version

Summary of OsREG465 (All List)

OrganismOryza sativa  
IDOsREG465  
SequenceAGCCCATA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1036  

Entry Sequences (1036 entries)

LocusGene modelSequenceDescription
Os01g0104000AK072087TAGGCCCACAGAAGCCCATAANONE 
AK103808TAGGCCCACAGAAGCCCATAAC-type lectin domain containing protein. 
Os01g0104100AK072797TTATGGGCTTCTGTGGGCCTAZinc finger, RING-type domain containing protein. 
AK104280TTATGGGCTTCTGTGGGCCTANONE 
Os01g0139600AK073130TCAGCCCATACSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0155600006-048-F03AAAGCCCATATNONE 
AK060171AAAGCCCATATNONE 
AK071635AAAGCCCATATSimilar to Splicing factor RSZ33. 
J023080A03AAAGCCCATATNONE 
J023100L15AAAGCCCATATNONE 
J033075I17AAAGCCCATATNONE 
J033085O09AAAGCCCATATNONE 
J033105E15AAAGCCCATATNONE 
J033132N10AAAGCCCATATNONE 
J033132P12AAAGCCCATATNONE 
J033149H12AAAGCCCATATNONE 
J043026M03AAAGCCCATATNONE 
J080305J10AAAGCCCATATNONE 
J080308K03AAAGCCCATATNONE 
J090023M04AAAGCCCATATNONE 
J090078F24AAAGCCCATATNONE 
J100066P05AAAGCCCATATNONE 
Os01g0191800AK061360AGCCCATAAAGGCCCACCTNONE 
Os01g0196600AK101742AGCCCATACNONE 
AK101742TATGGGCTTTNONE 
U25430AGCCCATACSimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
U25430TATGGGCTTTSimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
Os01g0229900AK065381ACAGCCCATANONE 
AK065429ACAGCCCATASimilar to Shaggy-related protein kinase dzeta (EC 2.7.1.-) (ASK-dzeta). 
Os01g0242200AK107468TTATGGGCTZinc finger, C2H2-type domain containing protein. 
Os01g0254000006-037-A11GAAGCCCATANONE 
006-059-H09GAAGCCCATANONE 
006-088-D11GAAGCCCATANONE 
006-112-B06GAAGCCCATANONE 
006-120-E12GAAGCCCATANONE 
AK111904GAAGCCCATANONE 
AK111979GAAGCCCATANONE 
AK119548GAAGCCCATANONE 
AY620417GAAGCCCATASimilar to NTGB2 (Fragment). 
J023112F13GAAGCCCATANONE 
J053066C19GAAGCCCATANONE 
J065006L12GAAGCCCATANONE 
J065019L17GAAGCCCATANONE 
J065081J05GAAGCCCATANONE 
J065085D02GAAGCCCATANONE 
J065203D03GAAGCCCATANONE 
J065210O20GAAGCCCATANONE 
J090062P06GAAGCCCATANONE 
J090063N07GAAGCCCATANONE 
J100061H24GAAGCCCATANONE 
Os01g0328400006-092-H09GAAGCCCATAANONE 
009-085-A02GAAGCCCATAANONE 
012-078-B03GAAGCCCATAANONE 
AK061988GAAGCCCATAAUbiquitin. 
J013073B13GAAGCCCATAANONE 
J023135L09GAAGCCCATAANONE 
J023135O07GAAGCCCATAANONE 
J033027B12GAAGCCCATAANONE 
J033084P17GAAGCCCATAANONE 
J065010M05GAAGCCCATAANONE 
J065021N11GAAGCCCATAANONE 
J065021N12GAAGCCCATAANONE 
J065031K11GAAGCCCATAANONE 
J065072P04GAAGCCCATAANONE 
J065098D05GAAGCCCATAANONE 
J065122N23GAAGCCCATAANONE 
J065129L13GAAGCCCATAANONE 
J065135N13GAAGCCCATAANONE 
J065215N10GAAGCCCATAANONE 
J075120N22GAAGCCCATAANONE 
J090011G23GAAGCCCATAANONE 
J090014F06GAAGCCCATAANONE 
J090040G23GAAGCCCATAANONE 
J090075I20GAAGCCCATAANONE 
J090075N01GAAGCCCATAANONE 
J090089B04GAAGCCCATAANONE 
J090090F08GAAGCCCATAANONE 
J090091M17GAAGCCCATAANONE 
J090094L03GAAGCCCATAANONE 
J090099L06GAAGCCCATAANONE 
J100018A18GAAGCCCATAANONE 
J100027H13GAAGCCCATAANONE 
J100069C05GAAGCCCATAANONE 
J100086L10GAAGCCCATAANONE 
Os01g0357400012-030-F01TATGGGCTNONE 
012-045-H02TATGGGCTNONE 
AK063489TATGGGCTSimilar to Alpha-amylase. 
