version

Summary of OsREG462 (All List)

OrganismOryza sativa  
IDOsREG462  
SequenceAGCCCACC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1421  

Entry Sequences (1421 entries)

LocusGene modelSequenceDescription
Os01g0102500011-064-A09CCAGCCCACCAACNONE 
015-011-E06CCAGCCCACCAACNONE 
016-083-H11CCAGCCCACCAACNONE 
AK100002CCAGCCCACCAACConserved hypothetical protein. 
J065063K05CCAGCCCACCAACNONE 
J065191H24CCAGCCCACCAACNONE 
J100079N16CCAGCCCACCAACNONE 
Os01g0147200016-005-F02TCAGCCCACCANONE 
AK106463TCAGCCCACCANONE 
AK121921TCAGCCCACCAIWS1, C-terminal family protein. 
J033098O16TCAGCCCACCANONE 
J033106E16TCAGCCCACCANONE 
J043026D12TCAGCCCACCANONE 
J065070B04TCAGCCCACCANONE 
J065162L03TCAGCCCACCANONE 
J065166F01TCAGCCCACCANONE 
J075030A13TCAGCCCACCANONE 
J075093O12TCAGCCCACCANONE 
J075106K15TCAGCCCACCANONE 
J075107F20TCAGCCCACCANONE 
J090031F21TCAGCCCACCANONE 
J090079E17TCAGCCCACCANONE 
Os01g0186900AK106168TAAGCCCACCTNONE 
J075116O22TAAGCCCACCTNONE 
J100060H12TAAGCCCACCTNONE 
Os01g0220300009-063-C12AGGTGGGCTTTNONE 
AK105167AGGTGGGCTTTConserved hypothetical protein. 
J065124E17AGGTGGGCTTTNONE 
J090096L11AGGTGGGCTTTNONE 
Os01g0224500AK109225GCAGCCCACCACGCGACGCGCGACConserved hypothetical protein. 
Os01g0239100Os01g0239100AGCCCACCCHeat shock protein DnaJ family protein. 
Os01g0244400J075054J20AGCCCACCCGCCCAAACProtein of unknown function DUF1618 domain containing protein. 
J075101O11AGCCCACCCGCCCAAACNONE 
J075123K08AGCCCACCCGCCCAAACNONE 
Os01g0324400AK102854ACAGCCCAGCCCACCAGGCCCACANONE 
AK111299ACAGCCCAGCCCACCAGGCCCACANONE 
J033032A11ACAGCCCAGCCCACCAGGCCCACANONE 
J033110L02ACAGCCCAGCCCACCAGGCCCACANONE 
Os01g0346400J100032G11TCAGCCCACCCConserved hypothetical protein. 
Os01g0348700009-125-H02GCAGCCCACCANONE 
009-156-F08GCAGCCCACCANONE 
009-177-A11GCAGCCCACCANONE 
009-195-D02GCAGCCCACCANONE 
013-040-B06GCAGCCCACCANONE 
013-051-B09GCAGCCCACCANONE 
AK120842GCAGCCCACCASimilar to 60S ribosomal protein L23a (L25). 
J013071O22GCAGCCCACCANONE 
J023022J07GCAGCCCACCANONE 
J033028J08GCAGCCCACCANONE 
J033109M11GCAGCCCACCANONE 
J043022K15GCAGCCCACCANONE 
J043031N11GCAGCCCACCANONE 
J053023I10GCAGCCCACCANONE 
J053045F16GCAGCCCACCANONE 
J053054F22GCAGCCCACCANONE 
J053094P15GCAGCCCACCANONE 
J065048F01GCAGCCCACCANONE 
J075012F16GCAGCCCACCANONE 
J075089C09GCAGCCCACCANONE 
J075179J20GCAGCCCACCANONE 
J080305E19GCAGCCCACCANONE 
J080309B21GCAGCCCACCANONE 
J090017L05GCAGCCCACCANONE 
J090058B11GCAGCCCACCANONE 
Os01g0384800009-073-F04AGCCCACCACNONE 
009-149-E07AGCCCACCACNONE 
AK119688AGCCCACCACConserved hypothetical protein. 
AK120910AGCCCACCACNONE 
J013033N16AGCCCACCACNONE 
J023034B07AGCCCACCACNONE 
J023034J16AGCCCACCACNONE 
J065105O09AGCCCACCACNONE 
J065194F07AGCCCACCACNONE 
J075070L22AGCCCACCACNONE 
J075128L01AGCCCACCACNONE 
J075164C09AGCCCACCACNONE 
J100028M15AGCCCACCACNONE 
J100042M14AGCCCACCACNONE 
J100063D20AGCCCACCACNONE 
J100066A19AGCCCACCACNONE 
J100079K09AGCCCACCACNONE 
J100079K17AGCCCACCACNONE 
Os01g0501800006-021-B07AGCCCACCACNONE 
006-021-E12AGCCCACCACNONE 
006-022-B08AGCCCACCACNONE 
006-022-C09AGCCCACCACNONE 
006-022-C12AGCCCACCACNONE 
006-022-F10AGCCCACCACNONE 
006-023-A09AGCCCACCACNONE 
006-023-D02AGCCCACCACNONE 
006-023-E06AGCCCACCACNONE 
006-023-E11AGCCCACCACNONE 
006-025-A01AGCCCACCACNONE 
006-025-B07AGCCCACCACNONE 
006-025-F04AGCCCACCACNONE 
006-025-F11AGCCCACCACNONE 
006-027-F05AGCCCACCACNONE 
006-028-C02AGCCCACCACNONE 
006-029-B01AGCCCACCACNONE 
006-029-D09AGCCCACCACNONE 
006-029-G02AGCCCACCACNONE 
006-029-H08AGCCCACCACNONE 
006-030-A02AGCCCACCACNONE 
006-030-B05AGCCCACCACNONE 
006-031-A01AGCCCACCACNONE 
006-032-E09AGCCCACCACNONE 
006-032-G10AGCCCACCACNONE 
006-032-H11AGCCCACCACNONE 
006-033-B08AGCCCACCACNONE 
006-033-E11AGCCCACCACNONE 
006-034-H01AGCCCACCACNONE 
006-035-B09AGCCCACCACNONE 
006-035-D08AGCCCACCACNONE 
006-036-F01AGCCCACCACNONE 
006-036-G01AGCCCACCACNONE 
006-037-E12AGCCCACCACNONE 
006-039-D07AGCCCACCACNONE 
006-040-A03AGCCCACCACNONE 
006-042-G11AGCCCACCACNONE 
006-044-F11AGCCCACCACNONE 
006-045-H04AGCCCACCACNONE 
006-046-A09AGCCCACCACNONE 
006-046-C12AGCCCACCACNONE 
006-046-F10AGCCCACCACNONE 
006-046-H08AGCCCACCACNONE 
006-047-G05AGCCCACCACNONE 
006-047-G06AGCCCACCACNONE 
006-048-C05AGCCCACCACNONE 
006-049-A07AGCCCACCACNONE 
006-049-E03AGCCCACCACNONE 
006-050-D08AGCCCACCACNONE 
006-050-E02AGCCCACCACNONE 
006-050-E07AGCCCACCACNONE 
006-050-F11AGCCCACCACNONE 
006-051-D04AGCCCACCACNONE 
006-051-G07AGCCCACCACNONE 
006-052-B06AGCCCACCACNONE 
006-052-B11AGCCCACCACNONE 
006-052-C06AGCCCACCACNONE 
006-053-G03AGCCCACCACNONE 
006-054-C01AGCCCACCACNONE 
006-054-D09AGCCCACCACNONE 
006-056-B11AGCCCACCACNONE 
006-056-C07AGCCCACCACNONE 
006-056-C12AGCCCACCACNONE 
006-057-C05AGCCCACCACNONE 
006-057-E08AGCCCACCACNONE 
006-058-F03AGCCCACCACNONE 
006-059-A03AGCCCACCACNONE 
006-059-C12AGCCCACCACNONE 
006-062-A06AGCCCACCACNONE 
006-062-H04AGCCCACCACNONE 
006-063-B08AGCCCACCACNONE 
006-063-B10AGCCCACCACNONE 
006-063-D11AGCCCACCACNONE 
006-063-H07AGCCCACCACNONE 
006-065-F08AGCCCACCACNONE 
006-067-F07AGCCCACCACNONE 
006-067-G04AGCCCACCACNONE 
006-067-G12AGCCCACCACNONE 
006-068-A12AGCCCACCACNONE 
006-068-E08AGCCCACCACNONE 
006-068-H01AGCCCACCACNONE 
006-069-C01AGCCCACCACNONE 
006-069-E08AGCCCACCACNONE 
006-070-D05AGCCCACCACNONE 
006-070-E10AGCCCACCACNONE 
006-071-A02AGCCCACCACNONE 
006-072-C01AGCCCACCACNONE 
006-073-B07AGCCCACCACNONE 
006-073-D02AGCCCACCACNONE 
006-073-F06AGCCCACCACNONE 
006-075-B10AGCCCACCACNONE 
006-075-C01AGCCCACCACNONE 
006-076-E10AGCCCACCACNONE 
006-076-H12AGCCCACCACNONE 
006-077-B10AGCCCACCACNONE 
006-077-F12AGCCCACCACNONE 
006-078-C04AGCCCACCACNONE 
006-078-C10AGCCCACCACNONE 
006-078-H11AGCCCACCACNONE 
006-079-A05AGCCCACCACNONE 
006-079-C01AGCCCACCACNONE 
006-079-E04AGCCCACCACNONE 
006-079-H06AGCCCACCACNONE 
006-080-G05AGCCCACCACNONE 
006-081-C07AGCCCACCACNONE 
006-081-H07AGCCCACCACNONE 
006-082-A09AGCCCACCACNONE 
006-082-D02AGCCCACCACNONE 
006-084-B11AGCCCACCACNONE 
006-085-G10AGCCCACCACNONE 
006-086-A05AGCCCACCACNONE 
