version

Summary of OsREG461 (All List)

OrganismOryza sativa  
IDOsREG461  
SequenceAGCCCACA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1325  

Entry Sequences (1325 entries)

LocusGene modelSequenceDescription
Os01g0139600AK073130TTGTGGGCTTGGSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0158900AK066765TCAGCCCACACZinc finger, RING-type domain containing protein. 
Os01g0172200AK100326TGTGGGCTGGGCCGGAWW/Rsp5/WWP domain containing protein. 
Os01g0184000015-008-B06TGTGGGCTNONE 
AK071130TGTGGGCTNUC156 family protein. 
AK100604TGTGGGCTNONE 
J075155H07TGTGGGCTNONE 
J100047O19TGTGGGCTNONE 
J100074A09TGTGGGCTNONE 
Os01g0184500AK060699AGCCCACAADEAD/DEAH box helicase, N-terminal domain containing protein. 
Os01g0196600AK101742AGCCCACAANONE 
U25430AGCCCACAASimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
Os01g0206600J065041P19TAATGGGCCTGAAGCCCACATGGCCCATAConserved hypothetical protein. 
Os01g0261500AK072194GTTGGTGGTGTGGGCTTTTNONE 
AK101899GTTGGTGGTGTGGGCTTTTConserved hypothetical protein. 
J065041N17GTTGGTGGTGTGGGCTTTTNONE 
Os01g0283000AK073165GAAGCCCACAConserved hypothetical protein. 
J033023G08GAAGCCCACANONE 
Os01g0283100004-018-B01TGTGGGCTTCNONE 
AK060908TGTGGGCTTCNONE 
AK071713TGTGGGCTTCSimilar to Ferripyochelin-binding protein-like. 
AK104205TGTGGGCTTCNONE 
AK122051TGTGGGCTTCNONE 
J023109L19TGTGGGCTTCNONE 
Os01g0290000AK066523AGCCCACASimilar to Cyprosin precursor (EC 3.4.23.-) (Fragment). 
AK072264AGCCCACANONE 
AK100420AGCCCACANONE 
J013031M03AGCCCACANONE 
J013040G24AGCCCACANONE 
J013040I24AGCCCACANONE 
J013043O11AGCCCACANONE 
J013043O12AGCCCACANONE 
J013071P15AGCCCACANONE 
J013073D01AGCCCACANONE 
J013100I22AGCCCACANONE 
J013100J16AGCCCACANONE 
J013108M16AGCCCACANONE 
J013109N10AGCCCACANONE 
J013120P12AGCCCACANONE 
J013132L07AGCCCACANONE 
J013155M01AGCCCACANONE 
J013159B01AGCCCACANONE 
J023019A06AGCCCACANONE 
J023024O17AGCCCACANONE 
J023045G23AGCCCACANONE 
J023061J23AGCCCACANONE 
J023075E13AGCCCACANONE 
J023108C14AGCCCACANONE 
J023139E04AGCCCACANONE 
J023149M23AGCCCACANONE 
J033107F07AGCCCACANONE 
J033118A08AGCCCACANONE 
J033128B19AGCCCACANONE 
J043029C04AGCCCACANONE 
J043038K12AGCCCACANONE 
J090025F19AGCCCACANONE 
J090051K09AGCCCACANONE 
J090060P22AGCCCACANONE 
J100017B17AGCCCACANONE 
J100019K04AGCCCACANONE 
J100030G02AGCCCACANONE 
Os01g0530400016-019-E07TGTGGGCTNONE 
AK103724TGTGGGCTNONE 
AK106476TGTGGGCTGlutaredoxin-related protein family protein. 
J023108F14TGTGGGCTNONE 
J033138C10TGTGGGCTNONE 
Os01g0531500004-017-G06CGTGTGGGCTGCNONE 
006-022-B04CGTGTGGGCTGCNONE 
006-084-A07CGTGTGGGCTGCNONE 
012-031-G11CGTGTGGGCTGCNONE 
AK059992CGTGTGGGCTGCNONE 
AK104379CGTGTGGGCTGCNONE 
AK106208CGTGTGGGCTGCDienelactone hydrolase domain containing protein. 
J013058J10CGTGTGGGCTGCNONE 
J013153A15CGTGTGGGCTGCNONE 
J033044K14CGTGTGGGCTGCNONE 
Os01g0590300014-089-E04ACAGCCCACANONE 
AK063740ACAGCCCACAConserved hypothetical protein. 
Os01g0620100AK070122TAAGCCCACAWD40-like domain containing protein. 
J023044A10TAAGCCCACANONE 
J033023C13TAAGCCCACANONE 
J033045E16TAAGCCCACANONE 
J033111H03TAAGCCCACANONE 
Os01g0698300AK058744TGTGGGCTTCNONE 
J090068O06TGTGGGCTTCNONE 
Os01g0710000AK111794AAATGGGCCCAGCCCACASimilar to WD-repeat protein RBAP1. 
J023006D22AAATGGGCCCAGCCCACANONE 
J065106P04AAATGGGCCCAGCCCACANONE 
J100036G13AAATGGGCCCAGCCCACANONE 
Os01g0739000AK069568CCAAGCCCACAASimilar to Mitochondrial processing peptidase. 
AK073810CCAAGCCCACAANONE 
J013042N17CCAAGCCCACAANONE 
J023128N16CCAAGCCCACAANONE 
J033024F18CCAAGCCCACAANONE 
J033037D09CCAAGCCCACAANONE 
J033050E17CCAAGCCCACAANONE 
J033065K22CCAAGCCCACAANONE 
J033070E13CCAAGCCCACAANONE 
J033087A13CCAAGCCCACAANONE 
Os01g0749200006-074-H04TGTGGGCTGCAAAGCCCAGCNONE 
AK072760TGTGGGCTGCAAAGCCCAGCNONE 
AK099041TGTGGGCTGCAAAGCCCAGCNONE 
AK104146TGTGGGCTGCAAAGCCCAGCSimilar to 50S ribosomal protein L13. 
AK119189TGTGGGCTGCAAAGCCCAGCNONE 
Os01g0770400006-112-B08AGCCCACANONE 
AK061253AGCCCACANONE 
AK061585AGCCCACACyclin-like F-box domain containing protein. 
Os01g0772200AK060471CCAGCCCACATranscription initiation factor IIF, beta subunit family protein. 
AK103491CCAGCCCACANONE 
J023093E05CCAGCCCACANONE 
J023101M03CCAGCCCACANONE 
J033130N17CCAGCCCACANONE 
J043021L02CCAGCCCACANONE 
J065001E22CCAGCCCACANONE 
J065070G06CCAGCCCACANONE 
J065081D15CCAGCCCACANONE 
J065123G09CCAGCCCACANONE 
J065170K04CCAGCCCACANONE 
J065187A01CCAGCCCACANONE 
J065210E10CCAGCCCACANONE 
J075172K06CCAGCCCACANONE 
Os01g0823500016-059-D03GCAGCCCACACNONE 
AK064237GCAGCCCACACProtein of unknown function DUF623, plant domain containing protein. 
Os01g0853800006-033-H02ACAGCCCACAANONE 
006-037-A10ACAGCCCACAANONE 
006-038-F10ACAGCCCACAANONE 
006-054-E01ACAGCCCACAANONE 
006-067-E10ACAGCCCACAANONE 
012-015-G05ACAGCCCACAANONE 
AK069147ACAGCCCACAAC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK105929ACAGCCCACAANONE 
AK106144ACAGCCCACAANONE 
AK106186ACAGCCCACAANONE 
J023007P09ACAGCCCACAANONE 
J023007P10ACAGCCCACAANONE 
J065084L10ACAGCCCACAANONE 
J065179B10ACAGCCCACAANONE 
J065186D16ACAGCCCACAANONE 
J075040I08ACAGCCCACAANONE 
J075043K21ACAGCCCACAANONE 
J075051J08ACAGCCCACAANONE 
J075061D24ACAGCCCACAANONE 
J075095H04ACAGCCCACAANONE 
J075145J12ACAGCCCACAANONE 
J075148O18ACAGCCCACAANONE 
J075187J05ACAGCCCACAANONE 
J090042A20ACAGCCCACAANONE 
J100025K01ACAGCCCACAANONE 
Os01g0857250J100049D24TGTGGGCTTTConserved hypothetical protein. 
Os01g0878000006-045-H09TGTGGGCTGCNONE 
006-078-F07TGTGGGCTGCNONE 
016-050-A09TGTGGGCTGCNONE 
AK060162TGTGGGCTGCConserved hypothetical protein. 
AK061119TGTGGGCTGCNONE 
AK104289TGTGGGCTGCNONE 
Os01g0908100AK072293GAAGCCCACARabGAP/TBC domain containing protein. 
J065010B13GAAGCCCACANONE 
J065010M12GAAGCCCACANONE 
J065047C19GAAGCCCACANONE 
J065069B18GAAGCCCACANONE 
J065071K24GAAGCCCACANONE 
J065142P04GAAGCCCACANONE 
J065170E11GAAGCCCACANONE 
Os01g0914000AK101364TTGTGGGCTTTConserved hypothetical protein. 
