCCCAAAGCCCAAGNONE 
J075061O20GTGGCCCAAAGCCCAAGNONE 
J075091P11GTGGCCCAAAGCCCAAGNONE 
J075095A18GTGGCCCAAAGCCCAAGNONE 
J075117C22GTGGCCCAAAGCCCAAGNONE 
J075166B22GTGGCCCAAAGCCCAAGNONE 
J075198L04GTGGCCCAAAGCCCAAGNONE 
J090032K13GTGGCCCAAAGCCCAAGNONE 
J090045E22GTGGCCCAAAGCCCAAGNONE 
Os04g0690500006-048-F04CTTGGGCTNONE 
006-051-F05CTTGGGCTNONE 
006-061-E05CTTGGGCTNONE 
009-084-H03CTTGGGCTNONE 
009-146-E05CTTGGGCTNONE 
014-039-E07CTTGGGCTNONE 
AK059830CTTGGGCTNONE 
AK061031CTTGGGCTNONE 
AK071887CTTGGGCTNONE 
AK104290CTTGGGCTNONE 
AK105853CTTGGGCTConserved hypothetical protein. 
Os05g0100500AK071466GCAGCCCAAAAAGCCCAAGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0102300015-069-C12AGCCCAAGNONE 
AK106387AGCCCAAGHAT dimerisation domain containing protein. 
Os05g0111000AK073598CTTGGGCTTASimilar to Gag polyprotein [Contains: Core protein p15 (Matrix protein); Core protein p24; Core protein p12]. 
Os05g0121800AK101222CCAGCCCAAGConserved hypothetical protein. 
J033031D02CCAGCCCAAGNONE 
J065078F10CCAGCCCAAGNONE 
J065151J16CCAGCCCAAGNONE 
J065151K04CCAGCCCAAGNONE 
J090057E18CCAGCCCAAGNONE 
Os05g0125600AK102952CTTGGGCTProtein of unknown function DUF1677, Oryza sativa family protein. 
J033115D18CTTGGGCTNONE 
Os05g0150300AK100732CCAGCCCAAGSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
Os05g0223200015-037-E09CCCAGCCCAAGNONE 
AK106308CCCAGCCCAAGSimilar to Glycine-rich RNA-binding protein GRP2A. 
J065013L17CCCAGCCCAAGNONE 
J065056N06CCCAGCCCAAGNONE 
J065080I11CCCAGCCCAAGNONE 
J065104F11CCCAGCCCAAGNONE 
J065183L10CCCAGCCCAAGNONE 
J065185H12CCCAGCCCAAGNONE 
J065186N17CCCAGCCCAAGNONE 
Os05g0255600AK073067CTTGGGCTGGGCCCTThioredoxin domain 2 containing protein. 
J033022A04CTTGGGCTGGGCCCTNONE 
J033022B03CTTGGGCTGGGCCCTNONE 
J033116F22CTTGGGCTGGGCCCTNONE 
J065017H13CTTGGGCTGGGCCCTNONE 
J065038G20CTTGGGCTGGGCCCTNONE 
J065076J16CTTGGGCTGGGCCCTNONE 
J065135D06CTTGGGCTGGGCCCTNONE 
J065168P22CTTGGGCTGGGCCCTNONE 
J065188G21CTTGGGCTGGGCCCTNONE 
J065207C14CTTGGGCTGGGCCCTNONE 
J080014C23CTTGGGCTGGGCCCTNONE 
J080018G12CTTGGGCTGGGCCCTNONE 
J080021F03CTTGGGCTGGGCCCTNONE 
J100068C14CTTGGGCTGGGCCCTNONE 
Os05g0269500AK072871CTTGGGCTConserved hypothetical protein. 
Os05g0346300009-033-C06AGATGGGCTTGGGCTTTNONE 
AF529175AGATGGGCTTGGGCTTTNONE 
AK061627AGATGGGCTTGGGCTTTSimilar to 40S ribosomal protein S7. 
