version

Summary of OsREG464 (All List)

OrganismOryza sativa  
IDOsREG464  
SequenceAGCCCAGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1279  

Entry Sequences (1279 entries)

LocusGene modelSequenceDescription
Os01g0102700009-009-A07GCAGCCCAGCCCAGNONE 
AK063774GCAGCCCAGCCCAGTranslocon-associated beta family protein. 
AK099081GCAGCCCAGCCCAGNONE 
AK099360GCAGCCCAGCCCAGNONE 
J013096O20GCAGCCCAGCCCAGNONE 
J023002P14GCAGCCCAGCCCAGNONE 
J033046F10GCAGCCCAGCCCAGNONE 
J033084K08GCAGCCCAGCCCAGNONE 
J065011H22GCAGCCCAGCCCAGNONE 
J090017O18GCAGCCCAGCCCAGNONE 
J090047F15GCAGCCCAGCCCAGNONE 
J090049G20GCAGCCCAGCCCAGNONE 
Os01g0180300AK120377GCTGGGCTGGGCCCACACLipoprotein, type 6 family protein. 
J013071N06GCTGGGCTGGGCCCACACNONE 
J023088F12GCTGGGCTGGGCCCACACNONE 
J100027H24GCTGGGCTGGGCCCACACNONE 
J100053K15GCTGGGCTGGGCCCACACNONE 
J100082M15GCTGGGCTGGGCCCACACNONE 
Os01g0224500AK109225GCAGCCCAGCCCAACTCCCACCTGTConserved hypothetical protein. 
Os01g0303800006-024-G06AGCCCAGCNONE 
006-025-F12AGCCCAGCNONE 
006-085-E12AGCCCAGCNONE 
006-092-F12AGCCCAGCNONE 
AK060078AGCCCAGCUniversal stress protein (Usp) family protein. 
AK121626AGCCCAGCNONE 
J023044K21AGCCCAGCNONE 
J023069K09AGCCCAGCNONE 
J023091A17AGCCCAGCNONE 
J033048C05AGCCCAGCNONE 
J033126M13AGCCCAGCNONE 
J065040E06AGCCCAGCNONE 
J065060D14AGCCCAGCNONE 
Os01g0324400AK102854ACAGCCCAGCCCACCAGGCCCACANONE 
AK111299ACAGCCCAGCCCACCAGGCCCACANONE 
J033032A11ACAGCCCAGCCCACCAGGCCCACANONE 
J033110L02ACAGCCCAGCCCACCAGGCCCACANONE 
Os01g0357400012-030-F01CAAGCCCAGCCNONE 
012-045-H02CAAGCCCAGCCNONE 
AK063489CAAGCCCAGCCSimilar to Alpha-amylase. 
D10417CAAGCCCAGCCNONE 
Os01g0373400AK110973GCTGGGCTGCHomeodomain-like containing protein. 
Os01g0571200014-074-A10GGCTGGGCTTGNONE 
AK121299GGCTGGGCTTGSimilar to Ribosomal protein L34. 
J023110L12GGCTGGGCTTGNONE 
Os01g0590300014-089-E04AAAAGCCCAGCNONE 
AK063740AAAAGCCCAGCConserved hypothetical protein. 
Os01g0633000006-075-A01AAAGCCCAGCCNONE 
009-064-A11AAAGCCCAGCCNONE 
009-153-F07AAAGCCCAGCCNONE 
AK062051AAAGCCCAGCCSimilar to 50S ribosomal protein L31. 
J013073B08AAAGCCCAGCCNONE 
J065006K19AAAGCCCAGCCNONE 
J065053P08AAAGCCCAGCCNONE 
J065057D08AAAGCCCAGCCNONE 
J065086P07AAAGCCCAGCCNONE 
J065095C14AAAGCCCAGCCNONE 
J065116B05AAAGCCCAGCCNONE 
J065164L20AAAGCCCAGCCNONE 
J065185K19AAAGCCCAGCCNONE 
J065191E21AAAGCCCAGCCNONE 
J065199P21AAAGCCCAGCCNONE 
J065216M12AAAGCCCAGCCNONE 
J075002M09AAAGCCCAGCCNONE 
J075016N10AAAGCCCAGCCNONE 
J075041K05AAAGCCCAGCCNONE 
J075094E04AAAGCCCAGCCNONE 
J075154O04AAAGCCCAGCCNONE 
J075176D22AAAGCCCAGCCNONE 
J075186M09AAAGCCCAGCCNONE 
J075191H20AAAGCCCAGCCNONE 
Os01g0661400AK073113AGCCCAGCCCAAACNucleic acid-binding, OB-fold domain containing protein. 
J023014C20AGCCCAGCCCAAACNONE 
J033022G03AGCCCAGCCCAAACNONE 
J065050H15AGCCCAGCCCAAACNONE 
J065059J19AGCCCAGCCCAAACNONE 
J065085I24AGCCCAGCCCAAACNONE 
J065166G12AGCCCAGCCCAAACNONE 
J065182C18AGCCCAGCCCAAACNONE 
Os01g0683400AB110983CCAGCCCAGCCNONE 
AK102997CCAGCCCAGCCSimilar to Origin recognition complex 4. 
J033116E22CCAGCCCAGCCNONE 
J090087A03CCAGCCCAGCCNONE 
Os01g0708600AK111377GCAGCCCAGCTransport protein particle (TRAPP) component, Bet3 family protein. 
J065006D07GCAGCCCAGCNONE 
J065007E03GCAGCCCAGCNONE 
J065015A13GCAGCCCAGCNONE 
J065093J17GCAGCCCAGCNONE 
J065116C09GCAGCCCAGCNONE 
J065120E04GCAGCCCAGCNONE 
J065197I17GCAGCCCAGCNONE 
J065208L13GCAGCCCAGCNONE 
J065213P07GCAGCCCAGCNONE 
J075056K07GCAGCCCAGCNONE 
J090036L08GCAGCCCAGCNONE 
Os01g0736400AK069723GGCTGGGCTTGGNONE 
AK100689GGCTGGGCTTGGAminotransferase, class I and II domain containing protein. 
Os01g0745700009-020-H03GGGCTGGGCTNONE 
AK062377GGGCTGGGCTNONE 
AK121896GGGCTGGGCTSimilar to GATA transcription factor 3 (AtGATA-3). 
J033105E11GGGCTGGGCTNONE 
J075022B21GGGCTGGGCTNONE 
J075147O07GGGCTGGGCTNONE 
Os01g0749200006-074-H04TGTGGGCTGCAAAGCCCAGCNONE 
AK072760TGTGGGCTGCAAAGCCCAGCNONE 
AK099041TGTGGGCTGCAAAGCCCAGCNONE 
AK104146TGTGGGCTGCAAAGCCCAGCSimilar to 50S ribosomal protein L13. 
AK119189TGTGGGCTGCAAAGCCCAGCNONE 
Os01g0765000AK101905TCAGCCCAGCCCAACSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0810000AK102143GTTTGGGCTGGGCTGCNONE 
AK120752GTTTGGGCTGGGCTGCUtp11 family protein. 
J023006E09GTTTGGGCTGGGCTGCNONE 
J033086A13GTTTGGGCTGGGCTGCNONE 
J033133K07GTTTGGGCTGGGCTGCNONE 
J065066L16GTTTGGGCTGGGCTGCNONE 
J065161C01GTTTGGGCTGGGCTGCNONE 
J100027D18GTTTGGGCTGGGCTGCNONE 
J100063J12GTTTGGGCTGGGCTGCNONE 
Os01g0831300AK109023GCTGGGCTSimilar to Ammonium transporter. 
Os01g0834900AK063898CCAGCCCAGCHypothetical protein. 
Os01g0848200AK069425GCTGGGCTGASimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AK101230GCTGGGCTGANONE 
Os01g0874800016-042-F01AAAAGCCCAGCNONE 
AK065916AAAAGCCCAGCNONE 
AK065991AAAAGCCCAGCNONE 
AK103577AAAAGCCCAGCNONE 
AK105063AAAAGCCCAGC5'-3' exonuclease domain containing protein. 
AK119315AAAAGCCCAGCNONE 
J023106C06AAAAGCCCAGCNONE 
J053023A11AAAAGCCCAGCNONE 
J053068H13AAAAGCCCAGCNONE 
J053071O13AAAAGCCCAGCNONE 
J053074M10AAAAGCCCAGCNONE 
Os01g0876500J053026A07CCAGCCCAGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17CCAGCCCAGCNONE 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
J065013G01CAGCCCAGCCCAAGGCCCACCANONE 
J065063D03CAGCCCAGCCCAAGGCCCACCANONE 
J065143H01CAGCCCAGCCCAAGGCCCACCANONE 
J065146F08CAGCCCAGCCCAAGGCCCACCANONE 
J065153D14CAGCCCAGCCCAAGGCCCACCANONE 
J065170E02CAGCCCAGCCCAAGGCCCACCANONE 
J065175M22CAGCCCAGCCCAAGGCCCACCANONE 
J065186E13CAGCCCAGCCCAAGGCCCACCANONE 
J075023J16CAGCCCAGCCCAAGGCCCACCANONE 
J075176J06CAGCCCAGCCCAAGGCCCACCANONE 
Os01g0913300AK100698CCAGCCCAGCCTGF-beta receptor, type I/II extracellular region family protein. 