006-086-B05AGCCCACCACNONE 
006-086-F09AGCCCACCACNONE 
006-088-B09AGCCCACCACNONE 
006-088-D02AGCCCACCACNONE 
006-088-D10AGCCCACCACNONE 
006-088-F05AGCCCACCACNONE 
006-089-C06AGCCCACCACNONE 
006-092-C07AGCCCACCACNONE 
006-092-C08AGCCCACCACNONE 
006-092-G09AGCCCACCACNONE 
006-093-D12AGCCCACCACNONE 
006-093-H10AGCCCACCACNONE 
006-094-E07AGCCCACCACNONE 
006-095-G01AGCCCACCACNONE 
006-096-A10AGCCCACCACNONE 
006-097-B06AGCCCACCACNONE 
006-097-H12AGCCCACCACNONE 
006-098-A08AGCCCACCACNONE 
006-098-A10AGCCCACCACNONE 
006-098-C10AGCCCACCACNONE 
006-098-D02AGCCCACCACNONE 
006-098-F10AGCCCACCACNONE 
006-099-B08AGCCCACCACNONE 
006-099-D02AGCCCACCACNONE 
006-099-D05AGCCCACCACNONE 
006-099-G10AGCCCACCACNONE 
006-100-G06AGCCCACCACNONE 
006-102-G09AGCCCACCACNONE 
006-104-F06AGCCCACCACNONE 
006-105-A12AGCCCACCACNONE 
006-105-D04AGCCCACCACNONE 
006-105-F05AGCCCACCACNONE 
006-106-B01AGCCCACCACNONE 
006-106-D05AGCCCACCACNONE 
006-107-B01AGCCCACCACNONE 
006-107-C02AGCCCACCACNONE 
006-107-E01AGCCCACCACNONE 
006-107-G03AGCCCACCACNONE 
006-108-D09AGCCCACCACNONE 
006-109-G01AGCCCACCACNONE 
006-109-H07AGCCCACCACNONE 
006-110-C04AGCCCACCACNONE 
006-111-B11AGCCCACCACNONE 
006-112-A02AGCCCACCACNONE 
006-112-E03AGCCCACCACNONE 
006-112-H04AGCCCACCACNONE 
006-113-B07AGCCCACCACNONE 
006-113-C08AGCCCACCACNONE 
006-114-C12AGCCCACCACNONE 
006-114-D06AGCCCACCACNONE 
006-115-B06AGCCCACCACNONE 
006-116-B01AGCCCACCACNONE 
006-116-C02AGCCCACCACNONE 
006-117-B05AGCCCACCACNONE 
006-117-C06AGCCCACCACNONE 
006-117-D10AGCCCACCACNONE 
006-118-D04AGCCCACCACNONE 
006-118-E12AGCCCACCACNONE 
006-119-A06AGCCCACCACNONE 
006-119-A09AGCCCACCACNONE 
006-119-D02AGCCCACCACNONE 
006-119-G07AGCCCACCACNONE 
006-120-B03AGCCCACCACNONE 
006-120-B07AGCCCACCACNONE 
006-120-C01AGCCCACCACNONE 
006-120-E04AGCCCACCACNONE 
006-120-F11AGCCCACCACNONE 
009-014-E11AGCCCACCACNONE 
009-079-C06AGCCCACCACNONE 
009-101-H06AGCCCACCACNONE 
009-113-F07AGCCCACCACNONE 
009-126-G04AGCCCACCACNONE 
009-138-F01AGCCCACCACNONE 
009-147-H02AGCCCACCACNONE 
009-198-B08AGCCCACCACNONE 
011-011-H03AGCCCACCACNONE 
013-053-A06AGCCCACCACNONE 
AK060886AGCCCACCACNONE 
AK067715AGCCCACCACSimilar to Photosystem II oxygen-evolving complex protein 1 (Fragment). 
AK103920AGCCCACCACNONE 
AK103937AGCCCACCACNONE 
AK104080AGCCCACCACNONE 
AK104649AGCCCACCACNONE 
AK104760AGCCCACCACNONE 
AK119163AGCCCACCACNONE 
AK119188AGCCCACCACNONE 
AK119515AGCCCACCACNONE 
J013071M07AGCCCACCACNONE 
J013098E19AGCCCACCACNONE 
J013119C03AGCCCACCACNONE 
J013135O08AGCCCACCACNONE 
J023060H14AGCCCACCACNONE 
J023075M20AGCCCACCACNONE 
J023098P12AGCCCACCACNONE 
J053061C24AGCCCACCACNONE 
J053065C19AGCCCACCACNONE 
J053094K19AGCCCACCACNONE 
J075047M15AGCCCACCACNONE 
J075083H07AGCCCACCACNONE 
J075108K14AGCCCACCACNONE 
J075112B16AGCCCACCACNONE 
J075169L16AGCCCACCACNONE 
J075180P05AGCCCACCACNONE 
J075194D02AGCCCACCACNONE 
J080013D18AGCCCACCACNONE 
J080016G20AGCCCACCACNONE 
J080017E18AGCCCACCACNONE 
J080018J18AGCCCACCACNONE 
J080018N18AGCCCACCACNONE 
J080036G23AGCCCACCACNONE 
J080038O04AGCCCACCACNONE 
J080038P09AGCCCACCACNONE 
J080039N23AGCCCACCACNONE 
J080043F01AGCCCACCACNONE 
J080064J05AGCCCACCACNONE 
J080067C16AGCCCACCACNONE 
J080069B15AGCCCACCACNONE 
J080071H03AGCCCACCACNONE 
J080086L16AGCCCACCACNONE 
J080088H01AGCCCACCACNONE 
J080089B09AGCCCACCACNONE 
J080090K14AGCCCACCACNONE 
J080090N19AGCCCACCACNONE 
J080093H07AGCCCACCACNONE 
J080097B17AGCCCACCACNONE 
J080301J11AGCCCACCACNONE 
J080301K18AGCCCACCACNONE 
J080305K22AGCCCACCACNONE 
J090008D23AGCCCACCACNONE 
J090013H02AGCCCACCACNONE 
J090031N19AGCCCACCACNONE 
J090053G01AGCCCACCACNONE 
Os01g0618200AK102319CCTGGGCCAGCCCACCAProtein phosphatase 2C family protein. 
Os01g0680400AK067914GCAGCCCACCAAGCCCTAFII28-like protein family protein. 
J065039K13GCAGCCCACCAAGCCCNONE 
J065042K22GCAGCCCACCAAGCCCNONE 
J080016E23GCAGCCCACCAAGCCCNONE 
J080064E22GCAGCCCACCAAGCCCNONE 
Os01g0707300AK059962AGCCCACCACNONE 
AK104463AGCCCACCACSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0714800AK108555GAAGCCCACCWRKY transcription factor 26. 
AY870609GAAGCCCACCNONE 
Os01g0749000AK107255AGCCCACCProtein of unknown function DUF1264 family protein. 
AK107265AGCCCACCNONE 
AK107290AGCCCACCNONE 
J075001C07AGCCCACCNONE 
Os01g0782300AK109175AGCCCACCTGGCCCAACAConserved hypothetical protein. 
Os01g0821700AK060539CCAGCCCACCSimilar to Chitin-binding lectin 1 precursor (PL-I). 
J090069K02CCAGCCCACCNONE 
Os01g0823100AK070463TGGTGGGCTAlpha-expansin OsEXPA2. 
J065162I18TGGTGGGCTNONE 
J090038D18TGGTGGGCTNONE 
U30477TGGTGGGCTNONE 
Os01g0847300AK071164AAAGCCCACCAProtein of unknown function DUF588 family protein. 
AK104027AAAGCCCACCANONE 
Os01g0885000009-071-H04GGTGGGCTNONE 
009-163-E07GGTGGGCTNONE 
AK121662GGTGGGCTSimilar to Cytochrome c. 
J033064H20GGTGGGCTNONE 
J065013G07GGTGGGCTNONE 
J065112D15GGTGGGCTNONE 
J065115D07GGTGGGCTNONE 
J100060M10GGTGGGCTNONE 
Os01g0904500AK119437GTGGTGGGCTGGConserved hypothetical protein. 
J065022O22GTGGTGGGCTGGNONE 
J065102M14GTGGTGGGCTGGNONE 
J065192C12GTGGTGGGCTGGNONE 
Os01g0913400AK099881TGGTGGGCTTCProtein prenyltransferase domain containing protein. 
Os01g0913800011-060-B02AGGTGGGCTGANONE 
016-088-H02AGGTGGGCTGAProtein prenyltransferase domain containing protein. 
Os01g0921600AK071344GGTGGGCTGGGCCGGGSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22GGTGGGCTGGGCCGGGNONE 
J013109E03GGTGGGCTGGGCCGGGNONE 
J023081J12GGTGGGCTGGGCCGGGNONE 
J023091E24GGTGGGCTGGGCCGGGNONE 
J033022A01GGTGGGCTGGGCCGGGNONE 
J033074C13GGTGGGCTGGGCCGGGNONE 
J065199E03GGTGGGCTGGGCCGGGNONE 
J075172O04GGTGGGCTGGGCCGGGNONE 
J090007G18GGTGGGCTGGGCCGGGNONE 
J090052B17GGTGGGCTGGGCCGGGNONE 
J090074H01GGTGGGCTGGGCCGGGNONE 
J100043J09GGTGGGCTGGGCCGGGNONE 
J100059J05GGTGGGCTGGGCCGGGNONE 
Os01g0952600AK067525GTTGGTGGGCTTANONE 
AK070047GTTGGTGGGCTTASimilar to LacZ (Fragment). 
Os01g0965500J075073G20AGCCCACCACNuclear protein SET domain containing protein. 
Os02g0170100006-118-G03AGCCCACCANONE 
AK058912AGCCCACCAGlycine cleavage H-protein family protein. 