AK103081AGATGGGCTTGGGCTTTNONE 
AK104191AGATGGGCTTGGGCTTTNONE 
J013049B09AGATGGGCTTGGGCTTTNONE 
J023142E24AGATGGGCTTGGGCTTTNONE 
J033052M14AGATGGGCTTGGGCTTTNONE 
J033089N04AGATGGGCTTGGGCTTTNONE 
J033118F01AGATGGGCTTGGGCTTTNONE 
J065054E07AGATGGGCTTGGGCTTTNONE 
J065066L18AGATGGGCTTGGGCTTTNONE 
J065078C21AGATGGGCTTGGGCTTTNONE 
J065127G23AGATGGGCTTGGGCTTTNONE 
J065128N24AGATGGGCTTGGGCTTTNONE 
J065144P17AGATGGGCTTGGGCTTTNONE 
J065147P14AGATGGGCTTGGGCTTTNONE 
J065170E16AGATGGGCTTGGGCTTTNONE 
J065175D17AGATGGGCTTGGGCTTTNONE 
J065176M05AGATGGGCTTGGGCTTTNONE 
J065218G20AGATGGGCTTGGGCTTTNONE 
J090074J12AGATGGGCTTGGGCTTTNONE 
J100019H16AGATGGGCTTGGGCTTTNONE 
J100031N24AGATGGGCTTGGGCTTTNONE 
J100072G08AGATGGGCTTGGGCTTTNONE 
J100086I23AGATGGGCTTGGGCTTTNONE 
Os05g0348100006-028-F04CGCGACGCCCCAGCCCAAGNONE 
009-036-C03CGCGACGCCCCAGCCCAAGNONE 
009-040-H02CGCGACGCCCCAGCCCAAGNONE 
009-173-H12CGCGACGCCCCAGCCCAAGNONE 
AK061434CGCGACGCCCCAGCCCAAGConserved hypothetical protein. 
J065137N04CGCGACGCCCCAGCCCAAGNONE 
J065164C10CGCGACGCCCCAGCCCAAGNONE 
J065210H22CGCGACGCCCCAGCCCAAGNONE 
Os05g0358500AK060575CTTGGGCTTANONE 
AK100777CTTGGGCTTAProtein phosphatase 2C-like domain containing protein. 
Os05g0387200AK060744CAAGCCCACCAAAAGCCCAAGSimilar to UDP-sulfoquinovose synthase, chloroplast precursor (EC 3.13.1.1) (Sulfite:UDP-glucose sulfotransferase) (Sulfolipid biosynthesis protein) (SoSQD1). 
AK065310CAAGCCCACCAAAAGCCCAAGNONE 
Os05g0450600016-072-G10AAAGCCCAAGNONE 
AK064266AAAGCCCAAGProtein of unknown function DUF740 family protein. 
Os05g0494700Os05g0494700ACAGCCCAAGNONE 
Os05g0524200AK071990CTTGGGCTTADual specificity protein phosphatase domain containing protein. 
Os05g0535700009-067-F01GCAGCCCAAGCCCAAGCCCAAGNONE 
AK061590GCAGCCCAAGCCCAAGCCCAAGNONE 
AK062545GCAGCCCAAGCCCAAGCCCAAGConserved hypothetical protein. 
Os05g0541500AK101190CTTGGGCTTCCyclin-like F-box domain containing protein. 
AK101531CTTGGGCTTCNONE 
J033030F10CTTGGGCTTCNONE 
Os05g0541900009-130-F05CTTGGGCTNONE 
009-200-E07CTTGGGCTNONE 
013-057-G09CTTGGGCTNONE 
Os05g0545500AK101095CTTGGGCTConserved hypothetical protein. 
AK119499CTTGGGCTNONE 
Os05g0557200AK062090CTTGGGCTCGGCCCAACANONE 
AK102111CTTGGGCTCGGCCCAACAArmadillo-like helical domain containing protein. 
J013047E13CTTGGGCTCGGCCCAACANONE 
J013089P04CTTGGGCTCGGCCCAACANONE 
J013130H17CTTGGGCTCGGCCCAACANONE 
J013132C20CTTGGGCTCGGCCCAACANONE 
J023001E06CTTGGGCTCGGCCCAACANONE 
J023108C09CTTGGGCTCGGCCCAACANONE 
J023125C12CTTGGGCTCGGCCCAACANONE 
J033023O10CTTGGGCTCGGCCCAACANONE 
J033033K16CTTGGGCTCGGCCCAACANONE 
J033064C11CTTGGGCTCGGCCCAACANONE 
J033071P07CTTGGGCTCGGCCCAACANONE 
J033072H14CTTGGGCTCGGCCCAACANONE 
J033084F06CTTGGGCTCGGCCCAACANONE 
J033084H11CTTGGGCTCGGCCCAACANONE 
J033097C05CTTGGGCTCGGCCCAACANONE 
J043009E20CTTGGGCTCGGCCCAACANONE 
J053035M10CTTGGGCTCGGCCCAACANONE 
J053043J22CTTGGGCTCGGCCCAACANONE 
J053082K10CTTGGGCTCGGCCCAACANONE 
J053094N13CTTGGGCTCGGCCCAACANONE 
Os05g0559900AK067197GAAGCCCAAGGCCCAAACtRNA-binding arm domain containing protein. 
