version

Summary of OsREG463 (All List)

OrganismOryza sativa  
IDOsREG463  
SequenceAGCCCACG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1167  

Entry Sequences (1167 entries)

LocusGene modelSequenceDescription
Os01g0132700J065063N10AGCCCACGASurfeit locus 5 family protein. 
J065164N24AGCCCACGANONE 
J065167H04AGCCCACGANONE 
J065187N12AGCCCACGANONE 
Os01g0186200AK109372TCGTGGGCTSimilar to Phototropin. 
AK111679TCGTGGGCTNONE 
J065120K01TCGTGGGCTNONE 
J100025D07TCGTGGGCTNONE 
Os01g0196600AK101742CCAAGCCCACGCNONE 
U25430CCAAGCCCACGCSimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
Os01g0226400AK102301AGCCCACGTAAA ATPase domain containing protein. 
Os01g0303000009-016-A06ACAGCCCACGTGGCNONE 
009-084-B05ACAGCCCACGTGGCNONE 
009-100-E07ACAGCCCACGTGGCNONE 
009-133-B03ACAGCCCACGTGGCNONE 
AK058929ACAGCCCACGTGGCSimilar to CP12 (Fragment). 
AK066266ACAGCCCACGTGGCNONE 
AK102013ACAGCCCACGTGGCNONE 
J065001I21ACAGCCCACGTGGCNONE 
J065025D22ACAGCCCACGTGGCNONE 
J065098M18ACAGCCCACGTGGCNONE 
J065105O22ACAGCCCACGTGGCNONE 
J065121F07ACAGCCCACGTGGCNONE 
J065181F03ACAGCCCACGTGGCNONE 
J075020M03ACAGCCCACGTGGCNONE 
J075028O06ACAGCCCACGTGGCNONE 
J075032F15ACAGCCCACGTGGCNONE 
J075033H07ACAGCCCACGTGGCNONE 
J075062F22ACAGCCCACGTGGCNONE 
J075083P19ACAGCCCACGTGGCNONE 
J075097J16ACAGCCCACGTGGCNONE 
J075099A15ACAGCCCACGTGGCNONE 
J075104P03ACAGCCCACGTGGCNONE 
J075118K12ACAGCCCACGTGGCNONE 
J075125H01ACAGCCCACGTGGCNONE 
J075127K12ACAGCCCACGTGGCNONE 
J075128F24ACAGCCCACGTGGCNONE 
J075151P06ACAGCCCACGTGGCNONE 
J075169K22ACAGCCCACGTGGCNONE 
J075170K24ACAGCCCACGTGGCNONE 
J075182A01ACAGCCCACGTGGCNONE 
J075199H16ACAGCCCACGTGGCNONE 
J080010O12ACAGCCCACGTGGCNONE 
J080013A02ACAGCCCACGTGGCNONE 
J080013F09ACAGCCCACGTGGCNONE 
J080017C19ACAGCCCACGTGGCNONE 
J080017G05ACAGCCCACGTGGCNONE 
J080022L04ACAGCCCACGTGGCNONE 
J080025B17ACAGCCCACGTGGCNONE 
J080029A08ACAGCCCACGTGGCNONE 
J080037C12ACAGCCCACGTGGCNONE 
J080037L14ACAGCCCACGTGGCNONE 
J080037M24ACAGCCCACGTGGCNONE 
J080038M21ACAGCCCACGTGGCNONE 
J080039E06ACAGCCCACGTGGCNONE 
J080039I10ACAGCCCACGTGGCNONE 
J080042H01ACAGCCCACGTGGCNONE 
J080042L18ACAGCCCACGTGGCNONE 
J080042N21ACAGCCCACGTGGCNONE 
J080043E01ACAGCCCACGTGGCNONE 
J080044H05ACAGCCCACGTGGCNONE 
J080047H10ACAGCCCACGTGGCNONE 
J080050H03ACAGCCCACGTGGCNONE 
J080060N21ACAGCCCACGTGGCNONE 
J080061M09ACAGCCCACGTGGCNONE 
J080062D15ACAGCCCACGTGGCNONE 
J080062I18ACAGCCCACGTGGCNONE 
J080063G05ACAGCCCACGTGGCNONE 
J080063H16ACAGCCCACGTGGCNONE 
J080067G16ACAGCCCACGTGGCNONE 
J080067M07ACAGCCCACGTGGCNONE 
J080068M13ACAGCCCACGTGGCNONE 
J080069A19ACAGCCCACGTGGCNONE 
J080069G14ACAGCCCACGTGGCNONE 
J080070F04ACAGCCCACGTGGCNONE 
J080070K15ACAGCCCACGTGGCNONE 
J080072O20ACAGCCCACGTGGCNONE 
J080075L02ACAGCCCACGTGGCNONE 
J080077I10ACAGCCCACGTGGCNONE 
J080077P03ACAGCCCACGTGGCNONE 
J080078F14ACAGCCCACGTGGCNONE 
J080092H15ACAGCCCACGTGGCNONE 
J080097J15ACAGCCCACGTGGCNONE 
J080305C10ACAGCCCACGTGGCNONE 
Os01g0588200006-052-E10CCAGGCCCAACCAAGCCCACGGNONE 
AJ251563CCAGGCCCAACCAAGCCCACGGNONE 
AK070745CCAGGCCCAACCAAGCCCACGGVoltage-dependent anion channel. 
AK104055CCAGGCCCAACCAAGCCCACGGNONE 
AK104419CCAGGCCCAACCAAGCCCACGGNONE 
J023057A07CCAGGCCCAACCAAGCCCACGGNONE 
J023068C08CCAGGCCCAACCAAGCCCACGGNONE 
J023148E24CCAGGCCCAACCAAGCCCACGGNONE 
J090045O22CCAGGCCCAACCAAGCCCACGGNONE 
J090045P03CCAGGCCCAACCAAGCCCACGGNONE 
J090050C18CCAGGCCCAACCAAGCCCACGGNONE 
J100023F01CCAGGCCCAACCAAGCCCACGGNONE 
J100051I18CCAGGCCCAACCAAGCCCACGGNONE 
J100060P17CCAGGCCCAACCAAGCCCACGGNONE 
Os01g0623500AK066142CCGTGGGCTAAA ATPase domain containing protein. 
J013055O07CCGTGGGCTNONE 
J053069D06CCGTGGGCTNONE 
J053095J11CCGTGGGCTNONE 
J065106D24CCGTGGGCTNONE 
J065134H18CCGTGGGCTNONE 
J075066D09CCGTGGGCTNONE 
J090004M17CCGTGGGCTNONE 
J100039L05CCGTGGGCTNONE 
J100042E15CCGTGGGCTNONE 
J100043B18CCGTGGGCTNONE 
J100057L11CCGTGGGCTNONE 
J100067C24CCGTGGGCTNONE 
J100073H01CCGTGGGCTNONE 
J100081J21CCGTGGGCTNONE 
Os01g0640800AK065688AGCCCACGAAConserved hypothetical protein 48 family protein. 
J013042L10AGCCCACGAANONE 
J013121H08AGCCCACGAANONE 
Os01g0772000009-139-F01TCGTGGGCTNONE 
AK069455TCGTGGGCTConserved hypothetical protein. 
J023019D24TCGTGGGCTNONE 
J033055P09TCGTGGGCTNONE 
J065059A13TCGTGGGCTNONE 
J090008C16TCGTGGGCTNONE 
J090012D20TCGTGGGCTNONE 
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE 
Os01g0821800015-005-A04CCCGTGGGCTNONE 
AK073951CCCGTGGGCTNONE 
AK103171CCCGTGGGCTNONE 
AK119168CCCGTGGGCTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J023031A22CCCGTGGGCTNONE 
J033098N09CCCGTGGGCTNONE 
J033121G11CCCGTGGGCTNONE 
J090030L03CCCGTGGGCTNONE 
Os01g0834700AK101559TCAGCCCACGAZinc finger, CCCH-type domain containing protein. 
AK106074TCAGCCCACGANONE 
Os01g0889000AK103621ACGTGGGCTTetratricopeptide-like helical domain containing protein. 
