version

Summary of OsREG460 (All List)

OrganismOryza sativa  
IDOsREG460  
SequenceAGCCCAAT  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1341  

Entry Sequences (1341 entries)

LocusGene modelSequenceDescription
Os01g0104800AK067602GAAGCCCAATASas10/Utp3 family protein. 
J013109E04GAAGCCCAATANONE 
J033057M05GAAGCCCAATANONE 
J043021M24GAAGCCCAATANONE 
J090014N05GAAGCCCAATANONE 
J090077H23GAAGCCCAATANONE 
J090084H08GAAGCCCAATANONE 
Os01g0134200AK102394AGCCCAATConserved hypothetical protein. 
Os01g0158900AK066765AAAAGCCCAATZinc finger, RING-type domain containing protein. 
Os01g0220300009-063-C12TATTGGGCTTTNONE 
AK105167TATTGGGCTTTConserved hypothetical protein. 
J065124E17TATTGGGCTTTNONE 
J090096L11TATTGGGCTTTNONE 
Os01g0283700AK107149AGCCCAATTSimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44). 
Os01g0580300AK063468GCAGCCCAATConserved hypothetical protein. 
Os01g0585400AK103584AGCCCAAAGCCCAATConserved hypothetical protein. 
J033133B01AGCCCAAAGCCCAATNONE 
Os01g0626300016-070-G04AATTGGGCTGTNONE 
016-070-G04GCAGCCCAATANONE 
AK122071AATTGGGCTGTSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
AK122071GCAGCCCAATASimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04AATTGGGCTGTNONE 
J023108I04GCAGCCCAATANONE 
J033117J08AATTGGGCTGTNONE 
J033117J08GCAGCCCAATANONE 
J065007O12AATTGGGCTGTNONE 
J065007O12GCAGCCCAATANONE 
J065020K12AATTGGGCTGTNONE 
J065020K12GCAGCCCAATANONE 
J065142D24AATTGGGCTGTNONE 
J065142D24GCAGCCCAATANONE 
J065157K19AATTGGGCTGTNONE 
J065157K19GCAGCCCAATANONE 
J080307H19AATTGGGCTGTNONE 
J080307H19GCAGCCCAATANONE 
J080311D16AATTGGGCTGTNONE 
J080311D16GCAGCCCAATANONE 
J080316C12AATTGGGCTGTNONE 
J080316C12GCAGCCCAATANONE 
J080316E03AATTGGGCTGTNONE 
J080316E03GCAGCCCAATANONE 
J100033K16AATTGGGCTGTNONE 
J100033K16GCAGCCCAATANONE 
J100042J21AATTGGGCTGTNONE 
J100042J21GCAGCCCAATANONE 
J100051E06AATTGGGCTGTNONE 
J100051E06GCAGCCCAATANONE 
J100071E22AATTGGGCTGTNONE 
J100071E22GCAGCCCAATANONE 
Os01g0679600009-061-F03AAAGCCCAATAGGCCCAATANONE 
014-055-H04AAAGCCCAATAGGCCCAATANONE 
AK062530AAAGCCCAATAGGCCCAATAConserved hypothetical protein. 
J065015E10AAAGCCCAATAGGCCCAATANONE 
J065061F21AAAGCCCAATAGGCCCAATANONE 
J065128F13AAAGCCCAATAGGCCCAATANONE 
J065189E14AAAGCCCAATAGGCCCAATANONE 
J075006F04AAAGCCCAATAGGCCCAATANONE 
J075017A20AAAGCCCAATAGGCCCAATANONE 
J075075H02AAAGCCCAATAGGCCCAATANONE 
J075104C06AAAGCCCAATAGGCCCAATANONE 
J075154F23AAAGCCCAATAGGCCCAATANONE 
J075168N01AAAGCCCAATAGGCCCAATANONE 
J075189L15AAAGCCCAATAGGCCCAATANONE 
J075192J18AAAGCCCAATAGGCCCAATANONE 
J100062M10AAAGCCCAATAGGCCCAATANONE 
J100064C23AAAGCCCAATAGGCCCAATANONE 
J100080M16AAAGCCCAATAGGCCCAATANONE 
Os01g0688200AK120982AAAGCCCAATAAlpha/beta hydrolase family protein. 
Os01g0704700AK100296AAAGCCCAATSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2. 
Os01g0715800011-061-G06AGCCCAATANONE 
AK063369AGCCCAATAConserved hypothetical protein. 
J065194O22AGCCCAATANONE 
Os01g0719250AK105184TAGGCCCATTGGGCTConserved hypothetical protein. 
Os01g0742000009-105-F08ATTGGGCTGANONE 
AK062779ATTGGGCTGAtRNA/rRNA methyltransferase, SpoU domain containing protein. 
Os01g0764300J090053G03AGCCCAATGGGCCATProtein of unknown function DUF155 family protein. 
Os01g0785600AK111308TTGGCCCAGCCCAATAMethyltransferase type 11 domain containing protein. 
Os01g0785700AK100774TATTGGGCTGGGCCAANONE 
AK102081TATTGGGCTGGGCCAAProtein prenyltransferase domain containing protein. 
AY129829TATTGGGCTGGGCCAANONE 
J023120B17TATTGGGCTGGGCCAANONE 
J033082K10TATTGGGCTGGGCCAANONE 
Os01g0810100AK071916ATGGCCCAGCCCAATTRibonuclease III domain containing protein. 
AK099056ATGGCCCAGCCCAATTNONE 
AK104320ATGGCCCAGCCCAATTNONE 
Os01g0838800AK066366CCAGCCCAATANONE 
AK073775CCAGCCCAATAClathrin adaptor complex, small chain family protein. 
J013067M01CCAGCCCAATANONE 
J033030I24CCAGCCCAATANONE 
J090089A10CCAGCCCAATANONE 
Os01g0868300AB004461TCAGCCCAATSimilar to DNA polymerase alpha catalytic subunit (EC 2.7.7.7). 
Os01g0876400AK100486ATTGGGCTNONE 
J023097N16ATTGGGCTNONE 
Os01g0916300011-018-B12AATTGGGCTNONE 
AK063922AATTGGGCTSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
AK103107AATTGGGCTNONE 
AK121061AATTGGGCTNONE 
AK121997AATTGGGCTNONE 
J033118P14AATTGGGCTNONE 
J065002N16AATTGGGCTNONE 
J065079B04AATTGGGCTNONE 
J065102J07AATTGGGCTNONE 
J065128F16AATTGGGCTNONE 
J065184D11AATTGGGCTNONE 
J065186A07AATTGGGCTNONE 
J075115C07AATTGGGCTNONE 
J075147C04AATTGGGCTNONE 
Os01g0948300009-023-A03AGCCCAATNONE 
AK102153AGCCCAATCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J013090K24AGCCCAATNONE 
J023019C13AGCCCAATNONE 
J023049L21AGCCCAATNONE 
J023066H02AGCCCAATNONE 
J033050A07AGCCCAATNONE 
J033086E01AGCCCAATNONE 
J033086F11AGCCCAATNONE 
J090047I04AGCCCAATNONE 
J100035E10AGCCCAATNONE 
J100040L06AGCCCAATNONE 
J100044G21AGCCCAATNONE 
J100045F13AGCCCAATNONE 
J100046G12AGCCCAATNONE 
J100075N10AGCCCAATNONE 
J100077I01AGCCCAATNONE 
Os01g0974500015-047-H07ATTGGGCTTCNONE 
AK064109ATTGGGCTTCPectinacetylesterase family protein. 
Os02g0133800006-092-D12CCTGGGCCAAAGCCCAATTNONE 
006-111-G01CCTGGGCCAAAGCCCAATTNONE 
AK103646CCTGGGCCAAAGCCCAATTNONE 
AK109376CCTGGGCCAAAGCCCAATTProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886CCTGGGCCAAAGCCCAATTNONE 
J033135B19CCTGGGCCAAAGCCCAATTNONE 
J065200F01CCTGGGCCAAAGCCCAATTNONE 
J065213J11CCTGGGCCAAAGCCCAATTNONE 
J075031N16CCTGGGCCAAAGCCCAATTNONE 
J075032N17CCTGGGCCAAAGCCCAATTNONE 
J075047P04CCTGGGCCAAAGCCCAATTNONE 
J075063D01CCTGGGCCAAAGCCCAATTNONE 
J075105F23CCTGGGCCAAAGCCCAATTNONE 
J075121E16CCTGGGCCAAAGCCCAATTNONE 
J075176F10CCTGGGCCAAAGCCCAATTNONE 
J075182M16CCTGGGCCAAAGCCCAATTNONE 
J075190E09CCTGGGCCAAAGCCCAATTNONE 
J075191B14CCTGGGCCAAAGCCCAATTNONE 
J100055J24CCTGGGCCAAAGCCCAATTNONE 
J100066H24CCTGGGCCAAAGCCCAATTNONE 
J100073N01CCTGGGCCAAAGCCCAATTNONE 
Os02g0163600AK068043ACAGCCCAATAConserved hypothetical protein. 
J013131O20ACAGCCCAATANONE 
J065006E03ACAGCCCAATANONE 
Os02g0184200J075194A02ATTGGGCTNONE 
Os02g0193600AK060499AAAAGCCCAATTMad3/BUB1 homology region 1 domain containing protein. 
Os02g0499300AK106994CAAGCCCAATTConserved hypothetical protein. 
Os02g0638400AK060633AGCCCAATGGCCCAGATGGGCCGABRO1 domain containing protein. 
J065083J17AGCCCAATGGCCCAGATGGGCCGANONE 
Os02g0643500AK068423AGCCCAATAPentapeptide repeat containing protein. 
Os02g0673000AK108650CCAGCCCAATAProtein of unknown function UPF0005 family protein. 
Os02g0754700AK066904AGCCCAATSimilar to Histidyl-tRNA synthetase (EC 6.1.1.21). 
AK099136AGCCCAATNONE 
Os02g0771200011-006-B07AGCCCAATANONE 
AK066823AGCCCAATAConserved hypothetical protein. 