J023030J07CCAGCCCAGCCNONE 
J023102B09CCAGCCCAGCCNONE 
J023102N03CCAGCCCAGCCNONE 
J023114K11CCAGCCCAGCCNONE 
J023140A21CCAGCCCAGCCNONE 
J043017F23CCAGCCCAGCCNONE 
J075058O15CCAGCCCAGCCNONE 
Os01g0934500AK073211TCAGCCCAGCConserved hypothetical protein. 
Os01g0946200AK071060GGCTGGGCTCAGCCCACANo apical meristem (NAM) protein domain containing protein. 
J023080K20GGCTGGGCTCAGCCCACANONE 
Os01g0948300009-023-A03GCAGCCCAGCNONE 
AK102153GCAGCCCAGCCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J013090K24GCAGCCCAGCNONE 
J023019C13GCAGCCCAGCNONE 
J023049L21GCAGCCCAGCNONE 
J023066H02GCAGCCCAGCNONE 
J033050A07GCAGCCCAGCNONE 
J033086E01GCAGCCCAGCNONE 
J033086F11GCAGCCCAGCNONE 
J090047I04GCAGCCCAGCNONE 
J100035E10GCAGCCCAGCNONE 
J100040L06GCAGCCCAGCNONE 
J100044G21GCAGCCCAGCNONE 
J100045F13GCAGCCCAGCNONE 
J100046G12GCAGCCCAGCNONE 
J100075N10GCAGCCCAGCNONE 
J100077I01GCAGCCCAGCNONE 
Os01g0971600AK070366GAAGCCCAGCSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
Os02g0148600AK059287GCTGGGCTTCConserved hypothetical protein. 
Os02g0150100AK060595GAAGCCCAGCCSimilar to DEAD-box protein abstrakt. 
Os02g0160200AK109618GGCTGGGCTGGCyclin-like F-box domain containing protein. 
Os02g0175800009-083-C02AGCCCAGCCCAACCNONE 
009-184-H07AGCCCAGCCCAACCNONE 
009-199-D07AGCCCAGCCCAACCNONE 
AK058292AGCCCAGCCCAACCNONE 
AK120215AGCCCAGCCCAACCConserved hypothetical protein. 
J013040G12AGCCCAGCCCAACCNONE 
J065050N21AGCCCAGCCCAACCNONE 
J065077O07AGCCCAGCCCAACCNONE 
J065102G05AGCCCAGCCCAACCNONE 
J065197A04AGCCCAGCCCAACCNONE 
J075024L24AGCCCAGCCCAACCNONE 
J075038K01AGCCCAGCCCAACCNONE 
J075044L04AGCCCAGCCCAACCNONE 
J075063D23AGCCCAGCCCAACCNONE 
J075079P13AGCCCAGCCCAACCNONE 
J075084G03AGCCCAGCCCAACCNONE 
J075135G07AGCCCAGCCCAACCNONE 
J075148D17AGCCCAGCCCAACCNONE 
J075150F13AGCCCAGCCCAACCNONE 
J075157F06AGCCCAGCCCAACCNONE 
J090054A05AGCCCAGCCCAACCNONE 
J090085O04AGCCCAGCCCAACCNONE 
J100023C04AGCCCAGCCCAACCNONE 
J100023H23AGCCCAGCCCAACCNONE 
J100026A16AGCCCAGCCCAACCNONE 
J100035K13AGCCCAGCCCAACCNONE 
Os02g0191800009-192-E11AGCCCAGCCNONE 
AK063218AGCCCAGCCConserved hypothetical protein. 
Os02g0215950J090051K07GACAGGTGGGCTGGGCTConserved hypothetical protein. 
Os02g0251900AK109286AAAGCCCAGCCCSimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0287000006-107-B10GCTGGGCTNONE 
006-107-B10GCTGGGCTNONE 
006-120-E07GCTGGGCTNONE 
006-120-E07GCTGGGCTNONE 
AF052503GCTGGGCTNONE 
AF052503GCTGGGCTNONE 
AK059647GCTGGGCTSimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK059647GCTGGGCTSimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK099131GCTGGGCTNONE 
AK099131GCTGGGCTNONE 
J023048M05GCTGGGCTNONE 
J023048M05GCTGGGCTNONE 
J033107L10GCTGGGCTNONE 
J033107L10GCTGGGCTNONE 
J065019A12GCTGGGCTNONE 
J065019A12GCTGGGCTNONE 
J065064J21GCTGGGCTNONE 
J065064J21GCTGGGCTNONE 
J065071D15GCTGGGCTNONE 
J065071D15GCTGGGCTNONE 
J065094L12GCTGGGCTNONE 
J065094L12GCTGGGCTNONE 
J065095L06GCTGGGCTNONE 
J065095L06GCTGGGCTNONE 
J065097J11GCTGGGCTNONE 
J065097J11GCTGGGCTNONE 
J065099M08GCTGGGCTNONE 
J065099M08GCTGGGCTNONE 
J065104D01GCTGGGCTNONE 
J065104D01GCTGGGCTNONE 
J065107L02GCTGGGCTNONE 
J065107L02GCTGGGCTNONE 
J065110D14GCTGGGCTNONE 
J065110D14GCTGGGCTNONE 
J065135J07GCTGGGCTNONE 
J065135J07GCTGGGCTNONE 
J065137C16GCTGGGCTNONE 
J065137C16GCTGGGCTNONE 
J065150C07GCTGGGCTNONE 
J065150C07GCTGGGCTNONE 
J065165I10GCTGGGCTNONE 
J065165I10GCTGGGCTNONE 
J065189F07GCTGGGCTNONE 
J065189F07GCTGGGCTNONE 
J065205L22GCTGGGCTNONE 
J065205L22GCTGGGCTNONE 
J065214C09GCTGGGCTNONE 
J065214C09GCTGGGCTNONE 
J065217G17GCTGGGCTNONE 
J065217G17GCTGGGCTNONE 
J075029E17GCTGGGCTNONE 
J075029E17GCTGGGCTNONE 
J075054O16GCTGGGCTNONE 
J075054O16GCTGGGCTNONE 
J075068N23GCTGGGCTNONE 
J075068N23GCTGGGCTNONE 
J075135N18GCTGGGCTNONE 
J075135N18GCTGGGCTNONE 
J075152G09GCTGGGCTNONE 
J075152G09GCTGGGCTNONE 
J075162D10GCTGGGCTNONE 
J075162D10GCTGGGCTNONE 
J075164F11GCTGGGCTNONE 
J075164F11GCTGGGCTNONE 
J080036L12GCTGGGCTNONE 
J080036L12GCTGGGCTNONE 
J080049K18GCTGGGCTNONE 
J080049K18GCTGGGCTNONE 
J080060P03GCTGGGCTNONE 
J080060P03GCTGGGCTNONE 
J080062G16GCTGGGCTNONE 
J080062G16GCTGGGCTNONE 
J080062G21GCTGGGCTNONE 
J080062G21GCTGGGCTNONE 
J080064N07GCTGGGCTNONE 
J080064N07GCTGGGCTNONE 
J080075I22GCTGGGCTNONE 
J080075I22GCTGGGCTNONE 
J080086F20GCTGGGCTNONE 
J080086F20GCTGGGCTNONE 
J080087G07GCTGGGCTNONE 
J080087G07GCTGGGCTNONE 
J080088I06GCTGGGCTNONE 
J080088I06GCTGGGCTNONE 
J080302B20GCTGGGCTNONE 
J080302B20GCTGGGCTNONE 
J080303L14GCTGGGCTNONE 
J080303L14GCTGGGCTNONE 
J080309O12GCTGGGCTNONE 
J080309O12GCTGGGCTNONE 
J080317F12GCTGGGCTNONE 
J080317F12GCTGGGCTNONE 
J080317P18GCTGGGCTNONE 
J080317P18GCTGGGCTNONE 
J090013L15GCTGGGCTNONE 
J090013L15GCTGGGCTNONE 
J090043N04GCTGGGCTNONE 
J090043N04GCTGGGCTNONE 
J090085G01GCTGGGCTNONE 
J090085G01GCTGGGCTNONE 
J090085G19GCTGGGCTNONE 
J090085G19GCTGGGCTNONE 
Os02g0288100AK107019AGCCCAGCCCACGCGSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
Os02g0316800009-104-A11AGCCCAGCNONE 
AK062767AGCCCAGCSimilar to MRNA binding protein precursor. 