J013074C15GAAGCCCAAGGCCCAAACNONE 
J013098O16GAAGCCCAAGGCCCAAACNONE 
J033030M01GAAGCCCAAGGCCCAAACNONE 
J090058H12GAAGCCCAAGGCCCAAACNONE 
J090075M06GAAGCCCAAGGCCCAAACNONE 
Os05g0563500AK121924CTTGGGCTConserved hypothetical protein. 
J033106F17CTTGGGCTNONE 
Os05g0567300013-039-F11TTTTGGGCCAGCCCAAGNONE 
AK112068TTTTGGGCCAGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
Os05g0589000AK061980CCAGCCCAAGNONE 
AK099181CCAGCCCAAGConserved hypothetical protein. 
Os05g0597100011-044-C10TCAGCCCAAGCCCAATNONE 
AF255711TCAGCCCAAGCCCAATNONE 
AK072845TCAGCCCAAGCCCAATSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16TCAGCCCAAGCCCAATNONE 
J023135M22TCAGCCCAAGCCCAATNONE 
J023141B21TCAGCCCAAGCCCAATNONE 
J023142J09TCAGCCCAAGCCCAATNONE 
J033025E09TCAGCCCAAGCCCAATNONE 
J033111A20TCAGCCCAAGCCCAATNONE 
J033126I01TCAGCCCAAGCCCAATNONE 
Os06g0156900AK110688CTTGGGCTGAGlycosyl transferase, family 31 protein. 
Os06g0163000AK069245AGCCCAAGCCCNONE 
AK069675AGCCCAAGCCCSimilar to Heat shock protein STI (Stress inducible protein) (GmSTI). 
AK072504AGCCCAAGCCCNONE 
Os06g0219600AK060429CCAAGCCCAAGSimilar to Poly(A)-binding protein II-like. 
AK099019CCAAGCCCAAGNONE 
J013118A14CCAAGCCCAAGNONE 
Os06g0222900AK109820CTTGGGCTTGGSimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase 2 (EC 3.1.3.56) (At5PTase2). 
Os06g0258000AK107483AGCCCAAGSimilar to Typical P-type R2R3 Myb protein (Fragment). 
Os06g0274200009-090-A02AAAGCCCAAGCCCAGNONE 
AK073155AAAGCCCAAGCCCAGSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065001C08AAAGCCCAAGCCCAGNONE 
J065061C07AAAGCCCAAGCCCAGNONE 
J065105L08AAAGCCCAAGCCCAGNONE 
J075013C12AAAGCCCAAGCCCAGNONE 
J090010N17AAAGCCCAAGCCCAGNONE 
J090068K07AAAGCCCAAGCCCAGNONE 
J100058A21AAAGCCCAAGCCCAGNONE 
J100066C07AAAGCCCAAGCCCAGNONE 
Os06g0291100J043017O10CTTGGGCTTCCGGCCCAGCHypothetical protein. 
Os06g0332400AK058294CCAGCCCAAGNONE 
AK101738CCAGCCCAAGVHS domain containing protein. 
J013119B12CCAGCCCAAGNONE 
J013132G17CCAGCCCAAGNONE 
J023034E06CCAGCCCAAGNONE 
J023039I05CCAGCCCAAGNONE 
J033024E14CCAGCCCAAGNONE 
J033039N04CCAGCCCAAGNONE 
J033048P16CCAGCCCAAGNONE 
J033069F24CCAGCCCAAGNONE 
J033071D15CCAGCCCAAGNONE 
J033106D01CCAGCCCAAGNONE 
J033106D09CCAGCCCAAGNONE 
J033106F09CCAGCCCAAGNONE 
J033107K03CCAGCCCAAGNONE 
J033129G10CCAGCCCAAGNONE 
J065016B15CCAGCCCAAGNONE 
J065022H07CCAGCCCAAGNONE 
J065048E07CCAGCCCAAGNONE 
J065068B11CCAGCCCAAGNONE 
J065157C13CCAGCCCAAGNONE 
J100042J02CCAGCCCAAGNONE 
Os06g0484600009-122-D10ATGGCCCAAGCCCAAGNONE 
AK062871ATGGCCCAAGCCCAAGSimilar to Pherophorin-S precursor. 