J080302O10TTGTGGGCTTTNONE 
J080305G04TTGTGGGCTTTNONE 
J080316B11TTGTGGGCTTTNONE 
J090049A14TTGTGGGCTTTNONE 
J090066O10TTGTGGGCTTTNONE 
Os01g0916300011-018-B12TGTGGGCTGTNONE 
AK063922TGTGGGCTGTSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
AK103107TGTGGGCTGTNONE 
AK121061TGTGGGCTGTNONE 
AK121997TGTGGGCTGTNONE 
J033118P14TGTGGGCTGTNONE 
J065002N16TGTGGGCTGTNONE 
J065079B04TGTGGGCTGTNONE 
J065102J07TGTGGGCTGTNONE 
J065128F16TGTGGGCTGTNONE 
J065184D11TGTGGGCTGTNONE 
J065186A07TGTGGGCTGTNONE 
J075115C07TGTGGGCTGTNONE 
J075147C04TGTGGGCTGTNONE 
Os01g0924000004-020-C09GAAGCCCACAANONE 
005-014-A06GAAGCCCACAANONE 
009-085-G12GAAGCCCACAANONE 
009-123-A08GAAGCCCACAANONE 
009-134-A05GAAGCCCACAANONE 
009-137-F06GAAGCCCACAANONE 
016-016-B08GAAGCCCACAANONE 
AF050674GAAGCCCACAANONE 
AK061690GAAGCCCACAASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797GAAGCCCACAANONE 
J013040A15GAAGCCCACAANONE 
J013104L20GAAGCCCACAANONE 
J013127E12GAAGCCCACAANONE 
J013158O05GAAGCCCACAANONE 
J023012E09GAAGCCCACAANONE 
J023126L23GAAGCCCACAANONE 
J023143B03GAAGCCCACAANONE 
J065005B16GAAGCCCACAANONE 
J065101J15GAAGCCCACAANONE 
J065105K16GAAGCCCACAANONE 
J065155K16GAAGCCCACAANONE 
J065171M17GAAGCCCACAANONE 
J065182F07GAAGCCCACAANONE 
J065187D10GAAGCCCACAANONE 
J065194I24GAAGCCCACAANONE 
J065207E24GAAGCCCACAANONE 
J075001C24GAAGCCCACAANONE 
J075090O10GAAGCCCACAANONE 
J075095H17GAAGCCCACAANONE 
J075109M24GAAGCCCACAANONE 
J075123C18GAAGCCCACAANONE 
J075148G22GAAGCCCACAANONE 
J090009B09GAAGCCCACAANONE 
J090075K17GAAGCCCACAANONE 
J090081H23GAAGCCCACAANONE 
J090097H21GAAGCCCACAANONE 
J100063P14GAAGCCCACAANONE 
Os01g0946200AK071060GGCTGGGCTCAGCCCACANo apical meristem (NAM) protein domain containing protein. 
J023080K20GGCTGGGCTCAGCCCACANONE 
Os01g0962600009-104-A04AGCCCACAANONE 
AK073846AGCCCACAASimilar to 40S ribosomal protein S10-1. 
J033070I05AGCCCACAANONE 
J065079N18AGCCCACAANONE 
J065122H12AGCCCACAANONE 
J065197O14AGCCCACAANONE 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0192300Os02g0192300GCAGCCCACACGZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0241100Os02g0241100TTGTGGGCTGGProtein kinase-like domain containing protein. 
Os02g0316800009-104-A11AGCCCACANONE 
AK062767AGCCCACASimilar to MRNA binding protein precursor. 
Os02g0326700AK064977AAAGCCCACARhomboid-like protein family protein. 
Os02g0452800J043024P15TTGTGGGCTGCConserved hypothetical protein. 
Os02g0461200012-026-A12GAAGCCCACACGNONE 
AK063459GAAGCCCACACGConserved hypothetical protein. 
J065183F11GAAGCCCACACGNONE 
J075190G18GAAGCCCACACGNONE 
Os02g0554000016-001-D09AGCCCACANONE 
AK106534AGCCCACANONE 
Os02g0555000015-020-G02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK065270TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK121253TGTGGGCTCTGGGCCGTGGGCCGTCProtein of unknown function, ATP binding family protein. 
J013002L01TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023060A02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023101O11TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023140A15TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033042H19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033046C02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033080N19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065026I02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065040C18TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J090004I16TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
Os02g0558300Os02g0558300AAAGCCCACAMolybdopterin converting factor, subunit 1 family protein. 
Os02g0581800J065071F12AGCCCACACGTGGConserved hypothetical protein. 
Os02g0612600009-058-F12AGCCCACANONE 
AK062519AGCCCACAConserved hypothetical protein. 
Os02g0612650Os02g0612650AGCCCACANONE 
Os02g0644000AB081464TGTGGGCTGGGCTGGNONE 
AK101360TGTGGGCTGGGCTGGNONE 
AY062178TGTGGGCTGGGCTGGNONE 
J023043E22TGTGGGCTGGGCTGGNONE 
J033024F05TGTGGGCTGGGCTGGNONE 
J033035H01TGTGGGCTGGGCTGGNONE 
J033042J19TGTGGGCTGGGCTGGNONE 
J033057G18TGTGGGCTGGGCTGGNONE 
J033111F09TGTGGGCTGGGCTGGNONE 
J033115L11TGTGGGCTGGGCTGGNONE 
J033143I16TGTGGGCTGGGCTGGNONE 
J033143M21TGTGGGCTGGGCTGGNONE 
J075072B10TGTGGGCTGGGCTGGNONE 
J075072L04TGTGGGCTGGGCTGGNONE 
J075088F01TGTGGGCTGGGCTGGNONE 
J075196H23TGTGGGCTGGGCTGGNONE 
Os02g0686700AK111294AGCCCACAGACAGGTGGGACCCGProtein of unknown function DUF581 family protein. 
Os02g0689200011-024-D04TGTGGGCTTGGNONE 
AK065336TGTGGGCTTGGNONE 
AK071254TGTGGGCTTGGNONE 
J013000O22TGTGGGCTTGGNONE 
J023087G23TGTGGGCTTGGNONE 
J033095E21TGTGGGCTTGGNONE 
J033113F12TGTGGGCTTGGNONE 
J033124F02TGTGGGCTTGGNONE 
J065070A01TGTGGGCTTGGNONE 
J065129C05TGTGGGCTTGGNONE 
J065165M19TGTGGGCTTGGNONE 
J090015K07TGTGGGCTTGGNONE 
J090016L11TGTGGGCTTGGNONE 
J090066D21TGTGGGCTTGGNONE 
J090075M20TGTGGGCTTGGNONE 
Os02g0717100014-089-G06AGCCCACAANONE 
AK063741AGCCCACAAEsterase/lipase/thioesterase domain containing protein. 
J065052A22AGCCCACAANONE 
Os02g0725200005-020-F05CCAGCCCACAANONE 
AK058309CCAGCCCACAANONE 
AK103602CCAGCCCACAARubisco methyltransferase family protein. 
J013109C13CCAGCCCACAANONE 
J033133G01CCAGCCCACAANONE 
J075087L23CCAGCCCACAANONE 
J090073J10CCAGCCCACAANONE 
Os02g0741500AK068867ACAGCCCACAARibbon-helix-helix domain containing protein. 
Os02g0744100006-070-H12AAAGCCCACACNONE 
006-115-C05AAAGCCCACACNONE 
AK061274AAAGCCCACACSAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0762300AK106684GAAGCCCACAAProtein of unknown function UPF0021 family protein. 
J090060M09GAAGCCCACAANONE 
J100083E05GAAGCCCACAANONE 
Os02g0812500AK106918ACAGCCCACACyclin-like F-box domain containing protein. 
Os02g0819100AK100156AAAGCCCACAZinc finger, DHHC-type domain containing protein. 
J013088C21AAAGCCCACANONE 
Os03g0106200AK120128GTGTGGGCTGCConserved hypothetical protein. 
Os03g0122000AK101458CGTGTGGGCTProtein kinase-like domain containing protein. 
J013035K10CGTGTGGGCTNONE 
J013050E10CGTGTGGGCTNONE 
J033040C13CGTGTGGGCTNONE 
Os03g0181400012-051-B05TGTGGGCTNONE 
015-065-E09TGTGGGCTNONE 
AK064006TGTGGGCTProtein of unknown function DUF860, plant family protein. 
Os03g0182800003-126-E06GCAGCCCACANONE 
AJ304840GCAGCCCACANONE 
AK073133GCAGCCCACANONE 
AY323478GCAGCCCACASimilar to Ethylene responsive element binding factor3 (OsERF3). 
J033023E13GCAGCCCACANONE 
J033028C22GCAGCCCACANONE 
J033042J03GCAGCCCACANONE 
J065022E13GCAGCCCACANONE 
J065208N24GCAGCCCACANONE 
J100034B17GCAGCCCACANONE 
J100035J21GCAGCCCACANONE 
J100039L16GCAGCCCACANONE 
J100040A02GCAGCCCACANONE 
J100051L11GCAGCCCACANONE 
J100064F07GCAGCCCACANONE 
J100070J12GCAGCCCACANONE 
Os03g0195200AK068949AGCCCACAPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
Os03g0195800AF493792TGTGGGCTGTGGGCTGANONE 
AK103007TGTGGGCTGTGGGCTGASimilar to Sulfate transporter (Fragment). 