D10417TATGGGCTNONE 
Os01g0513800012-032-E11GGCCGAAAAGCCCATANONE 
AK100776GGCCGAAAAGCCCATASimilar to Brix domain containing protein 1 homolog. 
J023120C10GGCCGAAAAGCCCATANONE 
J033044A22GGCCGAAAAGCCCATANONE 
J033048H13GGCCGAAAAGCCCATANONE 
J033118F03GGCCGAAAAGCCCATANONE 
J065176B05GGCCGAAAAGCCCATANONE 
J075026B19GGCCGAAAAGCCCATANONE 
J075048I23GGCCGAAAAGCCCATANONE 
J075141A19GGCCGAAAAGCCCATANONE 
J075148E05GGCCGAAAAGCCCATANONE 
J090031M12GGCCGAAAAGCCCATANONE 
Os01g0530300AK111105AAGGCCCAGCCCATACHypothetical protein. 
J090023M11AAGGCCCAGCCCATACNONE 
J090053G13AAGGCCCAGCCCATACNONE 
Os01g0581300AK066182TCCGGCCCATAGCAGCCCATATSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015TCCGGCCCATAGCAGCCCATATNONE 
Os01g0626300016-070-G04ATATGGGCTGGNONE 
AK122071ATATGGGCTGGSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04ATATGGGCTGGNONE 
J033117J08ATATGGGCTGGNONE 
J065007O12ATATGGGCTGGNONE 
J065020K12ATATGGGCTGGNONE 
J065142D24ATATGGGCTGGNONE 
J065157K19ATATGGGCTGGNONE 
J080307H19ATATGGGCTGGNONE 
J080311D16ATATGGGCTGGNONE 
J080316C12ATATGGGCTGGNONE 
J080316E03ATATGGGCTGGNONE 
J100033K16ATATGGGCTGGNONE 
J100042J21ATATGGGCTGGNONE 
J100051E06ATATGGGCTGGNONE 
J100071E22ATATGGGCTGGNONE 
Os01g0661400AK073113CCAAGCCCATANucleic acid-binding, OB-fold domain containing protein. 
J023014C20CCAAGCCCATANONE 
J033022G03CCAAGCCCATANONE 
J065050H15CCAAGCCCATANONE 
J065059J19CCAAGCCCATANONE 
J065085I24CCAAGCCCATANONE 
J065166G12CCAAGCCCATANONE 
J065182C18CCAAGCCCATANONE 
Os01g0680500AK069325ATATGGGCTCGTTGGATConserved hypothetical protein. 
J090003P06ATATGGGCTCGTTGGATNONE 
Os01g0752300AK121755ATATGGGCTTCGGCCCATGASimilar to 60S ribosomal protein L18a-1. 
AK121755CCAGCCCATATSimilar to 60S ribosomal protein L18a-1. 
J013049F10ATATGGGCTTCGGCCCATGANONE 
J013049F10CCAGCCCATATNONE 
J013088L10ATATGGGCTTCGGCCCATGANONE 
J013088L10CCAGCCCATATNONE 
J023020B21ATATGGGCTTCGGCCCATGANONE 
J023020B21CCAGCCCATATNONE 
J023038M01ATATGGGCTTCGGCCCATGANONE 
J023038M01CCAGCCCATATNONE 
J033058H15ATATGGGCTTCGGCCCATGANONE 
J033058H15CCAGCCCATATNONE 
J033088C04ATATGGGCTTCGGCCCATGANONE 
J033088C04CCAGCCCATATNONE 
J033115N19ATATGGGCTTCGGCCCATGANONE 
J033115N19CCAGCCCATATNONE 
J033131H04ATATGGGCTTCGGCCCATGANONE 
J033131H04CCAGCCCATATNONE 
J065067E05ATATGGGCTTCGGCCCATGANONE 
J065067E05CCAGCCCATATNONE 
J065085C07ATATGGGCTTCGGCCCATGANONE 
J065085C07CCAGCCCATATNONE 
J065095D12ATATGGGCTTCGGCCCATGANONE 
J065095D12CCAGCCCATATNONE 
J065124B19ATATGGGCTTCGGCCCATGANONE 
J065124B19CCAGCCCATATNONE 
J065181H07ATATGGGCTTCGGCCCATGANONE 
J065181H07CCAGCCCATATNONE 
J065197B09ATATGGGCTTCGGCCCATGANONE 
J065197B09CCAGCCCATATNONE 
J075090K22ATATGGGCTTCGGCCCATGANONE 
J075090K22CCAGCCCATATNONE 
J075101P17ATATGGGCTTCGGCCCATGANONE 
J075101P17CCAGCCCATATNONE 
J075181F13ATATGGGCTTCGGCCCATGANONE 
J075181F13CCAGCCCATATNONE 
J075190H19ATATGGGCTTCGGCCCATGANONE 
J075190H19CCAGCCCATATNONE 
J090004P17ATATGGGCTTCGGCCCATGANONE 
J090004P17CCAGCCCATATNONE 
J090066I03ATATGGGCTTCGGCCCATGANONE 
J090066I03CCAGCCCATATNONE 
Os01g0767100AK109493AGCCCATACSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0782300AK109175AAAAGCCCATAConserved hypothetical protein. 