AK071059AGCCCAATANONE 
J013075K03AGCCCAATANONE 
Os02g0787100Os02g0787100CAAGCCCAATAProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0791400009-106-F11TATTGGGCTTCNONE 
AK062787TATTGGGCTTCCytochrome oxidase c, subunit VIb family protein. 
Os02g0796900009-121-E06AGCCCAATTNONE 
D29725AGCCCAATTSimilar to 60S ribosomal protein L39. 
J075016N24AGCCCAATTNONE 
J075085F03AGCCCAATTNONE 
J075147P11AGCCCAATTNONE 
J075180E16AGCCCAATTNONE 
J075182A19AGCCCAATTNONE 
Os02g0811800011-036-F07ACAGCCCAATNONE 
AK063935ACAGCCCAATSimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44). 
AK119257ACAGCCCAATNONE 
J033022E13ACAGCCCAATNONE 
J033023F12ACAGCCCAATNONE 
J033028M20ACAGCCCAATNONE 
J033035L05ACAGCCCAATNONE 
J033043C20ACAGCCCAATNONE 
J033051O11ACAGCCCAATNONE 
J033071L10ACAGCCCAATNONE 
J033084E05ACAGCCCAATNONE 
J033101O21ACAGCCCAATNONE 
J033108A10ACAGCCCAATNONE 
J033115N15ACAGCCCAATNONE 
J033116N18ACAGCCCAATNONE 
J033117A11ACAGCCCAATNONE 
J033121C24ACAGCCCAATNONE 
J033131H15ACAGCCCAATNONE 
J033136O11ACAGCCCAATNONE 
J033138D20ACAGCCCAATNONE 
J033147C09ACAGCCCAATNONE 
J043036O15ACAGCCCAATNONE 
Os02g0819700AK067374TATTGGGCTZinc finger, Zim17-type family protein. 
AK099160TATTGGGCTNONE 
J100086K17TATTGGGCTNONE 
Os02g0828200AK071199TGCGGCCCACAGCCCAATANONE 
Os03g0181400012-051-B05CAAGCCCAATANONE 
015-065-E09CAAGCCCAATANONE 
AK064006CAAGCCCAATAProtein of unknown function DUF860, plant family protein. 
Os03g0249900AK058379GCAGCCCAATAConserved hypothetical protein. 
Os03g0282900006-088-H05AGCCCAATANONE 
AK061166AGCCCAATANONE 
AK102161AGCCCAATAConserved hypothetical protein. 
AK104514AGCCCAATANONE 
Os03g0313600AK067474ATTGGGCTSimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
AK067474ATTGGGCTGGSimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
AK067474ATTGGGCTGGGCTGASimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
Os03g0338000AK121399TATTGGGCTSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0355800AK069271AATTGGGCTTTNONE 
AK103902AATTGGGCTTTSimilar to Diphthine synthase (EC 2.1.1.98) (Diphthamide biosynthesis methyltransferase). 
Os03g0383100AK107106AGCCCAATGGGCCAGAConserved hypothetical protein. 
Os03g0388500AK070350ATTGGGCTGCSimilar to Anther ethylene-upregulated protein ER1 (Fragment). 
Os03g0393900AK069809TATTGGGCTTCCATGGGCCTCSimilar to S.tuberosum patatin (Fragment). 
J023030J03TATTGGGCTTCCATGGGCCTCNONE 
Os03g0438400AK070383AAGGCCCAAGCCCAATAConserved hypothetical protein. 
J023054E02AAGGCCCAAGCCCAATANONE 
Os03g0577000012-055-F04AAAGCCCAATGGGCTTTNONE 
AK061051AAAGCCCAATGGGCTTTSimilar to Ribosomal protein S3 (Fragment). 
AK099146AAAGCCCAATGGGCTTTNONE 
J065060A01AAAGCCCAATGGGCTTTNONE 
J075079B17AAAGCCCAATGGGCTTTNONE 
J075134K12AAAGCCCAATGGGCTTTNONE 
J090048F23AAAGCCCAATGGGCTTTNONE 
J090072I19AAAGCCCAATGGGCTTTNONE 
J100087C19AAAGCCCAATGGGCTTTNONE 
J100090C21AAAGCCCAATGGGCTTTNONE 
Os03g0604600J090093K23AAAAGCCCAATAConserved hypothetical protein. 
Os03g0699100AK110715AGCCCAATTWD40-like domain containing protein. 
Os03g0712200AK073205AAAAGCCCAATZinc finger, RanBP2-type domain containing protein. 
AK098968AAAAGCCCAATNONE 
Os03g0719100AK065127AGCCCAATTDNA-binding SAP domain containing protein. 
J013001P07AGCCCAATTNONE 
J065102J01AGCCCAATTNONE 
J065205K05AGCCCAATTNONE 
Os03g0740700011-093-H12AATTGGGCTGANONE 
AK102723AATTGGGCTGAProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19AATTGGGCTGANONE 
J013126N16AATTGGGCTGANONE 
J033105J16AATTGGGCTGANONE 
J090059D19AATTGGGCTGANONE 
Os03g0746000AK073682GTGGCCCATTGGGCTGAConserved hypothetical protein. 
AK111472GTGGCCCATTGGGCTGANONE 
J090083F05GTGGCCCATTGGGCTGANONE 
Os03g0751400AK069033TATTGGGCTTCSimilar to 50S ribosomal protein l6. 
J023004G24TATTGGGCTTCNONE 
J065176D08TATTGGGCTTCNONE 
Os03g0784400AK103474CAAGCCCAATGGGCCGAGAProtein of unknown function DUF1692 domain containing protein. 
J023135I15CAAGCCCAATGGGCCGAGANONE 
J033130D12CAAGCCCAATGGGCCGAGANONE 
J043035E20CAAGCCCAATGGGCCGAGANONE 
J065206K15CAAGCCCAATGGGCCGAGANONE 
J075053J20CAAGCCCAATGGGCCGAGANONE 
J075129B11CAAGCCCAATGGGCCGAGANONE 
J090003E22CAAGCCCAATGGGCCGAGANONE 
J100023E23CAAGCCCAATGGGCCGAGANONE 
Os03g0809300011-024-C02TATTGGGCTTANONE 
016-071-E09TATTGGGCTTANONE 
AK103140TATTGGGCTTAProtein phosphatase 2C-like domain containing protein. 
J013030O08TATTGGGCTTANONE 
J013108D19TATTGGGCTTANONE 
J013124D15TATTGGGCTTANONE 
J013128F17TATTGGGCTTANONE 
J013146J06TATTGGGCTTANONE 
J013149D12TATTGGGCTTANONE 
J013154P12TATTGGGCTTANONE 
J013162N01TATTGGGCTTANONE 
J013170G15TATTGGGCTTANONE 
J013170H16TATTGGGCTTANONE 
J023022I09TATTGGGCTTANONE 
J023072B19TATTGGGCTTANONE 
J023106H09TATTGGGCTTANONE 
J023135C03TATTGGGCTTANONE 
J023141C09TATTGGGCTTANONE 
J033091K23TATTGGGCTTANONE 
J033107I05TATTGGGCTTANONE 
J033112M18TATTGGGCTTANONE 
J033120G10TATTGGGCTTANONE 
J033144G06TATTGGGCTTANONE 
J043017L21TATTGGGCTTANONE 
J043024O10TATTGGGCTTANONE 
J053023K04TATTGGGCTTANONE 
J053035D01TATTGGGCTTANONE 
J053037P10TATTGGGCTTANONE 
J053042K15TATTGGGCTTANONE 
J053047C14TATTGGGCTTANONE 
J053054A06TATTGGGCTTANONE 
J053071H03TATTGGGCTTANONE 
J053073G08TATTGGGCTTANONE 
J053090D04TATTGGGCTTANONE 
J053095E17TATTGGGCTTANONE 
J090007O03TATTGGGCTTANONE 
J090024G24TATTGGGCTTANONE 
J090042M08TATTGGGCTTANONE 
J090045I16TATTGGGCTTANONE 
J090051E13TATTGGGCTTANONE 
J090073B15TATTGGGCTTANONE 
J090096F19TATTGGGCTTANONE 
J100030M23TATTGGGCTTANONE 
Os03g0837300AK111243AAAGCCCAATTNONE 
AK121140AAAGCCCAATTNicotinate phosphoribosyltransferase and related family protein. 
AY214337AAAGCCCAATTNONE 
J023077G12AAAGCCCAATTNONE 
J023078M10AAAGCCCAATTNONE 
J033031B10AAAGCCCAATTNONE 
J033067L18AAAGCCCAATTNONE 
J043005P09AAAGCCCAATTNONE 
J090013J15AAAGCCCAATTNONE 
J090042E10AAAGCCCAATTNONE 
J090045A20AAAGCCCAATTNONE 
J100022H02AAAGCCCAATTNONE 
Os03g0843500AK067985GCAGCCCAATNONE 
AK101661GCAGCCCAATSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454GCAGCCCAATNONE 
J080302L23GCAGCCCAATNONE 
Os04g0132500AK112081GAAGCCCAATNONE 
AK121779GAAGCCCAATProtein kinase-like domain containing protein. 
Os04g0381100AK121764TAAGCCCAATTBile acid:sodium symporter family protein. 
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
Os04g0440000AK073064GCAGCCCAATTNONE 
AK101691GCAGCCCAATTConserved hypothetical protein. 
AK102407GCAGCCCAATTNONE 
Os04g0451100AK106764AGCCCAATAConserved hypothetical protein. 
Os04g0461100009-136-H10GCTGGGCCATATTGGGCTTTNONE 
009-147-H12GCTGGGCCATATTGGGCTTTNONE 
AK068022GCTGGGCCATATTGGGCTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24GCTGGGCCATATTGGGCTTTNONE 
J065019D10GCTGGGCCATATTGGGCTTTNONE 
J065168O21GCTGGGCCATATTGGGCTTTNONE 
J075051G06GCTGGGCCATATTGGGCTTTNONE 
J075148G11GCTGGGCCATATTGGGCTTTNONE 
Os04g0475300AK066351TATTGGGCTTTGAGGCCCATAConserved hypothetical protein. 