J075017F14ATGGCCCAAGCCCAAGNONE 
J075021E06ATGGCCCAAGCCCAAGNONE 
J075054C10ATGGCCCAAGCCCAAGNONE 
Os06g0486000AK100169CTTGGGCTProtein kinase-like domain containing protein. 
Os06g0546500AK073833CAAGCCCAAGSimilar to Class III peroxidase GvPx2b (Fragment). 
J065042H02CAAGCCCAAGNONE 
Os06g0556300AK063985CCCAGCCCAAGCyclin-like F-box domain containing protein. 
AK101552CCCAGCCCAAGNONE 
Os06g0590301J033139K16TTGGCCCAAGCCCAAGNONE 
J065011M13TTGGCCCAAGCCCAAGNONE 
J065027D20TTGGCCCAAGCCCAAGNONE 
J065039O05TTGGCCCAAGCCCAAGGlucose/ribitol dehydrogenase family protein. 
J065051O10TTGGCCCAAGCCCAAGNONE 
J065128I21TTGGCCCAAGCCCAAGNONE 
J065163P10TTGGCCCAAGCCCAAGNONE 
J065169H02TTGGCCCAAGCCCAAGNONE 
Os06g0674800J065007E09GCAGCCCAAGNONE 
J065037D21GCAGCCCAAGHypothetical protein. 
J065063P14GCAGCCCAAGNONE 
J065128K24GCAGCCCAAGNONE 
J065188F06GCAGCCCAAGNONE 
J065199I24GCAGCCCAAGNONE 
J065214N19GCAGCCCAAGNONE 
Os06g0687200AK058749AGCCCAAGZinc finger, RING-type domain containing protein. 
Os06g0731700J065089G16GAAGCCCAAGNONE 
J065157E16GAAGCCCAAGNONE 
Os07g0121100AK102706AGCCCAAGProtein of unknown function DUF1719, Oryza sativa family protein. 
Os07g0122000AK102508AGCCCAAGProtein of unknown function DUF1719, Oryza sativa family protein. 
J033095G03AGCCCAAGNONE 
J065177D19AGCCCAAGNONE 
Os07g0133700J065005A21TCAGCCCAGCCCAGCCCAAGHypothetical protein. 
J065096D02TCAGCCCAGCCCAGCCCAAGNONE 
J065097G13TCAGCCCAGCCCAGCCCAAGNONE 
Os07g0185900009-023-G07CCCAGCCCAAGNONE 
009-105-E06CCCAGCCCAAGNONE 
009-125-B01CCCAGCCCAAGNONE 
009-169-A01CCCAGCCCAAGNONE 
AK070315CCCAGCCCAAGConserved hypothetical protein. 
J065140H13CCCAGCCCAAGNONE 
J100024L12CCCAGCCCAAGNONE 
Os07g0191700AK066389GCGGCCCAGCCCAAGSimilar to AT.I.24-9 protein (Fragment). 
AK103768GCGGCCCAGCCCAAGNONE 
Os07g0238800015-056-A01AGCCCAAGNONE 
AK106355AGCCCAAGProtein of unknown function DUF1723 domain containing protein. 
J065082E06AGCCCAAGNONE 
J065100L15AGCCCAAGNONE 
Os07g0555400AK070977CTTGGGCCGTGCTTGGGCTGAConserved hypothetical protein. 
Os07g0568700005-009-E12AGCCCAAGNONE 
006-100-D05AGCCCAAGNONE 
AF466357AGCCCAAGNONE 
AK061685AGCCCAAGNONE 
AK101897AGCCCAAGPolygalacturonase inhibitor 1 precursor (Polygalacturonase-inhibiting protein) (Floral organ regulator 1). 