AK100893AGCCCACCANONE 
J023055I08AGCCCACCANONE 
J023130P09AGCCCACCANONE 
J023139G13AGCCCACCANONE 
J043016H16AGCCCACCANONE 
J053027E10AGCCCACCANONE 
J053031J16AGCCCACCANONE 
J053061A22AGCCCACCANONE 
J053088J02AGCCCACCANONE 
J053093E17AGCCCACCANONE 
J065028L08AGCCCACCANONE 
J065038K06AGCCCACCANONE 
J065060G19AGCCCACCANONE 
J075037P13AGCCCACCANONE 
J075083I01AGCCCACCANONE 
J080034E20AGCCCACCANONE 
J080044E22AGCCCACCANONE 
J080077F17AGCCCACCANONE 
J080078P05AGCCCACCANONE 
J090007E12AGCCCACCANONE 
J100019B20AGCCCACCANONE 
J100025H05AGCCCACCANONE 
J100045B13AGCCCACCANONE 
J100045C10AGCCCACCANONE 
J100050L07AGCCCACCANONE 
Os02g0188500AK102004CCAGCCCACCANONE 
AK106917CCAGCCCACCAUbiquitin domain containing protein. 
J090039N13CCAGCCCACCANONE 
Os02g0215950J090051K07GACAGGTGGGCTGGGCTConserved hypothetical protein. 
Os02g0227100AK066722TCAGCCCACCConserved hypothetical protein. 
Os02g0252100AF139211AGCCCACCCNONE 
AK062577AGCCCACCCSimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051AGCCCACCCNONE 
J013156E01AGCCCACCCNONE 
J065001D02AGCCCACCCNONE 
J065042A05AGCCCACCCNONE 
J065116H01AGCCCACCCNONE 
J065167P13AGCCCACCCNONE 
J065168N07AGCCCACCCNONE 
J075093G21AGCCCACCCNONE 
J075109H15AGCCCACCCNONE 
J075194P17AGCCCACCCNONE 
Os02g0255200AK121591AAAGCCCACCASimilar to Ribosomal protein S15a homolog. 
J033023N03AAAGCCCACCANONE 
J033031C22AAAGCCCACCANONE 
J033037P22AAAGCCCACCANONE 
J090013J10AAAGCCCACCANONE 
J090030I04AAAGCCCACCANONE 
Os02g0316800009-104-A11AAAGCCCACCANONE 
AK062767AAAGCCCACCASimilar to MRNA binding protein precursor. 
Os02g0485000016-062-B12GGGTGGGCTNONE 
AK064246GGGTGGGCTTransferase family protein. 
Os02g0530600AK102681GGGTGGGCTACGTGTCGBRCT domain containing protein. 
Os02g0555000015-020-G02AAAGCCCACCACNONE 
AK065270AAAGCCCACCACNONE 
AK121253AAAGCCCACCACProtein of unknown function, ATP binding family protein. 
J013002L01AAAGCCCACCACNONE 
J023060A02AAAGCCCACCACNONE 
J023101O11AAAGCCCACCACNONE 
J023140A15AAAGCCCACCACNONE 
J033042H19AAAGCCCACCACNONE 
J033046C02AAAGCCCACCACNONE 
J033080N19AAAGCCCACCACNONE 
J065026I02AAAGCCCACCACNONE 
J065040C18AAAGCCCACCACNONE 
J090004I16AAAGCCCACCACNONE 
Os02g0562300AK073250GCGGTGCGGTGGGCTCalmodulin binding protein-like family protein. 
Os02g0574900AK073087AGCCCACCACCyclin-like F-box domain containing protein. 
J033023M04AGCCCACCACNONE 
J033117N08AGCCCACCACNONE 
J075008F16AGCCCACCACNONE 
J075075I19AGCCCACCACNONE 
J075079A06AGCCCACCACNONE 
J075086I07AGCCCACCACNONE 
J075088F13AGCCCACCACNONE 
J075093D04AGCCCACCACNONE 
J075163C10AGCCCACCACNONE 
Os02g0593400016-051-C08TGGTGGGCTNONE 
AK064226TGGTGGGCTNONE 
AK072362TGGTGGGCTConserved hypothetical protein. 
AK109015TGGTGGGCTNONE 
J023063B12TGGTGGGCTNONE 
J065192M02TGGTGGGCTNONE 
J075182N05TGGTGGGCTNONE 
Os02g0595800Os02g0595800AAAGCCCACCCSimilar to Eukaryotic initiation factor 4B (Fragment). 
Os02g0651500AK066333CGGGTGGGCTGGGNONE 
AK121865CGGGTGGGCTGGGHypothetical protein. 
J090038J11CGGGTGGGCTGGGNONE 
Os02g0652100AK072906AGCCCACCACSimilar to WRKY transcription factor 34. 
J075187F06AGCCCACCACNONE 
Os02g0653400Os02g0653400CCCAGCCCACCTTransferase family protein. 
Os02g0653900006-024-H11GGTGGGGCGGTGGGCTNONE 
006-069-F05GGTGGGGCGGTGGGCTNONE 
012-005-H01GGTGGGGCGGTGGGCTNONE 
AK064950GGTGGGGCGGTGGGCTSimilar to Avr9/Cf-9 rapidly elicited protein 14 (Fragment). 
AK098925GGTGGGGCGGTGGGCTNONE 
AK104793GGTGGGGCGGTGGGCTNONE 
AK106154GGTGGGGCGGTGGGCTNONE 
J013000P22GGTGGGGCGGTGGGCTNONE 
J013002P22GGTGGGGCGGTGGGCTNONE 
J013072L24GGTGGGGCGGTGGGCTNONE 
J013110J23GGTGGGGCGGTGGGCTNONE 
J013126I23GGTGGGGCGGTGGGCTNONE 
J013160D23GGTGGGGCGGTGGGCTNONE 
J023056H01GGTGGGGCGGTGGGCTNONE 
J033058I09GGTGGGGCGGTGGGCTNONE 
J065183H09GGTGGGGCGGTGGGCTNONE 
J065214P06GGTGGGGCGGTGGGCTNONE 
J075071L23GGTGGGGCGGTGGGCTNONE 
J090042C11GGTGGGGCGGTGGGCTNONE 
J090057H07GGTGGGGCGGTGGGCTNONE 
J090071O22GGTGGGGCGGTGGGCTNONE 
J100029M07GGTGGGGCGGTGGGCTNONE 
J100040O18GGTGGGGCGGTGGGCTNONE 
J100041P12GGTGGGGCGGTGGGCTNONE 
J100047J02GGTGGGGCGGTGGGCTNONE 
J100063L09GGTGGGGCGGTGGGCTNONE 
J100065B12GGTGGGGCGGTGGGCTNONE 
J100066N05GGTGGGGCGGTGGGCTNONE 
J100080O21GGTGGGGCGGTGGGCTNONE 
J100083F13GGTGGGGCGGTGGGCTNONE 
J100087G04GGTGGGGCGGTGGGCTNONE 
J100090J20GGTGGGGCGGTGGGCTNONE 
J100090N08GGTGGGGCGGTGGGCTNONE 
Os02g0673000AK108650TGGTGGGCTProtein of unknown function UPF0005 family protein. 
Os02g0679500AK067772GGTGGGCTTGSimilar to Rac GTPase activating protein 1. 
AY364311GGTGGGCTTGNONE 
Os02g0697200015-013-B10ACAGCCCACCACNONE 
AK059475ACAGCCCACCACNONE 
AK102993ACAGCCCACCACConserved hypothetical protein. 
J033079I18ACAGCCCACCACNONE 
J033082A14ACAGCCCACCACNONE 
J065047H08ACAGCCCACCACNONE 
J065131M14ACAGCCCACCACNONE 
Os02g0703900AK102115AGCCCACCAACSimilar to Nodulin-like protein. 
AK121966AGCCCACCAACNONE 
J023109K03AGCCCACCAACNONE 
J033051G23AGCCCACCAACNONE 
J033084H22AGCCCACCAACNONE 
J090056B12AGCCCACCAACNONE 
J090059L13AGCCCACCAACNONE 
J090080M03AGCCCACCAACNONE 
Os02g0710300AK109662AGCCCACCTSimilar to INDEHISCENT protein. 
Os02g0768200006-059-D06AAAGCCCACCTNONE 
AK070007AAAGCCCACCTemp24/gp25L/p24 family protein. 
J033050A21AAAGCCCACCTNONE 
Os02g0816600AK071389AGCCCACCTNONE 
Os02g0824700009-023-E06CCCAGCCCAGCCCACCTSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18CCCAGCCCAGCCCACCTNONE 
J065017H21CCCAGCCCAGCCCACCTNONE 
J065052N02CCCAGCCCAGCCCACCTNONE 
J065053M01CCCAGCCCAGCCCACCTNONE 
J065064B14CCCAGCCCAGCCCACCTNONE 
J065146K22CCCAGCCCAGCCCACCTNONE 
Os03g0116800012-097-D10GAAGCCCACCACNONE 
016-024-H10GAAGCCCACCACNONE 
AK066955GAAGCCCACCACConserved hypothetical protein. 