J065138J21TATTGGGCTTTGAGGCCCATANONE 
Os04g0476400J033082D17AGCCCAATTNONE 
Os04g0539000009-165-H09ACAGCCCAATANONE 
014-012-F10ACAGCCCAATANONE 
AK105343ACAGCCCAATALambda integrase-like, N-terminal domain containing protein. 
Os04g0574500AK110934ACAGCCCAATSimilar to Growth-regulating factor 3. 
J065101K11ACAGCCCAATNONE 
J065207F18ACAGCCCAATNONE 
Os04g0611300009-006-G08TATTGGGCTGGCCCAATTNONE 
009-011-C01TATTGGGCTGGCCCAATTNONE 
009-036-B09TATTGGGCTGGCCCAATTNONE 
009-116-G09TATTGGGCTGGCCCAATTNONE 
009-126-E09TATTGGGCTGGCCCAATTNONE 
009-132-F09TATTGGGCTGGCCCAATTNONE 
009-151-G07TATTGGGCTGGCCCAATTNONE 
009-155-C07TATTGGGCTGGCCCAATTNONE 
009-163-G01TATTGGGCTGGCCCAATTNONE 
009-169-G08TATTGGGCTGGCCCAATTNONE 
009-191-B02TATTGGGCTGGCCCAATTNONE 
009-196-A08TATTGGGCTGGCCCAATTNONE 
009-198-E07TATTGGGCTGGCCCAATTNONE 
014-015-F04TATTGGGCTGGCCCAATTNONE 
015-087-H04TATTGGGCTGGCCCAATTNONE 
AK062605TATTGGGCTGGCCCAATTNONE 
AK063022TATTGGGCTGGCCCAATTConserved hypothetical protein. 
AK066749TATTGGGCTGGCCCAATTNONE 
AK104924TATTGGGCTGGCCCAATTNONE 
J065002M20TATTGGGCTGGCCCAATTNONE 
J065045L23TATTGGGCTGGCCCAATTNONE 
J065101E05TATTGGGCTGGCCCAATTNONE 
J065140J23TATTGGGCTGGCCCAATTNONE 
J065179G11TATTGGGCTGGCCCAATTNONE 
J065191B18TATTGGGCTGGCCCAATTNONE 
J065192E03TATTGGGCTGGCCCAATTNONE 
J065199H21TATTGGGCTGGCCCAATTNONE 
J075067F01TATTGGGCTGGCCCAATTNONE 
J075089L01TATTGGGCTGGCCCAATTNONE 
J075147K22TATTGGGCTGGCCCAATTNONE 
J080069G23TATTGGGCTGGCCCAATTNONE 
J100053D10TATTGGGCTGGCCCAATTNONE 
J100078C10TATTGGGCTGGCCCAATTNONE 
Os04g0650200AK072573ATTGGGCTGGNONE 
AK109786ATTGGGCTGGLipolytic enzyme, G-D-S-L family protein. 
Os05g0101200012-091-H04AGCCCAATNONE 
AK062021AGCCCAATNONE 
AK099093AGCCCAATPeroxisomal membrane anchor protein (Pex14p) domain containing protein. 
AY262026AGCCCAATNONE 
J013025H22AGCCCAATNONE 
J013026A01AGCCCAATNONE 
J013026O05AGCCCAATNONE 
J013042B15AGCCCAATNONE 
J013045F02AGCCCAATNONE 
J013045F03AGCCCAATNONE 
J013062N14AGCCCAATNONE 
J013062P14AGCCCAATNONE 
J013089M19AGCCCAATNONE 
J013121D23AGCCCAATNONE 
J013126M01AGCCCAATNONE 
J013128A03AGCCCAATNONE 
J013149B07AGCCCAATNONE 
J013151E11AGCCCAATNONE 
J023019E14AGCCCAATNONE 
J023072L20AGCCCAATNONE 
J023112E01AGCCCAATNONE 
J023121L08AGCCCAATNONE 
J023130P18AGCCCAATNONE 
J023147H04AGCCCAATNONE 
J033066B09AGCCCAATNONE 
J033071J01AGCCCAATNONE 
J033098O20AGCCCAATNONE 
J033117K09AGCCCAATNONE 
J033138G16AGCCCAATNONE 
J033139L04AGCCCAATNONE 
J033148H09AGCCCAATNONE 
J033148I09AGCCCAATNONE 
J090063J24AGCCCAATNONE 
J100028D01AGCCCAATNONE 
Os05g0103500AK060306AAAAGCCCAATACHCH domain containing protein. 
AK102829AAAAGCCCAATANONE 
J033109D16AAAAGCCCAATANONE 
J043016E20AAAAGCCCAATANONE 
J065001C14AAAAGCCCAATANONE 
J065116L24AAAAGCCCAATANONE 
J075018E04AAAAGCCCAATANONE 
J075045E18AAAAGCCCAATANONE 
J075093G20AAAAGCCCAATANONE 
J075171A09AAAAGCCCAATANONE 
J100029F18AAAAGCCCAATANONE 
J100046I24AAAAGCCCAATANONE 
Os05g0110700AK102486ATCTGGGCCTAAGCCCAATAKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12ATCTGGGCCTAAGCCCAATANONE 
Os05g0111000AK073598TCAGCCCAATTSimilar to Gag polyprotein [Contains: Core protein p15 (Matrix protein); Core protein p24; Core protein p12]. 
Os05g0124700011-003-D10ATTGGGCTGANONE 
AK063257ATTGGGCTGADeoxynucleoside kinase family protein. 
Os05g0128100009-051-B07ATTGGGCTTGNONE 
009-127-B08ATTGGGCTTGNONE 
009-144-H03ATTGGGCTTGNONE 
009-176-B05ATTGGGCTTGNONE 
AK108556ATTGGGCTTGNONE 
AK119308ATTGGGCTTGNONE 
AK120934ATTGGGCTTGConserved hypothetical protein. 
J023036J15ATTGGGCTTGNONE 
J065122L01ATTGGGCTTGNONE 
J075104P10ATTGGGCTTGNONE 
Os05g0149600012-070-F05GCAGCCCAATTNONE 
012-080-A12GCAGCCCAATTNONE 
012-082-C06GCAGCCCAATTNONE 
AK073947GCAGCCCAATTSimilar to Cullin-1. 
J023063A09GCAGCCCAATTNONE 
J033073A13GCAGCCCAATTNONE 
J033093B09GCAGCCCAATTNONE 
J065017B10GCAGCCCAATTNONE 
J065037P19GCAGCCCAATTNONE 
J065142G16GCAGCCCAATTNONE 
J065147F13GCAGCCCAATTNONE 
J065195M20GCAGCCCAATTNONE 
J090011L24GCAGCCCAATTNONE 
J090018I19GCAGCCCAATTNONE 
J090040M12GCAGCCCAATTNONE 
J090054K21GCAGCCCAATTNONE 
J090059G09GCAGCCCAATTNONE 
J090070H17GCAGCCCAATTNONE 
J090071G17GCAGCCCAATTNONE 
J090077L09GCAGCCCAATTNONE 
J090091C15GCAGCCCAATTNONE 
J100032J17GCAGCCCAATTNONE 
J100061E08GCAGCCCAATTNONE 
Os05g0155300AK069217AGCCCAATTSimilar to HIRA interacting protein 5. 
Os05g0186000006-103-D10AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-047-D06AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-073-G05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-084-G09AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-097-G04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-111-D11AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-115-G01AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-131-B04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-144-F05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-154-D08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
014-004-H02AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK058675AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK060420AAAGCCCAATCCATGGGCCTGGGCTTCSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J065155C08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J075143K12AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
Os05g0220900AK109172CCCAGCCCAATTNONE 
AK109456CCCAGCCCAATTPrefoldin domain containing protein. 
Os05g0227100009-045-C06TAAGCCCAATANONE 
009-109-A08TAAGCCCAATANONE 
J075072D22TAAGCCCAATAHypothetical protein. 
Os05g0227300Os05g0227300TAAGCCCAATANONE 
Os05g0323100AK109472AAAGCCCAATARhodanese-like domain containing protein. 
Os05g0355450AK063864AGCCCAATConserved hypothetical protein. 
Os05g0383100AK121835TATTGGGCTTCClathrin adaptor complex, medium chain family protein. 
Os05g0429900AK066834CCAAGCCCAATANONE 
AK099108CCAAGCCCAATANONE 
AK104053CCAAGCCCAATANONE 
D88617CCAAGCCCAATASimilar to MybHv5 (Fragment). 
J090031E22CCAAGCCCAATANONE 
Os05g0447000AK108280AATTGGGCTTTTAGCCCATGTSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0518300003-113-E09AGCCCAATANONE 
006-088-A08AGCCCAATANONE 
011-046-H04AGCCCAATANONE 
013-059-A09AGCCCAATANONE 
014-094-H08AGCCCAATANONE 
015-008-B01AGCCCAATANONE 
015-062-H06AGCCCAATANONE 
016-057-H02AGCCCAATANONE 
AK061147AGCCCAATALipolytic enzyme, G-D-S-L family protein. 
J065171N11AGCCCAATANONE 
J065186B12AGCCCAATANONE 
Os05g0521500AK066030TATTGGGCTGTPeptidase S16, lon N-terminal domain containing protein. 
Os05g0524200AK071990GAAGCCCAATDual specificity protein phosphatase domain containing protein. 
Os05g0545500AK101095TATTGGGCTTTConserved hypothetical protein. 
AK119499TATTGGGCTTTNONE 
Os05g0552900AK102095CCAGCCCAATTMAP65/ASE1 family protein. 
Os05g0557200AK062090AATTGGGCTNONE 
AK102111AATTGGGCTArmadillo-like helical domain containing protein. 