Os01g0905800006-028-A06TCGTGGGCTNONE 
006-050-H08TCGTGGGCTNONE 
006-057-G07TCGTGGGCTNONE 
006-062-D02TCGTGGGCTNONE 
006-116-G09TCGTGGGCTNONE 
009-117-H10TCGTGGGCTNONE 
011-025-F02TCGTGGGCTNONE 
011-045-E10TCGTGGGCTNONE 
011-068-E01TCGTGGGCTNONE 
013-040-A01TCGTGGGCTNONE 
013-079-E10TCGTGGGCTNONE 
013-079-G11TCGTGGGCTNONE 
015-095-D06TCGTGGGCTNONE 
AK062270TCGTGGGCTNONE 
AK073770TCGTGGGCTAldolase C-1. 
AK104719TCGTGGGCTNONE 
D21279TCGTGGGCTNONE 
D50301TCGTGGGCTNONE 
J013029D24TCGTGGGCTNONE 
J013039N01TCGTGGGCTNONE 
J023039J01TCGTGGGCTNONE 
J023064E16TCGTGGGCTNONE 
J023085J23TCGTGGGCTNONE 
J023100H14TCGTGGGCTNONE 
J023127J19TCGTGGGCTNONE 
J023135J04TCGTGGGCTNONE 
J023140C02TCGTGGGCTNONE 
J023150B18TCGTGGGCTNONE 
J033027L09TCGTGGGCTNONE 
J033033N07TCGTGGGCTNONE 
J033042E03TCGTGGGCTNONE 
J033046K04TCGTGGGCTNONE 
J033068A16TCGTGGGCTNONE 
J033075I01TCGTGGGCTNONE 
J033076C19TCGTGGGCTNONE 
J033079O08TCGTGGGCTNONE 
J033080E19TCGTGGGCTNONE 
J033082F12TCGTGGGCTNONE 
J033089B13TCGTGGGCTNONE 
J033090E13TCGTGGGCTNONE 
J033091K16TCGTGGGCTNONE 
J033093E06TCGTGGGCTNONE 
J033094K02TCGTGGGCTNONE 
J033097O10TCGTGGGCTNONE 
J033098D04TCGTGGGCTNONE 
J033099J02TCGTGGGCTNONE 
J033109F07TCGTGGGCTNONE 
J033120F06TCGTGGGCTNONE 
J033126F10TCGTGGGCTNONE 
J033128I19TCGTGGGCTNONE 
J033132B13TCGTGGGCTNONE 
J033132C16TCGTGGGCTNONE 
J043022A15TCGTGGGCTNONE 
J065001J20TCGTGGGCTNONE 
J065009J23TCGTGGGCTNONE 
J065021P12TCGTGGGCTNONE 
J065047O05TCGTGGGCTNONE 
J065059G07TCGTGGGCTNONE 
J065072B20TCGTGGGCTNONE 
J065073N03TCGTGGGCTNONE 
J065108H21TCGTGGGCTNONE 
J065111B01TCGTGGGCTNONE 
J065113K02TCGTGGGCTNONE 
J065167F23TCGTGGGCTNONE 
J065168A06TCGTGGGCTNONE 
J065172D04TCGTGGGCTNONE 
J065191F04TCGTGGGCTNONE 
J065191K22TCGTGGGCTNONE 
J065193D04TCGTGGGCTNONE 
J065200O11TCGTGGGCTNONE 
J075063B18TCGTGGGCTNONE 
J075127I16TCGTGGGCTNONE 
J075189P14TCGTGGGCTNONE 
J080001P12TCGTGGGCTNONE 
J080004I20TCGTGGGCTNONE 
J080005I23TCGTGGGCTNONE 
J080007H13TCGTGGGCTNONE 
J080010O21TCGTGGGCTNONE 
J080011A07TCGTGGGCTNONE 
J080012N11TCGTGGGCTNONE 
J080012P03TCGTGGGCTNONE 
J080023O17TCGTGGGCTNONE 
J080033D12TCGTGGGCTNONE 
J080035G15TCGTGGGCTNONE 
J080036M15TCGTGGGCTNONE 
J080040N08TCGTGGGCTNONE 
J080044D18TCGTGGGCTNONE 
J080045E16TCGTGGGCTNONE 
J080045H12TCGTGGGCTNONE 
J080047D17TCGTGGGCTNONE 
J080054B19TCGTGGGCTNONE 
J080056P07TCGTGGGCTNONE 
J080063H06TCGTGGGCTNONE 
J080065A11TCGTGGGCTNONE 
J080066B03TCGTGGGCTNONE 
J080066H02TCGTGGGCTNONE 
J080067K05TCGTGGGCTNONE 
J080086B05TCGTGGGCTNONE 
J080096K02TCGTGGGCTNONE 
J080315F07TCGTGGGCTNONE 
J080315M01TCGTGGGCTNONE 
J090001L02TCGTGGGCTNONE 
J090001L03TCGTGGGCTNONE 
J090004I19TCGTGGGCTNONE 
J090024E02TCGTGGGCTNONE 
J090034N18TCGTGGGCTNONE 
J090036K17TCGTGGGCTNONE 
J090051C05TCGTGGGCTNONE 
J090094B01TCGTGGGCTNONE 
J100030C02TCGTGGGCTNONE 
J100033D19TCGTGGGCTNONE 
J100036K05TCGTGGGCTNONE 
J100042F23TCGTGGGCTNONE 
J100045C03TCGTGGGCTNONE 
J100045L18TCGTGGGCTNONE 
J100047A19TCGTGGGCTNONE 
J100052A07TCGTGGGCTNONE 
J100066N04TCGTGGGCTNONE 
J100066N18TCGTGGGCTNONE 
J100074B08TCGTGGGCTNONE 
J100074G10TCGTGGGCTNONE 
J100074H15TCGTGGGCTNONE 
J100074N03TCGTGGGCTNONE 
J100077H11TCGTGGGCTNONE 
J100078G24TCGTGGGCTNONE 
J100089K09TCGTGGGCTNONE 
Os01g0913400AK099881AGCCCACGCProtein prenyltransferase domain containing protein. 
Os01g0924000004-020-C09AGCCCACGTNONE 
005-014-A06AGCCCACGTNONE 
009-085-G12AGCCCACGTNONE 
009-123-A08AGCCCACGTNONE 
009-134-A05AGCCCACGTNONE 
009-137-F06AGCCCACGTNONE 
016-016-B08AGCCCACGTNONE 
AF050674AGCCCACGTNONE 
AK061690AGCCCACGTSimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797AGCCCACGTNONE 
J013040A15AGCCCACGTNONE 
J013104L20AGCCCACGTNONE 
J013127E12AGCCCACGTNONE 
J013158O05AGCCCACGTNONE 
J023012E09AGCCCACGTNONE 
J023126L23AGCCCACGTNONE 
J023143B03AGCCCACGTNONE 
J065005B16AGCCCACGTNONE 
J065101J15AGCCCACGTNONE 
J065105K16AGCCCACGTNONE 
J065155K16AGCCCACGTNONE 
J065171M17AGCCCACGTNONE 
J065182F07AGCCCACGTNONE 
J065187D10AGCCCACGTNONE 
J065194I24AGCCCACGTNONE 
J065207E24AGCCCACGTNONE 
J075001C24AGCCCACGTNONE 
J075090O10AGCCCACGTNONE 
J075095H17AGCCCACGTNONE 
J075109M24AGCCCACGTNONE 
J075123C18AGCCCACGTNONE 
J075148G22AGCCCACGTNONE 
J090009B09AGCCCACGTNONE 
J090075K17AGCCCACGTNONE 
J090081H23AGCCCACGTNONE 
J090097H21AGCCCACGTNONE 
J100063P14AGCCCACGTNONE 
Os01g0935700AK069403AAAGCCCACGTSimilar to Cytochrome c1 (Fragment). 
AK073125AAAGCCCACGTNONE 
J023013M20AAAGCCCACGTNONE 
Os01g0951800AK069239TCGTGGGCTTAProtein prenyltransferase domain containing protein. 
Os02g0121000AK099931CGCGTGGGCTTTGTTGGGCCCCSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0200900J090088F16CCGTGGGCTTCNONE 
Os02g0208900003-126-D10ACAGCCCACGTNONE 
AK066171ACAGCCCACGTNONE 
AK070031ACAGCCCACGTNONE 
AK121183ACAGCCCACGTSimilar to ZIGA2 protein (Fragment). 