AK068678GAAGCCCACCACNONE 
AK104839GAAGCCCACCACNONE 
J013033G16GAAGCCCACCACNONE 
J013091C10GAAGCCCACCACNONE 
J013158H22GAAGCCCACCACNONE 
J023106K11GAAGCCCACCACNONE 
J065051O15GAAGCCCACCACNONE 
J065129G22GAAGCCCACCACNONE 
J075001K02GAAGCCCACCACNONE 
J075011O03GAAGCCCACCACNONE 
J075024K04GAAGCCCACCACNONE 
J075026E07GAAGCCCACCACNONE 
J075037O14GAAGCCCACCACNONE 
J075071D17GAAGCCCACCACNONE 
J075084M05GAAGCCCACCACNONE 
J075114B06GAAGCCCACCACNONE 
J075128C23GAAGCCCACCACNONE 
J075153A13GAAGCCCACCACNONE 
J075158A15GAAGCCCACCACNONE 
J075165P09GAAGCCCACCACNONE 
J075167M21GAAGCCCACCACNONE 
J075170F11GAAGCCCACCACNONE 
J075186F12GAAGCCCACCACNONE 
J075186L13GAAGCCCACCACNONE 
J075189A01GAAGCCCACCACNONE 
J075192D19GAAGCCCACCACNONE 
Os03g0125000006-032-D09AAAGCCCACCTGNONE 
006-033-B05AAAGCCCACCTGNONE 
006-048-G06AAAGCCCACCTGNONE 
006-048-G09AAAGCCCACCTGNONE 
006-052-D09AAAGCCCACCTGNONE 
006-072-A04AAAGCCCACCTGNONE 
006-076-F12AAAGCCCACCTGNONE 
006-080-B03AAAGCCCACCTGNONE 
006-092-H03AAAGCCCACCTGNONE 
006-103-G04AAAGCCCACCTGNONE 
009-079-E01AAAGCCCACCTGNONE 
009-150-F03AAAGCCCACCTGNONE 
AF095708AAAGCCCACCTGNONE 
AK059557AAAGCCCACCTGNONE 
AK070779AAAGCCCACCTGSimilar to 50S ribosomal protein L5, chloroplast. 
AK098999AAAGCCCACCTGNONE 
AK104137AAAGCCCACCTGNONE 
J065002D07AAAGCCCACCTGNONE 
J065167E24AAAGCCCACCTGNONE 
J075199O14AAAGCCCACCTGNONE 
J100083L01AAAGCCCACCTGNONE 
Os03g0130500AK058465GGGTGGGCTNONE 
Os03g0178400AK108257GAAGCCCACCACCAACEpoxide hydrolase family protein. 
Os03g0181600AK067807TAAGCCCACCAACGGCTSimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TAAGCCCACCAACGGCTNONE 
Os03g0186800AK100356AAAGCCCACCTModifier of rudimentary, Modr family protein. 
Os03g0259600AK108532AGCCCACCAUbiquitin domain containing protein. 
J065064G04AGCCCACCANONE 
J065116I06AGCCCACCANONE 
J065165C14AGCCCACCANONE 
J075173K24AGCCCACCANONE 
Os03g0266900013-080-C12TATGGGCTACAGCCCACCCNONE 
014-010-A09TATGGGCTACAGCCCACCCNONE 
014-013-G10TATGGGCTACAGCCCACCCNONE 
014-019-D06TATGGGCTACAGCCCACCCNONE 
014-030-F08TATGGGCTACAGCCCACCCNONE 
014-039-C05TATGGGCTACAGCCCACCCNONE 
014-053-H08TATGGGCTACAGCCCACCCNONE 
014-089-F06TATGGGCTACAGCCCACCCNONE 
014-094-A05TATGGGCTACAGCCCACCCNONE 
014-098-C12TATGGGCTACAGCCCACCCNONE 
AK119243TATGGGCTACAGCCCACCCLow molecular mass heat shock protein Oshsp17.3. 
AK119717TATGGGCTACAGCCCACCCNONE 
D12635TATGGGCTACAGCCCACCCNONE 
M80186TATGGGCTACAGCCCACCCNONE 
Os03g0279600006-070-A07TAAGCCCACCANONE 
AK061080TAAGCCCACCAConserved hypothetical protein. 
AK071043TAAGCCCACCANONE 
AK103191TAAGCCCACCANONE 
J065077E22TAAGCCCACCANONE 
J065208F22TAAGCCCACCANONE 
J075156K12TAAGCCCACCANONE 
Os03g0297400AK060653CCAGCCCACCANONE 
AK061403CCAGCCCACCANONE 
AK101597CCAGCCCACCAMalonyl CoA-acyl carrier protein transacylase family protein. 
Os03g0310800009-126-C10AGCCCACCAACNONE 
009-156-D02AGCCCACCAACNONE 
AK058663AGCCCACCAACNONE 
AK099476AGCCCACCAACSimilar to Hypersensitive reaction associated Ca2+-binding protein. 
J065084G15AGCCCACCAACNONE 
J075046C12AGCCCACCAACNONE 
J075058D24AGCCCACCAACNONE 
J075151M03AGCCCACCAACNONE 
J075151M04AGCCCACCAACNONE 
J075153I20AGCCCACCAACNONE 
J075167J05AGCCCACCAACNONE 
J075179G06AGCCCACCAACNONE 
J100025I19AGCCCACCAACNONE 
J100025L21AGCCCACCAACNONE 
J100029C06AGCCCACCAACNONE 
J100068E24AGCCCACCAACNONE 
J100070F10AGCCCACCAACNONE 
J100083H23AGCCCACCAACNONE 
J100089H10AGCCCACCAACNONE 
Os03g0333300015-069-B02AGCCCACCANONE 
AK063858AGCCCACCANONE 
AK073228AGCCCACCASimilar to Eukaryotic translation initiation factor 2 beta subunit (eIF-2-beta) (P38). 
Os03g0626800015-067-B09GGGTGGGCTGTTCGTGGGCCTCNONE 
AK111916GGGTGGGCTGTTCGTGGGCCTCNONE 
AK112092GGGTGGGCTGTTCGTGGGCCTCCalcineurin B protein. 
J075016C21GGGTGGGCTGTTCGTGGGCCTCNONE 
Os03g0655700AK120254AAAGCCCAAGCCCACCACSimilar to 3-isopropylmalate dehydrogenase, chloroplast precursor (EC 1.1.1.85) (Beta-IPM dehydrogenase) (IMDH) (3-IPM-DH). 
Os03g0684400AK100086GCAGCCCACCCMg2+ transporter protein, CorA-like family protein. 
Os03g0703300016-074-H01GCAGCCCACCTGNONE 
AK073831GCAGCCCACCTGCalponin-like actin-binding domain containing protein. 
Os03g0719100AK065127GTGGTGGGCTDNA-binding SAP domain containing protein. 
J013001P07GTGGTGGGCTNONE 
J065102J01GTGGTGGGCTNONE 
J065205K05GTGGTGGGCTNONE 
Os03g0770100AK108776AGCCCACCARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0774200AK065851AAAAGCCCAGCCCACCAACNONE 
AK119532AAAAGCCCAGCCCACCAACSimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AAAAGCCCAGCCCACCAACNONE 
J023107I03AAAAGCCCAGCCCACCAACNONE 
J065156I19AAAAGCCCAGCCCACCAACNONE 
J065176L07AAAAGCCCAGCCCACCAACNONE 
J100066F15AAAAGCCCAGCCCACCAACNONE 
Os03g0784400AK103474TGGTGGGCTTTProtein of unknown function DUF1692 domain containing protein. 
J023135I15TGGTGGGCTTTNONE 
J033130D12TGGTGGGCTTTNONE 
J043035E20TGGTGGGCTTTNONE 
J065206K15TGGTGGGCTTTNONE 
J075053J20TGGTGGGCTTTNONE 
J075129B11TGGTGGGCTTTNONE 
J090003E22TGGTGGGCTTTNONE 
J100023E23TGGTGGGCTTTNONE 
Os03g0786000AK061286CCAAGCCCACCTConserved hypothetical protein. 
AK073187CCAAGCCCACCTNONE 
Os03g0787200AK103438CAAGCCCACCIQ calmodulin-binding region domain containing protein. 
J065009F06CAAGCCCACCNONE 
J065046F02CAAGCCCACCNONE 
J065127L12CAAGCCCACCNONE 
Os03g0801900015-081-G06GACAGGTGGGCTCTCCCCCANONE 
AK106415GACAGGTGGGCTCTCCCCCAProtein of unknown function DUF569 family protein. 
J090099L17GACAGGTGGGCTCTCCCCCANONE 
J100024B03GACAGGTGGGCTCTCCCCCANONE 
J100088I08GACAGGTGGGCTCTCCCCCANONE 
Os03g0825300AK072216AAAGCCCACCACNONE 
AK102693AAAGCCCACCACNONE 
AK105593AAAGCCCACCACProtein kinase-like domain containing protein. 
BT014687AAAGCCCACCACNONE 
Os03g0841100AK120279AGCCCACCTEGF domain containing protein. 
Os04g0343900AK107841TAAGCCCACCCConserved hypothetical protein. 
Os04g0418500AK121255GTGGTGGGCTTTU box domain containing protein. 
J065172M13GTGGTGGGCTTTNONE 
J100026H21GTGGTGGGCTTTNONE 
J100032D22GTGGTGGGCTTTNONE 
Os04g0440000AK073064AGGTGGGCTGTNONE 
AK101691AGGTGGGCTGTConserved hypothetical protein. 
AK102407AGGTGGGCTGTNONE 
Os04g0478600AK073788GGTGGGCTTTTConserved hypothetical protein. 
Os04g0513100AK067841GGGCTGGGCTGCGGTGGGCTGTSimilar to Beta-glucosidase. 
J075105F14GGGCTGGGCTGCGGTGGGCTGTNONE 
Os04g0528300AK058387AGCCCACCANONE 
J013000P15AGCCCACCANONE 
Os04g0564700AK111806GTGGTGGGCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os04g0599400AK101885AGCCCACCTScramblase family protein. 
Os04g0678800AK072212TGGTGGGCTN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065TGGTGGGCTNONE 
Os04g0681500AK105582AGCCCACCEF-Hand type domain containing protein. 
Os05g0101600AK101021AGGTGGGCTTTTCytochrome P450 family protein. 
Os05g0102900006-056-A01AGGTGGGCTGGGNONE 
AK061764AGGTGGGCTGGGNONE 
AK065749AGGTGGGCTGGGSnf7 family protein. 