J013067A12AGCCCAAGNONE 
J013129M22AGCCCAAGNONE 
J013170I15AGCCCAAGNONE 
J023008C13AGCCCAAGNONE 
J023010N01AGCCCAAGNONE 
J023024B08AGCCCAAGNONE 
J023026P11AGCCCAAGNONE 
J023030D12AGCCCAAGNONE 
J023031A19AGCCCAAGNONE 
J023061K19AGCCCAAGNONE 
J023065P08AGCCCAAGNONE 
J023074J10AGCCCAAGNONE 
J023078B17AGCCCAAGNONE 
J023080N22AGCCCAAGNONE 
J023098E21AGCCCAAGNONE 
J023101G13AGCCCAAGNONE 
J023106D07AGCCCAAGNONE 
J023123F20AGCCCAAGNONE 
J023133B22AGCCCAAGNONE 
J023148C22AGCCCAAGNONE 
J033060O10AGCCCAAGNONE 
J033068F12AGCCCAAGNONE 
J033070P18AGCCCAAGNONE 
J033075F21AGCCCAAGNONE 
J033079P04AGCCCAAGNONE 
J033082B10AGCCCAAGNONE 
J033086E07AGCCCAAGNONE 
J033108N11AGCCCAAGNONE 
J033122I16AGCCCAAGNONE 
J033145B19AGCCCAAGNONE 
J043040A18AGCCCAAGNONE 
J065081A15AGCCCAAGNONE 
J080004O13AGCCCAAGNONE 
J080005J19AGCCCAAGNONE 
J080011E13AGCCCAAGNONE 
J080014F24AGCCCAAGNONE 
J080021L01AGCCCAAGNONE 
J080025E09AGCCCAAGNONE 
J080037I21AGCCCAAGNONE 
J080039G24AGCCCAAGNONE 
J080044I04AGCCCAAGNONE 
J080053A18AGCCCAAGNONE 
J080053C03AGCCCAAGNONE 
J080054D10AGCCCAAGNONE 
J080058J03AGCCCAAGNONE 
J080068I04AGCCCAAGNONE 
J080077G15AGCCCAAGNONE 
J080086L13AGCCCAAGNONE 
J080092F14AGCCCAAGNONE 
J080092I21AGCCCAAGNONE 
J080094G12AGCCCAAGNONE 
J090003H04AGCCCAAGNONE 
J090031A07AGCCCAAGNONE 
Os07g0570700AK065242CTTGGGCTRibosome recycling factor family protein. 
J013002I12CTTGGGCTNONE 
Os07g0604500009-018-C07CTTGGGCTGANONE 
009-194-C02CTTGGGCTGANONE 
011-023-C06CTTGGGCTGANONE 
015-035-B10CTTGGGCTGANONE 
AK064312CTTGGGCTGASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK069085CTTGGGCTGANONE 
J090050I12CTTGGGCTGANONE 
J100027C10CTTGGGCTGANONE 
J100029A05CTTGGGCTGANONE 
J100031P17CTTGGGCTGANONE 
J100039E20CTTGGGCTGANONE 
J100064L15CTTGGGCTGANONE 
J100066K08CTTGGGCTGANONE 
Os07g0614000015-078-C05GACGTGGCTTGGGCTNONE 
AK069163GACGTGGCTTGGGCTNONE 
AK109489GACGTGGCTTGGGCTStrictosidine synthase family protein. 
J065123D15GACGTGGCTTGGGCTNONE 
J065124L12GACGTGGCTTGGGCTNONE 
J065180F02GACGTGGCTTGGGCTNONE 
J075143N04GACGTGGCTTGGGCTNONE 
J080014B10GACGTGGCTTGGGCTNONE 
J080026L16GACGTGGCTTGGGCTNONE 
J080044H09GACGTGGCTTGGGCTNONE 
J080071M17GACGTGGCTTGGGCTNONE 
Os07g0634300AK109879CTTGGGCTConserved hypothetical protein. 
J100035O13CTTGGGCTNONE 
J100039D07CTTGGGCTNONE 
J100039F13CTTGGGCTNONE 
Os07g0673100AK060100AAAGCCCAAGNONE 
AK103678AAAGCCCAAGRibosomal protein S8E family protein. 
AK104794AAAGCCCAAGNONE 
Os07g0682000AK110569CTTGGGCTTCHeavy metal transport/detoxification protein domain containing protein. 