Os02g0501350J090074D10GCTGGGCTNONE 
J090080M08GCTGGGCTNONE 
J090083F07GCTGGGCTConserved hypothetical protein. 
Os02g0517333AK105573GCTGGGCTTTNONE 
AK111331GCTGGGCTTTConserved hypothetical protein. 
Os02g0519900006-057-B12GGCTGGGCTTTNONE 
006-113-G04GGCTGGGCTTTNONE 
006-119-D01GGCTGGGCTTTNONE 
AK060953GGCTGGGCTTTNONE 
AK068869GGCTGGGCTTTNONE 
AK121453GGCTGGGCTTTNONE 
D21277GGCTGGGCTTTNONE 
D21278GGCTGGGCTTTNONE 
J023002E06GGCTGGGCTTTNONE 
J023106L15GGCTGGGCTTTNONE 
J023142O06GGCTGGGCTTTNONE 
J053089A15GGCTGGGCTTTNONE 
J053091H05GGCTGGGCTTTNONE 
J080303F06GGCTGGGCTTTNONE 
J090003E12GGCTGGGCTTTNONE 
Os02g0591800AK060611AGCCCAGCCBrix domain containing protein. 
AK102534AGCCCAGCCNONE 
J075057H08AGCCCAGCCNONE 
J075179P18AGCCCAGCCNONE 
J080011H01AGCCCAGCCNONE 
J080018E14AGCCCAGCCNONE 
J080026N17AGCCCAGCCNONE 
J080047A13AGCCCAGCCNONE 
J080049C17AGCCCAGCCNONE 
J080050G07AGCCCAGCCNONE 
J080064D10AGCCCAGCCNONE 
J080080A03AGCCCAGCCNONE 
J080080G20AGCCCAGCCNONE 
J080080I03AGCCCAGCCNONE 
J080081H12AGCCCAGCCNONE 
J080090K07AGCCCAGCCNONE 
J080092O06AGCCCAGCCNONE 
J080096B07AGCCCAGCCNONE 
J080097M08AGCCCAGCCNONE 
Os02g0610700014-008-A03GCTGGGCTTGGNONE 
AK059205GCTGGGCTTGGConserved hypothetical protein. 
AK100281GCTGGGCTTGGNONE 
J023074H03GCTGGGCTTGGNONE 
J065002J16GCTGGGCTTGGNONE 
J065032I20GCTGGGCTTGGNONE 
J065076A07GCTGGGCTTGGNONE 
J065142O21GCTGGGCTTGGNONE 
J065203A03GCTGGGCTTGGNONE 
J075017F24GCTGGGCTTGGNONE 
J075017G24GCTGGGCTTGGNONE 
Os02g0644000AB081464TGTGGGCTGGGCTGGNONE 
AK101360TGTGGGCTGGGCTGGNONE 
AY062178TGTGGGCTGGGCTGGNONE 
J023043E22TGTGGGCTGGGCTGGNONE 
J033024F05TGTGGGCTGGGCTGGNONE 
J033035H01TGTGGGCTGGGCTGGNONE 
J033042J19TGTGGGCTGGGCTGGNONE 
J033057G18TGTGGGCTGGGCTGGNONE 
J033111F09TGTGGGCTGGGCTGGNONE 
J033115L11TGTGGGCTGGGCTGGNONE 
J033143I16TGTGGGCTGGGCTGGNONE 
J033143M21TGTGGGCTGGGCTGGNONE 
J075072B10TGTGGGCTGGGCTGGNONE 
J075072L04TGTGGGCTGGGCTGGNONE 
J075088F01TGTGGGCTGGGCTGGNONE 
J075196H23TGTGGGCTGGGCTGGNONE 
Os02g0681100AK100584GCTGGGCTProtein of unknown function DUF604 family protein. 
J023106A15GCTGGGCTNONE 
Os02g0700100AK102954AAAGCCCATAAAGCCCAGCSimilar to WD-repeat protein. 
Os02g0703900AK102115TCAGCCCAGCCCAGCCCAGCCGAGATSimilar to Nodulin-like protein. 
AK121966TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J023109K03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033051G23TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033084H22TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090056B12TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090059L13TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090080M03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
Os02g0725700AK107861AGCCCAGCHistone-like transcription factor/archaeal histone/DNA topoisomerase family protein. 
AY062184AGCCCAGCNONE 
Os02g0732200AK102091AGCCCAGCU box domain containing protein. 
Os02g0741500AK068867GAAGCCCAGCRibbon-helix-helix domain containing protein. 
Os02g0753200AK067176GCAGCCCAGCCConserved hypothetical protein. 
J013097D23GCAGCCCAGCCNONE 
J065085J01GCAGCCCAGCCNONE 
J065152L23GCAGCCCAGCCNONE 
J065162F18GCAGCCCAGCCNONE 
J075002K17GCAGCCCAGCCNONE 
J075047D24GCAGCCCAGCCNONE 
J075064A01GCAGCCCAGCCNONE 
J075075C09GCAGCCCAGCCNONE 
J075088M01GCAGCCCAGCCNONE 
J075130K03GCAGCCCAGCCNONE 
J075146K03GCAGCCCAGCCNONE 
J090049F07GCAGCCCAGCCNONE 
Os02g0758200AK111266CCAGCCCAGCCConserved hypothetical protein. 
Os02g0764700AK107146AGCCCAGCSimilar to Ethylene-responsive transcription factor 4 (Ethylene-responsive element binding factor 4) (Related to APETALA-2 protein 5) (EREBP-4) (AtERF4). 
J075062H22AGCCCAGCNONE 
J090073I18AGCCCAGCNONE 
Os02g0765600011-044-C02CAAGCCCAGCCNONE 
011-059-H12CAAGCCCAGCCNONE 
012-010-G07CAAGCCCAGCCNONE 
012-040-D02CAAGCCCAGCCNONE 
012-048-F02CAAGCCCAGCCNONE 
012-055-C12CAAGCCCAGCCNONE 
012-065-C04CAAGCCCAGCCNONE 
012-086-D01CAAGCCCAGCCNONE 
012-099-G02CAAGCCCAGCCNONE 
015-002-D01CAAGCCCAGCCNONE 
015-067-D08CAAGCCCAGCCNONE 
016-060-E08CAAGCCCAGCCNONE 
AK101744CAAGCCCAGCCAlpha-amylase precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase) (Isozyme 1B). 
J033023N15CAAGCCCAGCCNONE 
J033061O03CAAGCCCAGCCNONE 
J033107J03CAAGCCCAGCCNONE 
J033119C02CAAGCCCAGCCNONE 
J043001H07CAAGCCCAGCCNONE 
J043003H07CAAGCCCAGCCNONE 
J043003I05CAAGCCCAGCCNONE 
J043009K22CAAGCCCAGCCNONE 
J043009L08CAAGCCCAGCCNONE 
J043012J02CAAGCCCAGCCNONE 
J043015P13CAAGCCCAGCCNONE 
J043016H11CAAGCCCAGCCNONE 
J043020F17CAAGCCCAGCCNONE 
J053027C06CAAGCCCAGCCNONE 
J053099F07CAAGCCCAGCCNONE 
J065025M06CAAGCCCAGCCNONE 
J065029M17CAAGCCCAGCCNONE 
J065044H20CAAGCCCAGCCNONE 
J065089P12CAAGCCCAGCCNONE 
J065098N21CAAGCCCAGCCNONE 
J065143N20CAAGCCCAGCCNONE 
J065161C24CAAGCCCAGCCNONE 
J065170A09CAAGCCCAGCCNONE 
J065197N16CAAGCCCAGCCNONE 
J065214E11CAAGCCCAGCCNONE 
J065216J23CAAGCCCAGCCNONE 
J100026D11CAAGCCCAGCCNONE 
J100062F01CAAGCCCAGCCNONE 
J100080O15CAAGCCCAGCCNONE 
J100082F09CAAGCCCAGCCNONE 
M24286CAAGCCCAGCCNONE 
Os02g0778200AK065948AGCCCAGCCAminoacyl-tRNA synthetase, class I family protein. 
Os02g0794400AK065845AGCCCAGCInitiation factor 3 family protein. 
J013042M03AGCCCAGCNONE 
Os02g0818900AK107997CCAAGCCCAGCHeavy metal transport/detoxification protein domain containing protein. 
J065112M01CCAAGCCCAGCNONE 
J065152N01CCAAGCCCAGCNONE 
J100052D19CCAAGCCCAGCNONE 
J100085M12CCAAGCCCAGCNONE 
J100087A05CCAAGCCCAGCNONE 
J100088H04CCAAGCCCAGCNONE 
Os02g0824700009-023-E06CCCAGCCCAGCCCACCTSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18CCCAGCCCAGCCCACCTNONE 
J065017H21CCCAGCCCAGCCCACCTNONE 
J065052N02CCCAGCCCAGCCCACCTNONE 
J065053M01CCCAGCCCAGCCCACCTNONE 
J065064B14CCCAGCCCAGCCCACCTNONE 
J065146K22CCCAGCCCAGCCCACCTNONE 
Os02g0832200AK108268AGCCCAGCCCConserved hypothetical protein. 