AK104101AGGTGGGCTGGGNONE 
J013042C01AGGTGGGCTGGGNONE 
J033038P15AGGTGGGCTGGGNONE 
J065032F16AGGTGGGCTGGGNONE 
J065039I22AGGTGGGCTGGGNONE 
J065150F19AGGTGGGCTGGGNONE 
J075079I21AGGTGGGCTGGGNONE 
J075082F14AGGTGGGCTGGGNONE 
J075098G16AGGTGGGCTGGGNONE 
J075167I08AGGTGGGCTGGGNONE 
Os05g0110100009-015-D08AGGTGGGCTTGGNONE 
009-023-C09AGGTGGGCTTGGNONE 
009-031-B11AGGTGGGCTTGGNONE 
009-034-C02AGGTGGGCTTGGNONE 
009-050-B08AGGTGGGCTTGGNONE 
009-065-D12AGGTGGGCTTGGNONE 
009-090-G08AGGTGGGCTTGGNONE 
009-111-H07AGGTGGGCTTGGNONE 
009-136-F12AGGTGGGCTTGGNONE 
009-138-E06AGGTGGGCTTGGNONE 
009-138-G12AGGTGGGCTTGGNONE 
009-141-D08AGGTGGGCTTGGNONE 
009-143-D01AGGTGGGCTTGGNONE 
009-179-D09AGGTGGGCTTGGNONE 
009-179-E03AGGTGGGCTTGGNONE 
009-196-A09AGGTGGGCTTGGNONE 
009-199-F04AGGTGGGCTTGGNONE 
013-021-E05AGGTGGGCTTGGNONE 
013-076-C04AGGTGGGCTTGGNONE 
013-096-F06AGGTGGGCTTGGNONE 
014-071-A05AGGTGGGCTTGGNONE 
014-077-F09AGGTGGGCTTGGNONE 
AK099779AGGTGGGCTTGGNONE 
AK121142AGGTGGGCTTGGConserved hypothetical protein. 
J013095A16AGGTGGGCTTGGNONE 
J013111A17AGGTGGGCTTGGNONE 
J013132G04AGGTGGGCTTGGNONE 
J023077M04AGGTGGGCTTGGNONE 
J065001B11AGGTGGGCTTGGNONE 
J065001E11AGGTGGGCTTGGNONE 
J065057G10AGGTGGGCTTGGNONE 
J065057L08AGGTGGGCTTGGNONE 
J065080E07AGGTGGGCTTGGNONE 
J065087K10AGGTGGGCTTGGNONE 
J065091M15AGGTGGGCTTGGNONE 
J065167A15AGGTGGGCTTGGNONE 
J075018F02AGGTGGGCTTGGNONE 
J075063F20AGGTGGGCTTGGNONE 
J075064F18AGGTGGGCTTGGNONE 
J075066N19AGGTGGGCTTGGNONE 
J075073I02AGGTGGGCTTGGNONE 
J075080P17AGGTGGGCTTGGNONE 
J075081F11AGGTGGGCTTGGNONE 
J075085E03AGGTGGGCTTGGNONE 
J075101G18AGGTGGGCTTGGNONE 
J075149N08AGGTGGGCTTGGNONE 
J075158I21AGGTGGGCTTGGNONE 
J075161M20AGGTGGGCTTGGNONE 
J075190F12AGGTGGGCTTGGNONE 
J075194K16AGGTGGGCTTGGNONE 
J080001E08AGGTGGGCTTGGNONE 
J080001F21AGGTGGGCTTGGNONE 
J080001H19AGGTGGGCTTGGNONE 
J080001O15AGGTGGGCTTGGNONE 
J080005I22AGGTGGGCTTGGNONE 
J080006K23AGGTGGGCTTGGNONE 
J080014D20AGGTGGGCTTGGNONE 
J080014I05AGGTGGGCTTGGNONE 
J080014K21AGGTGGGCTTGGNONE 
J080017I24AGGTGGGCTTGGNONE 
J080017K11AGGTGGGCTTGGNONE 
J080018F11AGGTGGGCTTGGNONE 
J080022L18AGGTGGGCTTGGNONE 
J080024N23AGGTGGGCTTGGNONE 
J080027J23AGGTGGGCTTGGNONE 
J080029B14AGGTGGGCTTGGNONE 
J080032F14AGGTGGGCTTGGNONE 
J080032K19AGGTGGGCTTGGNONE 
J080032O21AGGTGGGCTTGGNONE 
J080033P17AGGTGGGCTTGGNONE 
J080034I06AGGTGGGCTTGGNONE 
J080039F24AGGTGGGCTTGGNONE 
J080040O13AGGTGGGCTTGGNONE 
J080042B02AGGTGGGCTTGGNONE 
J080043E12AGGTGGGCTTGGNONE 
J080043J15AGGTGGGCTTGGNONE 
J080043N09AGGTGGGCTTGGNONE 
J080052J08AGGTGGGCTTGGNONE 
J080053K01AGGTGGGCTTGGNONE 
J080053K19AGGTGGGCTTGGNONE 
J080055J09AGGTGGGCTTGGNONE 
J080058D07AGGTGGGCTTGGNONE 
J080062F11AGGTGGGCTTGGNONE 
J080063J24AGGTGGGCTTGGNONE 
J080066H04AGGTGGGCTTGGNONE 
J080066I09AGGTGGGCTTGGNONE 
J080067B02AGGTGGGCTTGGNONE 
J080067N09AGGTGGGCTTGGNONE 
J080068D22AGGTGGGCTTGGNONE 
J080068K13AGGTGGGCTTGGNONE 
J080069N19AGGTGGGCTTGGNONE 
J080070D07AGGTGGGCTTGGNONE 
J080070E05AGGTGGGCTTGGNONE 
J080071G04AGGTGGGCTTGGNONE 
J080077G05AGGTGGGCTTGGNONE 
J080077O06AGGTGGGCTTGGNONE 
J080085F05AGGTGGGCTTGGNONE 
J080086E07AGGTGGGCTTGGNONE 
J080089G16AGGTGGGCTTGGNONE 
J080092K15AGGTGGGCTTGGNONE 
J080094A08AGGTGGGCTTGGNONE 
J080097A09AGGTGGGCTTGGNONE 
J080097J07AGGTGGGCTTGGNONE 
J090027N01AGGTGGGCTTGGNONE 
J090081J05AGGTGGGCTTGGNONE 
Os05g0129900AK060436GGTGGGCTTGGTetratricopeptide-like helical domain containing protein. 
AK102515GGTGGGCTTGGNONE 
Os05g0132800AK108629GTTGGTGGGCTGAConserved hypothetical protein. 
Os05g0153400AK108071TCAGCCCACCAACProtein prenyltransferase domain containing protein. 
Os05g0208000AK059612AGCCCACCANONE 
AK063666AGCCCACCANONE 
AK071500AGCCCACCASimilar to 2-oxoglutarate/malate translocator. 
Os05g0209000AK111487AGCCCACCACConserved hypothetical protein. 
J075017G20AGCCCACCACNONE 
J075025B12AGCCCACCACNONE 
J075112L13AGCCCACCACNONE 
J075115B08AGCCCACCACNONE 
J075121P06AGCCCACCACNONE 
Os05g0252000AK068865AGCCCACCTOligopeptide transporter OPT superfamily protein. 
Os05g0314100AK105062AGCCCACCANONE 
J023077K01AGCCCACCANONE 
J023147M20AGCCCACCANONE 
J065142K14AGCCCACCANONE 
J075097P11AGCCCACCANONE 
J080031C22AGCCCACCANONE 
J080309A17AGCCCACCANONE 
J090014C21AGCCCACCANONE 
Os05g0325400AK111393AGCCCACCCNONE 
Os05g0330700009-032-H01ACAGCCCACCACNONE 
AK062425ACAGCCCACCACConserved hypothetical protein. 
Os05g0350500013-071-D05AGCCCACCANONE 
AF020787AGCCCACCANONE 
AK061712AGCCCACCANONE 
AK102897AGCCCACCAProliferation-associated protein 1 family protein. 
J033060G23AGCCCACCANONE 
J033112P14AGCCCACCANONE 
J033127J04AGCCCACCANONE 
J090015L18AGCCCACCANONE 
J090047K03AGCCCACCANONE 
J090097J17AGCCCACCANONE 
Os05g0370700AK108862GCAGCCCACCACAlpha/beta hydrolase family protein. 
Os05g0387200AK060744CAAGCCCACCAAAAGCCCAAGSimilar to UDP-sulfoquinovose synthase, chloroplast precursor (EC 3.13.1.1) (Sulfite:UDP-glucose sulfotransferase) (Sulfolipid biosynthesis protein) (SoSQD1). 
AK065310CAAGCCCACCAAAAGCCCAAGNONE 
Os05g0430200J090095K16CAAGCCCACCACNONE 
Os05g0447000AK108280TGGTGGGCTGTSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0495100AK108028TCAGCCCACCCConserved hypothetical protein. 
Os05g0534400AK101368GGTGGGCTTGSimilar to Calcineurin B-like protein 4 (SALT OVERLY SENSITIVE 3 protein). 
J033035L13GGTGGGCTTGNONE 
J065045H07GGTGGGCTTGNONE 
Os05g0553000015-052-H09AGCCCACCANONE 
AK061681AGCCCACCAATP synthase beta chain, mitochondrial precursor (EC 3.6.3.14). 
AK071143AGCCCACCANONE 
J013068H04AGCCCACCANONE 
J013124C06AGCCCACCANONE 
J033127N11AGCCCACCANONE 
J100056O04AGCCCACCANONE 
Os05g0568800006-084-D04CAGGTGGGCTTGGGCCGCANONE 
009-009-B11CAGGTGGGCTTGGGCCGCANONE 
009-014-E10CAGGTGGGCTTGGGCCGCANONE 
009-107-C04CAGGTGGGCTTGGGCCGCANONE 
009-133-H08CAGGTGGGCTTGGGCCGCANONE 
AK059883CAGGTGGGCTTGGGCCGCAProtein of unknown function DUF1645 family protein. 
Os05g0571600Os05g0571600GGTGGGCTTCConserved hypothetical protein. 
Os05g0593100AK061855AGGTGGGCTTANONE 
AK100119AGGTGGGCTTASimilar to Vacuolar ATP synthase subunit C (EC 3.6.3.14) (V-ATPase C subunit) (Vacuolar proton pump C subunit). 