Os03g0197000AK071163TCAGCCCACAConserved hypothetical protein. 
J023079A07TCAGCCCACANONE 
Os03g0232800AK060669TGTGGGCTGTNONE 
AK072207TGTGGGCTGTLecithin:cholesterol acyltransferase family protein. 
AK121004TGTGGGCTGTNONE 
Os03g0240500003-116-E06AGCCCACAANONE 
AK058676AGCCCACAASimilar to Toc34-2 protein. 
AK099032AGCCCACAANONE 
J013128A13AGCCCACAANONE 
J075064H17AGCCCACAANONE 
J075075N03AGCCCACAANONE 
J075079H24AGCCCACAANONE 
J075127D23AGCCCACAANONE 
J075132C09AGCCCACAANONE 
J075159D02AGCCCACAANONE 
J090053O11AGCCCACAANONE 
J090062N04AGCCCACAANONE 
Os03g0249200009-103-B08AAAGCCCACATAGGCCCAAATNONE 
AK069944AAAGCCCACATAGGCCCAAATClass I peptide chain release factor domain containing protein. 
J065166E13AAAGCCCACATAGGCCCAAATNONE 
Os03g0256400AK073854TGTGGGCTGAATTGGGCCTTSimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0259600AK108532GAAGCCCACAUbiquitin domain containing protein. 
J065064G04GAAGCCCACANONE 
J065116I06GAAGCCCACANONE 
J065165C14GAAGCCCACANONE 
J075173K24GAAGCCCACANONE 
Os03g0263900AK121215ACAGCCCACACGCalcium-binding EF-hand domain containing protein. 
J075115D02ACAGCCCACACGNONE 
J090095P20ACAGCCCACACGNONE 
Os03g0269300011-021-H03CGTGTGGGCTNONE 
011-029-B01CGTGTGGGCTNONE 
AK111855CGTGTGGGCTNONE 
AK111884CGTGTGGGCTAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0285900AK073348TGTGGGCTSimilar to Splicing factor RSZ33. 
J033025D08TGTGGGCTNONE 
J033087M12TGTGGGCTNONE 
J065008F11TGTGGGCTNONE 
J065059C09TGTGGGCTNONE 
J065070J11TGTGGGCTNONE 
J065076L20TGTGGGCTNONE 
J065083M19TGTGGGCTNONE 
J065111I06TGTGGGCTNONE 
J065112H18TGTGGGCTNONE 
J065112J18TGTGGGCTNONE 
J065140C08TGTGGGCTNONE 
J065180P06TGTGGGCTNONE 
J065187G12TGTGGGCTNONE 
J065189B14TGTGGGCTNONE 
J090042N02TGTGGGCTNONE 
J090087M04TGTGGGCTNONE 
Os03g0297100AK059192AGCCCACACNONE 
AK122143AGCCCACACNONE 
J023012D24AGCCCACACNONE 
J023041A08AGCCCACACNONE 
J033067H08AGCCCACACNONE 
J033131K19AGCCCACACNONE 
J033136J20AGCCCACACNONE 
J053027D07AGCCCACACNONE 
J065191B01AGCCCACACNONE 
J075112A12AGCCCACACNONE 
J075136D05AGCCCACACNONE 
J090073P06AGCCCACACNONE 
J100026B16AGCCCACACNONE 
J100068P21AGCCCACACNONE 
J100088C15AGCCCACACNONE 
Os03g0321000AK103653CAAGCCCACAASimilar to Steroid membrane binding protein-like. 
Os03g0331900AK063044AGCCCACAANONE 
AK099570AGCCCACAAConserved hypothetical protein. 
J065064G01AGCCCACAANONE 
Os03g0334800AK101595TTGTGGGCTTTLung seven transmembrane receptor family protein. 
J023110B03TTGTGGGCTTTNONE 
J065102E22TTGTGGGCTTTNONE 
J065102F24TTGTGGGCTTTNONE 
J065140O22TTGTGGGCTTTNONE 
J075001N09TTGTGGGCTTTNONE 
J075057F24TTGTGGGCTTTNONE 
J075197K01TTGTGGGCTTTNONE 
J090080D05TTGTGGGCTTTNONE 
Os03g0335100AK107094TAAGCCCACAConserved hypothetical protein. 
Os03g0347800AK073756AGCCCACAGGGCCCAACAPeptidyl-tRNA hydrolase family protein. 
Os03g0390700AB110190GAAGCCCACAANONE 
AK103600GAAGCCCACAASimilar to Transthyretin-like protein. 
J065188H06GAAGCCCACAANONE 
Os03g0418700AK099879TCAGCCCACANONE 
AK101797TCAGCCCACAConserved hypothetical protein. 
Os03g0437200006-066-E02CCAGCCCACACNONE 
AK059839CCAGCCCACACZinc finger, C2H2-type domain containing protein. 
AY295345CCAGCCCACACNONE 
Os03g0438900AK111048GAAGCCCACAHypothetical protein. 
Os03g0563300006-086-B06TTGTGGGCTTTNONE 
006-102-B09TTGTGGGCTTTNONE 
AK060389TTGTGGGCTTTNONE 
AK070720TTGTGGGCTTTSimilar to Mg-chelatase subunit (Fragment). 
AK071134TTGTGGGCTTTNONE 
AK104435TTGTGGGCTTTNONE 
J013128N14TTGTGGGCTTTNONE 
J023041F09TTGTGGGCTTTNONE 
J023056M13TTGTGGGCTTTNONE 
J023078K03TTGTGGGCTTTNONE 
J023132N12TTGTGGGCTTTNONE 
J023134B01TTGTGGGCTTTNONE 
J033093B14TTGTGGGCTTTNONE 
Os03g0578300014-071-F09TGTGGGCTGCNONE 
J065098N06TGTGGGCTGCNONE 
J065129D09TGTGGGCTGCNONE 
J075018K16TGTGGGCTGCNONE 
J075106D12TGTGGGCTGCNONE 
J075106D18TGTGGGCTGCNONE 
J075139J02TGTGGGCTGCNONE 
J075170G09TGTGGGCTGCNONE 
J080317I24TGTGGGCTGCNONE 
J080319E11TGTGGGCTGCNONE 
Os03g0639700AK099587GCAGCCCACASimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
Os03g0647800003-103-H03AGCCCACANONE 
006-104-G09AGCCCACANONE 
AK070243AGCCCACAConserved hypothetical protein. 
J100056F22AGCCCACANONE 
Os03g0673600009-011-C08CGTGTGGGCTTTTNONE 
009-033-C05CGTGTGGGCTTTTNONE 
AK062334CGTGTGGGCTTTTNONE 
AK068539CGTGTGGGCTTTTConserved hypothetical protein. 
Os03g0712800AK063913GCAGCCCACACACACACCSimilar to Glutamine synthetase root isozyme 2 (EC 6.3.1.2) (Glutamate--ammonia ligase). 
AK099290GCAGCCCACACACACACCNONE 
J023127P21GCAGCCCACACACACACCNONE 
Os03g0725300011-085-E09AGCCCACAANONE 
AK063969AGCCCACAASimilar to Dbr1-prov protein. 
AK073636AGCCCACAANONE 
J033050L15AGCCCACAANONE 
J053082G03AGCCCACAANONE 
Os03g0759700011-078-B02TGTGGGCTNONE 
AK072833TGTGGGCTSimilar to ER33 protein (Fragment). 
J100036M24TGTGGGCTNONE 
J100047B02TGTGGGCTNONE 
J100062F21TGTGGGCTNONE 
J100066O16TGTGGGCTNONE 
J100082M12TGTGGGCTNONE 
Os03g0766900AK066137AGCCCACAAAllene oxide synthase. 
AK071361AGCCCACAANONE 
AK103989AGCCCACAANONE 
J023090K09AGCCCACAANONE 
J043022H11AGCCCACAANONE 
J053078F12AGCCCACAANONE 
Os03g0772800009-023-E05GAAGCCCACAANONE 
009-059-F12GAAGCCCACAANONE 
009-114-B08GAAGCCCACAANONE 
009-115-G09GAAGCCCACAANONE 
009-151-D08GAAGCCCACAANONE 
009-158-A10GAAGCCCACAANONE 
009-191-H02GAAGCCCACAANONE 
009-192-E05GAAGCCCACAANONE 
009-197-F11GAAGCCCACAANONE 
AK059576GAAGCCCACAANONE 
AK121608GAAGCCCACAACytochrome c oxidase, subunit VIa family protein. 
J023087H20GAAGCCCACAANONE 
J023105P14GAAGCCCACAANONE 
J033026P15GAAGCCCACAANONE 
J033042K10GAAGCCCACAANONE 
J033133C09GAAGCCCACAANONE 
J065123K13GAAGCCCACAANONE 
J075190D03GAAGCCCACAANONE 
J080310M14GAAGCCCACAANONE 
J080317L14GAAGCCCACAANONE 
J100067J19GAAGCCCACAANONE 
J100079H21GAAGCCCACAANONE 
Os03g0801500AK122059ACAGCCCACAConserved hypothetical protein. 