J065053F07AGCCCAGCCCNONE 
J065095B09AGCCCAGCCCNONE 
J065137I11AGCCCAGCCCNONE 
J065187O12AGCCCAGCCCNONE 
J075193O05AGCCCAGCCCNONE 
Os03g0101400AK120679GCTGGGCTGAConserved hypothetical protein. 
J013162J03GCTGGGCTGANONE 
Os03g0108700003-131-E01GCAGCCCAGCCCAGCCNONE 
AK105115GCAGCCCAGCCCAGCCConserved hypothetical protein. 
AY224538GCAGCCCAGCCCAGCCNONE 
J065029A19GCAGCCCAGCCCAGCCNONE 
J065109N11GCAGCCCAGCCCAGCCNONE 
Os03g0168200AK099530GCTGGGCTConserved hypothetical protein. 
Os03g0197400AK071413GCAGCCCAGCCCSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905GCAGCCCAGCCCNONE 
J053023D18GCAGCCCAGCCCNONE 
Os03g0249400009-059-H08GCTGGGCTGGNONE 
AK062522GCTGGGCTGGSimilar to 40S ribosomal protein S20 (S22) (Fragment). 
J053031I05GCTGGGCTGGNONE 
J053052E06GCTGGGCTGGNONE 
J053061K22GCTGGGCTGGNONE 
J065108I02GCTGGGCTGGNONE 
Os03g0251800AK067333TCCGGCCCAGCCCAGCSimilar to Possible OmpA family member precursor. 
AK073337TCCGGCCCAGCCCAGCNONE 
Os03g0269300011-021-H03CCAGCCCAGCNONE 
011-029-B01CCAGCCCAGCNONE 
AK111855CCAGCCCAGCNONE 
AK111884CCAGCCCAGCAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0279600006-070-A07GAAGCCCAGCCNONE 
AK061080GAAGCCCAGCCConserved hypothetical protein. 
AK071043GAAGCCCAGCCNONE 
AK103191GAAGCCCAGCCNONE 
J065077E22GAAGCCCAGCCNONE 
J065208F22GAAGCCCAGCCNONE 
J075156K12GAAGCCCAGCCNONE 
Os03g0313600AK067474ATTGGGCTGGGCTGASimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
Os03g0315400AK120551CCAGCCCAGCCSimilar to Typical P-type R2R3 Myb protein (Fragment). 
J013130B13CCAGCCCAGCCNONE 
J065053B05CCAGCCCAGCCNONE 
J065169H20CCAGCCCAGCCNONE 
J065169M22CCAGCCCAGCCNONE 
J100061H19CCAGCCCAGCCNONE 
Os03g0322200009-102-F01AGCCCAGCNONE 
009-144-G06AGCCCAGCNONE 
016-048-D06AGCCCAGCNONE 
AK062978AGCCCAGCConserved hypothetical protein. 
Os03g0337800AK059309TGATGGGCCGACGGCCCAGCCCAGCCSimilar to 60S ribosomal protein L19 (Fragment). 
AK102721TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J023146K24TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033069H01TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033105G07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065009B17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065010F02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065068A06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065085M23TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065095H02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065118O17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065121I06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065138J02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065143L09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065146P12TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065169D03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065181E03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065184C13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188D08TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188O16TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075066J20TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075081E13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075175B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080301E05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080302B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080316P06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080319C09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090038K21TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090046J05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090098B03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100039N19TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100041E17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100081L04TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100089N15TGATGGGCCGACGGCCCAGCCCAGCCNONE 
Os03g0411500AK058696CCCAGCCCAGCCCAACCNONE 
AK071057CCCAGCCCAGCCCAACCPeptidase S14, ClpP family protein. 
Os03g0453800014-002-A05AGCCCAGCNONE 
AK063623AGCCCAGCConserved hypothetical protein. 
Os03g0628900009-062-G01TTTTGGGCTGGGCTNONE 
AK103619TTTTGGGCTGGGCTPrefoldin domain containing protein. 
J033133L23TTTTGGGCTGGGCTNONE 
J100039C17TTTTGGGCTGGGCTNONE 
J100048I07TTTTGGGCTGGGCTNONE 
J100062E19TTTTGGGCTGGGCTNONE 
J100063B11TTTTGGGCTGGGCTNONE 
Os03g0734500AK108001AAAAGCCCAGCConserved hypothetical protein. 
J080013F05AAAAGCCCAGCNONE 
J080030B16AAAAGCCCAGCNONE 
J080074G16AAAAGCCCAGCNONE 
J100062F08AAAAGCCCAGCNONE 
Os03g0737600014-094-E01CCAAGCCCAGCNONE 
014-094-E01GCTGGGCTNONE 
AB038234CCAAGCCCAGCNONE 
AB038234GCTGGGCTNONE 
AK101854CCAAGCCCAGCCyclin H-1. 
AK101854GCTGGGCTCyclin H-1. 
AK105468CCAAGCCCAGCNONE 
AK105468GCTGGGCTNONE 
J033069N12CCAAGCCCAGCNONE 
J033069N12GCTGGGCTNONE 
J043017A22CCAAGCCCAGCNONE 
J043017A22GCTGGGCTNONE 
J065154A20CCAAGCCCAGCNONE 
J065154A20GCTGGGCTNONE 
Os03g0746400AK063445CCCAGCCCATACCAGCCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK070923CCCAGCCCATACCAGCCCAGCCCATTANONE 
J065008K24CCCAGCCCATACCAGCCCAGCCCATTANONE 
Os03g0774200AK065851AAAAGCCCAGCCCACCAACNONE 
AK119532AAAAGCCCAGCCCACCAACSimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AAAAGCCCAGCCCACCAACNONE 
J023107I03AAAAGCCCAGCCCACCAACNONE 
J065156I19AAAAGCCCAGCCCACCAACNONE 
J065176L07AAAAGCCCAGCCCACCAACNONE 
J100066F15AAAAGCCCAGCCCACCAACNONE 
Os03g0833700011-060-A10GTGTGGGCCCACAGCCCAGCNONE 
AK121918GTGTGGGCCCACAGCCCAGCRNA 3'-terminal phosphate cyclase family protein. 
Os03g0835400AK061773GCTGGGCTSimilar to Uvs101. 
AK098986GCTGGGCTNONE 
AK105896GCTGGGCTNONE 
Os03g0846400AK067706TGGTGGGCCGTGGCTGGGCTGGNONE 
AK070549TGGTGGGCCGTGGCTGGGCTGGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0848100J013028M09TGTTGGGCTGGGCTTCNONE 
J065080L17TGTTGGGCTGGGCTTCNONE 
J065083C11TGTTGGGCTGGGCTTCNONE 
Os04g0117100009-025-D02AGCCCAGCCCANONE 
009-056-D03AGCCCAGCCCANONE 
009-145-F01AGCCCAGCCCANONE 
009-146-C06AGCCCAGCCCANONE 
009-186-C05AGCCCAGCCCANONE 
AK060395AGCCCAGCCCANONE 
AK121763AGCCCAGCCCAConserved hypothetical protein. 
J033090J17AGCCCAGCCCANONE 
J065058O06AGCCCAGCCCANONE 
J065058P05AGCCCAGCCCANONE 
J065141C14AGCCCAGCCCANONE 
J065162F07AGCCCAGCCCANONE 
J065199N16AGCCCAGCCCANONE 
J065214I05AGCCCAGCCCANONE 
J075003L04AGCCCAGCCCANONE 
J075014C14AGCCCAGCCCANONE 
J075063K14AGCCCAGCCCANONE 
J075111N19AGCCCAGCCCANONE 
J075138E13AGCCCAGCCCANONE 
J075189E23AGCCCAGCCCANONE 
J080304J23AGCCCAGCCCANONE 
J080310L07AGCCCAGCCCANONE 
J080318A16AGCCCAGCCCANONE 
J100054P14AGCCCAGCCCANONE 
Os04g0118100006-100-G08CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
AK058463CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
J065078C03CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
Os04g0376600J033065H17GGCTGGGCTGGGNONE 
Os04g0391900AK101777CCAGCCCAGCAmidohydrolase 2 family protein. 
Os04g0416000J065041L09TCATGGGCTGGGCTTCNONE 
J065050F15TCATGGGCTGGGCTTCNONE 
J065053M14TCATGGGCTGGGCTTCProtein of unknown function DUF1279 domain containing protein. 