J013047E13AATTGGGCTNONE 
J013089P04AATTGGGCTNONE 
J013130H17AATTGGGCTNONE 
J013132C20AATTGGGCTNONE 
J023001E06AATTGGGCTNONE 
J023108C09AATTGGGCTNONE 
J023125C12AATTGGGCTNONE 
J033023O10AATTGGGCTNONE 
J033033K16AATTGGGCTNONE 
J033064C11AATTGGGCTNONE 
J033071P07AATTGGGCTNONE 
J033072H14AATTGGGCTNONE 
J033084F06AATTGGGCTNONE 
J033084H11AATTGGGCTNONE 
J033097C05AATTGGGCTNONE 
J043009E20AATTGGGCTNONE 
J053035M10AATTGGGCTNONE 
J053043J22AATTGGGCTNONE 
J053082K10AATTGGGCTNONE 
J053094N13AATTGGGCTNONE 
Os05g0571100006-092-E08TATTGGGCTTANONE 
006-120-A03TATTGGGCTTANONE 
015-030-F01TATTGGGCTTANONE 
AK068658TATTGGGCTTAProtein of unknown function DUF860, plant family protein. 
AK104438TATTGGGCTTANONE 
Os05g0574500006-021-A08ATTGGGCTGTNONE 
006-049-A11ATTGGGCTGTNONE 
006-086-F03ATTGGGCTGTNONE 
009-051-F06ATTGGGCTGTNONE 
AB015287ATTGGGCTGTNONE 
AB015972ATTGGGCTGTNONE 
AK061714ATTGGGCTGTNONE 
AK098889ATTGGGCTGTNONE 
AK121699ATTGGGCTGTSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATTGGGCTGTNONE 
J013072D17ATTGGGCTGTNONE 
J023028M04ATTGGGCTGTNONE 
J023031F01ATTGGGCTGTNONE 
J023114L22ATTGGGCTGTNONE 
J033058L12ATTGGGCTGTNONE 
J033073D17ATTGGGCTGTNONE 
J043031D08ATTGGGCTGTNONE 
J043036G01ATTGGGCTGTNONE 
J065144O04ATTGGGCTGTNONE 
J065181O08ATTGGGCTGTNONE 
J080066B20ATTGGGCTGTNONE 
Os05g0597100011-044-C10TCAGCCCAAGCCCAATNONE 
AF255711TCAGCCCAAGCCCAATNONE 
AK072845TCAGCCCAAGCCCAATSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16TCAGCCCAAGCCCAATNONE 
J023135M22TCAGCCCAAGCCCAATNONE 
J023141B21TCAGCCCAAGCCCAATNONE 
J023142J09TCAGCCCAAGCCCAATNONE 
J033025E09TCAGCCCAAGCCCAATNONE 
J033111A20TCAGCCCAAGCCCAATNONE 
J033126I01TCAGCCCAAGCCCAATNONE 
Os06g0106800006-036-B11TATTGGGCTNONE 
006-046-F11TATTGGGCTNONE 
011-014-C09TATTGGGCTNONE 
011-060-G08TATTGGGCTNONE 
AK073364TATTGGGCTNONE 
AK105650TATTGGGCTNONE 
AK105782TATTGGGCTNONE 
AK105911TATTGGGCTNONE 
AK122178TATTGGGCTConserved hypothetical protein. 
J033023K09TATTGGGCTNONE 
J033093J16TATTGGGCTNONE 
J033148N22TATTGGGCTNONE 
J100054L15TATTGGGCTNONE 
Os06g0119300AK067271CCAGCCCAATCCAGCCCAGProtein of unknown function DUF594 family protein. 
Os06g0124900009-128-B12ATTGGGCTNONE 
009-186-H09ATTGGGCTNONE 
AK062901ATTGGGCTConserved hypothetical protein. 
J013056D13ATTGGGCTNONE 
J013056D17ATTGGGCTNONE 
J013066A13ATTGGGCTNONE 
J013066C03ATTGGGCTNONE 
J013066F01ATTGGGCTNONE 
J023078D03ATTGGGCTNONE 
J033113N02ATTGGGCTNONE 
J065019F09ATTGGGCTNONE 
J065048C21ATTGGGCTNONE 
J065077L13ATTGGGCTNONE 
J065082J09ATTGGGCTNONE 
J065113H16ATTGGGCTNONE 
J065147A20ATTGGGCTNONE 
J065180A13ATTGGGCTNONE 
J065198M18ATTGGGCTNONE 
J065207K19ATTGGGCTNONE 
J075109H13ATTGGGCTNONE 
Os06g0130000AK064427TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK070084TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK119321TATTGGGCTCAGCCCATGAGCCCATGTSimilar to Tobacco mosaic virus helicase domain-binding protein (Fragment). 
Os06g0135340J065061D17TCAGCCCAATANONE 
J065159A10TCAGCCCAATAConserved hypothetical protein. 
Os06g0140100011-063-A02GCAGCCCAATNONE 
AK063371GCAGCCCAATLeucine carboxyl methyltransferase family protein. 
Os06g0199500AK060939ACAGCCCAATANONE 
AK064613ACAGCCCAATASimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138ACAGCCCAATANONE 
Os06g0257200J053059P05GCAGCCCAATNONE 
J075006K03GCAGCCCAATNONE 
J075067F07GCAGCCCAATNONE 
J075068F14GCAGCCCAATNONE 
J075068H14GCAGCCCAATNONE 
J075098N06GCAGCCCAATNONE 
J075099F08GCAGCCCAATNONE 
J075154G24GCAGCCCAATNONE 
J075195H09GCAGCCCAATNONE 
Os06g0542200AK058589CCAGCCCAATANADP oxidoreductase, coenzyme F420-dependent family protein. 
Os06g0567900AB004799AGCCCAATTSimilar to L-ascorbate oxidase precursor (EC 1.10.3.3) (Ascorbase) (ASO). 
AK105605AGCCCAATTNONE 
Os06g0656800AK109762AAAGCCCAATGGGCCAGABeta-Ig-H3/fasciclin domain containing protein. 
Os06g0667600AK058606AGCCCAATTNONE 
AK071621AGCCCAATTSimilar to Glycine decarboxylase complex H-protein. 
J023101D03AGCCCAATTNONE 
J033095E17AGCCCAATTNONE 
J065020B16AGCCCAATTNONE 
Os06g0704900AK103054AGCCCAATASimilar to Cell division-like protein. 
J033117I21AGCCCAATANONE 
Os07g0100200006-022-D06TATTGGGCTNONE 
011-025-B06TATTGGGCTNONE 
012-069-A07TATTGGGCTNONE 
AK060986TATTGGGCTNONE 
AK073305TATTGGGCTSimilar to PDX1-like protein 4. 
J023055C05TATTGGGCTNONE 
J033024J11TATTGGGCTNONE 
J065045F14TATTGGGCTNONE 
J075097C22TATTGGGCTNONE 
Os07g0176600AK066812TCAGCCCAATTNONE 
AK067073TCAGCCCAATTSimilar to Kinase-like protein. 
Os07g0437500AK103253ATTGGGCTSimilar to Tyrosine decarboxylase 1 (EC 4.1.1.25). 
Os07g0486000AK069343TATTGGGCTTCSimilar to MSH4. 
Os07g0513200015-004-B02AGCCCAATTNONE 
AK101410AGCCCAATTNONE 
AK106227AGCCCAATTNONE 
AK119451AGCCCAATTProtein prenyltransferase domain containing protein. 
Os07g0565600AK071983TATTGGGCTTTGGGCTSimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481TATTGGGCTTTGGGCTNONE 
Os07g0568900009-083-H02TAATGGGCCTTATTGGGCTTANONE 
AK062660TAATGGGCCTTATTGGGCTTAConserved hypothetical protein. 
Os07g0569000AK073915TAAGCCCAATAAGGCCCATTAConserved hypothetical protein. 
Os07g0585800006-106-A05CAGCCCAATANONE 
AK066419CAGCCCAATANONE 
AK105064CAGCCCAATASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01CAGCCCAATANONE 
J065085B08CAGCCCAATANONE 
J065099I23CAGCCCAATANONE 
J065169A01CAGCCCAATANONE 
J065187N13CAGCCCAATANONE 
J065191L18CAGCCCAATANONE 
J065194D04CAGCCCAATANONE 
J065211M09CAGCCCAATANONE 
J065212I02CAGCCCAATANONE 
J090003C10CAGCCCAATANONE 
J090025O11CAGCCCAATANONE 
J090092F10CAGCCCAATANONE 
J100055A04CAGCCCAATANONE 
J100064A01CAGCCCAATANONE 
J100080L02CAGCCCAATANONE 
Os07g0633800AK103878AGCCCAATConserved hypothetical protein. 
J033025K08AGCCCAATNONE 
J033026N04AGCCCAATNONE 
J090062M09AGCCCAATNONE 
J090087F04AGCCCAATNONE 
Os07g0644300AK066726TAAGCCCAATTSimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483TAAGCCCAATTNONE 
Os07g0653100J065130E21AATTGGGCTTCConserved hypothetical protein. 
J065186P07AATTGGGCTTCNONE 
Os07g0668200AK059051AAAGCCCAGCCCAATNONE 
AK101682AAAGCCCAGCCCAATConserved hypothetical protein. 
AK102839AAAGCCCAGCCCAATNONE 
Os07g0679500AK102562CCAGCCCAATSimilar to Transcription factor RF2b. 
Os07g0690300012-048-A07AGCCCAATTNONE 
AK099674AGCCCAATTChromatin SPT2 family protein. 
J013028F12AGCCCAATTNONE 
J013069F21AGCCCAATTNONE 
J013104E17AGCCCAATTNONE 
J013153M16AGCCCAATTNONE 
J023012L09AGCCCAATTNONE 
J023069A08AGCCCAATTNONE 
J023132L23AGCCCAATTNONE 
J033120P19AGCCCAATTNONE 
J065173J03AGCCCAATTNONE 
J075008H06AGCCCAATTNONE 
J075043J15AGCCCAATTNONE 
J075147I12AGCCCAATTNONE 
J090041G07AGCCCAATTNONE 
Os08g0102000009-020-B12CCCAGCCCAATNONE 
009-068-H05CCCAGCCCAATNONE 
009-119-F03CCCAGCCCAATNONE 
009-166-A06CCCAGCCCAATNONE 
009-176-G12CCCAGCCCAATNONE 
AK068156CCCAGCCCAATGCN5-related N-acetyltransferase domain containing protein. 