J033115B08ACAGCCCACANONE 
J075092K04ACAGCCCACANONE 
J090005N01ACAGCCCACANONE 
Os03g0808300006-053-B11AAAGCCCACANONE 
006-057-A01AAAGCCCACANONE 
006-090-F05AAAGCCCACANONE 
006-106-G01AAAGCCCACANONE 
006-120-D10AAAGCCCACANONE 
009-139-H09AAAGCCCACANONE 
AK109389AAAGCCCACARemorin, C-terminal region domain containing protein. 
J033065F13AAAGCCCACANONE 
J053045H15AAAGCCCACANONE 
J065021C02AAAGCCCACANONE 
J065021D01AAAGCCCACANONE 
J065039B14AAAGCCCACANONE 
J065064J22AAAGCCCACANONE 
J065167I09AAAGCCCACANONE 
J065170A13AAAGCCCACANONE 
J065183J10AAAGCCCACANONE 
J065202K10AAAGCCCACANONE 
J065218F21AAAGCCCACANONE 
J075028D07AAAGCCCACANONE 
J100048J08AAAGCCCACANONE 
J100050H06AAAGCCCACANONE 
J100054M24AAAGCCCACANONE 
J100068G07AAAGCCCACANONE 
J100079F23AAAGCCCACANONE 
Os03g0819900006-058-B05GGGCCAGACAGCCCACACNONE 
AK111912GGGCCAGACAGCCCACACNONE 
AK112029GGGCCAGACAGCCCACACSimilar to RAB8C. 
AY576526GGGCCAGACAGCCCACACNONE 
AY579410GGGCCAGACAGCCCACACNONE 
J075041G24GGGCCAGACAGCCCACACNONE 
J100070N08GGGCCAGACAGCCCACACNONE 
Os03g0821900AK070847AGTGGGCCTACCGGGCCAAAGCCCACASimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0822100AK101094TGCGGGCCTTGGGCTGTGGGCTGCSimilar to Transposase (Fragment). 
J033024N05TGCGGGCCTTGGGCTGTGGGCTGCNONE 
Os03g0833900AK073655AGCCCACASimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800AGCCCACANONE 
AK104068AGCCCACANONE 
J075031J11AGCCCACANONE 
J075051N01AGCCCACANONE 
J075166D18AGCCCACANONE 
J075171E14AGCCCACANONE 
Os03g0844700J090056L22GAAGCCCACASimilar to Inner membrane protein ALBINO3, chloroplast precursor. Splice isoform 2. 
Os03g0854800J090007D13ACAGCCCACACNONE 
J090085N22ACAGCCCACACNONE 
Os04g0197200AK073556TCAGCCCACAProtein kinase-like domain containing protein. 
Os04g0224900AK058569TGTGGGCTFAD dependent oxidoreductase family protein. 
AK104305TGTGGGCTNONE 
Os04g0269900J065139P11AGCCCACACNONE 
J100034P12AGCCCACACNONE 
J100045D21AGCCCACACNONE 
Os04g0418000006-025-C05TCAGCCCACACNONE 
006-025-D11TCAGCCCACACNONE 
006-045-F02TCAGCCCACACNONE 
006-060-B04TCAGCCCACACNONE 
006-063-E03TCAGCCCACACNONE 
006-070-G08TCAGCCCACACNONE 
006-072-H05TCAGCCCACACNONE 
AK061030TCAGCCCACACNONE 
AK099124TCAGCCCACACNONE 
AK106155TCAGCCCACACConserved hypothetical protein. 
AK119714TCAGCCCACACNONE 
J023039I07TCAGCCCACACNONE 
J065025N03TCAGCCCACACNONE 
Os04g0440100AK101324TTGTGGGCTTANONE 
AK105415TTGTGGGCTTANonsense-mediated decay UPF3 domain containing protein. 
Os04g0444900AK063657AGCCCACASimilar to Alfin-1. 
AK098960AGCCCACANONE 
J065037L14AGCCCACANONE 
J065037P22AGCCCACANONE 
J065173O15AGCCCACANONE 
Os04g0448600006-043-F06AGCCCACAANONE 
AK068709AGCCCACAAChaC-like protein family protein. 
AK104134AGCCCACAANONE 
J065034G07AGCCCACAANONE 
J065071O11AGCCCACAANONE 
J065120F08AGCCCACAANONE 
J065143K01AGCCCACAANONE 
J065154B20AGCCCACAANONE 
J065158N11AGCCCACAANONE 
J065170A03AGCCCACAANONE 
J065180H19AGCCCACAANONE 
J065192D07AGCCCACAANONE 
J075004F21AGCCCACAANONE 
J075083D04AGCCCACAANONE 
J075092K14AGCCCACAANONE 
J075116G09AGCCCACAANONE 
J075156B11AGCCCACAANONE 
J075197L06AGCCCACAANONE 
J090020M13AGCCCACAANONE 
Os04g0461100009-136-H10AGCCCACANONE 
009-147-H12AGCCCACANONE 
AK068022AGCCCACAPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24AGCCCACANONE 
J065019D10AGCCCACANONE 
J065168O21AGCCCACANONE 
J075051G06AGCCCACANONE 
J075148G11AGCCCACANONE 
Os04g0581300009-171-H01ATGGCCCACGCCACAAGCCCACAANONE 
AK063093ATGGCCCACGCCACAAGCCCACAASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0619500011-051-B09AGCCCACAANONE 
016-006-B12AGCCCACAANONE 
016-012-H10AGCCCACAANONE 
AK066247AGCCCACAAOvarian tumour, otubain domain containing protein. 
J013052H21AGCCCACAANONE 
J033136I05AGCCCACAANONE 
J090080J12AGCCCACAANONE 
J100065N24AGCCCACAANONE 
J100087L02AGCCCACAANONE 
Os04g0636900011-028-G03TTGTGGGCTGTTGGGCTNONE 
012-040-G03TTGTGGGCTGTTGGGCTNONE 
AK058405TTGTGGGCTGTTGGGCTNONE 
AK065789TTGTGGGCTGTTGGGCTNONE 
AK101408TTGTGGGCTGTTGGGCTNONE 
AK119286TTGTGGGCTGTTGGGCTNONE 
J013042J24TTGTGGGCTGTTGGGCTNONE 
J033037I12TTGTGGGCTGTTGGGCTNONE 
J043031B12TTGTGGGCTGTTGGGCTNONE 
J065152N10TTGTGGGCTGTTGGGCTNONE 
J090060K17TTGTGGGCTGTTGGGCTNONE 
J090083K14TTGTGGGCTGTTGGGCTNONE 
J100046O13TTGTGGGCTGTTGGGCTNONE 
J100066G22TTGTGGGCTGTTGGGCTNONE 
Os04g0660100AK109923AGCCCACAHelix-loop-helix DNA-binding domain containing protein. 
J065042A13AGCCCACANONE 
J100043N14AGCCCACANONE 
Os04g0685100AK065262AGCCCACARibosomal biogenesis regulatory protein family protein. 
J013002J24AGCCCACANONE 
J013030M11AGCCCACANONE 
J033139J12AGCCCACANONE 
J065013D12AGCCCACANONE 
J065117J01AGCCCACANONE 
J065143K20AGCCCACANONE 
J065181E12AGCCCACANONE 
J065184A17AGCCCACANONE 
J065193B13AGCCCACANONE 
J065196H01AGCCCACANONE 
J075072G17AGCCCACANONE 
J075077B02AGCCCACANONE 
J075088A06AGCCCACANONE 
J075099H13AGCCCACANONE 
J075111O04AGCCCACANONE 
J075131F20AGCCCACANONE 
J075139K01AGCCCACANONE 
J075194I16AGCCCACANONE 
Os05g0105300AK069395CCAGCCCACAGCCCAAAACAP-Gly domain containing protein. 
Os05g0155100006-075-B02AAGGCCCAAACCAGCCCACAANONE 
AK061929AAGGCCCAAACCAGCCCACAANONE 
AK102810AAGGCCCAAACCAGCCCACAANONE 
AK120877AAGGCCCAAACCAGCCCACAASimilar to 60S ribosomal protein L18. 