J065057I09TCATGGGCTGGGCTTCNONE 
J065132E14TCATGGGCTGGGCTTCNONE 
J065144L23TCATGGGCTGGGCTTCNONE 
J065154N13TCATGGGCTGGGCTTCNONE 
J065158P16TCATGGGCTGGGCTTCNONE 
J080302F01TCATGGGCTGGGCTTCNONE 
J080308G20TCATGGGCTGGGCTTCNONE 
Os04g0430100009-125-A01AACTGGGCCTGAAAAGCCCAGCCCNONE 
AK102190AACTGGGCCTGAAAAGCCCAGCCCSimilar to 40S ribosomal protein S10-1. 
J033087A06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J053032M06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065033D05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045D15AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045K10AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065049N05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065064N09AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065068F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065088F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065104N22AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065117B19AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065119O12AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065134G24AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065150G16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065176C03AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065212M23AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075009P18AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075019G06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075037H14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075057C13AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075100E14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075120I16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075130F07AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075156M16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J100043J03AACTGGGCCTGAAAAGCCCAGCCCNONE 
Os04g0445100014-052-B04GAAGCCCAGCAAACGGCCCATCANONE 
AK063700GAAGCCCAGCAAACGGCCCATCASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0513100AK067841GCTGGGCTSimilar to Beta-glucosidase. 
AK067841GGGCTGGGCTGCGGTGGGCTGTSimilar to Beta-glucosidase. 
J075105F14GCTGGGCTNONE 
J075105F14GGGCTGGGCTGCGGTGGGCTGTNONE 
Os04g0530300009-053-E04GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
009-074-E03GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
AK066705GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGConserved hypothetical protein. 
Os04g0530400AK067634CACTGACATGTGGGCCAGCAGCCCAGCACGTGTCt-snare domain containing protein. 
Os04g0541700AK109177GCTGGGCTNONE 
AY554030GCTGGGCTNONE 
J065055P13GCTGGGCTNONE 
J065057N20GCTGGGCTNONE 
J065136D07GCTGGGCTNONE 
Os04g0551800016-049-G12TAATGGGCTGGGCTNONE 
AK121568TAATGGGCTGGGCTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06TAATGGGCTGGGCTNONE 
J013111B11TAATGGGCTGGGCTNONE 
J013121H23TAATGGGCTGGGCTNONE 
J023012A17TAATGGGCTGGGCTNONE 
J023092M05TAATGGGCTGGGCTNONE 
J033026P14TAATGGGCTGGGCTNONE 
J033033C10TAATGGGCTGGGCTNONE 
J033033M10TAATGGGCTGGGCTNONE 
J033035C24TAATGGGCTGGGCTNONE 
J033052E19TAATGGGCTGGGCTNONE 
J033140K19TAATGGGCTGGGCTNONE 
J065036F18TAATGGGCTGGGCTNONE 
J065067L12TAATGGGCTGGGCTNONE 
J065095G09TAATGGGCTGGGCTNONE 
J065115B08TAATGGGCTGGGCTNONE 
J065218E24TAATGGGCTGGGCTNONE 
J090002N13TAATGGGCTGGGCTNONE 
J090008B12TAATGGGCTGGGCTNONE 
J090016F24TAATGGGCTGGGCTNONE 
J090019H14TAATGGGCTGGGCTNONE 
J090020G20TAATGGGCTGGGCTNONE 
J090029L18TAATGGGCTGGGCTNONE 
J090057C23TAATGGGCTGGGCTNONE 
J090073H23TAATGGGCTGGGCTNONE 
J090081C16TAATGGGCTGGGCTNONE 
J090081E21TAATGGGCTGGGCTNONE 
J090084L14TAATGGGCTGGGCTNONE 
J090086M01TAATGGGCTGGGCTNONE 
J090089E16TAATGGGCTGGGCTNONE 
J100031P12TAATGGGCTGGGCTNONE 
J100090N23TAATGGGCTGGGCTNONE 
Os04g0555300012-003-H04GGCTGGGCTNONE 
012-055-C10GGCTGGGCTNONE 
012-067-E04GGCTGGGCTNONE 
015-035-G03GGCTGGGCTNONE 
016-038-E01GGCTGGGCTNONE 
AK105088GGCTGGGCTNONE 
J013048K21GGCTGGGCTNONE 
J013149O17GGCTGGGCTNONE 
J023008F10GGCTGGGCTNONE 
J023086K19GGCTGGGCTNONE 
J033123B14GGCTGGGCTNONE 
J053043L13GGCTGGGCTNONE 
J053045D23GGCTGGGCTNONE 
J053061O14GGCTGGGCTNONE 
J053062F14GGCTGGGCTNONE 
J053095C01GGCTGGGCTNONE 
J053095I16GGCTGGGCTNONE 
J053099E11GGCTGGGCTNONE 
J090008C01GGCTGGGCTNONE 
J090010K10GGCTGGGCTNONE 
J090026I23GGCTGGGCTNONE 
J090045I22GGCTGGGCTNONE 
J090051K01GGCTGGGCTNONE 
J090057J15GGCTGGGCTNONE 
J090061K23GGCTGGGCTNONE 
J100045I16GGCTGGGCTNONE 
J100084L22GGCTGGGCTNONE 
Os04g0559400AK106376AAAAGCCCAGCCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0564700AK111615GCTGGGCTTGNONE 
Os04g0583101005-010-A06GCTGGGCTTGNONE 
AK065769GCTGGGCTTGProtein prenyltransferase domain containing protein. 
J013040G18GCTGGGCTTGNONE 
J023100E21GCTGGGCTTGNONE 
J075041E15GCTGGGCTTGNONE 
J075056L11GCTGGGCTTGNONE 
J075081F19GCTGGGCTTGNONE 
J075126J10GCTGGGCTTGNONE 
J075148G19GCTGGGCTTGNONE 
J075178A14GCTGGGCTTGNONE 
J100085H06GCTGGGCTTGNONE 
Os04g0589200AK068571AGCCCAGCCCAGCCConserved hypothetical protein. 
AK102463AGCCCAGCCCAGCCNONE 
J075083K10AGCCCAGCCCAGCCNONE 
Os04g0609700AK101763GCTGGGCTTCZinc finger, FYVE/PHD-type domain containing protein. 
Os04g0636000015-046-E08AGCCCAGCCCNONE 
AK065639AGCCCAGCCCSPla/RYanodine receptor SPRY domain containing protein. 
AK099615AGCCCAGCCCNONE 
Os04g0636400006-064-G07TAAGCCCAGCCNONE 
006-097-D05TAAGCCCAGCCNONE 
AK061848TAAGCCCAGCCSimilar to Senescence-associated protein 6. 
AK099573TAAGCCCAGCCNONE 
J013035J20TAAGCCCAGCCNONE 
Os04g0636900011-028-G03CAAGCCCAGCNONE 
012-040-G03CAAGCCCAGCNONE 
AK058405CAAGCCCAGCNONE 
AK065789CAAGCCCAGCNONE 
AK101408CAAGCCCAGCNONE 
AK119286CAAGCCCAGCNONE 
J013042J24CAAGCCCAGCNONE 
J033037I12CAAGCCCAGCNONE 
J043031B12CAAGCCCAGCNONE 
J065152N10CAAGCCCAGCNONE 
J090060K17CAAGCCCAGCNONE 
J090083K14CAAGCCCAGCNONE 
J100046O13CAAGCCCAGCNONE 
J100066G22CAAGCCCAGCNONE 
Os04g0682800AK121846CCAGCCCAGCCCAGCSodium/hydrogen exchanger family protein. 
Os04g0691900AK068257GCAGCCCAGCCACCAACChaperonin Cpn60/TCP-1 family protein. 
Os05g0123400AK069521TCAGCCCAGCConserved hypothetical protein. 
J023022O05TCAGCCCAGCNONE 
Os05g0205100AK111332CAAGCCCAGCNLI interacting factor domain containing protein. 
Os05g0459300009-006-D08GCTGGGCTGCNONE 
AK062312GCTGGGCTGCNONE 
AK119604GCTGGGCTGCNONE 
AK121463GCTGGGCTGCConserved hypothetical protein. 
J023145E12GCTGGGCTGCNONE 
Os05g0459900AK058918AAGGCCCATTTAGCCCAGCCCSimilar to 60S ribosomal protein L36-1. 
AK111268AAGGCCCATTTAGCCCAGCCCNONE 
J013129N08AAGGCCCATTTAGCCCAGCCCNONE 
J065191E01AAGGCCCATTTAGCCCAGCCCNONE 
J065216P03AAGGCCCATTTAGCCCAGCCCNONE 
J075089K21AAGGCCCATTTAGCCCAGCCCNONE 
Os05g0490800J065037L19AAAAGCCCAGCCNONE 
Os05g0495100AK108028GGGCTGGGCTTTTConserved hypothetical protein. 
Os05g0540100AB021666CCCAGCCCAGCCNONE 
AK060623CCCAGCCCAGCCNONE 
AK103819CCCAGCCCAGCCFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0551700AK071216CCCAGCCCAGCCtRNA isopentenyltransferase family protein. 