Os08g0107500013-094-H02TCCGGCCCACGAACCAGCCCAATTNONE 
013-095-E07TCCGGCCCACGAACCAGCCCAATTNONE 
AK064053TCCGGCCCACGAACCAGCCCAATTShwachman-Bodian-Diamond syndrome proteins family protein. 
AK101418TCCGGCCCACGAACCAGCCCAATTNONE 
J033037P14TCCGGCCCACGAACCAGCCCAATTNONE 
J090025I15TCCGGCCCACGAACCAGCCCAATTNONE 
J100022F23TCCGGCCCACGAACCAGCCCAATTNONE 
Os08g0113800J033069I12TAAGCCCAATTNONE 
J053050I07TAAGCCCAATTNONE 
J065006J11TAAGCCCAATTNONE 
J065013D02TAAGCCCAATTNONE 
J065055L24TAAGCCCAATTNONE 
J065071I11TAAGCCCAATTConserved hypothetical protein. 
J065093G12TAAGCCCAATTNONE 
J065101N03TAAGCCCAATTNONE 
Os08g0130500006-024-B12AGCCCAATAAGGCCCATCTNONE 
006-032-F11AGCCCAATAAGGCCCATCTNONE 
006-047-B12AGCCCAATAAGGCCCATCTNONE 
006-058-H06AGCCCAATAAGGCCCATCTNONE 
006-062-D07AGCCCAATAAGGCCCATCTNONE 
006-083-F11AGCCCAATAAGGCCCATCTNONE 
006-084-A11AGCCCAATAAGGCCCATCTNONE 
006-096-F12AGCCCAATAAGGCCCATCTNONE 
006-105-A04AGCCCAATAAGGCCCATCTNONE 
006-110-D11AGCCCAATAAGGCCCATCTNONE 
011-022-D11AGCCCAATAAGGCCCATCTNONE 
AK064857AGCCCAATAAGGCCCATCT60S acidic ribosomal protein P0. 
D21130AGCCCAATAAGGCCCATCTNONE 
J013000H12AGCCCAATAAGGCCCATCTNONE 
J013024M17AGCCCAATAAGGCCCATCTNONE 
J013028H09AGCCCAATAAGGCCCATCTNONE 
J013045N22AGCCCAATAAGGCCCATCTNONE 
J013092K19AGCCCAATAAGGCCCATCTNONE 
J013106L12AGCCCAATAAGGCCCATCTNONE 
J013107A03AGCCCAATAAGGCCCATCTNONE 
J013109E12AGCCCAATAAGGCCCATCTNONE 
J013114N08AGCCCAATAAGGCCCATCTNONE 
J013120J12AGCCCAATAAGGCCCATCTNONE 
J013121E21AGCCCAATAAGGCCCATCTNONE 
J013135P20AGCCCAATAAGGCCCATCTNONE 
J023006J08AGCCCAATAAGGCCCATCTNONE 
J023014L16AGCCCAATAAGGCCCATCTNONE 
J023020N03AGCCCAATAAGGCCCATCTNONE 
J023027M24AGCCCAATAAGGCCCATCTNONE 
J023029D18AGCCCAATAAGGCCCATCTNONE 
J023030A14AGCCCAATAAGGCCCATCTNONE 
J023041G23AGCCCAATAAGGCCCATCTNONE 
J023049H05AGCCCAATAAGGCCCATCTNONE 
J023060I23AGCCCAATAAGGCCCATCTNONE 
J023099D07AGCCCAATAAGGCCCATCTNONE 
J023104A20AGCCCAATAAGGCCCATCTNONE 
J023105F18AGCCCAATAAGGCCCATCTNONE 
J023112D21AGCCCAATAAGGCCCATCTNONE 
J023122M18AGCCCAATAAGGCCCATCTNONE 
J023139J20AGCCCAATAAGGCCCATCTNONE 
J023149L20AGCCCAATAAGGCCCATCTNONE 
J023150G04AGCCCAATAAGGCCCATCTNONE 
J033036G02AGCCCAATAAGGCCCATCTNONE 
J033045P13AGCCCAATAAGGCCCATCTNONE 
J033046A22AGCCCAATAAGGCCCATCTNONE 
J033086H16AGCCCAATAAGGCCCATCTNONE 
J033087D07AGCCCAATAAGGCCCATCTNONE 
J033089M14AGCCCAATAAGGCCCATCTNONE 
J033095F14AGCCCAATAAGGCCCATCTNONE 
J033108M01AGCCCAATAAGGCCCATCTNONE 
J033117A17AGCCCAATAAGGCCCATCTNONE 
J033122F03AGCCCAATAAGGCCCATCTNONE 
J033126A04AGCCCAATAAGGCCCATCTNONE 
J033144D13AGCCCAATAAGGCCCATCTNONE 
J033145D13AGCCCAATAAGGCCCATCTNONE 
J043022M09AGCCCAATAAGGCCCATCTNONE 
J053025I11AGCCCAATAAGGCCCATCTNONE 
J053027K06AGCCCAATAAGGCCCATCTNONE 
J053029D15AGCCCAATAAGGCCCATCTNONE 
J053048I22AGCCCAATAAGGCCCATCTNONE 
J053055I01AGCCCAATAAGGCCCATCTNONE 
J053079P07AGCCCAATAAGGCCCATCTNONE 
J053090J23AGCCCAATAAGGCCCATCTNONE 
J053094C24AGCCCAATAAGGCCCATCTNONE 
J065023F18AGCCCAATAAGGCCCATCTNONE 
J065029I12AGCCCAATAAGGCCCATCTNONE 
J065044B18AGCCCAATAAGGCCCATCTNONE 
J065045C07AGCCCAATAAGGCCCATCTNONE 
J065063K22AGCCCAATAAGGCCCATCTNONE 
J065093D11AGCCCAATAAGGCCCATCTNONE 
J065096P09AGCCCAATAAGGCCCATCTNONE 
J065099N04AGCCCAATAAGGCCCATCTNONE 
J065103K24AGCCCAATAAGGCCCATCTNONE 
J065110H12AGCCCAATAAGGCCCATCTNONE 
J065132F24AGCCCAATAAGGCCCATCTNONE 
J065157K16AGCCCAATAAGGCCCATCTNONE 
J065185D11AGCCCAATAAGGCCCATCTNONE 
J065202E16AGCCCAATAAGGCCCATCTNONE 
J065217D07AGCCCAATAAGGCCCATCTNONE 
J075053I19AGCCCAATAAGGCCCATCTNONE 
J075055L24AGCCCAATAAGGCCCATCTNONE 
J075056H24AGCCCAATAAGGCCCATCTNONE 
J075070D02AGCCCAATAAGGCCCATCTNONE 
J075084O15AGCCCAATAAGGCCCATCTNONE 
J075090F24AGCCCAATAAGGCCCATCTNONE 
J075135E03AGCCCAATAAGGCCCATCTNONE 
J075174A01AGCCCAATAAGGCCCATCTNONE 
J075188F05AGCCCAATAAGGCCCATCTNONE 
J075192C17AGCCCAATAAGGCCCATCTNONE 
J080001B02AGCCCAATAAGGCCCATCTNONE 
J080001C08AGCCCAATAAGGCCCATCTNONE 
J080002D15AGCCCAATAAGGCCCATCTNONE 
J080002I03AGCCCAATAAGGCCCATCTNONE 
J080003E24AGCCCAATAAGGCCCATCTNONE 
J080004M10AGCCCAATAAGGCCCATCTNONE 
J080005C18AGCCCAATAAGGCCCATCTNONE 
J080006A12AGCCCAATAAGGCCCATCTNONE 
J080006F04AGCCCAATAAGGCCCATCTNONE 
J080006M11AGCCCAATAAGGCCCATCTNONE 
J080008J11AGCCCAATAAGGCCCATCTNONE 
J080008J22AGCCCAATAAGGCCCATCTNONE 
J080009F14AGCCCAATAAGGCCCATCTNONE 
J080010B12AGCCCAATAAGGCCCATCTNONE 
J080010G14AGCCCAATAAGGCCCATCTNONE 
J080010N07AGCCCAATAAGGCCCATCTNONE 
J080011D04AGCCCAATAAGGCCCATCTNONE 
J080011G10AGCCCAATAAGGCCCATCTNONE 
J080011O19AGCCCAATAAGGCCCATCTNONE 
J080013K23AGCCCAATAAGGCCCATCTNONE 
J080013M09AGCCCAATAAGGCCCATCTNONE 
J080013N12AGCCCAATAAGGCCCATCTNONE 
J080013O15AGCCCAATAAGGCCCATCTNONE 
J080014C13AGCCCAATAAGGCCCATCTNONE 
J080014D21AGCCCAATAAGGCCCATCTNONE 
J080014F08AGCCCAATAAGGCCCATCTNONE 
J080014N08AGCCCAATAAGGCCCATCTNONE 
J080014P19AGCCCAATAAGGCCCATCTNONE 
J080015L09AGCCCAATAAGGCCCATCTNONE 
J080015P15AGCCCAATAAGGCCCATCTNONE 
J080018P10AGCCCAATAAGGCCCATCTNONE 
J080020C06AGCCCAATAAGGCCCATCTNONE 
J080022C14AGCCCAATAAGGCCCATCTNONE 
J080022E01AGCCCAATAAGGCCCATCTNONE 
J080022P04AGCCCAATAAGGCCCATCTNONE 
J080022P10AGCCCAATAAGGCCCATCTNONE 
J080023B20AGCCCAATAAGGCCCATCTNONE 
J080023G19AGCCCAATAAGGCCCATCTNONE 
J080024N15AGCCCAATAAGGCCCATCTNONE 
J080025E11AGCCCAATAAGGCCCATCTNONE 
J080025G24AGCCCAATAAGGCCCATCTNONE 
J080026B01AGCCCAATAAGGCCCATCTNONE 
J080026B05AGCCCAATAAGGCCCATCTNONE 
J080027L17AGCCCAATAAGGCCCATCTNONE 
J080028K02AGCCCAATAAGGCCCATCTNONE 
J080029L23AGCCCAATAAGGCCCATCTNONE 
J080030D08AGCCCAATAAGGCCCATCTNONE 
J080031C03AGCCCAATAAGGCCCATCTNONE 