Os08g0116800AK063695CAAGCCCAAGExoribonuclease domain containing protein. 
Os08g0128000AK069322ACAGCCCAAGNONE 
AK103896ACAGCCCAAGGalactose oxidase, central domain containing protein. 
J023013D19ACAGCCCAAGNONE 
J023013I07ACAGCCCAAGNONE 
J023037F21ACAGCCCAAGNONE 
J023106B02ACAGCCCAAGNONE 
J023134E22ACAGCCCAAGNONE 
J033027F15ACAGCCCAAGNONE 
J033150H12ACAGCCCAAGNONE 
J090088A10ACAGCCCAAGNONE 
Os08g0191900AK067587CTTGGGCTProtein prenyltransferase domain containing protein. 
AK099016CTTGGGCTNONE 
J013032I08CTTGGGCTNONE 
J013050I24CTTGGGCTNONE 
J013128E05CTTGGGCTNONE 
Os08g0236900AK109597CTTGGGCTTGConserved hypothetical protein. 
Os08g0278100014-004-D02AGCCCAAGNONE 
014-004-D02TAAGCCCAAGNONE 
AK063626AGCCCAAGConserved hypothetical protein. 
AK063626TAAGCCCAAGConserved hypothetical protein. 
Os08g0341700J100085I02AGCCCAAGNONE 
Os08g0387050J043038F21CTTGGGCTGCConserved hypothetical protein. 
Os08g0411200AK120890AGCCCAAGSAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0456600AK059009AAAGCCCAAGConserved hypothetical protein. 
Os08g0476000J065040M11CTTGGGCTNONE 
J065051M03CTTGGGCTNONE 
J065065F08CTTGGGCTNONE 
Os08g0505900014-083-F01AGCCCAAGNONE 
AK060670AGCCCAAGSimilar to DNA-damage-repair/toleration protein DRT100 precursor. 
AK120866AGCCCAAGNONE 
AK120908AGCCCAAGNONE 
Os08g0558200AK069761TAAGCCCAAGGlutathione S-transferase, N-terminal domain containing protein. 
J013041N12TAAGCCCAAGNONE 
J013093H08TAAGCCCAAGNONE 
J023020B17TAAGCCCAAGNONE 
J023028D17TAAGCCCAAGNONE 
J023039B10TAAGCCCAAGNONE 
J065045O11TAAGCCCAAGNONE 
J065206N10TAAGCCCAAGNONE 
J075032G11TAAGCCCAAGNONE 
J075037C22TAAGCCCAAGNONE 
J075074J23TAAGCCCAAGNONE 
J090023A08TAAGCCCAAGNONE 
J090028N16TAAGCCCAAGNONE 
J100081G01TAAGCCCAAGNONE 
Os08g0563300009-007-B01TAAGCCCAAGNONE 
AK062315TAAGCCCAAGSimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
J065095F04TAAGCCCAAGNONE 
Os09g0103400016-041-C04GAAGCCCAAGNONE 
016-045-D02GAAGCCCAAGNONE 
AK064377GAAGCCCAAGConserved hypothetical protein. 
J043010E20GAAGCCCAAGNONE 
Os09g0323000AK121426GAAGCCCAAGSimilar to UDP-galactose 4-epimerase-like protein. 
Os09g0332100009-067-H06CTTGGGCTGCNONE 
009-092-B11CTTGGGCTGCNONE 
009-094-D10CTTGGGCTGCNONE 
009-095-C09CTTGGGCTGCNONE 
009-147-F07CTTGGGCTGCNONE 
AK069759CTTGGGCTGCConserved hypothetical protein. 
J080092G16CTTGGGCTGCNONE 
J090053I07CTTGGGCTGCNONE 
Os09g0388400AK069644CTTGGGCTGTCof protein family protein. 
J023147A17CTTGGGCTGTNONE 
Os09g0434900AK109104AGCCCAAGNONE 
AK120863AGCCCAAGZinc finger, RING-type domain containing protein. 
Os09g0458100AK109625AGCCCAAGXyloglucan fucosyltransferase family protein. 
Os09g0534000AK100026CTTGGGCTConserved hypothetical protein. 
Os09g0535000AK058712CTTGGGCTGTSimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488CTTGGGCTGTNONE 
AK069832CTTGGGCTGTNONE 
J100065D20CTTGGGCTGTNONE 
Os09g0535300AK071211AAGGCCCAGCCCAAGXAP5 protein family protein. 