Os05g0563500AK121924AGCCCAGCConserved hypothetical protein. 
AK121924GCTGGGCTConserved hypothetical protein. 
J033106F17AGCCCAGCNONE 
J033106F17GCTGGGCTNONE 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os05g0592400AB037144GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
AK065508GTTTGGGCTGGGCTGGGCTGGGCTGGUV-damaged DNA binding protein. 
J013069J24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013075H15GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013095H04GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013105L19GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013152P13GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J023072O05GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033024J22GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033030D07GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033041D09GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033051M16GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033126M01GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033145H24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
Os05g0594800AK058332CCAGCCCAGCAdhesion regulating molecule family protein. 
AK058332GAAGCCCAGCCCACCAAdhesion regulating molecule family protein. 
AK068013CCAGCCCAGCNONE 
AK068013GAAGCCCAGCCCACCANONE 
J013129L24CCAGCCCAGCNONE 
J013129L24GAAGCCCAGCCCACCANONE 
Os05g0595000AK071326AGCCCAGCCAllergen V5/Tpx-1 related family protein. 
J023088B21AGCCCAGCCNONE 
Os06g0116400006-082-G06GAAGCCCAGCCNONE 
AK058327GAAGCCCAGCCNONE 
AK105979GAAGCCCAGCCHigh-affinity nickel-transporter family protein. 
J065083I24GAAGCCCAGCCNONE 
J100072O18GAAGCCCAGCCNONE 
Os06g0136900AK107405ACAGCCCAGCCCAGGGCCCGCProtein of unknown function DUF296 domain containing protein. 
Os06g0159600AK068486TAAGCCCAGCU box domain containing protein. 
AK108446TAAGCCCAGCNONE 
J065084J15TAAGCCCAGCNONE 
Os06g0159900011-100-G09GCTGGGCTNONE 
AK063418GCTGGGCTSimilar to Arm repeat containing protein. 
J065122B22GCTGGGCTNONE 
Os06g0209300AK066363GCTGGGCTNONE 
Os06g0210200012-084-E04GCTGGGCTGGTTGGGCCTCNONE 
AK060502GCTGGGCTGGTTGGGCCTCNONE 
AK069709GCTGGGCTGGTTGGGCCTCN-acyl-L-amino-acid amidohydrolase family protein. 
J023028L23GCTGGGCTGGTTGGGCCTCNONE 
J023056O05GCTGGGCTGGTTGGGCCTCNONE 
J033075N06GCTGGGCTGGTTGGGCCTCNONE 
J065099C14GCTGGGCTGGTTGGGCCTCNONE 
J065158C17GCTGGGCTGGTTGGGCCTCNONE 
J065214B02GCTGGGCTGGTTGGGCCTCNONE 
J075026E10GCTGGGCTGGTTGGGCCTCNONE 
J075066J06GCTGGGCTGGTTGGGCCTCNONE 
J075121I06GCTGGGCTGGTTGGGCCTCNONE 
J075124L08GCTGGGCTGGTTGGGCCTCNONE 
J100055D09GCTGGGCTGGTTGGGCCTCNONE 
J100055E04GCTGGGCTGGTTGGGCCTCNONE 
J100077L12GCTGGGCTGGTTGGGCCTCNONE 
Os06g0219800011-090-C04GGCTGGGCTNONE 
AK072030GGCTGGGCTSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3. 
AK100405GGCTGGGCTNONE 
J065063P03GGCTGGGCTNONE 
J100032E17GGCTGGGCTNONE 
J100081I18GGCTGGGCTNONE 
Os06g0227200AK066970GCTGGGCTConserved hypothetical protein. 
AK073517GCTGGGCTNONE 
J013088F13GCTGGGCTNONE 
J013089B21GCTGGGCTNONE 
J013109D18GCTGGGCTNONE 
J023138G01GCTGGGCTNONE 
J033040I03GCTGGGCTNONE 
J033042L14GCTGGGCTNONE 
J065207L20GCTGGGCTNONE 
J090019A12GCTGGGCTNONE 
J090053M23GCTGGGCTNONE 
Os06g0496800AK069969GGCTGGGCTNONE 
AK105608GGCTGGGCTSimilar to S-locus receptor kinase precursor. 
J023038O14GGCTGGGCTNONE 
J023067C09GGCTGGGCTNONE 
J065040A13GGCTGGGCTNONE 
J075041I24GGCTGGGCTNONE 
J075088P04GGCTGGGCTNONE 
J075114B05GGCTGGGCTNONE 
J075155L05GGCTGGGCTNONE 
J075169G21GGCTGGGCTNONE 
J090049L19GGCTGGGCTNONE 
J090075E08GGCTGGGCTNONE 
J090092J03GGCTGGGCTNONE 
J100054E02GGCTGGGCTNONE 
J100079D08GGCTGGGCTNONE 
Os06g0573600AK102756GCTGGGCTGASimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase). 
J023001F23GCTGGGCTGANONE 
J033107B05GCTGGGCTGANONE 
J090078G02GCTGGGCTGANONE 
J090099E09GCTGGGCTGANONE 
Os06g0673500J100018J12ATATGGGCTCAGCCCAGCCCATCANONE 
J100072F13ATATGGGCTCAGCCCAGCCCATCASimilar to Ubiquitin. 
Os06g0691200AK108191CCAGCCCAGCSimilar to Thaumatin-like protein precursor. 
Os06g0695400AK073198GAAGCCCAGCHaem peroxidase family protein. 
J033022I15GAAGCCCAGCNONE 
Os06g0714100AK121079AAAGCCCAGCCCAComplex 1 LYR protein family protein. 
J023062M13AAAGCCCAGCCCANONE 
J043020D18AAAGCCCAGCCCANONE 
J065073A17AAAGCCCAGCCCANONE 
J065158D09AAAGCCCAGCCCANONE 
J065195H04AAAGCCCAGCCCANONE 
J065214P13AAAGCCCAGCCCANONE 
J080079I22AAAGCCCAGCCCANONE 
J100031M06AAAGCCCAGCCCANONE 
J100036I12AAAGCCCAGCCCANONE 
Os07g0130500AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
Os07g0133700J065005A21TCAGCCCAGCCCAGCCCAAGHypothetical protein. 
J065096D02TCAGCCCAGCCCAGCCCAAGNONE 
J065097G13TCAGCCCAGCCCAGCCCAAGNONE 
Os07g0198300006-052-H02GCAGCCCAGCCNONE 
009-097-B09GCAGCCCAGCCNONE 
009-116-E02GCAGCCCAGCCNONE 
009-186-A12GCAGCCCAGCCNONE 
AK060951GCAGCCCAGCCPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
AK071830GCAGCCCAGCCNONE 
J023117F24GCAGCCCAGCCNONE 
J065073D24GCAGCCCAGCCNONE 
J065116O11GCAGCCCAGCCNONE 
J065122C11GCAGCCCAGCCNONE 
Os07g0217600AK065971AGCCCAGCCytochrome P450 family protein. 
Os07g0240400009-080-C04GCAGCCCAGCNONE 
AK062643GCAGCCCAGCConserved hypothetical protein. 
Os07g0256200AK072904GCTGGGCTGGGCTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23GCTGGGCTGGGCTNONE 
Os07g0459200AK066819GCTGGGCTTGGGCCAACCGAGCCGNONE 
AK102099GCTGGGCTTGGGCCAACCGAGCCGSimilar to Possible kinase. 
Os07g0571100AK119301CCCAGCCCAGCConserved hypothetical protein. 
Os07g0574800006-097-G09CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
013-077-E02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
014-010-B04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK067721CCAGCCCAGCCCAGCCCACGGGCCGTGGTubulin alpha-1 chain. 
AK069140CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK104900CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013037J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013045O05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013056A21CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013119N24CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036H19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036K16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023067J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023075H08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023084K13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023097O10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033093K22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033105L08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J065219H05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075010N07CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075130I08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090014E16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090025K17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090030L19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090035J05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090036B17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090037A15CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090064C17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090069L18CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090073N11CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090077F23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090099F02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100029N06CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100056I04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100061A13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062B10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062J17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072F22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072J22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100076C03CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
X91808CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Z11931CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Os07g0589400AK072501GGCTGGGCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617GGCTGGGCTNONE 
AK104756GGCTGGGCTNONE 
Os07g0598900015-040-C12GCTGGGCTTCNONE 
AK102627GCTGGGCTTCCobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK106521GCTGGGCTTCNONE 
J033087C18GCTGGGCTTCNONE 
J033099K03GCTGGGCTTCNONE 
J065054E02GCTGGGCTTCNONE 
J090055O05GCTGGGCTTCNONE 
Os07g0603800006-088-D04GCTGGGCTNONE 
AK061822GCTGGGCTNONE 
J013040K19GCTGGGCTNONE 
Os07g0617800AK060481CAAGCCCAGCSimilar to Alanine aminotransferase. 