J013023E03AAGGCCCAAACCAGCCCACAANONE 
J013038C16AAGGCCCAAACCAGCCCACAANONE 
J013120M14AAGGCCCAAACCAGCCCACAANONE 
J013153B04AAGGCCCAAACCAGCCCACAANONE 
J013159B07AAGGCCCAAACCAGCCCACAANONE 
J023012A02AAGGCCCAAACCAGCCCACAANONE 
J023027F08AAGGCCCAAACCAGCCCACAANONE 
J023027I12AAGGCCCAAACCAGCCCACAANONE 
J023120F05AAGGCCCAAACCAGCCCACAANONE 
J023138O03AAGGCCCAAACCAGCCCACAANONE 
J023142H13AAGGCCCAAACCAGCCCACAANONE 
J023143P06AAGGCCCAAACCAGCCCACAANONE 
J033023P09AAGGCCCAAACCAGCCCACAANONE 
J033035O14AAGGCCCAAACCAGCCCACAANONE 
J033042N19AAGGCCCAAACCAGCCCACAANONE 
J033043B12AAGGCCCAAACCAGCCCACAANONE 
J033065D10AAGGCCCAAACCAGCCCACAANONE 
J033081A12AAGGCCCAAACCAGCCCACAANONE 
J033084N05AAGGCCCAAACCAGCCCACAANONE 
J033085M03AAGGCCCAAACCAGCCCACAANONE 
J033112D15AAGGCCCAAACCAGCCCACAANONE 
J033114O07AAGGCCCAAACCAGCCCACAANONE 
J033119D15AAGGCCCAAACCAGCCCACAANONE 
J033140E06AAGGCCCAAACCAGCCCACAANONE 
J033141K23AAGGCCCAAACCAGCCCACAANONE 
J043040I22AAGGCCCAAACCAGCCCACAANONE 
J053050B21AAGGCCCAAACCAGCCCACAANONE 
J053065I18AAGGCCCAAACCAGCCCACAANONE 
J053074O16AAGGCCCAAACCAGCCCACAANONE 
J065072K13AAGGCCCAAACCAGCCCACAANONE 
J065211I09AAGGCCCAAACCAGCCCACAANONE 
J090004K04AAGGCCCAAACCAGCCCACAANONE 
J090016L06AAGGCCCAAACCAGCCCACAANONE 
J090040F22AAGGCCCAAACCAGCCCACAANONE 
J090063F22AAGGCCCAAACCAGCCCACAANONE 
J090081J09AAGGCCCAAACCAGCCCACAANONE 
J100032A10AAGGCCCAAACCAGCCCACAANONE 
J100037G20AAGGCCCAAACCAGCCCACAANONE 
J100056O10AAGGCCCAAACCAGCCCACAANONE 
J100071D10AAGGCCCAAACCAGCCCACAANONE 
J100075K13AAGGCCCAAACCAGCCCACAANONE 
J100079F16AAGGCCCAAACCAGCCCACAANONE 
J100080O16AAGGCCCAAACCAGCCCACAANONE 
J100086N05AAGGCCCAAACCAGCCCACAANONE 
Os05g0203800AK111723GAAGCCCACAASimilar to MADS box protein. 
J023023K24GAAGCCCACAANONE 
J023027E19GAAGCCCACAANONE 
Os05g0219800AK102822GGCCCGCAGCCCACAASimilar to Clone ZZD1128 mRNA sequence. 
Os05g0323100AK109472AAAGCCCACARhodanese-like domain containing protein. 
Os05g0345700AK121350CCAGCCCACACConserved hypothetical protein. 
Os05g0382500AK107084AGCCCACAConserved hypothetical protein. 
Os05g0415600AK065818TGTGGGCTNONE 
J013042K21TGTGGGCTNONE 
J013114E15TGTGGGCTNONE 
J013131H02TGTGGGCTNONE 
J023041G06TGTGGGCTNONE 
J100037M21TGTGGGCTNONE 
Os05g0436400003-014-B09TGTGGGCTGTNONE 
AK060776TGTGGGCTGTPeptidase A22, presenilin signal peptide family protein. 
Os05g0445500009-021-C05TTGTGGGCTNONE 
009-129-D11TTGTGGGCTNONE 
009-147-E04TTGTGGGCTNONE 
009-169-C11TTGTGGGCTNONE 
AK121459TTGTGGGCTSimilar to 60S acidic ribosomal protein P2B. 
D21114TTGTGGGCTNONE 
J023001K23TTGTGGGCTNONE 
J023107J19TTGTGGGCTNONE 
J023143J09TTGTGGGCTNONE 
J065049D04TTGTGGGCTNONE 
J065092I06TTGTGGGCTNONE 
J065188H04TTGTGGGCTNONE 
Os05g0459900AK058918CAAGCCCACAASimilar to 60S ribosomal protein L36-1. 
AK111268CAAGCCCACAANONE 
J013129N08CAAGCCCACAANONE 
J065191E01CAAGCCCACAANONE 
J065216P03CAAGCCCACAANONE 
J075089K21CAAGCCCACAANONE 
Os05g0476100011-031-E09ACAGCCCACACACCNONE 
011-033-E05ACAGCCCACACACCNONE 
011-038-E02ACAGCCCACACACCNONE 
012-053-A09ACAGCCCACACACCNONE 
012-057-E02ACAGCCCACACACCNONE 
AK064010ACAGCCCACACACCProtein of unknown function DUF827, plant family protein. 
AK102615ACAGCCCACACACCNONE 
J033057J03ACAGCCCACACACCNONE 
J033099E14ACAGCCCACACACCNONE 
Os05g0480700AK100850ACAGCCCACASimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11ACAGCCCACANONE 
Os05g0486200009-099-B03CAAGCCCACACNONE 
AK121022CAAGCCCACACConserved hypothetical protein. 
J023049I09CAAGCCCACACNONE 
J033029N07CAAGCCCACACNONE 
J075074I18CAAGCCCACACNONE 
Os05g0531400J065101L04CCAGCCCACACGConserved hypothetical protein. 
J065130M24CCAGCCCACACGNONE 
Os05g0541500AK101190AGCCCACAACyclin-like F-box domain containing protein. 
AK101531AGCCCACAANONE 
J033030F10AGCCCACAANONE 
Os05g0548100AK060333TGTGGGCTGGConserved hypothetical protein. 
AK100682TGTGGGCTGGNONE 
J013151E01TGTGGGCTGGNONE 
J023113L22TGTGGGCTGGNONE 
J043027A19TGTGGGCTGGNONE 
J075093E06TGTGGGCTGGNONE 
J090060D15TGTGGGCTGGNONE 
J090082J03TGTGGGCTGGNONE 
J100050E01TGTGGGCTGGNONE 
Os05g0577900016-028-C02TGTGGGCTNONE 
AK064201TGTGGGCTConserved hypothetical protein. 
Os06g0111700011-090-A02CAAGGCCCACCAAAGCCCACACNONE 
AK063401CAAGGCCCACCAAAGCCCACACTetratricopeptide-like helical domain containing protein. 
Os06g0115400AK111656GAAGCCCAAAGCCCACASimilar to Superoxide dismutase [Fe], chloroplast (EC 1.15.1.1) (Fragment). 
Os06g0129000Os06g0129000CCAGCCCACAConserved hypothetical protein. 
Os06g0134300AK071534TTGTGGGCTACTGGGCCATConserved hypothetical protein. 
J023106E03TTGTGGGCTACTGGGCCATNONE 
J075172D02TTGTGGGCTACTGGGCCATNONE 
J100047B13TTGTGGGCTACTGGGCCATNONE 
Os06g0291100J043017O10CCGAGCCGGCCCAAGTCAGCCCACAAHypothetical protein. 
Os06g0316100011-089-C01TCAGCCCACAANONE 
015-030-D11TCAGCCCACAANONE 
015-044-H10TCAGCCCACAANONE 
AK105260TCAGCCCACAAConserved hypothetical protein. 
AK119646TCAGCCCACAANONE 
Os06g0603400AK060002TAAGCCCACANONE 
AK060002TAAGCCCACANONE 
AK102325TAAGCCCACANONE 
AK102325TAAGCCCACANONE 
AK106905TAAGCCCACASimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
AK106905TAAGCCCACASimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
J090039I22TAAGCCCACANONE 
J090039I22TAAGCCCACANONE 
J100022N15TAAGCCCACANONE 
J100022N15TAAGCCCACANONE 
J100023E09TAAGCCCACANONE 
J100023E09TAAGCCCACANONE 
J100052D21TAAGCCCACANONE 
J100052D21TAAGCCCACANONE 
Os06g0608500AK060097AGCCCACANONE 
AK070667AGCCCACASnf7 family protein. 
Os06g0643000AK067701GTGTGGGCTTGPhox-like domain containing protein. 
J013032G04GTGTGGGCTTGNONE 
J013044B17GTGTGGGCTTGNONE 
J013114M13GTGTGGGCTTGNONE 
J023133A02GTGTGGGCTTGNONE 
J043022A07GTGTGGGCTTGNONE 
J075046O21GTGTGGGCTTGNONE 
J075142L01GTGTGGGCTTGNONE 
J090076I16GTGTGGGCTTGNONE 
J100056O17GTGTGGGCTTGNONE 
Os06g0644100006-034-H12GAAGCCCACAANONE 
009-111-A04GAAGCCCACAANONE 
009-153-H08GAAGCCCACAANONE 
AK059777GAAGCCCACAACarboxypeptidase regulatory region domain containing protein. 
J023011D18GAAGCCCACAANONE 
J043030D15GAAGCCCACAANONE 
J053079B12GAAGCCCACAANONE 
J053079F07GAAGCCCACAANONE 
J065006C11GAAGCCCACAANONE 
J065007D15GAAGCCCACAANONE 
J065012C09GAAGCCCACAANONE 
J065019J01GAAGCCCACAANONE 
J065034K17GAAGCCCACAANONE 
J065040M09GAAGCCCACAANONE 
J065059B09GAAGCCCACAANONE 
J065070A22GAAGCCCACAANONE 
J065099A13GAAGCCCACAANONE 
J065141F08GAAGCCCACAANONE 
J065152G12GAAGCCCACAANONE 
J065181I04GAAGCCCACAANONE 
J065198E17GAAGCCCACAANONE 
J065201N23GAAGCCCACAANONE 
J065202M07GAAGCCCACAANONE 
J065208F11GAAGCCCACAANONE 
J090031B20GAAGCCCACAANONE 
J090099B14GAAGCCCACAANONE 
J100032C05GAAGCCCACAANONE 
J100057O07GAAGCCCACAANONE 
J100077M07GAAGCCCACAANONE 
J100081E21GAAGCCCACAANONE 
Os06g0659600AK110885GGTCCAGAGCCCACACConserved hypothetical protein. 