J080031K02AGCCCAATAAGGCCCATCTNONE 
J080032C16AGCCCAATAAGGCCCATCTNONE 
J080033F10AGCCCAATAAGGCCCATCTNONE 
J080033G12AGCCCAATAAGGCCCATCTNONE 
J080033K03AGCCCAATAAGGCCCATCTNONE 
J080034B03AGCCCAATAAGGCCCATCTNONE 
J080034N21AGCCCAATAAGGCCCATCTNONE 
J080034O03AGCCCAATAAGGCCCATCTNONE 
J080035G10AGCCCAATAAGGCCCATCTNONE 
J080038E14AGCCCAATAAGGCCCATCTNONE 
J080039A19AGCCCAATAAGGCCCATCTNONE 
J080039G10AGCCCAATAAGGCCCATCTNONE 
J080039J01AGCCCAATAAGGCCCATCTNONE 
J080039J09AGCCCAATAAGGCCCATCTNONE 
J080040F07AGCCCAATAAGGCCCATCTNONE 
J080040H18AGCCCAATAAGGCCCATCTNONE 
J080041E08AGCCCAATAAGGCCCATCTNONE 
J080041E16AGCCCAATAAGGCCCATCTNONE 
J080041L08AGCCCAATAAGGCCCATCTNONE 
J080042A07AGCCCAATAAGGCCCATCTNONE 
J080044E02AGCCCAATAAGGCCCATCTNONE 
J080045K03AGCCCAATAAGGCCCATCTNONE 
J080046O03AGCCCAATAAGGCCCATCTNONE 
J080047F08AGCCCAATAAGGCCCATCTNONE 
J080048H01AGCCCAATAAGGCCCATCTNONE 
J080048I05AGCCCAATAAGGCCCATCTNONE 
J080048N06AGCCCAATAAGGCCCATCTNONE 
J080050A07AGCCCAATAAGGCCCATCTNONE 
J080050B04AGCCCAATAAGGCCCATCTNONE 
J080050E21AGCCCAATAAGGCCCATCTNONE 
J080051J01AGCCCAATAAGGCCCATCTNONE 
J080051K02AGCCCAATAAGGCCCATCTNONE 
J080051L02AGCCCAATAAGGCCCATCTNONE 
J080052C20AGCCCAATAAGGCCCATCTNONE 
J080052I22AGCCCAATAAGGCCCATCTNONE 
J080052J21AGCCCAATAAGGCCCATCTNONE 
J080052K22AGCCCAATAAGGCCCATCTNONE 
J080055A05AGCCCAATAAGGCCCATCTNONE 
J080055I12AGCCCAATAAGGCCCATCTNONE 
J080056A21AGCCCAATAAGGCCCATCTNONE 
J080056N11AGCCCAATAAGGCCCATCTNONE 
J080057D02AGCCCAATAAGGCCCATCTNONE 
J080058H21AGCCCAATAAGGCCCATCTNONE 
J080058P16AGCCCAATAAGGCCCATCTNONE 
J080059M03AGCCCAATAAGGCCCATCTNONE 
J080059N17AGCCCAATAAGGCCCATCTNONE 
J080060F13AGCCCAATAAGGCCCATCTNONE 
J080060H06AGCCCAATAAGGCCCATCTNONE 
J080060J03AGCCCAATAAGGCCCATCTNONE 
J080060O09AGCCCAATAAGGCCCATCTNONE 
J080060P22AGCCCAATAAGGCCCATCTNONE 
J080061F06AGCCCAATAAGGCCCATCTNONE 
J080061H21AGCCCAATAAGGCCCATCTNONE 
J080061O13AGCCCAATAAGGCCCATCTNONE 
J080062J07AGCCCAATAAGGCCCATCTNONE 
J080063A08AGCCCAATAAGGCCCATCTNONE 
J080063F19AGCCCAATAAGGCCCATCTNONE 
J080063O18AGCCCAATAAGGCCCATCTNONE 
J080065D15AGCCCAATAAGGCCCATCTNONE 
J080066E13AGCCCAATAAGGCCCATCTNONE 
J080068L01AGCCCAATAAGGCCCATCTNONE 
J080068P07AGCCCAATAAGGCCCATCTNONE 
J080069I21AGCCCAATAAGGCCCATCTNONE 
J080070M04AGCCCAATAAGGCCCATCTNONE 
J080071E01AGCCCAATAAGGCCCATCTNONE 
J080071J08AGCCCAATAAGGCCCATCTNONE 
J080071M23AGCCCAATAAGGCCCATCTNONE 
J080072A03AGCCCAATAAGGCCCATCTNONE 
J080072G18AGCCCAATAAGGCCCATCTNONE 
J080075A04AGCCCAATAAGGCCCATCTNONE 
J080075E19AGCCCAATAAGGCCCATCTNONE 
J080075P18AGCCCAATAAGGCCCATCTNONE 
J080076N11AGCCCAATAAGGCCCATCTNONE 
J080077A11AGCCCAATAAGGCCCATCTNONE 
J080077D22AGCCCAATAAGGCCCATCTNONE 
J080077H18AGCCCAATAAGGCCCATCTNONE 
J080077L03AGCCCAATAAGGCCCATCTNONE 
J080078D02AGCCCAATAAGGCCCATCTNONE 
J080078L05AGCCCAATAAGGCCCATCTNONE 
J080078N20AGCCCAATAAGGCCCATCTNONE 
J080079I20AGCCCAATAAGGCCCATCTNONE 
J080081D04AGCCCAATAAGGCCCATCTNONE 
J080082A07AGCCCAATAAGGCCCATCTNONE 
J080082E24AGCCCAATAAGGCCCATCTNONE 
J080084A22AGCCCAATAAGGCCCATCTNONE 
J080084E15AGCCCAATAAGGCCCATCTNONE 
J080084G06AGCCCAATAAGGCCCATCTNONE 
J080086A05AGCCCAATAAGGCCCATCTNONE 
J080086F09AGCCCAATAAGGCCCATCTNONE 
J080087B11AGCCCAATAAGGCCCATCTNONE 
J080087H12AGCCCAATAAGGCCCATCTNONE 
J080088I05AGCCCAATAAGGCCCATCTNONE 
J080088N08AGCCCAATAAGGCCCATCTNONE 
J080088P07AGCCCAATAAGGCCCATCTNONE 
J080089A09AGCCCAATAAGGCCCATCTNONE 
J080089D21AGCCCAATAAGGCCCATCTNONE 
J080089F24AGCCCAATAAGGCCCATCTNONE 
J080089H22AGCCCAATAAGGCCCATCTNONE 
J080089I04AGCCCAATAAGGCCCATCTNONE 
J080090D01AGCCCAATAAGGCCCATCTNONE 
J080091F09AGCCCAATAAGGCCCATCTNONE 
J080091G18AGCCCAATAAGGCCCATCTNONE 
J080091L24AGCCCAATAAGGCCCATCTNONE 
J080091M12AGCCCAATAAGGCCCATCTNONE 
J080091N12AGCCCAATAAGGCCCATCTNONE 
J080093A15AGCCCAATAAGGCCCATCTNONE 
J080093C08AGCCCAATAAGGCCCATCTNONE 
J080093I08AGCCCAATAAGGCCCATCTNONE 
J080093P21AGCCCAATAAGGCCCATCTNONE 
J080094E18AGCCCAATAAGGCCCATCTNONE 
J080094F15AGCCCAATAAGGCCCATCTNONE 
J080094J21AGCCCAATAAGGCCCATCTNONE 
J080095A09AGCCCAATAAGGCCCATCTNONE 
J080096G05AGCCCAATAAGGCCCATCTNONE 
J080096K07AGCCCAATAAGGCCCATCTNONE 
J080097M17AGCCCAATAAGGCCCATCTNONE 
J080097P21AGCCCAATAAGGCCCATCTNONE 
J080302B15AGCCCAATAAGGCCCATCTNONE 
J080306J15AGCCCAATAAGGCCCATCTNONE 
J080306O13AGCCCAATAAGGCCCATCTNONE 
J080307C15AGCCCAATAAGGCCCATCTNONE 
J080307I04AGCCCAATAAGGCCCATCTNONE 
J080307L05AGCCCAATAAGGCCCATCTNONE 
J080308F11AGCCCAATAAGGCCCATCTNONE 
J080311C04AGCCCAATAAGGCCCATCTNONE 
J080311I07AGCCCAATAAGGCCCATCTNONE 
J080312C01AGCCCAATAAGGCCCATCTNONE 
J080312O08AGCCCAATAAGGCCCATCTNONE 
J080315F14AGCCCAATAAGGCCCATCTNONE 
J080318K13AGCCCAATAAGGCCCATCTNONE 
J080319A17AGCCCAATAAGGCCCATCTNONE 
J090001I01AGCCCAATAAGGCCCATCTNONE 
J090002O18AGCCCAATAAGGCCCATCTNONE 
J090007A08AGCCCAATAAGGCCCATCTNONE 
J090007F22AGCCCAATAAGGCCCATCTNONE 
J090008D09AGCCCAATAAGGCCCATCTNONE 
J090008L07AGCCCAATAAGGCCCATCTNONE 
J090008O08AGCCCAATAAGGCCCATCTNONE 
J090012N11AGCCCAATAAGGCCCATCTNONE 
J090013M05AGCCCAATAAGGCCCATCTNONE 
J090020E08AGCCCAATAAGGCCCATCTNONE 
J090020O20AGCCCAATAAGGCCCATCTNONE 
J090021I10AGCCCAATAAGGCCCATCTNONE 
J090023D07AGCCCAATAAGGCCCATCTNONE 
J090023K22AGCCCAATAAGGCCCATCTNONE 
J090023O08AGCCCAATAAGGCCCATCTNONE 
J090028D21AGCCCAATAAGGCCCATCTNONE 
J090029H14AGCCCAATAAGGCCCATCTNONE 
J090029L12AGCCCAATAAGGCCCATCTNONE 
J090030C05AGCCCAATAAGGCCCATCTNONE 
J090031D18AGCCCAATAAGGCCCATCTNONE 
J090032G10AGCCCAATAAGGCCCATCTNONE 
J090034J22AGCCCAATAAGGCCCATCTNONE 
J090034K16AGCCCAATAAGGCCCATCTNONE 
J090036D10AGCCCAATAAGGCCCATCTNONE 