J013031N09ACAGCCCACGTNONE 
J013045O19ACAGCCCACGTNONE 
J023102A14ACAGCCCACGTNONE 
J023145E14ACAGCCCACGTNONE 
J033033E15ACAGCCCACGTNONE 
J033041H19ACAGCCCACGTNONE 
J033050E09ACAGCCCACGTNONE 
J065191H21ACAGCCCACGTNONE 
J065193C21ACAGCCCACGTNONE 
J075068F07ACAGCCCACGTNONE 
Os02g0288100AK107019AGCCCAGCCCACGCGSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
Os02g0445600009-183-B02AGCCCACGCNONE 
AK063150AGCCCACGCSimilar to Auxin-induced SAUR-like protein (Fragment). 
Os02g0478700AK099723AAGGCCCAGCCCACGGGRibosomal protein S27. 
J013089A06AAGGCCCAGCCCACGGGNONE 
J065068E01AAGGCCCAGCCCACGGGNONE 
J065217F15AAGGCCCAGCCCACGGGNONE 
Os02g0517333AK105573GCAGCCCACGANONE 
AK111331GCAGCCCACGAConserved hypothetical protein. 
Os02g0543200AK100963AAAAGCCCACGCGCyclin-like F-box domain containing protein. 
Os02g0610700014-008-A03TAAGCCCACGTAGGCCCAAACNONE 
AK059205TAAGCCCACGTAGGCCCAAACConserved hypothetical protein. 
AK100281TAAGCCCACGTAGGCCCAAACNONE 
J023074H03TAAGCCCACGTAGGCCCAAACNONE 
J065002J16TAAGCCCACGTAGGCCCAAACNONE 
J065032I20TAAGCCCACGTAGGCCCAAACNONE 
J065076A07TAAGCCCACGTAGGCCCAAACNONE 
J065142O21TAAGCCCACGTAGGCCCAAACNONE 
J065203A03TAAGCCCACGTAGGCCCAAACNONE 
J075017F24TAAGCCCACGTAGGCCCAAACNONE 
J075017G24TAAGCCCACGTAGGCCCAAACNONE 
Os02g0616100006-043-E12GAAGCCCACGGNONE 
006-043-G11GAAGCCCACGGNONE 
006-053-C05GAAGCCCACGGNONE 
006-059-C04GAAGCCCACGGNONE 
006-068-F02GAAGCCCACGGNONE 
006-071-B10GAAGCCCACGGNONE 
006-084-A03GAAGCCCACGGNONE 
006-086-F07GAAGCCCACGGNONE 
006-105-B05GAAGCCCACGGNONE 
006-109-A06GAAGCCCACGGNONE 
009-105-B10GAAGCCCACGGNONE 
009-153-H09GAAGCCCACGGNONE 
AK060972GAAGCCCACGGConserved hypothetical protein. 
AK104643GAAGCCCACGGNONE 
J075074K09GAAGCCCACGGNONE 
Os02g0655300006-024-H05GCAGCCCACGANONE 
006-032-G04GCAGCCCACGANONE 
006-045-F03GCAGCCCACGANONE 
006-076-D04GCAGCCCACGANONE 
006-086-C09GCAGCCCACGANONE 
006-104-C07GCAGCCCACGANONE 
AK061544GCAGCCCACGANONE 
AK103778GCAGCCCACGANONE 
AK106107GCAGCCCACGANONE 
AK120006GCAGCCCACGANONE 
AY363174GCAGCCCACGASimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21GCAGCCCACGANONE 
J065021C16GCAGCCCACGANONE 
J065182F01GCAGCCCACGANONE 
J075063I18GCAGCCCACGANONE 
J075151E01GCAGCCCACGANONE 
J075198K18GCAGCCCACGANONE 
J090026M06GCAGCCCACGANONE 
J090081H02GCAGCCCACGANONE 
J100061E20GCAGCCCACGANONE 
Os02g0668500006-056-A05CCAGCCCACGCNONE 
AK060958CCAGCCCACGCNONE 
AK071867CCAGCCCACGCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15CCAGCCCACGCNONE 
J065013J03CCAGCCCACGCNONE 
J065021P16CCAGCCCACGCNONE 
J065044B07CCAGCCCACGCNONE 
J065059E23CCAGCCCACGCNONE 
J065087N20CCAGCCCACGCNONE 
J065185I04CCAGCCCACGCNONE 
J065190G19CCAGCCCACGCNONE 
J065199C15CCAGCCCACGCNONE 
J065213L12CCAGCCCACGCNONE 
J080305C01CCAGCCCACGCNONE 
J080308C07CCAGCCCACGCNONE 
J080310F02CCAGCCCACGCNONE 
Os02g0681100AK100584GAAGCCCACGAAProtein of unknown function DUF604 family protein. 
J023106A15GAAGCCCACGAANONE 
Os02g0681200006-024-F11CCAAGCCCACGACCCGCACCGCNONE 
006-051-H06CCAAGCCCACGACCCGCACCGCNONE 
006-062-F08CCAAGCCCACGACCCGCACCGCNONE 
009-172-G01CCAAGCCCACGACCCGCACCGCNONE 
AK071853CCAAGCCCACGACCCGCACCGCZinc finger, RING-type domain containing protein. 
AK099314CCAAGCCCACGACCCGCACCGCNONE 
AK104122CCAAGCCCACGACCCGCACCGCNONE 
Os02g0744000AK064898AGCCCACGGGConserved hypothetical protein. 
AK104827AGCCCACGGGNONE 
J013000L12AGCCCACGGGNONE 
J013156N02AGCCCACGGGNONE 
J065001H14AGCCCACGGGNONE 
J065038D18AGCCCACGGGNONE 
J065039I18AGCCCACGGGNONE 
J065047C13AGCCCACGGGNONE 
J065053J09AGCCCACGGGNONE 
J065064G03AGCCCACGGGNONE 
J065066M05AGCCCACGGGNONE 
J065068O10AGCCCACGGGNONE 
J065090H22AGCCCACGGGNONE 
J065113L19AGCCCACGGGNONE 
J065121M02AGCCCACGGGNONE 
J065122K23AGCCCACGGGNONE 
J065138C12AGCCCACGGGNONE 
J065153E14AGCCCACGGGNONE 
J065156N12AGCCCACGGGNONE 
J065158L20AGCCCACGGGNONE 
J065166I06AGCCCACGGGNONE 
J065174L15AGCCCACGGGNONE 
J065175N03AGCCCACGGGNONE 
J090092C23AGCCCACGGGNONE 
Os02g0744700AF395537AGCCCACGANONE 
AJ308110AGCCCACGANONE 
AK066446AGCCCACGASimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0753300012-010-H04AGCCCACGANONE 
AK065736AGCCCACGALipoxygenase, LH2 domain containing protein. 
AK104930AGCCCACGANONE 
J013038J04AGCCCACGANONE 
J065041B21AGCCCACGANONE 
J065162K13AGCCCACGANONE 
J065187G18AGCCCACGANONE 
J075051J11AGCCCACGANONE 
J100027H02AGCCCACGANONE 
Os02g0754500AK069965AGCCCATGACAAGCCCACGGNONE 
AK105696AGCCCATGACAAGCCCACGGAmidase family protein. 
Os02g0802400J065054M13GAAGCCCACGTNONE 
J065061I04GAAGCCCACGTNONE 
J065112M15GAAGCCCACGTEF-Hand type domain containing protein. 
J100050L24GAAGCCCACGTNONE 
J100059D20GAAGCCCACGTNONE 
Os02g0805900AK073740AGCCCACGGCCCACCTDcp2, box A domain containing protein. 
J013068E03AGCCCACGGCCCACCTNONE 
J033066K03AGCCCACGGCCCACCTNONE 
J033092C14AGCCCACGGCCCACCTNONE 
J065020G11AGCCCACGGCCCACCTNONE 
J065098E16AGCCCACGGCCCACCTNONE 
J065124L06AGCCCACGGCCCACCTNONE 
J065134M23AGCCCACGGCCCACCTNONE 
J065187M23AGCCCACGGCCCACCTNONE 
J065208G07AGCCCACGGCCCACCTNONE 
J075002G10AGCCCACGGCCCACCTNONE 
J075004L01AGCCCACGGCCCACCTNONE 
J075051K23AGCCCACGGCCCACCTNONE 
J090063C03AGCCCACGGCCCACCTNONE 
J090071J21AGCCCACGGCCCACCTNONE 
J100078K12AGCCCACGGCCCACCTNONE 
Os02g0806000AK072745AGGTGGGCCGTGGGCTGCN5-related N-acetyltransferase domain containing protein. 