Os06g0666800AK103209CCAAGCCCACATGGGCCAANONE 
AK107710CCAAGCCCACATGGGCCAAConserved hypothetical protein. 
Os06g0695400AK073198AGCCCACAAHaem peroxidase family protein. 
J033022I15AGCCCACAANONE 
Os07g0115200AK111404ACAGCCCACAConserved hypothetical protein. 
Os07g0122300015-004-G08CTTGGGCCTCTGTGGGCTTGNONE 
AK103212CTTGGGCCTCTGTGGGCTTGNONE 
AK119295CTTGGGCCTCTGTGGGCTTGProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09CTTGGGCCTCTGTGGGCTTGNONE 
J090007P13CTTGGGCCTCTGTGGGCTTGNONE 
Os07g0150200009-152-C07TGTGGGCTNONE 
AK058680TGTGGGCTNONE 
AK121635TGTGGGCTSimilar to 40S ribosomal protein S12-1. 
J033051C16TGTGGGCTNONE 
J033123H15TGTGGGCTNONE 
J065093I01TGTGGGCTNONE 
J065197C05TGTGGGCTNONE 
J075037B11TGTGGGCTNONE 
J075114B08TGTGGGCTNONE 
J075123N01TGTGGGCTNONE 
J075129O04TGTGGGCTNONE 
J075160H17TGTGGGCTNONE 
J075166H17TGTGGGCTNONE 
J080310F11TGTGGGCTNONE 
J080315P11TGTGGGCTNONE 
J090025A22TGTGGGCTNONE 
Os07g0171100AF272978CGTGTGGGCTGTNONE 
AK062132CGTGTGGGCTGTNONE 
AK066475CGTGTGGGCTGTTetratricopeptide-like helical domain containing protein. 
J013068C23CGTGTGGGCTGTNONE 
Os07g0242600AK065752AGCCCATTTAAGCCCACACyclin-like F-box domain containing protein. 
J013037K22AGCCCATTTAAGCCCACANONE 
Os07g0469100009-036-F03TTGTGGGCTCGTGGGCCACNONE 
009-126-D06TTGTGGGCTCGTGGGCCACNONE 
009-190-A01TTGTGGGCTCGTGGGCCACNONE 
AK061626TTGTGGGCTCGTGGGCCACNONE 
AK120365TTGTGGGCTCGTGGGCCACSimilar to Thylakoid membrane phosphoprotein 14 kDa, chloroplast precursor. 
J013068P10TTGTGGGCTCGTGGGCCACNONE 
J053066C23TTGTGGGCTCGTGGGCCACNONE 
J065011K15TTGTGGGCTCGTGGGCCACNONE 
J065053E15TTGTGGGCTCGTGGGCCACNONE 
J065167F21TTGTGGGCTCGTGGGCCACNONE 
J075065G04TTGTGGGCTCGTGGGCCACNONE 
J075146A09TTGTGGGCTCGTGGGCCACNONE 
Os07g0545400009-136-E03GCAGCCCACAGGCCGAGANONE 
013-015-G08GCAGCCCACAGGCCGAGANONE 
AK059228GCAGCCCACAGGCCGAGANONE 
J065040D09GCAGCCCACAGGCCGAGANONE 
J065051C19GCAGCCCACAGGCCGAGANONE 
J065139B05GCAGCCCACAGGCCGAGANONE 
J065160E20GCAGCCCACAGGCCGAGANONE 
J065207I17GCAGCCCACAGGCCGAGANONE 
J080319M24GCAGCCCACAGGCCGAGANONE 
Os07g0577400AK100831TTGTGGGCTTGNONE 
J013095B12TTGTGGGCTTGNONE 
J023123D09TTGTGGGCTTGNONE 
J065002E19TTGTGGGCTTGNONE 
J065135H07TTGTGGGCTTGNONE 
J065150N01TTGTGGGCTTGNONE 
Os07g0582400003-104-B09AGCCCACANONE 
AK059423AGCCCACANONE 
AK102676AGCCCACANONE 
J065001F09AGCCCACANONE 
J065005K22AGCCCACANONE 
J065006D10AGCCCACANONE 
J065006P17AGCCCACANONE 
J065015G23AGCCCACANONE 
J065020F21AGCCCACANONE 
J065028I05AGCCCACANONE 
J065042N09AGCCCACANONE 
J065043P03AGCCCACANONE 
J065059E15AGCCCACANONE 
J065090I12AGCCCACANONE 
J065130I02AGCCCACANONE 
J065131P05AGCCCACANONE 
J065163I24AGCCCACANONE 
J065168I21AGCCCACANONE 
J065174A12AGCCCACANONE 
J065178K16AGCCCACANONE 
J065182P03AGCCCACANONE 
J065186B07AGCCCACANONE 
J065189M13AGCCCACANONE 
J065208J22AGCCCACANONE 
J065211E11AGCCCACANONE 
J075054E08AGCCCACANONE 
J075067K14AGCCCACANONE 
J075104E20AGCCCACANONE 
J075152M07AGCCCACANONE 
Os07g0593200AK121652AGCCCACAZinc finger, SWIM-type domain containing protein. 
J033061B14AGCCCACANONE 
Os07g0604600009-114-E05TCAGCCCACANONE 
AK062832TCAGCCCACAB12D family protein. 
Os07g0618500AK068210GGTGTGTGGGCTTAGGGCCGTGNONE 
AK068975GGTGTGTGGGCTTAGGGCCGTGSimilar to Dihydropterin pyrophosphokinase /dihydropteroate synthase precursor (EC 2.5.1.15). 
J013147H17GGTGTGTGGGCTTAGGGCCGTGNONE 
J013170L10GGTGTGTGGGCTTAGGGCCGTGNONE 
J023061I07GGTGTGTGGGCTTAGGGCCGTGNONE 
J043024N01GGTGTGTGGGCTTAGGGCCGTGNONE 
Os07g0623300AK070292GTGTGGGCTSimilar to Splicing factor SC35. 
J023050C05GTGTGGGCTNONE 
J090025O12GTGTGGGCTNONE 
Os07g0627700AK070893AAAAGCCCACAASterol desaturase family protein. 
AK110696AAAAGCCCACAANONE 
J065068I04AAAAGCCCACAANONE 
J065121P07AAAAGCCCACAANONE 
Os07g0640900AK099354AGCCCACACGNONE 
Os07g0673500005-016-H01TCTGGGCCCACGAAAGCCCACACGNONE 
AK072839TCTGGGCCCACGAAAGCCCACACGNONE 
AK106176TCTGGGCCCACGAAAGCCCACACGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J013030G14TCTGGGCCCACGAAAGCCCACACGNONE 
J013153M24TCTGGGCCCACGAAAGCCCACACGNONE 
J023129E21TCTGGGCCCACGAAAGCCCACACGNONE 
J023141I23TCTGGGCCCACGAAAGCCCACACGNONE 
J033069A22TCTGGGCCCACGAAAGCCCACACGNONE 
J075021G17TCTGGGCCCACGAAAGCCCACACGNONE 
J075022B06TCTGGGCCCACGAAAGCCCACACGNONE 
J075049O15TCTGGGCCCACGAAAGCCCACACGNONE 
J075060O14TCTGGGCCCACGAAAGCCCACACGNONE 
J075073G03TCTGGGCCCACGAAAGCCCACACGNONE 
J075095D13TCTGGGCCCACGAAAGCCCACACGNONE 
J075120M18TCTGGGCCCACGAAAGCCCACACGNONE 
J075130D09TCTGGGCCCACGAAAGCCCACACGNONE 
J075152C20TCTGGGCCCACGAAAGCCCACACGNONE 
J075158L19TCTGGGCCCACGAAAGCCCACACGNONE 
J075199P18TCTGGGCCCACGAAAGCCCACACGNONE 
J090011K21TCTGGGCCCACGAAAGCCCACACGNONE 
J090078O10TCTGGGCCCACGAAAGCCCACACGNONE 
Os07g0690300012-048-A07ACAGCCCACANONE 
AK099674ACAGCCCACAChromatin SPT2 family protein. 
J013028F12ACAGCCCACANONE 
J013069F21ACAGCCCACANONE 
J013104E17ACAGCCCACANONE 
J013153M16ACAGCCCACANONE 
J023012L09ACAGCCCACANONE 
J023069A08ACAGCCCACANONE 
J023132L23ACAGCCCACANONE 
J033120P19ACAGCCCACANONE 
J065173J03ACAGCCCACANONE 
J075008H06ACAGCCCACANONE 
J075043J15ACAGCCCACANONE 
J075147I12ACAGCCCACANONE 
J090041G07ACAGCCCACANONE 
Os08g0139100006-027-E12AGCCCACACNONE 
006-089-E06AGCCCACACNONE 
006-113-G02AGCCCACACNONE 
AK061429AGCCCACACNONE 
AK099590AGCCCACACSimilar to DAG protein, chloroplast precursor. 