J090037N17AGCCCAATAAGGCCCATCTNONE 
J090043P17AGCCCAATAAGGCCCATCTNONE 
J090044L20AGCCCAATAAGGCCCATCTNONE 
J090045N16AGCCCAATAAGGCCCATCTNONE 
J090048K03AGCCCAATAAGGCCCATCTNONE 
J090048K10AGCCCAATAAGGCCCATCTNONE 
J090049O07AGCCCAATAAGGCCCATCTNONE 
J090055H23AGCCCAATAAGGCCCATCTNONE 
J090056G12AGCCCAATAAGGCCCATCTNONE 
J090056G16AGCCCAATAAGGCCCATCTNONE 
J090059B16AGCCCAATAAGGCCCATCTNONE 
J090066H21AGCCCAATAAGGCCCATCTNONE 
J090067D22AGCCCAATAAGGCCCATCTNONE 
J090072M07AGCCCAATAAGGCCCATCTNONE 
J090073J21AGCCCAATAAGGCCCATCTNONE 
J090075A15AGCCCAATAAGGCCCATCTNONE 
J090079J09AGCCCAATAAGGCCCATCTNONE 
J090080L07AGCCCAATAAGGCCCATCTNONE 
J090084A03AGCCCAATAAGGCCCATCTNONE 
J090085B07AGCCCAATAAGGCCCATCTNONE 
J090088H11AGCCCAATAAGGCCCATCTNONE 
J090090J12AGCCCAATAAGGCCCATCTNONE 
J090091I21AGCCCAATAAGGCCCATCTNONE 
J090091L02AGCCCAATAAGGCCCATCTNONE 
J090093G18AGCCCAATAAGGCCCATCTNONE 
J090094D23AGCCCAATAAGGCCCATCTNONE 
J090098L19AGCCCAATAAGGCCCATCTNONE 
J100017I22AGCCCAATAAGGCCCATCTNONE 
J100018F08AGCCCAATAAGGCCCATCTNONE 
J100018G19AGCCCAATAAGGCCCATCTNONE 
J100019B05AGCCCAATAAGGCCCATCTNONE 
J100019J18AGCCCAATAAGGCCCATCTNONE 
J100019L04AGCCCAATAAGGCCCATCTNONE 
J100023M06AGCCCAATAAGGCCCATCTNONE 
J100024J23AGCCCAATAAGGCCCATCTNONE 
J100024P09AGCCCAATAAGGCCCATCTNONE 
J100027I05AGCCCAATAAGGCCCATCTNONE 
J100029G03AGCCCAATAAGGCCCATCTNONE 
J100029K08AGCCCAATAAGGCCCATCTNONE 
J100031J17AGCCCAATAAGGCCCATCTNONE 
J100037L16AGCCCAATAAGGCCCATCTNONE 
J100038C05AGCCCAATAAGGCCCATCTNONE 
J100039D19AGCCCAATAAGGCCCATCTNONE 
J100041L02AGCCCAATAAGGCCCATCTNONE 
J100045B08AGCCCAATAAGGCCCATCTNONE 
J100045B15AGCCCAATAAGGCCCATCTNONE 
J100047G07AGCCCAATAAGGCCCATCTNONE 
J100047P19AGCCCAATAAGGCCCATCTNONE 
J100048I15AGCCCAATAAGGCCCATCTNONE 
J100049M16AGCCCAATAAGGCCCATCTNONE 
J100049P18AGCCCAATAAGGCCCATCTNONE 
J100050E21AGCCCAATAAGGCCCATCTNONE 
J100051N02AGCCCAATAAGGCCCATCTNONE 
J100052M02AGCCCAATAAGGCCCATCTNONE 
J100055M24AGCCCAATAAGGCCCATCTNONE 
J100056K11AGCCCAATAAGGCCCATCTNONE 
J100059F20AGCCCAATAAGGCCCATCTNONE 
J100059J15AGCCCAATAAGGCCCATCTNONE 
J100068C19AGCCCAATAAGGCCCATCTNONE 
J100068G06AGCCCAATAAGGCCCATCTNONE 
J100069N02AGCCCAATAAGGCCCATCTNONE 
J100073N04AGCCCAATAAGGCCCATCTNONE 
J100074B05AGCCCAATAAGGCCCATCTNONE 
J100080P13AGCCCAATAAGGCCCATCTNONE 
J100083P09AGCCCAATAAGGCCCATCTNONE 
J100084B11AGCCCAATAAGGCCCATCTNONE 
J100085B07AGCCCAATAAGGCCCATCTNONE 
J100086O20AGCCCAATAAGGCCCATCTNONE 
J100087B02AGCCCAATAAGGCCCATCTNONE 
J100089B14AGCCCAATAAGGCCCATCTNONE 
Os08g0150800AK101530AGCCCAATTSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0158900AK067062AAAAGCCCAATTGTP1/OBG domain containing protein. 
J013089F04AAAAGCCCAATTNONE 
J013092D16AAAAGCCCAATTNONE 
J033120K14AAAAGCCCAATTNONE 
J033133F24AAAAGCCCAATTNONE 
J033145A10AAAAGCCCAATTNONE 
J033145A11AAAAGCCCAATTNONE 
J053048H24AAAAGCCCAATTNONE 
J053075H10AAAAGCCCAATTNONE 
Os08g0159000AK073617AATTGGGCTTTTNONE 
AK103973AATTGGGCTTTTSimilar to DnaJ homolog subfamily C member 1. 
J023130H14AATTGGGCTTTTNONE 
J033051J11AATTGGGCTTTTNONE 
J065101C10AATTGGGCTTTTNONE 
J065168B04AATTGGGCTTTTNONE 
J065184E22AATTGGGCTTTTNONE 
J080021D11AATTGGGCTTTTNONE 
J080025H10AATTGGGCTTTTNONE 
J080026N19AATTGGGCTTTTNONE 
J080034A12AATTGGGCTTTTNONE 
J080040L02AATTGGGCTTTTNONE 
J080042H19AATTGGGCTTTTNONE 
J080047B05AATTGGGCTTTTNONE 
J080047E09AATTGGGCTTTTNONE 
J080047I01AATTGGGCTTTTNONE 
J080052H19AATTGGGCTTTTNONE 
J080062K13AATTGGGCTTTTNONE 
J080063A22AATTGGGCTTTTNONE 
J080068G18AATTGGGCTTTTNONE 
J080068N19AATTGGGCTTTTNONE 
J080076G08AATTGGGCTTTTNONE 
J080077H13AATTGGGCTTTTNONE 
J080077K06AATTGGGCTTTTNONE 
J080093D15AATTGGGCTTTTNONE 
J080094D21AATTGGGCTTTTNONE 
J080097A20AATTGGGCTTTTNONE 
J080097E21AATTGGGCTTTTNONE 
J080097N17AATTGGGCTTTTNONE 
J100071K18AATTGGGCTTTTNONE 
J100072F09AATTGGGCTTTTNONE 
Os08g0178100AK101717TATTGGGCTTCPep3/Vps18/deep orange domain containing protein. 
Os08g0202400AK070769ATTGGGCTTTDisease resistance protein family protein. 
Os08g0243900011-052-H03TAAGCCCAATNONE 
AK102707TAAGCCCAATNONE 
AK121452TAAGCCCAATMu2 adaptin subunit (AP50) of AP2 domain containing protein. 
J023142L20TAAGCCCAATNONE 
J065168E04TAAGCCCAATNONE 
Os08g0386300AK059323TAAGCCCATTGGGCTGANONE 
AK070379TAAGCCCATTGGGCTGACytochrome b5 domain containing protein. 
J023054P20TAAGCCCATTGGGCTGANONE 
J033089H01TAAGCCCATTGGGCTGANONE 
J065013I01TAAGCCCATTGGGCTGANONE 
J065212E17TAAGCCCATTGGGCTGANONE 
J080317O15TAAGCCCATTGGGCTGANONE 
J090018O07TAAGCCCATTGGGCTGANONE 
Os08g0430600009-181-E04ACAGCCCAATTNONE 
AK060045ACAGCCCAATTConserved hypothetical protein. 
AK068922ACAGCCCAATTNONE 
J013170B19ACAGCCCAATTNONE 
J065076C03ACAGCCCAATTNONE 
J065218G16ACAGCCCAATTNONE 
J090045N10ACAGCCCAATTNONE 
J100028O03ACAGCCCAATTNONE 
Os08g0441400011-033-F01AGCCCAATANONE 
015-084-B04AGCCCAATANONE 
AK063317AGCCCAATANONE 
AK064141AGCCCAATAConserved hypothetical protein. 
J065060F06AGCCCAATANONE 
J075110A22AGCCCAATANONE 
J080307P11AGCCCAATANONE 
J090041E06AGCCCAATANONE 
Os08g0450800AK102479TATTGGGCTPhosphatidylinositol-4-phosphate 5-kinase family protein. 
Os08g0494300AK066150AGCCCAATvon Willebrand factor, type A domain containing protein. 
Os08g0565800009-034-G02AATTGGGCTGCNONE 
009-111-D12AATTGGGCTGCNONE 
AK062431AATTGGGCTGCSimilar to Glutaredoxin. 
AK062820AATTGGGCTGCNONE 
J075022E05AATTGGGCTGCNONE 
J075066F07AATTGGGCTGCNONE 
J075146B21AATTGGGCTGCNONE 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0287500006-102-A02CCAGCCCAGTAACAGCCCAATNONE 
AK059944CCAGCCCAGTAACAGCCCAATProtein of unknown function DUF565 family protein. 