J013130C06AGGTGGGCCGTGGGCTNONE 
J013154L12AGGTGGGCCGTGGGCTNONE 
J023135J07AGGTGGGCCGTGGGCTNONE 
J065038E23AGGTGGGCCGTGGGCTNONE 
J065042C10AGGTGGGCCGTGGGCTNONE 
J090075B11AGGTGGGCCGTGGGCTNONE 
J100033J17AGGTGGGCCGTGGGCTNONE 
Os02g0815300AK061607ACGTGGGCTConserved hypothetical protein. 
J075088I01ACGTGGGCTNONE 
Os02g0829900009-044-G07GCGTGGGCTNONE 
AK120917GCGTGGGCTSimilar to BRICK1. 
AY224582GCGTGGGCTNONE 
J023034L01GCGTGGGCTNONE 
J023034M01GCGTGGGCTNONE 
J090010G06GCGTGGGCTNONE 
J090020D07GCGTGGGCTNONE 
J100041L04GCGTGGGCTNONE 
J100061D05GCGTGGGCTNONE 
J100070L18GCGTGGGCTNONE 
Os02g0830000011-075-D11AGCCCACGCNONE 
AK101841AGCCCACGCProtein prenyltransferase domain containing protein. 
J033069G13AGCCCACGCNONE 
Os03g0124300AK069148AAAAGCCCACGCConserved hypothetical protein. 
AK106076AAAAGCCCACGCNONE 
J023003G19AAAAGCCCACGCNONE 
Os03g0127000AK068479TAGGCCCAGCAAAGCCCACGTConserved hypothetical protein. 
J013152D10TAGGCCCAGCAAAGCCCACGTNONE 
J075167I20TAGGCCCAGCAAAGCCCACGTNONE 
J090067O04TAGGCCCAGCAAAGCCCACGTNONE 
Os03g0137500006-040-G01ACAGCCCACGTNONE 
015-054-G04ACAGCCCACGTNONE 
AK060148ACAGCCCACGTNONE 
AK073584ACAGCCCACGTNONE 
AK100231ACAGCCCACGTSimilar to VDAC3.1. 
J013146L24ACAGCCCACGTNONE 
J023022O09ACAGCCCACGTNONE 
J023049J19ACAGCCCACGTNONE 
J023133L05ACAGCCCACGTNONE 
J023143P12ACAGCCCACGTNONE 
J033040B12ACAGCCCACGTNONE 
J033050O14ACAGCCCACGTNONE 
J033066G05ACAGCCCACGTNONE 
J065007J18ACAGCCCACGTNONE 
J100067H13ACAGCCCACGTNONE 
Os03g0141200AK068968AGCCCACGCGTCGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092AGCCCACGCGTCGCGNONE 
J023003L18AGCCCACGCGTCGCGNONE 
J023022K18AGCCCACGCGTCGCGNONE 
J023107H13AGCCCACGCGTCGCGNONE 
J023107K02AGCCCACGCGTCGCGNONE 
Os03g0146300011-078-E08CCAGCCCACGCCACNONE 
014-009-B07CCAGCCCACGCCACNONE 
AK121395CCAGCCCACGCCACSimilar to Cyclin-dependent kinases regulatory subunit. 
AY583319CCAGCCCACGCCACNONE 
J013104I06CCAGCCCACGCCACNONE 
J023130M16CCAGCCCACGCCACNONE 
J053037E13CCAGCCCACGCCACNONE 
J075104M08CCAGCCCACGCCACNONE 
J075144I22CCAGCCCACGCCACNONE 
J100057B09CCAGCCCACGCCACNONE 
Os03g0189400AK067720TCAGCCCACGTSimilar to Alcohol dehydrogenase ADH. 
J043012M09TCAGCCCACGTNONE 
J043026L22TCAGCCCACGTNONE 
J075115C06TCAGCCCACGTNONE 
J100056M03TCAGCCCACGTNONE 
J100064I05TCAGCCCACGTNONE 
Os03g0295500009-083-F02AAAAGCCCACGAANONE 
J053029J05AAAAGCCCACGAANONE 
J053054B07AAAAGCCCACGAACHCH domain containing protein. 
J065024G23AAAAGCCCACGAANONE 
J065036F08AAAAGCCCACGAANONE 
J065066M11AAAAGCCCACGAANONE 
J065143G19AAAAGCCCACGAANONE 
Os03g0299900AK069075CGCGTGGGCTGCSimilar to Plastid aminotransferase (Fragment). 
AK069075TCAGCCCACGGSimilar to Plastid aminotransferase (Fragment). 
AY338235CGCGTGGGCTGCNONE 
AY338235TCAGCCCACGGNONE 
J053077F07CGCGTGGGCTGCNONE 
J053077F07TCAGCCCACGGNONE 
Os03g0300600003-125-G06AAAGCCCACGCNONE 
006-048-C04AAAGCCCACGCNONE 
009-044-A09AAAGCCCACGCNONE 
AK059801AAAGCCCACGCNONE 
AK066250AAAGCCCACGCSimilar to Chaperone protein dnaJ. 
AK069897AAAGCCCACGCNONE 
AK104186AAAGCCCACGCNONE 
J065197D15AAAGCCCACGCNONE 
J090031C11AAAGCCCACGCNONE 
J100024C23AAAGCCCACGCNONE 
J100030B16AAAGCCCACGCNONE 
J100033K12AAAGCCCACGCNONE 
J100043M19AAAGCCCACGCNONE 
J100056N09AAAGCCCACGCNONE 
J100058E12AAAGCCCACGCNONE 
J100084J08AAAGCCCACGCNONE 
Os03g0372900AK100417GAAGCCCACGGGCyclin-like F-box domain containing protein. 
Os03g0421400J075194I21AAAGCCCACGTNONE 
Os03g0438000AK119977GCAGCCCACGGConserved hypothetical protein. 
Os03g0438400AK070383GCTCAGCTCGTGGGCTCGGCTCGGCTCGGConserved hypothetical protein. 
J023054E02GCTCAGCTCGTGGGCTCGGCTCGGCTCGGNONE 
Os03g0567100AK109220CTCGCGCGCCGCGTGGGCTGTATGGGCCAGConserved hypothetical protein. 
Os03g0574300AK072541CCAAGCCCACGGCCHypothetical protein. 
J023134M10CCAAGCCCACGGCCNONE 
Os03g0588700Os03g0588700GCAGCCCACGCGConserved hypothetical protein. 
Os03g0596800AK073603TCGTGGGCTGGConserved hypothetical protein. 
J033052N01TCGTGGGCTGGNONE 
Os03g0668400AK119454AGCCCACGATGGCCCAGGCCCAGGCCCAGGProtein of unknown function DUF860, plant family protein. 
Os03g0685700AK066043CCGTGGGCTGTProtein prenyltransferase domain containing protein. 
J013048F08CCGTGGGCTGTNONE 
Os03g0739700003-104-A04TTCGTGGGCTTTNONE 
AK062272TTCGTGGGCTTTUncharacterized protein UPF0114 family protein. 
Os03g0752800AB041020TCGGCCCAGAAAAGCCCACGANONE 
AF058697TCGGCCCAGAAAAGCCCACGAMADS14 protein. 
AF139664TCGGCCCAGAAAAGCCCACGANONE 
AK121171TCGGCCCAGAAAAGCCCACGANONE 
AY332478TCGGCCCAGAAAAGCCCACGANONE 
AY551916TCGGCCCAGAAAAGCCCACGANONE 
J023081C04TCGGCCCAGAAAAGCCCACGANONE 
Os03g0772800009-023-E05AAAGCCCACGAANONE 
009-059-F12AAAGCCCACGAANONE 
009-114-B08AAAGCCCACGAANONE 
009-115-G09AAAGCCCACGAANONE 
009-151-D08AAAGCCCACGAANONE 
009-158-A10AAAGCCCACGAANONE 
009-191-H02AAAGCCCACGAANONE 
009-192-E05AAAGCCCACGAANONE 
009-197-F11AAAGCCCACGAANONE 
AK059576AAAGCCCACGAANONE 
AK121608AAAGCCCACGAACytochrome c oxidase, subunit VIa family protein. 