Os07g0668200AK059051AAAGCCCAGCCCAATNONE 
AK101682AAAGCCCAGCCCAATConserved hypothetical protein. 
AK102839AAAGCCCAGCCCAATNONE 
Os07g0695400015-036-B08GCTGGGCTGCTGGCCCATGGNONE 
AK100615GCTGGGCTGCTGGCCCATGGNONE 
AK106304GCTGGGCTGCTGGCCCATGGKIP1-like domain containing protein. 
J023108B01GCTGGGCTGCTGGCCCATGGNONE 
Os08g0134900012-044-H02AGCCCAGCCCATCANONE 
015-040-D07AGCCCAGCCCATCANONE 
AK066009AGCCCAGCCCATCAConserved hypothetical protein. 
J013047E17AGCCCAGCCCATCANONE 
J065064A15AGCCCAGCCCATCANONE 
J065116E14AGCCCAGCCCATCANONE 
J090067O03AGCCCAGCCCATCANONE 
Os08g0236900AK109597GAAGCCCAGCCCConserved hypothetical protein. 
Os08g0359500003-107-F09CCAAGCCCAGCCCATCCCCCNONE 
006-091-E08CCAAGCCCAGCCCATCCCCCNONE 
006-096-E12CCAAGCCCAGCCCATCCCCCNONE 
006-111-F11CCAAGCCCAGCCCATCCCCCNONE 
009-090-H10CCAAGCCCAGCCCATCCCCCNONE 
014-013-B02CCAAGCCCAGCCCATCCCCCNONE 
014-083-E03CCAAGCCCAGCCCATCCCCCNONE 
014-100-F05CCAAGCCCAGCCCATCCCCCNONE 
AK104798CCAAGCCCAGCCCATCCCCCNONE 
AK112034CCAAGCCCAGCCCATCCCCCHSP20-like chaperone domain containing protein. 
J013060J18CCAAGCCCAGCCCATCCCCCNONE 
J033042C22CCAAGCCCAGCCCATCCCCCNONE 
J065168I06CCAAGCCCAGCCCATCCCCCNONE 
J075077E12CCAAGCCCAGCCCATCCCCCNONE 
J075094M21CCAAGCCCAGCCCATCCCCCNONE 
J090068D17CCAAGCCCAGCCCATCCCCCNONE 
J100027E21CCAAGCCCAGCCCATCCCCCNONE 
J100058D21CCAAGCCCAGCCCATCCCCCNONE 
J100067B02CCAAGCCCAGCCCATCCCCCNONE 
Os08g0387050J043038F21GAAGCCCAGCCGAGCCGGCCCACAGCCCAGCCConserved hypothetical protein. 
Os08g0416400AK064144AGCCCAGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK064144AGCCCAGCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0435800AK121712CCAGCCCAGCCCAGATSimilar to Lipoate protein ligase-like protein. 
J065121P15CCAGCCCAGCCCAGATNONE 
Os08g0442300006-067-F05GCTGGGCTGGGCTTTNONE 
AK059843GCTGGGCTGGGCTTTNONE 
AK071719GCTGGGCTGGGCTTTSimilar to Calcineurin-like protein. 
AK102411GCTGGGCTGGGCTTTNONE 
J023108H11GCTGGGCTGGGCTTTNONE 
J033092P05GCTGGGCTGGGCTTTNONE 
J075109C09GCTGGGCTGGGCTTTNONE 
J090070B02GCTGGGCTGGGCTTTNONE 
J090076M14GCTGGGCTGGGCTTTNONE 
J100064B16GCTGGGCTGGGCTTTNONE 
Os08g0469500AK109599AGCCCAGCConserved hypothetical protein. 
Os08g0471900015-099-E10TAAGCCCAGCCCATTTNONE 
AK069434TAAGCCCAGCCCATTTZinc finger, ZPR1-type domain containing protein. 
Os08g0526500016-063-D04GCTGGGCTNONE 
AK073431GCTGGGCTSimilar to SOX-1 protein. 
J033042D10GCTGGGCTNONE 
J065019E02GCTGGGCTNONE 
Os08g0527100AK119411TCAGCCCAGCCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J090013J12TCAGCCCAGCCNONE 
J090029K18TCAGCCCAGCCNONE 
Os08g0532800AK061214GGCTGGGCTCTGGGCTGTPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
AK061387GGCTGGGCTCTGGGCTGTNONE 
AK067802GGCTGGGCTCTGGGCTGTNONE 
AK104251GGCTGGGCTCTGGGCTGTNONE 
Os08g0536000011-094-E07GGCTGGGCTNONE 
AK071782GGCTGGGCTSimilar to Pyruvate dehydrogenase E1 beta subunit isoform 1 (EC 1.2.4.1). 
AK104686GGCTGGGCTNONE 
J013041J12GGCTGGGCTNONE 
Os08g0539700AB013451GGGCTGGGCTGANONE 
AK065693GGGCTGGGCTGADisease resistance protein family protein. 
AK099855GGGCTGGGCTGANONE 
J013022K17GGGCTGGGCTGANONE 
J013035D04GGGCTGGGCTGANONE 
J013037A20GGGCTGGGCTGANONE 
J013043I01GGGCTGGGCTGANONE 
J013051J07GGGCTGGGCTGANONE 
J013056G09GGGCTGGGCTGANONE 
J013067C09GGGCTGGGCTGANONE 
J013067M22GGGCTGGGCTGANONE 
J013089C05GGGCTGGGCTGANONE 
J013106J08GGGCTGGGCTGANONE 
J013110K12GGGCTGGGCTGANONE 
J013114K06GGGCTGGGCTGANONE 
J013135N19GGGCTGGGCTGANONE 
J013149H06GGGCTGGGCTGANONE 
J075111G14GGGCTGGGCTGANONE 
Os08g0550100AB070258GACGGCCCAGCTCAGCCCAGCNONE 
AK061287GACGGCCCAGCTCAGCCCAGCSimilar to 26S proteasome subunit RPN3a. 
Os08g0564300006-049-F07GTCGCGTCGCTGGGCTNONE 
AK105923GTCGCGTCGCTGGGCTNONE 
Os08g0566700AK119354GCTGGGCTConserved hypothetical protein. 
Os09g0115500006-023-A12GCAGCCCAGCCNONE 
006-042-G01GCAGCCCAGCCNONE 
AK061717GCAGCCCAGCCCBS domain containing protein. 
AK065986GCAGCCCAGCCNONE 
J013043C13GCAGCCCAGCCNONE 
J013111D13GCAGCCCAGCCNONE 
J023114K12GCAGCCCAGCCNONE 
J065102N18GCAGCCCAGCCNONE 
Os09g0120033AK069069CTTGGGCCAGCCCAGCConserved hypothetical protein. 
Os09g0293900Os09g0293900AAAGCCCAGCCCACGAAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0381400AK070060CCAGCCCAGCSimilar to Ervatamin C (EC 3.4.22.-) (ERV-C). 
AK071091CCAGCCCAGCNONE 
AK121482CCAGCCCAGCNONE 
J023012A12CCAGCCCAGCNONE 
J023020C17CCAGCCCAGCNONE 
J023022A04CCAGCCCAGCNONE 
J023023L01CCAGCCCAGCNONE 
J023030H24CCAGCCCAGCNONE 
J023037K19CCAGCCCAGCNONE 
J023039D03CCAGCCCAGCNONE 
J023039L09CCAGCCCAGCNONE 
J023041D01CCAGCCCAGCNONE 
J023042B22CCAGCCCAGCNONE 
J023042J06CCAGCCCAGCNONE 
J023045I18CCAGCCCAGCNONE 
J023061G16CCAGCCCAGCNONE 
J023079N05CCAGCCCAGCNONE 
J023107I09CCAGCCCAGCNONE 
J023110N16CCAGCCCAGCNONE 
J023111F23CCAGCCCAGCNONE 
J023112D15CCAGCCCAGCNONE 
J023112P12CCAGCCCAGCNONE 
J023121J19CCAGCCCAGCNONE 
J023125B04CCAGCCCAGCNONE 
J023132B12CCAGCCCAGCNONE 
J023146J21CCAGCCCAGCNONE 
J090046I17CCAGCCCAGCNONE 
J090073M23CCAGCCCAGCNONE 
J090080L22CCAGCCCAGCNONE 
J100043P14CCAGCCCAGCNONE 
J100047M20CCAGCCCAGCNONE 
J100055M10CCAGCCCAGCNONE 
J100080J10CCAGCCCAGCNONE 
Os09g0397900AK101306GGCTGGGCTTTTTGGTGGGCCAASimilar to FEG protein. 
Os09g0458400AK070055ACTGACAGCCCAGCCCATTAConserved hypothetical protein. 