AK104727AGCCCACACNONE 
J013043H11AGCCCACACNONE 
J013049N13AGCCCACACNONE 
J065079F01AGCCCACACNONE 
J065122N24AGCCCACACNONE 
J065142J24AGCCCACACNONE 
J065193N03AGCCCACACNONE 
J075041I21AGCCCACACNONE 
J075145E04AGCCCACACNONE 
Os08g0158900AK067062TTGTGGGCTGGGTP1/OBG domain containing protein. 
J013089F04TTGTGGGCTGGNONE 
J013092D16TTGTGGGCTGGNONE 
J033120K14TTGTGGGCTGGNONE 
J033133F24TTGTGGGCTGGNONE 
J033145A10TTGTGGGCTGGNONE 
J033145A11TTGTGGGCTGGNONE 
J053048H24TTGTGGGCTGGNONE 
J053075H10TTGTGGGCTGGNONE 
Os08g0159000AK073617CCAGCCCACAANONE 
AK103973CCAGCCCACAASimilar to DnaJ homolog subfamily C member 1. 
J023130H14CCAGCCCACAANONE 
J033051J11CCAGCCCACAANONE 
J065101C10CCAGCCCACAANONE 
J065168B04CCAGCCCACAANONE 
J065184E22CCAGCCCACAANONE 
J080021D11CCAGCCCACAANONE 
J080025H10CCAGCCCACAANONE 
J080026N19CCAGCCCACAANONE 
J080034A12CCAGCCCACAANONE 
J080040L02CCAGCCCACAANONE 
J080042H19CCAGCCCACAANONE 
J080047B05CCAGCCCACAANONE 
J080047E09CCAGCCCACAANONE 
J080047I01CCAGCCCACAANONE 
J080052H19CCAGCCCACAANONE 
J080062K13CCAGCCCACAANONE 
J080063A22CCAGCCCACAANONE 
J080068G18CCAGCCCACAANONE 
J080068N19CCAGCCCACAANONE 
J080076G08CCAGCCCACAANONE 
J080077H13CCAGCCCACAANONE 
J080077K06CCAGCCCACAANONE 
J080093D15CCAGCCCACAANONE 
J080094D21CCAGCCCACAANONE 
J080097A20CCAGCCCACAANONE 
J080097E21CCAGCCCACAANONE 
J080097N17CCAGCCCACAANONE 
J100071K18CCAGCCCACAANONE 
J100072F09CCAGCCCACAANONE 
Os08g0237000003-111-F01ACAGCCCACAANONE 
006-022-H07ACAGCCCACAANONE 
006-028-G01ACAGCCCACAANONE 
006-032-D10ACAGCCCACAANONE 
006-039-F08ACAGCCCACAANONE 
006-039-H01ACAGCCCACAANONE 
006-051-E01ACAGCCCACAANONE 
006-053-E11ACAGCCCACAANONE 
006-055-E09ACAGCCCACAANONE 
006-061-H02ACAGCCCACAANONE 
006-062-G07ACAGCCCACAANONE 
006-074-D07ACAGCCCACAANONE 
006-074-F11ACAGCCCACAANONE 
006-076-F03ACAGCCCACAANONE 
006-080-G01ACAGCCCACAANONE 
006-081-A03ACAGCCCACAANONE 
006-084-F05ACAGCCCACAANONE 
006-085-B08ACAGCCCACAANONE 
006-089-C03ACAGCCCACAANONE 
006-090-B12ACAGCCCACAANONE 
006-092-D04ACAGCCCACAANONE 
006-095-E05ACAGCCCACAANONE 
006-100-C12ACAGCCCACAANONE 
006-109-C03ACAGCCCACAANONE 
006-114-E09ACAGCCCACAANONE 
009-033-G02ACAGCCCACAANONE 
009-189-F09ACAGCCCACAANONE 
009-200-A08ACAGCCCACAANONE 
009-200-D07ACAGCCCACAANONE 
AB110604ACAGCCCACAAXyloglucan endotransglycosylase/hydrolase protein 8 precursor (EC 2.4.1.207) (End-xyloglucan transferase) (OsXTH8) (OsXRT5). 
AK060654ACAGCCCACAANONE 
AK104451ACAGCCCACAANONE 
Os08g0401100AK121508TGTGGGCTAnkyrin repeat containing protein. 
J023009D05TGTGGGCTNONE 
J033023C05TGTGGGCTNONE 
Os08g0530200009-166-A09AGCCCACAATAATGGGCCAGNONE 
AK062052AGCCCACAATAATGGGCCAGNONE 
AK120448AGCCCACAATAATGGGCCAGSimilar to 60S ribosomal protein L17. 
J013100M19AGCCCACAATAATGGGCCAGNONE 
J023045K22AGCCCACAATAATGGGCCAGNONE 
J033046D13AGCCCACAATAATGGGCCAGNONE 
J033066N01AGCCCACAATAATGGGCCAGNONE 
J033143N05AGCCCACAATAATGGGCCAGNONE 
J053070P13AGCCCACAATAATGGGCCAGNONE 
J065011C18AGCCCACAATAATGGGCCAGNONE 
J065013C23AGCCCACAATAATGGGCCAGNONE 
J065016B09AGCCCACAATAATGGGCCAGNONE 
J065016C21AGCCCACAATAATGGGCCAGNONE 
J065023K18AGCCCACAATAATGGGCCAGNONE 
J065028F12AGCCCACAATAATGGGCCAGNONE 
J065030L02AGCCCACAATAATGGGCCAGNONE 
J065042H15AGCCCACAATAATGGGCCAGNONE 
J065078H02AGCCCACAATAATGGGCCAGNONE 
J065092D07AGCCCACAATAATGGGCCAGNONE 
J065092E01AGCCCACAATAATGGGCCAGNONE 
J065104M21AGCCCACAATAATGGGCCAGNONE 
J065119P21AGCCCACAATAATGGGCCAGNONE 
J065124B15AGCCCACAATAATGGGCCAGNONE 
J065146H09AGCCCACAATAATGGGCCAGNONE 
J065149L09AGCCCACAATAATGGGCCAGNONE 
J065156A09AGCCCACAATAATGGGCCAGNONE 
J065157H23AGCCCACAATAATGGGCCAGNONE 
J065165L14AGCCCACAATAATGGGCCAGNONE 
J065165M18AGCCCACAATAATGGGCCAGNONE 
J065172O03AGCCCACAATAATGGGCCAGNONE 
J065192M18AGCCCACAATAATGGGCCAGNONE 
J065198D21AGCCCACAATAATGGGCCAGNONE 
J065200D05AGCCCACAATAATGGGCCAGNONE 
J065202B20AGCCCACAATAATGGGCCAGNONE 
J065212P11AGCCCACAATAATGGGCCAGNONE 
J065215E08AGCCCACAATAATGGGCCAGNONE 
J065217P19AGCCCACAATAATGGGCCAGNONE 
J075005I19AGCCCACAATAATGGGCCAGNONE 
J075134J06AGCCCACAATAATGGGCCAGNONE 
J075162G12AGCCCACAATAATGGGCCAGNONE 
J075178H07AGCCCACAATAATGGGCCAGNONE 
J075186K01AGCCCACAATAATGGGCCAGNONE 
J080315I17AGCCCACAATAATGGGCCAGNONE 
J080318P19AGCCCACAATAATGGGCCAGNONE 
J090004H16AGCCCACAATAATGGGCCAGNONE 
J090020A16AGCCCACAATAATGGGCCAGNONE 
J090047J12AGCCCACAATAATGGGCCAGNONE 
J090080E07AGCCCACAATAATGGGCCAGNONE 
J090090H23AGCCCACAATAATGGGCCAGNONE 
J100021G24AGCCCACAATAATGGGCCAGNONE 
J100037L04AGCCCACAATAATGGGCCAGNONE 
J100043L09AGCCCACAATAATGGGCCAGNONE 
J100044A10AGCCCACAATAATGGGCCAGNONE 
Os08g0544500AK071354GCAGCCCACAASimilar to ARP2/3 regulatory protein subunit NAPP. 
Os08g0556200009-008-D12TGTGGGCTGANONE 
AK121222TGTGGGCTGASimilar to Dihydroneopterin aldolase. 
J023090H22TGTGGGCTGANONE 
J075027J23TGTGGGCTGANONE 
J075032L14TGTGGGCTGANONE 
J075053H04TGTGGGCTGANONE 
J075171P20TGTGGGCTGANONE 
J100057F12TGTGGGCTGANONE 
Os08g0557400006-024-C02CCAGCCCACANONE 
AK060067CCAGCCCACAProtein tyrosine phosphatase-like protein. 
AY224424CCAGCCCACANONE 
Os08g0558400AK071334GGTTGGGCCGCAGCCCACAASimilar to Kinesin heavy chain (Fragment). 
Os08g0565200AK108143AGCCCACAPathogenesis-related transcriptional factor and ERF domain containing protein. 