J023087H20AAAGCCCACGAANONE 
J023105P14AAAGCCCACGAANONE 
J033026P15AAAGCCCACGAANONE 
J033042K10AAAGCCCACGAANONE 
J033133C09AAAGCCCACGAANONE 
J065123K13AAAGCCCACGAANONE 
J075190D03AAAGCCCACGAANONE 
J080310M14AAAGCCCACGAANONE 
J080317L14AAAGCCCACGAANONE 
J100067J19AAAGCCCACGAANONE 
J100079H21AAAGCCCACGAANONE 
Os03g0843500AK067985CGGGCCCAGCCCACGCNONE 
AK101661CGGGCCCAGCCCACGCSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454CGGGCCCAGCCCACGCNONE 
J080302L23CGGGCCCAGCCCACGCNONE 
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein. 
AK072577CCGTGGGCCGCACGTGGGCTTTTNONE 
AK099773CCGTGGGCCGCACGTGGGCTTTTNONE 
J013030L03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013042D23CCGTGGGCCGCACGTGGGCTTTTNONE 
J013050E17CCGTGGGCCGCACGTGGGCTTTTNONE 
J013051J21CCGTGGGCCGCACGTGGGCTTTTNONE 
J013055L09CCGTGGGCCGCACGTGGGCTTTTNONE 
J013064A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013095E06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013111A06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013118K01CCGTGGGCCGCACGTGGGCTTTTNONE 
J013119A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013134F07CCGTGGGCCGCACGTGGGCTTTTNONE 
J033132N23CCGTGGGCCGCACGTGGGCTTTTNONE 
Os04g0208400AK069629CCAGCCCACGTGCyclin-like F-box domain containing protein. 
Os04g0390500AK066575ACAGCCCACGAANONE 
AK099908ACAGCCCACGAANONE 
AK100148ACAGCCCACGAANONE 
Os04g0406600AK103609CCCAGCCCACGCPrephenate dehydratase domain containing protein. 
J033133I10CCCAGCCCACGCNONE 
J075092D11CCCAGCCCACGCNONE 
J100031M09CCCAGCCCACGCNONE 
Os04g0428500AK109932CGCGTGGGCTGTCGGACGGConserved hypothetical protein. 
Os04g0479300AK106088AGCCCACGTGTConserved hypothetical protein. 
Os04g0552400AK069623TTCGTGGGCTGGSimilar to ZPT2-13. 
J023023M18TTCGTGGGCTGGNONE 
J023063H11TTCGTGGGCTGGNONE 
Os04g0562000006-096-A05GCAGCCCACGGGNONE 
006-105-B08GCAGCCCACGGGNONE 
AK060894GCAGCCCACGGGNONE 
AK072630GCAGCCCACGGGZinc finger, DHHC-type domain containing protein. 
AK104521GCAGCCCACGGGNONE 
J023038A11GCAGCCCACGGGNONE 
J023130P03GCAGCCCACGGGNONE 
J090006F10GCAGCCCACGGGNONE 
J090007M22GCAGCCCACGGGNONE 
Os04g0595000AK106907TTTTGGGCCGTGGGCTPeptidase A1, pepsin family protein. 
Os04g0672100AK121689GCAGCCCACGAASimilar to Phytosulfokine receptor precursor (EC 2.7.1.37) (Phytosulfokine LRR receptor kinase). 
J033057E18GCAGCCCACGAANONE 
J033071C20GCAGCCCACGAANONE 
J033107C06GCAGCCCACGAANONE 
J090033H05GCAGCCCACGAANONE 
J090036E04GCAGCCCACGAANONE 
J090082J15GCAGCCCACGAANONE 
Os05g0214900006-070-A10GCGTGGGCTGCNONE 
AK061081GCGTGGGCTGCConserved hypothetical protein. 
Os05g0364300009-036-C07TTCGTGGGCTGTNONE 
AK062440TTCGTGGGCTGTConserved hypothetical protein. 
Os05g0399300AK108949TCCGACGGCGTGGGCTNONE 
Os05g0477300009-016-A12ATTGGGCCTCCAGCCCACGANONE 
009-029-B06ATTGGGCCTCCAGCCCACGANONE 
009-166-G04ATTGGGCCTCCAGCCCACGANONE 
013-016-C08ATTGGGCCTCCAGCCCACGANONE 
016-091-E10ATTGGGCCTCCAGCCCACGANONE 
AK061933ATTGGGCCTCCAGCCCACGANONE 
AK098982ATTGGGCCTCCAGCCCACGANONE 
AK119683ATTGGGCCTCCAGCCCACGANONE 
AK119693ATTGGGCCTCCAGCCCACGANONE 
AK119797ATTGGGCCTCCAGCCCACGANONE 
AK121584ATTGGGCCTCCAGCCCACGARibosomal protein S26E family protein. 
J013063C18ATTGGGCCTCCAGCCCACGANONE 
J013129B12ATTGGGCCTCCAGCCCACGANONE 
J013152K23ATTGGGCCTCCAGCCCACGANONE 
J023013K21ATTGGGCCTCCAGCCCACGANONE 
J023077O13ATTGGGCCTCCAGCCCACGANONE 
J023085D23ATTGGGCCTCCAGCCCACGANONE 
J033029G14ATTGGGCCTCCAGCCCACGANONE 
J033037F24ATTGGGCCTCCAGCCCACGANONE 
J033040H08ATTGGGCCTCCAGCCCACGANONE 
J033064J24ATTGGGCCTCCAGCCCACGANONE 
J033085C06ATTGGGCCTCCAGCCCACGANONE 
J033123P10ATTGGGCCTCCAGCCCACGANONE 
J033127K23ATTGGGCCTCCAGCCCACGANONE 
J033147D24ATTGGGCCTCCAGCCCACGANONE 
J075064E05ATTGGGCCTCCAGCCCACGANONE 
J090026B03ATTGGGCCTCCAGCCCACGANONE 
J100050M11ATTGGGCCTCCAGCCCACGANONE 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
Os05g0565000AK102673GAAGCCCACGGCCCATTASimilar to 60S ribosomal protein L18a-1. 
J033102C12GAAGCCCACGGCCCATTANONE 
J033124C13GAAGCCCACGGCCCATTANONE 
J043003L04GAAGCCCACGGCCCATTANONE 
J043006N08GAAGCCCACGGCCCATTANONE 
Os06g0147600AK107817ACGTGGGCTGTConserved hypothetical protein. 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0214300AK108107TCGTGGGCTEsterase/lipase/thioesterase domain containing protein. 
Os06g0219600AK060429CAACGGCCCACAGCCCACGGSimilar to Poly(A)-binding protein II-like. 
AK099019CAACGGCCCACAGCCCACGGNONE 
J013118A14CAACGGCCCACAGCCCACGGNONE 
Os06g0309000AK121021ACGTGGGCTTTTZinc finger, FYVE/PHD-type domain containing protein. 
Os06g0506600009-119-E12TCGTGGGCTNONE 
J023086A18TCGTGGGCTNONE 
J033036I02TCGTGGGCTNONE 
J033125C16TCGTGGGCTNONE 
J065013I11TCGTGGGCTNONE 
J065026O21TCGTGGGCTNONE 
J065060H10TCGTGGGCTNONE 
J065067A15TCGTGGGCTNONE 
J065068F07TCGTGGGCTNONE 
J065085N06TCGTGGGCTNONE 
J065108N10TCGTGGGCTNONE 
J065161O11TCGTGGGCTNONE 
J065185J15TCGTGGGCTNONE 
J065191H18TCGTGGGCTNONE 
J065199J09TCGTGGGCTNONE 
J075005G03TCGTGGGCTNONE 
J075018C16TCGTGGGCTNONE 
J075061K20TCGTGGGCTNONE 
J075069J06TCGTGGGCTNONE 
J075075H19TCGTGGGCTNONE 
J075076D20TCGTGGGCTNONE 
J075078D16TCGTGGGCTNONE 
J075100J19TCGTGGGCTNONE 
J075110M11TCGTGGGCTNONE 
J075157N05TCGTGGGCTNONE 
J075171F20TCGTGGGCTNONE 
J075177G08TCGTGGGCTNONE 
J075179G08TCGTGGGCTNONE 
Os06g0550800J065058J22AGCCCACGAConserved hypothetical protein. 