AK120321ACTGACAGCCCAGCCCATTANONE 
J065064N11ACTGACAGCCCAGCCCATTANONE 
J065083J06ACTGACAGCCCAGCCCATTANONE 
J065121D24ACTGACAGCCCAGCCCATTANONE 
J065156I22ACTGACAGCCCAGCCCATTANONE 
J065163J24ACTGACAGCCCAGCCCATTANONE 
J075001I02ACTGACAGCCCAGCCCATTANONE 
J090088O06ACTGACAGCCCAGCCCATTANONE 
Os09g0487500AK108131AAAGCCCAGCCCATTTConserved hypothetical protein. 
J080062L16AAAGCCCAGCCCATTTNONE 
Os09g0516800009-017-A01TAAGCCCAGCCCAACCConserved hypothetical protein. 
Os09g0526800014-002-D10GAAGCCCAGCNONE 
AK060048GAAGCCCAGCNONE 
AK072174GAAGCCCAGCNONE 
AK105121GAAGCCCAGCNC domain containing protein. 
J013135P13GAAGCCCAGCNONE 
J033135C23GAAGCCCAGCNONE 
J043036C17GAAGCCCAGCNONE 
J065066N16GAAGCCCAGCNONE 
Os09g0531900AK073015CAGGCCCAAATAGCCCAGCSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os09g0568000AK068829TACTGGGCTGGGCTTGNONE 
Os09g0571400AK103109AAATGGGCTGGGCTTGCyclophilin 1. 
J023011A12AAATGGGCTGGGCTTGNONE 
J033119A20AAATGGGCTGGGCTTGNONE 
J053034N16AAATGGGCTGGGCTTGNONE 
J053045N23AAATGGGCTGGGCTTGNONE 
J053052J12AAATGGGCTGGGCTTGNONE 
J053052K04AAATGGGCTGGGCTTGNONE 
J053099M15AAATGGGCTGGGCTTGNONE 
J065071H23AAATGGGCTGGGCTTGNONE 
J065131B16AAATGGGCTGGGCTTGNONE 
J075003F19AAATGGGCTGGGCTTGNONE 
J075116F02AAATGGGCTGGGCTTGNONE 
J075126G05AAATGGGCTGGGCTTGNONE 
J075145E09AAATGGGCTGGGCTTGNONE 
J075149O22AAATGGGCTGGGCTTGNONE 
J075163A09AAATGGGCTGGGCTTGNONE 
J075194A09AAATGGGCTGGGCTTGNONE 
L29471AAATGGGCTGGGCTTGNONE 
Os11g0100100009-122-C12ACATGGGCTGGGCTSimilar to Gamma-aminobutyric acid receptor-associated protein-like 2 (GABA(A) receptor-associated protein-like 2) (Ganglioside expression factor 2) (GEF-2) (General protein transport factor p16) (MAP1 light chain 3 related protein). 
Os11g0147600AK111127GCTGGGCTTCHypothetical protein. 
Os11g0168200005-010-H01CCCAGCCCAGCCCAGNONE 
009-156-F07CCCAGCCCAGCCCAGNONE 
012-025-F01CCCAGCCCAGCCCAGNONE 
012-089-A02CCCAGCCCAGCCCAGNONE 
016-016-E08CCCAGCCCAGCCCAGNONE 
AK073392CCCAGCCCAGCCCAG60S ribosomal protein L3. 
AK099225CCCAGCCCAGCCCAGNONE 
AK101469CCCAGCCCAGCCCAGNONE 
AY236158CCCAGCCCAGCCCAGNONE 
J013152M22CCCAGCCCAGCCCAGNONE 
J023013N11CCCAGCCCAGCCCAGNONE 
J023038J11CCCAGCCCAGCCCAGNONE 
J023054N21CCCAGCCCAGCCCAGNONE 
J033041E13CCCAGCCCAGCCCAGNONE 
J033050O09CCCAGCCCAGCCCAGNONE 
J033093G05CCCAGCCCAGCCCAGNONE 
J033094J17CCCAGCCCAGCCCAGNONE 
J033112J24CCCAGCCCAGCCCAGNONE 
J033113D05CCCAGCCCAGCCCAGNONE 
J033120K10CCCAGCCCAGCCCAGNONE 
J033121H19CCCAGCCCAGCCCAGNONE 
J033129C08CCCAGCCCAGCCCAGNONE 
J033140H24CCCAGCCCAGCCCAGNONE 
J065020I18CCCAGCCCAGCCCAGNONE 
J065058L01CCCAGCCCAGCCCAGNONE 
J065059G22CCCAGCCCAGCCCAGNONE 
J065212L09CCCAGCCCAGCCCAGNONE 
J075047P09CCCAGCCCAGCCCAGNONE 
J075063C18CCCAGCCCAGCCCAGNONE 
J075076E07CCCAGCCCAGCCCAGNONE 
J075077F14CCCAGCCCAGCCCAGNONE 
J075086C22CCCAGCCCAGCCCAGNONE 
J075161L09CCCAGCCCAGCCCAGNONE 
J075177K20CCCAGCCCAGCCCAGNONE 
J090007L06CCCAGCCCAGCCCAGNONE 
J090010M02CCCAGCCCAGCCCAGNONE 
J090013M20CCCAGCCCAGCCCAGNONE 
J090044I15CCCAGCCCAGCCCAGNONE 
J090045O06CCCAGCCCAGCCCAGNONE 
J090060L04CCCAGCCCAGCCCAGNONE 
J090061C17CCCAGCCCAGCCCAGNONE 
J090062F10CCCAGCCCAGCCCAGNONE 
J090066L03CCCAGCCCAGCCCAGNONE 
J090089E13CCCAGCCCAGCCCAGNONE 
J090096D21CCCAGCCCAGCCCAGNONE 
J100039F12CCCAGCCCAGCCCAGNONE 
J100053N06CCCAGCCCAGCCCAGNONE 
Os11g0184900011-088-C07GCGGCCCAGCCCAGCNONE 
015-036-B03GCGGCCCAGCCCAGCNONE 
016-087-F07GCGGCCCAGCCCAGCNONE 
AB028184GCGGCCCAGCCCAGCNONE 
AK063399GCGGCCCAGCCCAGCSimilar to NAC-domain protein 5-7. 
AK064292GCGGCCCAGCCCAGCNONE 
AK102475GCGGCCCAGCCCAGCNONE 
J033094I01GCGGCCCAGCCCAGCNONE 
J090087J16GCGGCCCAGCCCAGCNONE 
Os11g0306300006-102-D09GCTGGGCTGTNONE 
AK109384GCTGGGCTGTSimilar to Herbicide safener binding protein. 
Os11g0513900AK101049GGCTGGGCTGGGCCTTGConserved hypothetical protein. 
Os11g0545800AK073687CCAGCCCAGCCCRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCAGCCCAGCCCNONE 
Os12g0100050Os12g0100050ACATGGGCTGGGCTGGGCTGGGCTLight chain 3 (LC3) family protein. 
Os12g0100100006-036-G03AGCCCAGCCCAGCCCAGCCCATGTNONE 
AK061492AGCCCAGCCCAGCCCAGCCCATGTSimilar to ALY protein. 
AK068452AGCCCAGCCCAGCCCAGCCCATGTNONE 
J013153E18AGCCCAGCCCAGCCCAGCCCATGTNONE 
J033140D06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065046A19AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065061F08AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065101I03AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065158B05AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065162H06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065195I23AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065218E07AGCCCAGCCCAGCCCAGCCCATGTNONE 
Os12g0236400AK059754AGCCCAGCNONE 
AK069870AGCCCAGCNONE 
D10334AGCCCAGCAdenylate kinase A (EC 2.7.4.3) (ATP-AMP transphosphorylase). 
D10429AGCCCAGCNONE 
J023039H09AGCCCAGCNONE 
J033075J04AGCCCAGCNONE 
J033088L16AGCCCAGCNONE 
J053037D11AGCCCAGCNONE 
J090084M20AGCCCAGCNONE 
J100078B20AGCCCAGCNONE 
Os12g0422800J065011P21AGCCCAGCNONE 
J065036P16AGCCCAGCHypothetical protein. 
J065118L16AGCCCAGCNONE 
J065132N08AGCCCAGCNONE 
J065136P11AGCCCAGCNONE 
J065140I05AGCCCAGCNONE 
J065189B21AGCCCAGCNONE 
J065189P11AGCCCAGCNONE 
J065218P03AGCCCAGCNONE 
Os12g0479400AK065254AAAGCCCAAGCCCAGCCCAACCNONE 
AK067061AAAGCCCAAGCCCAGCCCAACCSimilar to Auxin response factor 1. 
Os12g0573200AK111522AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
AK121943AGCCCAAGCCCAGCCCAGCCCAGCCCAAACGRAS transcription factor domain containing protein. 
J013002M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013151M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013159J22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J023087F18AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033107F03AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033125L09AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033126E12AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J043022I15AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J065176F05AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090034D17AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090075J06AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058D22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058P04AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.