AK108143TGTGGGCTPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os09g0323500009-131-F04TGTGGGCTNONE 
AK071737TGTGGGCTProtein of unknown function DUF833 family protein. 
J023109A10TGTGGGCTNONE 
J090087M18TGTGGGCTNONE 
Os09g0449400J023086D02GCAGCCCACAAZinc finger, C2H2-type domain containing protein. 
Os09g0457500012-027-D12AGCCCACAAlpha-amylase isozyme 3B precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
012-063-A01AGCCCACANONE 
016-040-A03AGCCCACANONE 
J065076N06AGCCCACANONE 
J065096O14AGCCCACANONE 
J065120P10AGCCCACANONE 
J065137H09AGCCCACANONE 
J065189E15AGCCCACANONE 
Os09g0457800011-043-E09AGCCCACAANONE 
015-049-D08AGCCCACAANONE 
AK101358AGCCCACAAAlpha-amylase isozyme 3C precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
J043020J09AGCCCACAANONE 
J043034A10AGCCCACAANONE 
J065025A07AGCCCACAANONE 
J065081G01AGCCCACAANONE 
J065111I18AGCCCACAANONE 
J065127L15AGCCCACAANONE 
J065130H08AGCCCACAANONE 
J065146E12AGCCCACAANONE 
J065192N20AGCCCACAANONE 
J065212D06AGCCCACAANONE 
Os09g0471900AK073815CGCGTCTCCAGCCCACACGBacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0502200AK102600AAAGCCCACASimilar to Beta-1,3-glucanase (Fragment). 
AK121879AAAGCCCACANONE 
J100061G20AAAGCCCACANONE 
Os09g0517800012-034-H10AAAGCCCACANONE 
012-034-H10TTGTGGGCTGCNONE 
AK121391AAAGCCCACACyclin-like F-box domain containing protein. 
AK121391TTGTGGGCTGCCyclin-like F-box domain containing protein. 
J023129D04AAAGCCCACANONE 
J023129D04TTGTGGGCTGCNONE 
J043012D11AAAGCCCACANONE 
J043012D11TTGTGGGCTGCNONE 
Os11g0107700AK073061ACAGCCCACAProtein kinase-like domain containing protein. 
AK109643ACAGCCCACANONE 
Os11g0127600015-021-H02TTGTGGGCTTCNONE 
016-038-B06TTGTGGGCTTCNONE 
016-079-H06TTGTGGGCTTCNONE 
016-085-G02TTGTGGGCTTCNONE 
016-086-C02TTGTGGGCTTCNONE 
AK067922TTGTGGGCTTCNo apical meristem (NAM) protein domain containing protein. 
J013121J10TTGTGGGCTTCNONE 
Os11g0132700AK103286TTGTGGGCTTCCGGCCCAAATCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0207000AK062074TTGTGGGCTTGNONE 
Os11g0414000012-012-F01TCAGCCCACACGNONE 
AK071277TCAGCCCACACGeIF4-gamma/eIF5/eIF2-epsilon domain containing protein. 
J023082M08TCAGCCCACACGNONE 
J023083E17TCAGCCCACACGNONE 
J023128I07TCAGCCCACACGNONE 
J033098J04TCAGCCCACACGNONE 
J033135G10TCAGCCCACACGNONE 
J043007L23TCAGCCCACACGNONE 
J065011N07TCAGCCCACACGNONE 
J065016E01TCAGCCCACACGNONE 
J065162N12TCAGCCCACACGNONE 
J065164O22TCAGCCCACACGNONE 
J065173J06TCAGCCCACACGNONE 
J065200E24TCAGCCCACACGNONE 
J065203K20TCAGCCCACACGNONE 
J075033N16TCAGCCCACACGNONE 
J075047L06TCAGCCCACACGNONE 
J075064J24TCAGCCCACACGNONE 
J075100O07TCAGCCCACACGNONE 
J075121G11TCAGCCCACACGNONE 
J075134A13TCAGCCCACACGNONE 
J075190F20TCAGCCCACACGNONE 
J075190H08TCAGCCCACACGNONE 
J080033L04TCAGCCCACACGNONE 
J080045O09TCAGCCCACACGNONE 
J080064J07TCAGCCCACACGNONE 
J080066N22TCAGCCCACACGNONE 
J080075C09TCAGCCCACACGNONE 
J090002C08TCAGCCCACACGNONE 
J090058G21TCAGCCCACACGNONE 
J090074M07TCAGCCCACACGNONE 
J100090G06TCAGCCCACACGNONE 
Os11g0425300AK065810CCACGGCCCAGCCCACACConserved hypothetical protein. 
AK067248CCACGGCCCAGCCCACACNONE 
J013038F05CCACGGCCCAGCCCACACNONE 
J013039B05CCACGGCCCAGCCCACACNONE 
J013060P13CCACGGCCCAGCCCACACNONE 
J013099D01CCACGGCCCAGCCCACACNONE 
J023023L06CCACGGCCCAGCCCACACNONE 
J023061G18CCACGGCCCAGCCCACACNONE 
J023099E11CCACGGCCCAGCCCACACNONE 
J065002A08CCACGGCCCAGCCCACACNONE 
J065046L21CCACGGCCCAGCCCACACNONE 
J065122K11CCACGGCCCAGCCCACACNONE 
J090071I21CCACGGCCCAGCCCACACNONE 
J090077P13CCACGGCCCAGCCCACACNONE 
Os11g0518900AK063772TGTGGGCTConserved hypothetical protein. 
AK102677TGTGGGCTNONE 
AK121776TGTGGGCTNONE 
Os11g0557000009-007-D09AGCCCACANONE 
AK062316AGCCCACAPhytosulfokine family protein. 
J065072P06AGCCCACANONE 
J065132A14AGCCCACANONE 
J065200C24AGCCCACANONE 
Os11g0575600AK073570TAAGCCCACAASimilar to Lipoxygenase (Fragment). 
Os11g0595200009-005-A06AGCCCACAATGTGGGCCCCACGNONE 
AK071115AGCCCACAATGTGGGCCCCACGNONE 
AK106159AGCCCACAATGTGGGCCCCACGPAP fibrillin family protein. 
AY387683AGCCCACAATGTGGGCCCCACGNONE 
AY387684AGCCCACAATGTGGGCCCCACGNONE 
J065166K17AGCCCACAATGTGGGCCCCACGNONE 
Os11g0682600J090026G08TGTGGGGCCCATGTGGGCTConserved hypothetical protein. 
J090037N19TGTGGGGCCCATGTGGGCTNONE 
J090061M21TGTGGGGCCCATGTGGGCTNONE 
Os12g0112250J013069O10GAAGCCCACASaposin B domain containing protein. 
J065206G04GAAGCCCACANONE 
J080302C06GAAGCCCACANONE 
J080306K06GAAGCCCACANONE 
J080307O09GAAGCCCACANONE 
J080310J07GAAGCCCACANONE 
J080311G18GAAGCCCACANONE 
J080318C07GAAGCCCACANONE 
Os12g0131300J090086B06TTGTGGGCTTCCGGCCCAAATHypothetical protein. 
Os12g0133600AK103096GTGTGGGCTConserved hypothetical protein. 
J033118M03GTGTGGGCTNONE 
Os12g0150100009-047-B11GAAGCCCACANONE 
009-047-B11GAAGCCCACAANONE 
AK105075GAAGCCCACASimilar to 60S ribosomal protein L26A. 
AK105075GAAGCCCACAASimilar to 60S ribosomal protein L26A. 
J013067G22GAAGCCCACANONE 
J013067G22GAAGCCCACAANONE 
J033103F08GAAGCCCACANONE 
J033103F08GAAGCCCACAANONE 
J065029P11GAAGCCCACANONE 
J065029P11GAAGCCCACAANONE 
J065043B18GAAGCCCACANONE 
J065043B18GAAGCCCACAANONE 
J065123E16GAAGCCCACANONE 
J065123E16GAAGCCCACAANONE 
J065141O20GAAGCCCACANONE 
J065141O20GAAGCCCACAANONE 
J065161O04GAAGCCCACANONE 
J065161O04GAAGCCCACAANONE 
J065201M07GAAGCCCACANONE 
J065201M07GAAGCCCACAANONE 
J075058I23GAAGCCCACANONE 
J075058I23GAAGCCCACAANONE 
J075172J08GAAGCCCACANONE 
J075172J08GAAGCCCACAANONE 
J100040L13GAAGCCCACANONE 
J100040L13GAAGCCCACAANONE 
Os12g0156400012-065-D02ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK072086ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK099278ACAGCCCACACGTGGCCGTGGGCCCCDcp1-like decapping family protein. 
J013063H09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023125D09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023149G21ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033064E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033093C07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033107E06ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J075172A11ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090009E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090023F13ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090071N18ACAGCCCACACGTGGCCGTGGGCCCCNONE 
Os12g0278900AK106816GAAGCCCACAAPeptidase C1A, papain family protein. 
Os12g0577900015-034-E07CCAGCCCACANONE 
AK106299CCAGCCCACAProtein prenyltransferase domain containing protein. 
Os12g0633200009-073-D03TTGTGGGCTGANONE 
AK062615TTGTGGGCTGAErg28-like family protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.