Os06g0573700015-015-F02AGCCCACGCNONE 
AK106254AGCCCACGCConserved hypothetical protein. 
J065172G24AGCCCACGCNONE 
Os06g0600100AK065619AAAAGCCCACGAAGCCCAACASimilar to TAT-binding protein homolog (Fragment). 
Os06g0603600012-088-B11AGCCCACGANONE 
AK063544AGCCCACGANONE 
AK072067AGCCCACGASimilar to Ids4-like protein. 
J065011H14AGCCCACGANONE 
J065020D09AGCCCACGANONE 
J065130O10AGCCCACGANONE 
J065132J07AGCCCACGANONE 
J075015L15AGCCCACGANONE 
J090091K07AGCCCACGANONE 
Os06g0683400009-047-C07CCAGCCCACGCCCAACTNONE 
009-060-B06CCAGCCCACGCCCAACTNONE 
013-057-F12CCAGCCCACGCCCAACTNONE 
AK111852CCAGCCCACGCCCAACTNONE 
AK111897CCAGCCCACGCCCAACTNONE 
AK112082CCAGCCCACGCCCAACTSimilar to EF-hand Ca2+-binding protein CCD1. 
J065104C07CCAGCCCACGCCCAACTNONE 
J065187J11CCAGCCCACGCCCAACTNONE 
J065197L08CCAGCCCACGCCCAACTNONE 
J100045K14CCAGCCCACGCCCAACTNONE 
J100074M08CCAGCCCACGCCCAACTNONE 
J100088H21CCAGCCCACGCCCAACTNONE 
Os06g0709300AK108588ACGTGGGCTTGFAR1 domain containing protein. 
Os07g0100200006-022-D06AAAGCCCACGGNONE 
011-025-B06AAAGCCCACGGNONE 
012-069-A07AAAGCCCACGGNONE 
AK060986AAAGCCCACGGNONE 
AK073305AAAGCCCACGGSimilar to PDX1-like protein 4. 
J023055C05AAAGCCCACGGNONE 
J033024J11AAAGCCCACGGNONE 
J065045F14AAAGCCCACGGNONE 
J075097C22AAAGCCCACGGNONE 
Os07g0147600AK099551ACAGCCCACGCNONE 
AK102834ACAGCCCACGCProtein kinase-like domain containing protein. 
J090004P22ACAGCCCACGCNONE 
J090040K07ACAGCCCACGCNONE 
J090044I03ACAGCCCACGCNONE 
J090060I04ACAGCCCACGCNONE 
J090063O16ACAGCCCACGCNONE 
J090072C03ACAGCCCACGCNONE 
J090072E05ACAGCCCACGCNONE 
J090091P08ACAGCCCACGCNONE 
J090099P14ACAGCCCACGCNONE 
Os07g0166800006-038-C11TCGTGGGCTNONE 
012-080-F02TCGTGGGCTNONE 
AK070524TCGTGGGCTRad6 (Ubiquitin carrier protein). 
AK121382TCGTGGGCTNONE 
J023022D19TCGTGGGCTNONE 
J023055G02TCGTGGGCTNONE 
J023073E02TCGTGGGCTNONE 
J023125B08TCGTGGGCTNONE 
J023127H21TCGTGGGCTNONE 
J033052G01TCGTGGGCTNONE 
J033067F13TCGTGGGCTNONE 
J065046L14TCGTGGGCTNONE 
J065178D11TCGTGGGCTNONE 
J065205N17TCGTGGGCTNONE 
J075006K17TCGTGGGCTNONE 
J075051D20TCGTGGGCTNONE 
J075109L04TCGTGGGCTNONE 
J090024K15TCGTGGGCTNONE 
J090025N04TCGTGGGCTNONE 
J090049N09TCGTGGGCTNONE 
J090070N12TCGTGGGCTNONE 
J090078O21TCGTGGGCTNONE 
J090083L07TCGTGGGCTNONE 
J100063K16TCGTGGGCTNONE 
J100083D14TCGTGGGCTNONE 
Os07g0190600AK070975AGCCCACGTGSimilar to Helicase. 
Os07g0194500AK121816CCGTGGGCTProlyl 4-hydroxylase, alpha subunit domain containing protein. 
J033098K22CCGTGGGCTNONE 
Os07g0272800AK107279GTTTGGGCCAAGCCCACGAAHypothetical protein. 
J065124H15GTTTGGGCCAAGCCCACGAANONE 
Os07g0296900J075050I18CCAAGCCCACGAConserved hypothetical protein. 
Os07g0301200AB110202AGCCCACGTGNONE 
AK073463AGCCCACGTGSimilar to RNA helicase (Fragment). 
Os07g0472300AK070792CCGTGGGCTGAConserved hypothetical protein. 
J023007O06CCGTGGGCTGANONE 
J023041I11CCGTGGGCTGANONE 
J023065F23CCGTGGGCTGANONE 
Os07g0549200006-072-D03TCGTGGGCTNONE 
AK073657TCGTGGGCTNONE 
AK109365TCGTGGGCTProtein prenyltransferase domain containing protein. 
J033051K19TCGTGGGCTNONE 
J100084G13TCGTGGGCTNONE 
Os07g0561300AK072982ACGTGGGCTGCCyclin-like F-box domain containing protein. 
J023149I22ACGTGGGCTGCNONE 
J065149C18ACGTGGGCTGCNONE 
J065166N15ACGTGGGCTGCNONE 
J075011J01ACGTGGGCTGCNONE 
J075013I05ACGTGGGCTGCNONE 
J075039H11ACGTGGGCTGCNONE 
J075067J09ACGTGGGCTGCNONE 
J075084E08ACGTGGGCTGCNONE 
J075085E12ACGTGGGCTGCNONE 
J075090D11ACGTGGGCTGCNONE 
J075092D12ACGTGGGCTGCNONE 
J075126N17ACGTGGGCTGCNONE 
J075179F01ACGTGGGCTGCNONE 
J075184P21ACGTGGGCTGCNONE 
Os07g0570700AK065242AGTTGGGCCCAAGCCCACGTGRibosome recycling factor family protein. 
J013002I12AGTTGGGCCCAAGCCCACGTGNONE 
Os07g0574800006-097-G09CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
013-077-E02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
014-010-B04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK067721CCAGCCCAGCCCAGCCCACGGGCCGTGGTubulin alpha-1 chain. 
AK069140CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK104900CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013037J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013045O05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013056A21CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013119N24CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036H19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036K16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023067J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023075H08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023084K13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023097O10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033093K22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033105L08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J065219H05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075010N07CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075130I08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090014E16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090025K17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090030L19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090035J05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090036B17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090037A15CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090064C17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090069L18CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090073N11CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090077F23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090099F02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100029N06CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100056I04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100061A13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062B10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062J17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072F22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072J22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100076C03CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
X91808CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Z11931CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Os07g0583700AK070537CCCAGCCCACGCWRKY transcription factor 78. 
AY341850CCCAGCCCACGCNONE 
J013089A12CCCAGCCCACGCNONE 
J013118N13CCCAGCCCACGCNONE 
J023039L18CCCAGCCCACGCNONE 
J023062H03CCCAGCCCACGCNONE 
J100029J20CCCAGCCCACGCNONE 
Os07g0594400J065137M02ACGTGGGCTTGGGCCACGGGCCGAConserved hypothetical protein. 
J065218E03ACGTGGGCTTGGGCCACGGGCCGANONE 
Os07g0607200AK065746CCAAGCCCACGGCCCAACCProtein of unknown function DUF751 family protein. 
J065037B15CCAAGCCCACGGCCCAACCNONE 
J065042E20CCAAGCCCACGGCCCAACCNONE 
J065161I08CCAAGCCCACGGCCCAACCNONE 
Os07g0669000AK099431AGCCCACGGSimilar to Catalytic subunit of polymerase zeta. 
J065073M09AGCCCACGGNONE 
Os07g0695400015-036-B08ACGTGGGCTGCNONE 
AK100615ACGTGGGCTGCNONE 
AK106304ACGTGGGCTGCKIP1-like domain containing protein. 
J023108B01ACGTGGGCTGCNONE 
Os08g0101600AB074260TGTTGGGCCGGCGTGGGCTTGSingle-strand DNA endonuclease-1. 