AY224442AGGTGGGCTTANONE 
Os05g0594800AK058332GAAGCCCAGCCCACCAAdhesion regulating molecule family protein. 
AK068013GAAGCCCAGCCCACCANONE 
J013129L24GAAGCCCAGCCCACCANONE 
Os06g0112800J090052L21AGGTGGGCTTTNONE 
Os06g0116900009-176-D04GGGTGGGCTGTNONE 
AK063112GGGTGGGCTGTConserved hypothetical protein. 
Os06g0122500AK108322GGTGGGCTConserved hypothetical protein. 
Os06g0134000AK102796GCCCAGCCCACCTNONE 
Os06g0156600006-055-F08AGGTGGGCTNONE 
006-056-B12AGGTGGGCTNONE 
006-098-H12AGGTGGGCTNONE 
AK061497AGGTGGGCTLipolytic enzyme, G-D-S-L family protein. 
AK104394AGGTGGGCTNONE 
AK104883AGGTGGGCTNONE 
AK121780AGGTGGGCTNONE 
Os06g0163000AK069245CCCAGCCCACCTGNONE 
AK069675CCCAGCCCACCTGSimilar to Heat shock protein STI (Stress inducible protein) (GmSTI). 
AK072504CCCAGCCCACCTGNONE 
Os06g0217700009-074-A04AGCCCACCCNONE 
AK062617AGCCCACCCConserved hypothetical protein. 
Os06g0298500AK108252AAAAGCCCACCAConserved hypothetical protein. 
J065144C04AAAAGCCCACCANONE 
J075054P09AAAAGCCCACCANONE 
J075165A13AAAAGCCCACCANONE 
J075172E10AAAAGCCCACCANONE 
Os06g0498500AK099764GCAGCCCACCCGACTGGGCCGGTNONE 
AK103794GCAGCCCACCCGACTGGGCCGGTNucleolar complex-associated family protein. 
AK121899GCAGCCCACCCGACTGGGCCGGTNONE 
Os06g0506600009-119-E12AGCCCACCACNONE 
J023086A18AGCCCACCACNONE 
J033036I02AGCCCACCACNONE 
J033125C16AGCCCACCACNONE 
J065013I11AGCCCACCACNONE 
J065026O21AGCCCACCACNONE 
J065060H10AGCCCACCACNONE 
J065067A15AGCCCACCACNONE 
J065068F07AGCCCACCACNONE 
J065085N06AGCCCACCACNONE 
J065108N10AGCCCACCACNONE 
J065161O11AGCCCACCACNONE 
J065185J15AGCCCACCACNONE 
J065191H18AGCCCACCACNONE 
J065199J09AGCCCACCACNONE 
J075005G03AGCCCACCACNONE 
J075018C16AGCCCACCACNONE 
J075061K20AGCCCACCACNONE 
J075069J06AGCCCACCACNONE 
J075075H19AGCCCACCACNONE 
J075076D20AGCCCACCACNONE 
J075078D16AGCCCACCACNONE 
J075100J19AGCCCACCACNONE 
J075110M11AGCCCACCACNONE 
J075157N05AGCCCACCACNONE 
J075171F20AGCCCACCACNONE 
J075177G08AGCCCACCACNONE 
J075179G08AGCCCACCACNONE 
Os06g0647400AK068457GTGGTGGGCTSimilar to Lysosomal Pro-X carboxypeptidase. 
AK103281GTGGTGGGCTNONE 
J013151A14GTGGTGGGCTNONE 
Os06g0683400009-047-C07GAAGCCCACCACNONE 
009-060-B06GAAGCCCACCACNONE 
013-057-F12GAAGCCCACCACNONE 
AK111852GAAGCCCACCACNONE 
AK111897GAAGCCCACCACNONE 
AK112082GAAGCCCACCACSimilar to EF-hand Ca2+-binding protein CCD1. 
J065104C07GAAGCCCACCACNONE 
J065187J11GAAGCCCACCACNONE 
J065197L08GAAGCCCACCACNONE 
J100045K14GAAGCCCACCACNONE 
J100074M08GAAGCCCACCACNONE 
J100088H21GAAGCCCACCACNONE 
Os06g0709300AK108588AGCCCACCCFAR1 domain containing protein. 
Os06g0711600016-047-G09GAAGCCCACCACNONE 
AK064384GAAGCCCACCACmRNA splicing factor SYF2 family protein. 
AK102831GAAGCCCACCACNONE 
J013072P18GAAGCCCACCACNONE 
J023049G01GAAGCCCACCACNONE 
J023088I01GAAGCCCACCACNONE 
J033023I22GAAGCCCACCACNONE 
J033106I12GAAGCCCACCACNONE 
J033109G07GAAGCCCACCACNONE 
J065030F22GAAGCCCACCACNONE 
J065132H19GAAGCCCACCACNONE 
J080301D07GAAGCCCACCACNONE 
J080305C09GAAGCCCACCACNONE 
J080312C03GAAGCCCACCACNONE 
J080313I15GAAGCCCACCACNONE 
J080315B09GAAGCCCACCACNONE 
J090056N21GAAGCCCACCACNONE 
J100027B07GAAGCCCACCACNONE 
Os07g0185700012-040-A11CAAGCCCACCACNONE 
AK070572CAAGCCCACCACConserved hypothetical protein. 
J065116D10CAAGCCCACCACNONE 
J065122F20CAAGCCCACCACNONE 
Os07g0246200012-046-B07AGCCCACCNONE 
AB021259AGCCCACCNONE 
AK065341AGCCCACCSimilar to Calreticulin (Fragment). 
AK099348AGCCCACCNONE 
AK104328AGCCCACCNONE 
AK104826AGCCCACCNONE 
J013000E04AGCCCACCNONE 
J013093M19AGCCCACCNONE 
J013108J08AGCCCACCNONE 
J013118G03AGCCCACCNONE 
J013121I07AGCCCACCNONE 
J013153K07AGCCCACCNONE 
J023028N07AGCCCACCNONE 
J023034F12AGCCCACCNONE 
J023043J11AGCCCACCNONE 
J023087A03AGCCCACCNONE 
J023099N05AGCCCACCNONE 
J023105B02AGCCCACCNONE 
J023110H02AGCCCACCNONE 
J023112E15AGCCCACCNONE 
J023132C20AGCCCACCNONE 
J023134G12AGCCCACCNONE 
J023138O12AGCCCACCNONE 
J033031E05AGCCCACCNONE 
J033032C03AGCCCACCNONE 
J033039K10AGCCCACCNONE 
J033050P09AGCCCACCNONE 
J033074D03AGCCCACCNONE 
J033075G14AGCCCACCNONE 
J033075I23AGCCCACCNONE 
J033081H23AGCCCACCNONE 
J033087N08AGCCCACCNONE 
J033110B03AGCCCACCNONE 
J033148H22AGCCCACCNONE 
J043027F13AGCCCACCNONE 
J043031H01AGCCCACCNONE 
J080003O10AGCCCACCNONE 
J080022D10AGCCCACCNONE 
J080029I12AGCCCACCNONE 
J080034A09AGCCCACCNONE 
J080035H20AGCCCACCNONE 
J080049C10AGCCCACCNONE 
J080053G14AGCCCACCNONE 
J080055J22AGCCCACCNONE 
J080058J04AGCCCACCNONE 
J080069E14AGCCCACCNONE 
J080069M23AGCCCACCNONE 
J080072E19AGCCCACCNONE 
J080072I03AGCCCACCNONE 
J080075B13AGCCCACCNONE 
J080078I11AGCCCACCNONE 
J080081F16AGCCCACCNONE 
J080088O10AGCCCACCNONE 
J080089G18AGCCCACCNONE 
J090009C10AGCCCACCNONE 
J090022D23AGCCCACCNONE 
J090023A15AGCCCACCNONE 
J090024M10AGCCCACCNONE 
J090038F24AGCCCACCNONE 
J090039O13AGCCCACCNONE 
J090040N12AGCCCACCNONE 
J090054I18AGCCCACCNONE 
J090061C16AGCCCACCNONE 
J090063H23AGCCCACCNONE 
J090067F21AGCCCACCNONE 
J090075A01AGCCCACCNONE 
J090076K11AGCCCACCNONE 
J090078L11AGCCCACCNONE 
J090079P03AGCCCACCNONE 
J090087D23AGCCCACCNONE 
J090087G22AGCCCACCNONE 
J090089F03AGCCCACCNONE 
J090092A04AGCCCACCNONE 
J100024L17AGCCCACCNONE 
J100031P13AGCCCACCNONE 
J100032H05AGCCCACCNONE 
J100036P03AGCCCACCNONE 
J100038L07AGCCCACCNONE 
J100043I20AGCCCACCNONE 
J100069A21AGCCCACCNONE 
J100078G06AGCCCACCNONE 
J100081J24AGCCCACCNONE 
J100081N04AGCCCACCNONE 
J100084K16AGCCCACCNONE 
J100085O06AGCCCACCNONE 
J100088L13AGCCCACCNONE 
J100090O21AGCCCACCNONE 
Os07g0421300AK121014GCAGCCCACCSimilar to Alpha glucosidase-like protein. 
Os07g0496000AK111986CCAGCCCACCCSimilar to Nt-rab6 protein. 
J065098H22CCAGCCCACCCNONE 
J065172F22CCAGCCCACCCNONE 
J075001F01CCAGCCCACCCNONE 
J075017I20CCAGCCCACCCNONE 
J075035G14CCAGCCCACCCNONE 
J075082D07CCAGCCCACCCNONE 
J075134M14CCAGCCCACCCNONE 
J075146P21CCAGCCCACCCNONE 
J075167H19CCAGCCCACCCNONE 
J075176L08CCAGCCCACCCNONE 
J075190E06CCAGCCCACCCNONE 
J100026M06CCAGCCCACCCNONE 
J100061L07CCAGCCCACCCNONE 
J100079J12CCAGCCCACCCNONE 
Os07g0498900AK073263CTTGGGCCCAGCCCACCAACProtein of unknown function DUF231, plant domain containing protein. 