Os09g0347900AK071224CAAGCCCAATTConserved hypothetical protein. 
J023087B12CAAGCCCAATTNONE 
Os09g0363700AK103667ATTGGGCTTTTConserved hypothetical protein. 
J075001L14ATTGGGCTTTTNONE 
J075049M23ATTGGGCTTTTNONE 
J075051I04ATTGGGCTTTTNONE 
J075073L04ATTGGGCTTTTNONE 
J075077E03ATTGGGCTTTTNONE 
J075083J11ATTGGGCTTTTNONE 
J075094J22ATTGGGCTTTTNONE 
J075112E08ATTGGGCTTTTNONE 
J075137J23ATTGGGCTTTTNONE 
J075192E02ATTGGGCTTTTNONE 
J100039K04ATTGGGCTTTTNONE 
Os09g0381600AK107716AAAGCCCAATConserved hypothetical protein. 
J065046L11AAAGCCCAATNONE 
J075140N02AAAGCCCAATNONE 
J075156D10AAAGCCCAATNONE 
Os09g0419500016-067-D11CCAGCCCAATTNONE 
AK064394CCAGCCCAATTZinc finger, RING-type domain containing protein. 
AK073786CCAGCCCAATTNONE 
J033067G01CCAGCCCAATTNONE 
Os09g0424850J065006K24CAAGCCCAATConserved hypothetical protein. 
Os09g0459200AK110733AATTGGGCTGAConserved hypothetical protein. 
J065131C07AATTGGGCTGANONE 
Os09g0470900AK065853AGCCCAATTConserved hypothetical protein. 
AK072191AGCCCAATTNONE 
J075129F12AGCCCAATTNONE 
J100024L18AGCCCAATTNONE 
Os09g0516800009-017-A01AAAGCCCAATAConserved hypothetical protein. 
Os09g0528100009-173-A08CCAAGCCCAATNONE 
009-190-G12CCAAGCCCAATNONE 
AK059096CCAAGCCCAATSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
Os09g0530700AK058211ACAGCCCAATTConserved hypothetical protein. 
AK100759ACAGCCCAATTNONE 
J065039L02ACAGCCCAATTNONE 
J065043O03ACAGCCCAATTNONE 
J065070M16ACAGCCCAATTNONE 
Os09g0553200003-101-F12GCAGCCCAATNONE 
003-125-E09GCAGCCCAATNONE 
011-031-H12GCAGCCCAATNONE 
012-033-A01GCAGCCCAATNONE 
015-046-H04GCAGCCCAATNONE 
015-056-F04GCAGCCCAATNONE 
016-029-H06GCAGCCCAATNONE 
016-080-D05GCAGCCCAATNONE 
AB062606GCAGCCCAATNONE 
AK065780GCAGCCCAATSimilar to UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) (UDP-glucose pyrophosphorylase) (UDPGP) (UGPase). 
AK103930GCAGCCCAATNONE 
AK104344GCAGCCCAATNONE 
AK119197GCAGCCCAATNONE 
AK119232GCAGCCCAATNONE 
J013039M01GCAGCCCAATNONE 
J013043M01GCAGCCCAATNONE 
J013064F03GCAGCCCAATNONE 
J013066K19GCAGCCCAATNONE 
J013092G12GCAGCCCAATNONE 
J013123P09GCAGCCCAATNONE 
J013155F01GCAGCCCAATNONE 
J013158J12GCAGCCCAATNONE 
J013159H14GCAGCCCAATNONE 
J013169C10GCAGCCCAATNONE 
J013170L23GCAGCCCAATNONE 
J023010J18GCAGCCCAATNONE 
J023019E23GCAGCCCAATNONE 
J023045B14GCAGCCCAATNONE 
J023082K24GCAGCCCAATNONE 
J023086G04GCAGCCCAATNONE 
J023090N09GCAGCCCAATNONE 
J023113C08GCAGCCCAATNONE 
J023125H18GCAGCCCAATNONE 
J033034M08GCAGCCCAATNONE 
J033035K03GCAGCCCAATNONE 
J033039D15GCAGCCCAATNONE 
J033045P18GCAGCCCAATNONE 
J033058P08GCAGCCCAATNONE 
J033061D16GCAGCCCAATNONE 
J033070F14GCAGCCCAATNONE 
J033086F23GCAGCCCAATNONE 
J033095C05GCAGCCCAATNONE 
J033114H22GCAGCCCAATNONE 
J033133M20GCAGCCCAATNONE 
J043026G01GCAGCCCAATNONE 
J043037F17GCAGCCCAATNONE 
J065120K17GCAGCCCAATNONE 
J065123O07GCAGCCCAATNONE 
J080305H06GCAGCCCAATNONE 
J090001F11GCAGCCCAATNONE 
J090020C17GCAGCCCAATNONE 
J090043A19GCAGCCCAATNONE 
J090051J17GCAGCCCAATNONE 
J090068K06GCAGCCCAATNONE 
J090075P19GCAGCCCAATNONE 
J100036G10GCAGCCCAATNONE 
J100084F02GCAGCCCAATNONE 
Os11g0127700AK103742AAAAGCCCAATAHypothetical protein. 
J090083M11AAAAGCCCAATANONE 
Os11g0146700AK065900GAAGCCCAATANONE 
AK072412GAAGCCCAATARED-like, C-terminal family protein. 
Os11g0153700AK058576AAAGCCCAATAGGGCCCATATSimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
Os11g0162200009-059-H04AGCCCAATTCAGCCCATCTNONE 
AK060396AGCCCAATTCAGCCCATCTSimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11AGCCCAATTCAGCCCATCTNONE 
J065105K09AGCCCAATTCAGCCCATCTNONE 
J075024G12AGCCCAATTCAGCCCATCTNONE 
J075040K04AGCCCAATTCAGCCCATCTNONE 
J075066D13AGCCCAATTCAGCCCATCTNONE 
J075108A11AGCCCAATTCAGCCCATCTNONE 
J100031D04AGCCCAATTCAGCCCATCTNONE 
J100060O05AGCCCAATTCAGCCCATCTNONE 
J100075M22AGCCCAATTCAGCCCATCTNONE 
Os11g0417400AK070536AAAGCCCAATProtein phosphatase 2C-like domain containing protein. 
Os11g0425800AK066603GAAGCCCAATTSimilar to 60S ribosomal protein L13a. 
J065063A20GAAGCCCAATTNONE 
J075021H08GAAGCCCAATTNONE 
J075058J10GAAGCCCAATTNONE 
J075088B15GAAGCCCAATTNONE 
J075099E15GAAGCCCAATTNONE 
J075110F13GAAGCCCAATTNONE 
J075150G18GAAGCCCAATTNONE 
J080312E14GAAGCCCAATTNONE 
Os11g0545000011-025-F09CCCGGCCCAACTCAGCCCAATANONE 
AK058871CCCGGCCCAACTCAGCCCAATAConserved hypothetical protein. 
AK063297CCCGGCCCAACTCAGCCCAATANONE 
AK100607CCCGGCCCAACTCAGCCCAATANONE 
Os11g0554200016-030-B02AGCCCAATNONE 
AK106479AGCCCAATConserved hypothetical protein. 
Os11g0617800009-105-D10ATTGGGCTTANONE 
AK062778ATTGGGCTTAConserved hypothetical protein. 
Os11g0664700012-064-D03ATTGGGCTGGNONE 
AK100084ATTGGGCTGGConserved hypothetical protein. 
J023002K05ATTGGGCTGGNONE 
J023037C21ATTGGGCTGGNONE 
J033029N10ATTGGGCTGGNONE 
J090047F07ATTGGGCTGGNONE 
Os11g0708000006-046-G03CCAAGCCCAATNONE 
AK072065CCAAGCCCAATNONE 
AK120102CCAAGCCCAATConserved hypothetical protein. 
J013022N13CCAAGCCCAATNONE 
J013062I09CCAAGCCCAATNONE 
J013066H01CCAAGCCCAATNONE 
J013067A19CCAAGCCCAATNONE 
J033107A16CCAAGCCCAATNONE 
J065068A18CCAAGCCCAATNONE 
J065118D08CCAAGCCCAATNONE 
J075056H13CCAAGCCCAATNONE 
J075156I15CCAAGCCCAATNONE 
J100045J12CCAAGCCCAATNONE 
Os12g0127500AK064595GCAGCCCAATConserved hypothetical protein. 
J065067F11GCAGCCCAATNONE 
J090007D02GCAGCCCAATNONE 
J100035G10GCAGCCCAATNONE 
J100077J10GCAGCCCAATNONE 
Os12g0136200AK068700TATTGGGCTGANONE 
AK069493TATTGGGCTGAWD40-like domain containing protein. 
Os12g0178800014-070-H03AGCCCAATANONE 
AK063709AGCCCAATAConserved hypothetical protein. 
Os12g0182200AK099737ATTGGGCTTASimilar to Dihydrolipoamide S-acetyltransferase. 
Os12g0477050J065069B06ATTGGGCTGTNONE 
J065105I23ATTGGGCTGTNONE 
J065203F03ATTGGGCTGTNONE 
J075019C20ATTGGGCTGTConserved hypothetical protein. 
J075164G13ATTGGGCTGTNONE 
J075187H10ATTGGGCTGTNONE 
Os12g0517100012-071-A03AGCCCATCCAGCCCAATTNONE 
AK073020AGCCCATCCAGCCCAATTCyclin-like F-box domain containing protein. 
J023149K21AGCCCATCCAGCCCAATTNONE 
Os12g0554400AK104059TATTGGGCTTTNONE 
Os12g0554800AK105676CCAAGCCCAATTSimilar to Polygalacturonase-like protein. 
Os12g0590900J100033M15ACAGCCCAATConserved hypothetical protein. 
J100042H14ACAGCCCAATNONE 
J100059P17ACAGCCCAATNONE 
J100062H13ACAGCCCAATNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.