AK102542TGTTGGGCCGGCGTGGGCTTGNONE 
Os08g0150800AK101530AGCCCACGTSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0195400006-057-E04CACGTGGGCTGGNONE 
006-060-B10CACGTGGGCTGGNONE 
AK070464CACGTGGGCTGGConserved hypothetical protein. 
AK104389CACGTGGGCTGGNONE 
AK106140CACGTGGGCTGGNONE 
J023013G08CACGTGGGCTGGNONE 
J023054K19CACGTGGGCTGGNONE 
J023089D18CACGTGGGCTGGNONE 
J023092K05CACGTGGGCTGGNONE 
J033025A08CACGTGGGCTGGNONE 
J033067P12CACGTGGGCTGGNONE 
J033098A10CACGTGGGCTGGNONE 
J065219L04CACGTGGGCTGGNONE 
J090021P06CACGTGGGCTGGNONE 
J090062M05CACGTGGGCTGGNONE 
J090079F15CACGTGGGCTGGNONE 
J100041H19CACGTGGGCTGGNONE 
Os08g0224200AK101331CACGTGGGCTGGSimilar to Ythdf2-prov protein. 
Os08g0300700AK101762AGCCCACGGProtein prenyltransferase domain containing protein. 
Os08g0319900AK108030GCGTGGGCTGGPutative cyclase family protein. 
Os08g0387500AK105106TCGTGGGCTSimilar to Sulfated surface glycoprotein 185 precursor (SSG 185). 
Os08g0414300AK072217GCAGCCCACGAConserved hypothetical protein. 
J065039C07GCAGCCCACGANONE 
J065098N11GCAGCCCACGANONE 
J065120J15GCAGCCCACGANONE 
J075076H12GCAGCCCACGANONE 
J075101N16GCAGCCCACGANONE 
J080010A07GCAGCCCACGANONE 
J080023C16GCAGCCCACGANONE 
J080027G22GCAGCCCACGANONE 
J080053D02GCAGCCCACGANONE 
J080065E17GCAGCCCACGANONE 
J080068C15GCAGCCCACGANONE 
J090061J10GCAGCCCACGANONE 
Os08g0416000AF145729TAAGCCCACGCHomeodomain leucine zipper protein. 
AK100634TAAGCCCACGCNONE 
AK101569TAAGCCCACGCNONE 
AK110561TAAGCCCACGCNONE 
J013074A01TAAGCCCACGCNONE 
J013159K22TAAGCCCACGCNONE 
J023028M01TAAGCCCACGCNONE 
J023033C15TAAGCCCACGCNONE 
J023107N23TAAGCCCACGCNONE 
J023110A12TAAGCCCACGCNONE 
J023122D02TAAGCCCACGCNONE 
J033050G15TAAGCCCACGCNONE 
J033107D17TAAGCCCACGCNONE 
J065082J21TAAGCCCACGCNONE 
J065165L21TAAGCCCACGCNONE 
J065171J17TAAGCCCACGCNONE 
J100026K13TAAGCCCACGCNONE 
J100039E16TAAGCCCACGCNONE 
J100056J11TAAGCCCACGCNONE 
J100070I19TAAGCCCACGCNONE 
J100073B16TAAGCCCACGCNONE 
J100081M19TAAGCCCACGCNONE 
J100088E09TAAGCCCACGCNONE 
Os08g0441400011-033-F01AGCCCACGGNONE 
015-084-B04AGCCCACGGNONE 
AK063317AGCCCACGGNONE 
AK064141AGCCCACGGConserved hypothetical protein. 
J065060F06AGCCCACGGNONE 
J075110A22AGCCCACGGNONE 
J080307P11AGCCCACGGNONE 
J090041E06AGCCCACGGNONE 
Os08g0480400J065154C22TAAGCCCACGGNONE 
J065214F15TAAGCCCACGGProtein of unknown function DUF1637 family protein. 
Os09g0293900Os09g0293900AAAGCCCAGCCCACGAAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0293900AGCCCACGAAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0324300AK109691TTATGGGCCGCCGTGGGCTTTCyclin-like F-box domain containing protein. 
Os09g0450200AK068872AGCCCACGGGConserved hypothetical protein. 
J065013B14AGCCCACGGGNONE 
J065034F17AGCCCACGGGNONE 
J065039K11AGCCCACGGGNONE 
J065093N22AGCCCACGGGNONE 
J075034N13AGCCCACGGGNONE 
J075110O14AGCCCACGGGNONE 
J075122H04AGCCCACGGGNONE 
J075147B13AGCCCACGGGNONE 
J075149A02AGCCCACGGGNONE 
J075195L14AGCCCACGGGNONE 
Os09g0458400AK070055AGTTGGGCAGCCCACGAAConserved hypothetical protein. 
AK120321AGTTGGGCAGCCCACGAANONE 
J065064N11AGTTGGGCAGCCCACGAANONE 
J065083J06AGTTGGGCAGCCCACGAANONE 
J065121D24AGTTGGGCAGCCCACGAANONE 
J065156I22AGTTGGGCAGCCCACGAANONE 
J065163J24AGTTGGGCAGCCCACGAANONE 
J075001I02AGTTGGGCAGCCCACGAANONE 
J090088O06AGTTGGGCAGCCCACGAANONE 
Os09g0533900003-104-E05AAAGCCCACGCGAGCCCATCCNONE 
012-076-C03AAAGCCCACGCGAGCCCATCCNONE 
AK067774AAAGCCCACGCGAGCCCATCCNONE 
AK100449AAAGCCCACGCGAGCCCATCCSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07AAAGCCCACGCGAGCCCATCCNONE 
J023026E11AAAGCCCACGCGAGCCCATCCNONE 
J023028B20AAAGCCCACGCGAGCCCATCCNONE 
J023050P11AAAGCCCACGCGAGCCCATCCNONE 
J023052K08AAAGCCCACGCGAGCCCATCCNONE 
J023075J03AAAGCCCACGCGAGCCCATCCNONE 
J023078E15AAAGCCCACGCGAGCCCATCCNONE 
J023090P12AAAGCCCACGCGAGCCCATCCNONE 
J023120E01AAAGCCCACGCGAGCCCATCCNONE 
J023142K01AAAGCCCACGCGAGCCCATCCNONE 
J033027K23AAAGCCCACGCGAGCCCATCCNONE 
J033058A09AAAGCCCACGCGAGCCCATCCNONE 
J033058C12AAAGCCCACGCGAGCCCATCCNONE 
J033125A04AAAGCCCACGCGAGCCCATCCNONE 
J043040L01AAAGCCCACGCGAGCCCATCCNONE 
J053061D06AAAGCCCACGCGAGCCCATCCNONE 
J053096N13AAAGCCCACGCGAGCCCATCCNONE 
J065193H10AAAGCCCACGCGAGCCCATCCNONE 
J090075L17AAAGCCCACGCGAGCCCATCCNONE 
J100050D10AAAGCCCACGCGAGCCCATCCNONE 
Os09g0554000J065123C23AGCCCACGAASimilar to Mitochondrial phosphate transporter. 
Os11g0114700AK065865AAAAGCCCACGANONE 
AK066583AAAAGCCCACGANONE 
AK070834AAAAGCCCACGAPAP/25A core domain containing protein. 
AK072543AAAAGCCCACGANONE 
Os11g0137500AK070070CGCGTGGGCTGATranscription factor TFIIE, alpha subunit family protein. 
Os11g0139500AK121845TCGTGGGCTGTATATGGGCTGANONE 
Os11g0219400AK069850CCCGTGGGCTGGAnkyrin repeat containing protein. 
AK099123CCCGTGGGCTGGNONE 
J023143G18CCCGTGGGCTGGNONE 
Os11g0303200J023135L01GCGTGGGCTGGNONE 
J075074O21GCGTGGGCTGGNONE 
Os11g0481600AK109900GAAGCCCACGGConserved hypothetical protein. 
Os11g0488600AK111309CACGGCCCAGCCCACGAConserved hypothetical protein. 
J075011H20CACGGCCCAGCCCACGANONE 
J075068E17CACGGCCCAGCCCACGANONE 
J075102G16CACGGCCCAGCCCACGANONE 
Os11g0530600AB000801AGCCCACGTGGCSimilar to Chalcone synthase C2 (EC 2.3.1.74) (Naringenin-chalcone synthase C2). 