J033024K20CTTGGGCCCAGCCCACCAACNONE 
J065207I19CTTGGGCCCAGCCCACCAACNONE 
Os07g0515700AK103117ACGTGGGCGGTGGGCTAnkyrin repeat containing protein. 
Os07g0569800AK108637CCAAGCCCACCACConcanavalin A-like lectin/glucanase domain containing protein. 
Os07g0603100AK101352GCGGGCCCACACAGCCCACCACNuclear transport factor 2 domain containing protein. 
J023077E09GCGGGCCCACACAGCCCACCACNONE 
J023081N15GCGGGCCCACACAGCCCACCACNONE 
J033022N22GCGGGCCCACACAGCCCACCACNONE 
J033024M18GCGGGCCCACACAGCCCACCACNONE 
J033034P09GCGGGCCCACACAGCCCACCACNONE 
J033046A06GCGGGCCCACACAGCCCACCACNONE 
J033051K01GCGGGCCCACACAGCCCACCACNONE 
J033081P09GCGGGCCCACACAGCCCACCACNONE 
J033091B17GCGGGCCCACACAGCCCACCACNONE 
J033092K23GCGGGCCCACACAGCCCACCACNONE 
J033132J09GCGGGCCCACACAGCCCACCACNONE 
J033144A14GCGGGCCCACACAGCCCACCACNONE 
J033145A14GCGGGCCCACACAGCCCACCACNONE 
J043021B20GCGGGCCCACACAGCCCACCACNONE 
J053024D23GCGGGCCCACACAGCCCACCACNONE 
J065212J10GCGGGCCCACACAGCCCACCACNONE 
J090055M05GCGGGCCCACACAGCCCACCACNONE 
J090065E14GCGGGCCCACACAGCCCACCACNONE 
J090092J06GCGGGCCCACACAGCCCACCACNONE 
Os07g0605200AF091458AGCCCACCGCACNONE 
AF139665AGCCCACCGCACNONE 
AJ011675AGCCCACCGCACNONE 
AK064704AGCCCACCGCACMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
J075159J15AGCCCACCGCACNONE 
J090034M06AGCCCACCGCACNONE 
J090079L24AGCCCACCGCACNONE 
Os07g0607800012-042-C02CCAGCCCACCACGCCTCCACGCCNONE 
015-097-B06CCAGCCCACCACGCCTCCACGCCNONE 
AK069010CCAGCCCACCACGCCTCCACGCCNONE 
J013170I18CCAGCCCACCACGCCTCCACGCCNONE 
J090036G23CCAGCCCACCACGCCTCCACGCCNONE 
Os07g0622000005-017-G03AGCCCACCANONE 
AB125303AGCCCACCANONE 
AK070965AGCCCACCASerine/threonine-protein kinase SAPK2 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 2). 
AK103945AGCCCACCANONE 
AY207043AGCCCACCANONE 
J023068H23AGCCCACCANONE 
J065093I04AGCCCACCANONE 
J065184K24AGCCCACCANONE 
Os07g0639800AK074012CAAGTGGGCCCACGAGCCCACCCGSimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592CAAGTGGGCCCACGAGCCCACCCGNONE 
AK104739CAAGTGGGCCCACGAGCCCACCCGNONE 
Os07g0673100AK060100AGCCCACCTNONE 
AK103678AGCCCACCTRibosomal protein S8E family protein. 
AK104794AGCCCACCTNONE 
Os07g0673700AK071934TCGGCCCAGCCCACCCCyclin-like F-box domain containing protein. 
AK107556TCGGCCCAGCCCACCCNONE 
Os08g0107900014-055-C03TGGTGGGCTGANONE 
J065062G20TGGTGGGCTGANONE 
Os08g0130500AK062008AGGTGGGCTNONE 
Os08g0143400015-006-A10AGCCCACCTGNONE 
AK066792AGCCCACCTGNONE 
AK120532AGCCCACCTGSWIRM domain containing protein. 
J100083F02AGCCCACCTGNONE 
Os08g0143500006-072-G06CAGGTGGGCTNONE 
016-053-H02CAGGTGGGCTNONE 
AK061094CAGGTGGGCTNONE 
AK071122CAGGTGGGCTGlycosyl transferase, family 14 protein. 
J023081E17CAGGTGGGCTNONE 
J023106O18CAGGTGGGCTNONE 
J043001N22CAGGTGGGCTNONE 
J065062D05CAGGTGGGCTNONE 
J065099M15CAGGTGGGCTNONE 
J065180K12CAGGTGGGCTNONE 
J090045L23CAGGTGGGCTNONE 
J100088K05CAGGTGGGCTNONE 
Os08g0299200009-120-G12AGCCCACCCGNONE 
J075096F13AGCCCACCCGAdenylate cyclase domain containing protein. 
Os08g0322400AK120116TGGTGGGCTGCATGGGCTGCNucleotide-binding, alpha-beta plait domain containing protein. 
J013025M20TGGTGGGCTGCATGGGCTGCNONE 
J013096J15TGGTGGGCTGCATGGGCTGCNONE 
Os08g0327400AK070992AAAAGCCCACCSimilar to Enoyl-ACP reductase (Fragment). 
J023077K10AAAAGCCCACCNONE 
J065075F06AAAAGCCCACCNONE 
J065112N14AAAAGCCCACCNONE 
J090028K07AAAAGCCCACCNONE 
J090039C15AAAAGCCCACCNONE 
J090048I11AAAAGCCCACCNONE 
J090083M10AAAAGCCCACCNONE 
Os08g0379000AK105647CCAAGCCCACCProtein prenyltransferase domain containing protein. 
Os08g0414200AK102789TCAGCCCACCTBRCT domain containing protein. 
AK102789TGCGGCCCACCAGCCCACCACBRCT domain containing protein. 
J033048B10TCAGCCCACCTNONE 
J033048B10TGCGGCCCACCAGCCCACCACNONE 
J033071G24TCAGCCCACCTNONE 
J033071G24TGCGGCCCACCAGCCCACCACNONE 
J033107O17TCAGCCCACCTNONE 
J033107O17TGCGGCCCACCAGCCCACCACNONE 
Os08g0476000AK066585GAAGCCCACCCNONE 
Os08g0500900AK102314GGTGGGCTTGGSimilar to Phosphoribosylglycinamide formyltransferase, chloroplast precursor (EC 2.1.2.2) (GART) (GAR transformylase) (5'-phosphoribosylglycinamide transformylase). 
Os08g0525600AK103172GAAGCCCACCACSimilar to Peptidylprolyl isomerase; FK506-binding protein. 
Os08g0527400AK119389AGCCCATACCAGCCCACCCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0548300AK073266CCCAGCCCACCACZinc finger, RING-type domain containing protein. 
J013030C19CCCAGCCCACCACNONE 
J033029A20CCCAGCCCACCACNONE 
J033050L14CCCAGCCCACCACNONE 
J033058F03CCCAGCCCACCACNONE 
J033110K01CCCAGCCCACCACNONE 
J033123D21CCCAGCCCACCACNONE 
Os08g0549300009-008-F01TCAGCCCACCAACNONE 
009-033-G10TCAGCCCACCAACNONE 
AK120938TCAGCCCACCAACSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420TCAGCCCACCAACNONE 
J023037A21TCAGCCCACCAACNONE 
J023066D20TCAGCCCACCAACNONE 
J033099K13TCAGCCCACCAACNONE 
J065116C14TCAGCCCACCAACNONE 
J075009K15TCAGCCCACCAACNONE 
J075071P13TCAGCCCACCAACNONE 
J075080D18TCAGCCCACCAACNONE 
J075124F24TCAGCCCACCAACNONE 
J075198F23TCAGCCCACCAACNONE 
J080006B15TCAGCCCACCAACNONE 
J090078H13TCAGCCCACCAACNONE 
J090089J09TCAGCCCACCAACNONE 
J100017A03TCAGCCCACCAACNONE 
J100023G03TCAGCCCACCAACNONE 
Os08g0557100AK070743AGCCCACCCNONE 
AK101214AGCCCACCCSimilar to Nucleic acid-binding protein precursor. 
AK105901AGCCCACCCNONE 
J033031B04AGCCCACCCNONE 
J080004F08AGCCCACCCNONE 
J080004H12AGCCCACCCNONE 
J080005H08AGCCCACCCNONE 
J080005I02AGCCCACCCNONE 
J080008N16AGCCCACCCNONE 
J080009H23AGCCCACCCNONE 
J080012H17AGCCCACCCNONE 
J080012J21AGCCCACCCNONE 
J080013I20AGCCCACCCNONE 
J080016E07AGCCCACCCNONE 
J080018O04AGCCCACCCNONE 
J080020B18AGCCCACCCNONE 
J080021I16AGCCCACCCNONE 
J080022N01AGCCCACCCNONE 
J080023G08AGCCCACCCNONE 
J080023N09AGCCCACCCNONE 
J080024J24AGCCCACCCNONE 
J080025M12AGCCCACCCNONE 
J080028A22AGCCCACCCNONE 
J080028I01AGCCCACCCNONE 
J080029D22AGCCCACCCNONE 
J080030M02AGCCCACCCNONE 
J080031B06AGCCCACCCNONE 
J080035G08AGCCCACCCNONE 
J080036F19AGCCCACCCNONE 
J080038P14AGCCCACCCNONE 
J080039C17AGCCCACCCNONE 
J080043A10AGCCCACCCNONE 
J080044H02AGCCCACCCNONE 
J080044P12AGCCCACCCNONE 
J080047L06AGCCCACCCNONE 
J080050L06AGCCCACCCNONE 
J080052J11AGCCCACCCNONE 
J080052M10AGCCCACCCNONE 
J080053E20AGCCCACCCNONE 
J080054J01AGCCCACCCNONE 
J080059N09AGCCCACCCNONE 
J080064F19AGCCCACCCNONE 
J080064N22AGCCCACCCNONE 
J080065K14AGCCCACCCNONE 
J080065M12AGCCCACCCNONE 
J080068O07AGCCCACCCNONE 
J080076P20AGCCCACCCNONE 
J080087D08AGCCCACCCNONE 
J080087H16AGCCCACCCNONE 
J080090N23AGCCCACCCNONE 
J080091H04AGCCCACCCNONE 
J080091P13AGCCCACCCNONE 
J080094O15AGCCCACCCNONE 
J080094P14AGCCCACCCNONE 
J080095I07AGCCCACCCNONE 
J080097E22AGCCCACCCNONE 
Os09g0306700J023045A19AAAAGCCCACCTNONE 
Os09g0322100AK107018TCAGCCCACCACConserved hypothetical protein. 