Os09g0568000AK068829ACAGCCCAAGNONE 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os12g0100100006-036-G03GGGCTTGGGCTTCNONE 
AK061492GGGCTTGGGCTTCSimilar to ALY protein. 
AK068452GGGCTTGGGCTTCNONE 
J013153E18GGGCTTGGGCTTCNONE 
J033140D06GGGCTTGGGCTTCNONE 
J065046A19GGGCTTGGGCTTCNONE 
J065061F08GGGCTTGGGCTTCNONE 
J065101I03GGGCTTGGGCTTCNONE 
J065158B05GGGCTTGGGCTTCNONE 
J065162H06GGGCTTGGGCTTCNONE 
J065195I23GGGCTTGGGCTTCNONE 
J065218E07GGGCTTGGGCTTCNONE 
Os12g0122000AB180961AGCCCAAGSCARECROW. 
J065142K16AGCCCAAGNONE 
J100030A12AGCCCAAGNONE 
Os12g0131300J090086B06CTTGGGCTGTHypothetical protein. 
Os12g0146500AK107470AGCCCAAGProtein of unknown function DUF668 family protein. 
Os12g0164300AK120100GCCCAGCCCAAGCyclin-like F-box domain containing protein. 
J013022J17GCCCAGCCCAAGNONE 
J013040L22GCCCAGCCCAAGNONE 
J013041G05GCCCAGCCCAAGNONE 
J013096I02GCCCAGCCCAAGNONE 
J013156F05GCCCAGCCCAAGNONE 
J023122E20GCCCAGCCCAAGNONE 
J065008K06GCCCAGCCCAAGNONE 
J065073G14GCCCAGCCCAAGNONE 
J065105H07GCCCAGCCCAAGNONE 
J065117A15GCCCAGCCCAAGNONE 
J075025K21GCCCAGCCCAAGNONE 
J075051A13GCCCAGCCCAAGNONE 
J075119C17GCCCAGCCCAAGNONE 
J075143A02GCCCAGCCCAAGNONE 
J075149K04GCCCAGCCCAAGNONE 
J080304A20GCCCAGCCCAAGNONE 
J080305H17GCCCAGCCCAAGNONE 
J080306D14GCCCAGCCCAAGNONE 
J080306N01GCCCAGCCCAAGNONE 
J080308P13GCCCAGCCCAAGNONE 
J080310C04GCCCAGCCCAAGNONE 
J090048B12GCCCAGCCCAAGNONE 
J090092A18GCCCAGCCCAAGNONE 
J090099G20GCCCAGCCCAAGNONE 
Os12g0223700J075049J03CTTGGGCCAAAAGCCCAAGHypothetical protein. 
J075101F23CTTGGGCCAAAAGCCCAAGNONE 
Os12g0244000AK106408CTTGGGCTCGGCCCAAGHypothetical protein. 
Os12g0279600AK070295AAAGCCCAAGExodeoxyribonuclease III xth family protein. 
Os12g0479400AK065254AAAGCCCAAGCCCAGCCCAACCNONE 
AK065254AGCCCAAGNONE 
AK067061AAAGCCCAAGCCCAGCCCAACCSimilar to Auxin response factor 1. 
AK067061AGCCCAAGSimilar to Auxin response factor 1. 
Os12g0527500AK109836CCCAGCCCAAGCyclin-like F-box domain containing protein. 
AK109836GAAGCCCAAGCyclin-like F-box domain containing protein. 
Os12g0540000AK108630TAATGGGCTTGGGCTConserved hypothetical protein. 
J065046N02TAATGGGCTTGGGCTNONE 
J065100H24TAATGGGCTTGGGCTNONE 
J065142M24TAATGGGCTTGGGCTNONE 
Os12g0564400009-069-F12GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
AK059949GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
Os12g0573200AK111522AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
AK121943AGCCCAAGCCCAGCCCAGCCCAGCCCAAACGRAS transcription factor domain containing protein. 
J013002M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013151M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013159J22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J023087F18AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033107F03AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033125L09AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033126E12AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J043022I15AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J065176F05AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090034D17AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090075J06AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058D22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058P04AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
Os12g0610950J075157D04ACAGCCCAAGHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.