AK067810AGCCCACGTGGCNONE 
D29697AGCCCACGTGGCNONE 
J013119K06AGCCCACGTGGCNONE 
J023001C21AGCCCACGTGGCNONE 
J023081C19AGCCCACGTGGCNONE 
J065026K21AGCCCACGTGGCNONE 
J065040A17AGCCCACGTGGCNONE 
J065043H01AGCCCACGTGGCNONE 
J065093P05AGCCCACGTGGCNONE 
J065104P15AGCCCACGTGGCNONE 
J065127C09AGCCCACGTGGCNONE 
J065140D08AGCCCACGTGGCNONE 
X89859AGCCCACGTGGCNONE 
Os11g0582400AF049348CCCCCGCGCGCGACGTGGGCTConserved hypothetical protein. 
AF516927CCCCCGCGCGCGACGTGGGCTNONE 
AK073083CCCCCGCGCGCGACGTGGGCTNONE 
AK108352CCCCCGCGCGCGACGTGGGCTNONE 
J075005O16CCCCCGCGCGCGACGTGGGCTNONE 
J075007D15CCCCCGCGCGCGACGTGGGCTNONE 
J075007L04CCCCCGCGCGCGACGTGGGCTNONE 
J075009C11CCCCCGCGCGCGACGTGGGCTNONE 
J075012L11CCCCCGCGCGCGACGTGGGCTNONE 
J075013A14CCCCCGCGCGCGACGTGGGCTNONE 
J075015K01CCCCCGCGCGCGACGTGGGCTNONE 
J075019O21CCCCCGCGCGCGACGTGGGCTNONE 
J075020G20CCCCCGCGCGCGACGTGGGCTNONE 
J075020H06CCCCCGCGCGCGACGTGGGCTNONE 
J075022D07CCCCCGCGCGCGACGTGGGCTNONE 
J075024M12CCCCCGCGCGCGACGTGGGCTNONE 
J075025G04CCCCCGCGCGCGACGTGGGCTNONE 
J075026F09CCCCCGCGCGCGACGTGGGCTNONE 
J075027D19CCCCCGCGCGCGACGTGGGCTNONE 
J075030A12CCCCCGCGCGCGACGTGGGCTNONE 
J075030C16CCCCCGCGCGCGACGTGGGCTNONE 
J075030D15CCCCCGCGCGCGACGTGGGCTNONE 
J075034M20CCCCCGCGCGCGACGTGGGCTNONE 
J075041H12CCCCCGCGCGCGACGTGGGCTNONE 
J075052D12CCCCCGCGCGCGACGTGGGCTNONE 
J075052G11CCCCCGCGCGCGACGTGGGCTNONE 
J075053L09CCCCCGCGCGCGACGTGGGCTNONE 
J075064G05CCCCCGCGCGCGACGTGGGCTNONE 
J075067J01CCCCCGCGCGCGACGTGGGCTNONE 
J075071O03CCCCCGCGCGCGACGTGGGCTNONE 
J075072G12CCCCCGCGCGCGACGTGGGCTNONE 
J075078H06CCCCCGCGCGCGACGTGGGCTNONE 
J075081D06CCCCCGCGCGCGACGTGGGCTNONE 
J075084G23CCCCCGCGCGCGACGTGGGCTNONE 
J075085M10CCCCCGCGCGCGACGTGGGCTNONE 
J075087N20CCCCCGCGCGCGACGTGGGCTNONE 
J075088E11CCCCCGCGCGCGACGTGGGCTNONE 
J075088O22CCCCCGCGCGCGACGTGGGCTNONE 
J075091E10CCCCCGCGCGCGACGTGGGCTNONE 
J075092B12CCCCCGCGCGCGACGTGGGCTNONE 
J075093E08CCCCCGCGCGCGACGTGGGCTNONE 
J075095D04CCCCCGCGCGCGACGTGGGCTNONE 
J075095J10CCCCCGCGCGCGACGTGGGCTNONE 
J075095O19CCCCCGCGCGCGACGTGGGCTNONE 
J075096H20CCCCCGCGCGCGACGTGGGCTNONE 
J075098F10CCCCCGCGCGCGACGTGGGCTNONE 
J075100H10CCCCCGCGCGCGACGTGGGCTNONE 
J075104C23CCCCCGCGCGCGACGTGGGCTNONE 
J075105B10CCCCCGCGCGCGACGTGGGCTNONE 
J075106I24CCCCCGCGCGCGACGTGGGCTNONE 
J075109H23CCCCCGCGCGCGACGTGGGCTNONE 
J075115A03CCCCCGCGCGCGACGTGGGCTNONE 
J075118M06CCCCCGCGCGCGACGTGGGCTNONE 
J075121G08CCCCCGCGCGCGACGTGGGCTNONE 
J075122C09CCCCCGCGCGCGACGTGGGCTNONE 
J075122J12CCCCCGCGCGCGACGTGGGCTNONE 
J075123E06CCCCCGCGCGCGACGTGGGCTNONE 
J075123E16CCCCCGCGCGCGACGTGGGCTNONE 
J075124N09CCCCCGCGCGCGACGTGGGCTNONE 
J075127F23CCCCCGCGCGCGACGTGGGCTNONE 
J075128H17CCCCCGCGCGCGACGTGGGCTNONE 
J075129C02CCCCCGCGCGCGACGTGGGCTNONE 
J075139P18CCCCCGCGCGCGACGTGGGCTNONE 
J075140H17CCCCCGCGCGCGACGTGGGCTNONE 
J075146E12CCCCCGCGCGCGACGTGGGCTNONE 
J075146I07CCCCCGCGCGCGACGTGGGCTNONE 
J075150A08CCCCCGCGCGCGACGTGGGCTNONE 
J075150I22CCCCCGCGCGCGACGTGGGCTNONE 
J075155D01CCCCCGCGCGCGACGTGGGCTNONE 
J075155N10CCCCCGCGCGCGACGTGGGCTNONE 
J075155O09CCCCCGCGCGCGACGTGGGCTNONE 
J075156K11CCCCCGCGCGCGACGTGGGCTNONE 
J075157N01CCCCCGCGCGCGACGTGGGCTNONE 
J075164L09CCCCCGCGCGCGACGTGGGCTNONE 
J075166F14CCCCCGCGCGCGACGTGGGCTNONE 
J075169E20CCCCCGCGCGCGACGTGGGCTNONE 
J075170B13CCCCCGCGCGCGACGTGGGCTNONE 
J075170F24CCCCCGCGCGCGACGTGGGCTNONE 
J075170N16CCCCCGCGCGCGACGTGGGCTNONE 
J075172H22CCCCCGCGCGCGACGTGGGCTNONE 
J075172I02CCCCCGCGCGCGACGTGGGCTNONE 
J075176E08CCCCCGCGCGCGACGTGGGCTNONE 
J075177H17CCCCCGCGCGCGACGTGGGCTNONE 
J075179C18CCCCCGCGCGCGACGTGGGCTNONE 
J075182H23CCCCCGCGCGCGACGTGGGCTNONE 
J075187B10CCCCCGCGCGCGACGTGGGCTNONE 
J075192L10CCCCCGCGCGCGACGTGGGCTNONE 
J075195C04CCCCCGCGCGCGACGTGGGCTNONE 
U25969CCCCCGCGCGCGACGTGGGCTNONE 
Os12g0124400AK071024GCAGCCCACGAExostosin-like family protein. 
Os12g0133600AK103096ACGTGGGCTTTConserved hypothetical protein. 
J033118M03ACGTGGGCTTTNONE 
Os12g0557800AK121691CCAGCCCACGGGProtein prenyltransferase domain containing protein. 
J013095M03CCAGCCCACGGGNONE 
J033071H11CCAGCCCACGGGNONE 
J065101B02CCAGCCCACGGGNONE 
Os12g0569500AK066624CGTGGGCTTTThaumatin, pathogenesis-related family protein. 
J065041B03CGTGGGCTTTNONE 
J065046P11CGTGGGCTTTNONE 
J075140J11CGTGGGCTTTNONE 
Os12g0596000AK073530ACAGCCCACGTSimilar to Lipoyltransferase (EC 2.3.1.-) (Lipoyl-[acyl-carrier protein]-protein- N-lipoyltransferase) (Lipoate-protein ligase B). 
AK101541ACAGCCCACGTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.