Os09g0370300AK108199AAAGCCCACCSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
AK108199AGCCCACCACSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0439700AK105702AGCCCACCCNONE 
AK119953AGCCCACCCNONE 
AK120805AGCCCACCCLung seven transmembrane receptor family protein. 
Os09g0461500006-107-E02AAAGCCCACCACNONE 
011-089-D02AAAGCCCACCACNONE 
AK063400AAAGCCCACCACNONE 
AK102328AAAGCCCACCACEsterase/lipase/thioesterase domain containing protein. 
J033090L22AAAGCCCACCACNONE 
J065031O14AAAGCCCACCACNONE 
J065083D22AAAGCCCACCACNONE 
J065182N14AAAGCCCACCACNONE 
J065190H22AAAGCCCACCACNONE 
J065219H11AAAGCCCACCACNONE 
J075007O22AAAGCCCACCACNONE 
J075025E09AAAGCCCACCACNONE 
J075041K24AAAGCCCACCACNONE 
J075046F11AAAGCCCACCACNONE 
J090032E12AAAGCCCACCACNONE 
Os09g0493700015-091-G11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
AK068501AGCCCACCCTCATGGGCCCAGATGTCAGTGACACSimilar to CUC2. 
AK099237AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J013155B08AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023006E01AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023060K23AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023100B11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033026L19AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033129J12AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033149K09AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065045I06AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065061A10AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065101H05AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065135A03AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065169C16AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047C11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047K07AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
Os09g0501100009-126-C12CCAGCCCACCNONE 
AK063752CCAGCCCACCSimilar to 60S ribosomal protein L32A. 
AK099282CCAGCCCACCNONE 
J023130H04CCAGCCCACCNONE 
J075013C11CCAGCCCACCNONE 
J075060E07CCAGCCCACCNONE 
J075106K07CCAGCCCACCNONE 
J075124L15CCAGCCCACCNONE 
J075161D15CCAGCCCACCNONE 
J080311I18CCAGCCCACCNONE 
J080315G08CCAGCCCACCNONE 
J080316F09CCAGCCCACCNONE 
J080318B05CCAGCCCACCNONE 
J100052O18CCAGCCCACCNONE 
J100064D07CCAGCCCACCNONE 
Os11g0114700AK065865TGGTGGGCTNONE 
AK066583TGGTGGGCTNONE 
AK070834TGGTGGGCTPAP/25A core domain containing protein. 
AK072543TGGTGGGCTNONE 
Os11g0130300AK059597GGGTGGGCTNse1 non-SMC component of SMC5-6 complex family protein. 
AK101224GGGTGGGCTNONE 
J033031D09GGGTGGGCTNONE 
J033135B02GGGTGGGCTNONE 
J100021A17GGGTGGGCTNONE 
J100066G09GGGTGGGCTNONE 
Os11g0267000006-024-H12ACAGCCCACCANONE 
006-039-A12ACAGCCCACCANONE 
006-039-B09ACAGCCCACCANONE 
006-044-F05ACAGCCCACCANONE 
006-069-C12ACAGCCCACCANONE 
006-098-E01ACAGCCCACCANONE 
006-099-H05ACAGCCCACCANONE 
006-103-B11ACAGCCCACCANONE 
006-107-A02ACAGCCCACCANONE 
006-109-C12ACAGCCCACCANONE 
009-123-C09ACAGCCCACCANONE 
AK060022ACAGCCCACCANONE 
AK061014ACAGCCCACCAGUN4-like domain containing protein. 
AK100815ACAGCCCACCANONE 
AK104559ACAGCCCACCANONE 
J023122C05ACAGCCCACCANONE 
Os11g0297900AK067692CAGGTGGGCTTASimilar to Txnl4b protein. 
J013118F01CAGGTGGGCTTANONE 
J023066E22CAGGTGGGCTTANONE 
J023066E24CAGGTGGGCTTANONE 
Os11g0306300006-102-D09GTGGTGGGCTGANONE 
AK109384GTGGTGGGCTGASimilar to Herbicide safener binding protein. 
Os11g0585900AK070793CCAGCCCACCTSimilar to ETO1-like protein 1 (Ethylene overproducer 1-like protein 1). 
Os11g0602300AK103473ACAGCCCACCACSimilar to HVA22-like protein a (AtHVA22a). 
J033075N24ACAGCCCACCACNONE 
Os11g0684700Os11g0684700AGCCCACCCDisease resistance protein family protein. 
Os12g0175700AK069143ATCCGACGGCCGTCCAAGCCCACCCGNonaspanin (TM9SF) family protein. 
Os12g0179700AK068305GCCCATCACAGCCCACCCNONE 
AK120612GCCCATCACAGCCCACCCNONE 
J013146K12GCCCATCACAGCCCACCCNONE 
J023131C17GCCCATCACAGCCCACCCNONE 
J033079I11GCCCATCACAGCCCACCCNONE 
J033125D20GCCCATCACAGCCCACCCNONE 
J090048O13GCCCATCACAGCCCACCCNONE 
J100076M12GCCCATCACAGCCCACCCNONE 
J100079L09GCCCATCACAGCCCACCCNONE 
Os12g0190100AK109819AGCCCACCASimilar to Auxin-independent growth promoter-like protein. 
AK109819AGCCCACCASimilar to Auxin-independent growth promoter-like protein. 
AK109819CCAGCCCACCASimilar to Auxin-independent growth promoter-like protein. 
Os12g0226900AK060453GTGGTGGGCTSimilar to Allyl alcohol dehydrogenase. 
AK071631GTGGTGGGCTNONE 
AK104386GTGGTGGGCTNONE 
Os12g0235800AK071066AGCCCACCACSimilar to Argininosuccinate synthase (Fragment). 
Os12g0250700AK069277AGCCCACCAConserved hypothetical protein. 
Os12g0287200009-067-B11AGCCCACCTNONE 
009-130-F06AGCCCACCTNONE 
009-185-H10AGCCCACCTNONE 
AF338343AGCCCACCTNONE 
AK063847AGCCCACCTSimilar to Mago nashi protein. 
AK121477AGCCCACCTNONE 
J023149H05AGCCCACCTNONE 
J065019G18AGCCCACCTNONE 
J065049J18AGCCCACCTNONE 
J065143C22AGCCCACCTNONE 
J075130D23AGCCCACCTNONE 
J090014I22AGCCCACCTNONE 
J090018A06AGCCCACCTNONE 
J090053H11AGCCCACCTNONE 
J090080N13AGCCCACCTNONE 
J100019H19AGCCCACCTNONE 
Os12g0440400AK064643GGTGGGCTHypothetical protein. 
Os12g0442700AK111062AGGTGGGCTTTTHypothetical protein. 
J065080H14AGGTGGGCTTTTNONE 
J075019H22AGGTGGGCTTTTNONE 
J075088M09AGGTGGGCTTTTNONE 
Os12g0584100006-083-C12TAGGCCCAGCCCACCCNONE 
006-104-C06TAGGCCCAGCCCACCCNONE 
AK066829TAGGCCCAGCCCACCCNONE 
AK071424TAGGCCCAGCCCACCCConserved hypothetical protein. 
J013075O22TAGGCCCAGCCCACCCNONE 
J023091J20TAGGCCCAGCCCACCCNONE 
J065167K15TAGGCCCAGCCCACCCNONE 
J065213C02TAGGCCCAGCCCACCCNONE 
J075001B17TAGGCCCAGCCCACCCNONE 
J075165D13TAGGCCCAGCCCACCCNONE 
J075195C24TAGGCCCAGCCCACCCNONE 
Os12g0605400009-005-G05CTCGGCCCAACCCAGCCCACCTNONE 
016-024-B01CTCGGCCCAACCCAGCCCACCTNONE 
016-043-A11CTCGGCCCAACCCAGCCCACCTNONE 
AK068060CTCGGCCCAACCCAGCCCACCTSimilar to CROC-1-like protein (Fragment). 
J013130B07CTCGGCCCAACCCAGCCCACCTNONE 
J023141C14CTCGGCCCAACCCAGCCCACCTNONE 
J033037O04CTCGGCCCAACCCAGCCCACCTNONE 
J033081L17CTCGGCCCAACCCAGCCCACCTNONE 
J033108C03CTCGGCCCAACCCAGCCCACCTNONE 
J065079G22CTCGGCCCAACCCAGCCCACCTNONE 
J065082D03CTCGGCCCAACCCAGCCCACCTNONE 
J065207O15CTCGGCCCAACCCAGCCCACCTNONE 
J075027C23CTCGGCCCAACCCAGCCCACCTNONE 
J075037A17CTCGGCCCAACCCAGCCCACCTNONE 
J075056D17CTCGGCCCAACCCAGCCCACCTNONE 
J075064O21CTCGGCCCAACCCAGCCCACCTNONE 
J075096E08CTCGGCCCAACCCAGCCCACCTNONE 
J090036I15CTCGGCCCAACCCAGCCCACCTNONE 
J100018P15CTCGGCCCAACCCAGCCCACCTNONE 
J100074O06CTCGGCCCAACCCAGCCCACCTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.