Os01g0811100006-061-F11TTATGGGCTCGTGGACCNONE 
AB026562TTATGGGCTCGTGGACCNONE 
AK061784TTATGGGCTCGTGGACCNONE 
AK103541TTATGGGCTCGTGGACCProteasome subunit alpha type 3 (EC 3.4.25.1) (20S proteasome alpha subunit G) (20S proteasome subunit alpha-7). 
J013020B12TTATGGGCTCGTGGACCNONE 
J013022J21TTATGGGCTCGTGGACCNONE 
J013056G19TTATGGGCTCGTGGACCNONE 
J013060O07TTATGGGCTCGTGGACCNONE 
J013110I07TTATGGGCTCGTGGACCNONE 
J013160D19TTATGGGCTCGTGGACCNONE 
J090035A13TTATGGGCTCGTGGACCNONE 
Os01g0852200AK063954GGGCCGTATGGGCTTTNONE 
Os01g0861000AK058707CAAGCCCATATConserved hypothetical protein. 
Os01g0912600009-186-H02AGCCCATACNONE 
AK063179AGCCCATACConserved hypothetical protein. 
Os02g0162500009-181-F03TTGGCCCAGCCCATAANONE 
AK058907TTGGCCCAGCCCATAANONE 
AK121223TTGGCCCAGCCCATAASimilar to 40S ribosomal protein S14. 
J023090I10TTGGCCCAGCCCATAANONE 
J023136J11TTGGCCCAGCCCATAANONE 
J053097J20TTGGCCCAGCCCATAANONE 
J053098F01TTGGCCCAGCCCATAANONE 
J065065B09TTGGCCCAGCCCATAANONE 
J065082M04TTGGCCCAGCCCATAANONE 
J065188O05TTGGCCCAGCCCATAANONE 
J075057P15TTGGCCCAGCCCATAANONE 
J075061J08TTGGCCCAGCCCATAANONE 
J075061N15TTGGCCCAGCCCATAANONE 
J075131I08TTGGCCCAGCCCATAANONE 
J075141H13TTGGCCCAGCCCATAANONE 
J080062E14TTGGCCCAGCCCATAANONE 
J080062P15TTGGCCCAGCCCATAANONE 
J080318G17TTGGCCCAGCCCATAANONE 
J080319G19TTGGCCCAGCCCATAANONE 
J090001L10TTGGCCCAGCCCATAANONE 
J090024I18TTGGCCCAGCCCATAANONE 
J090033F24TTGGCCCAGCCCATAANONE 
J090036M16TTGGCCCAGCCCATAANONE 
J090040I24TTGGCCCAGCCCATAANONE 
J090048P06TTGGCCCAGCCCATAANONE 
J090049B12TTGGCCCAGCCCATAANONE 
J090068C02TTGGCCCAGCCCATAANONE 
J090069O04TTGGCCCAGCCCATAANONE 
J090084H22TTGGCCCAGCCCATAANONE 
J100022L03TTGGCCCAGCCCATAANONE 
J100028O14TTGGCCCAGCCCATAANONE 
J100028O18TTGGCCCAGCCCATAANONE 
J100032A15TTGGCCCAGCCCATAANONE 
J100033D21TTGGCCCAGCCCATAANONE 
J100034J23TTGGCCCAGCCCATAANONE 
J100043K22TTGGCCCAGCCCATAANONE 
J100052M22TTGGCCCAGCCCATAANONE 
J100053N03TTGGCCCAGCCCATAANONE 
J100074N24TTGGCCCAGCCCATAANONE 
J100082J10TTGGCCCAGCCCATAANONE 
Os02g0188000011-003-E06AGCCCATAANONE 
AK105236AGCCCATAAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os02g0188500AK102004AGCCCATACAACTGGGCCTCGGCCCATCANONE 
AK106917AGCCCATACAACTGGGCCTCGGCCCATCAUbiquitin domain containing protein. 
J090039N13AGCCCATACAACTGGGCCTCGGCCCATCANONE 
Os02g0439700AK067803CCAGCCCATATPlant specific eukaryotic initiation factor 4B family protein. 
Os02g0467200014-053-H06GAAGCCCATAANONE 
AK063704GAAGCCCATAAConserved hypothetical protein. 
J065197J05GAAGCCCATAANONE 
Os02g0496900AK059542ATATGGGCTGTConserved hypothetical protein. 
J053031E06ATATGGGCTGTNONE 
J065195E11ATATGGGCTGTNONE 
J090008P16ATATGGGCTGTNONE 
Os02g0618700AK070657CCCAGCCCATCAAGCCCATATLung seven transmembrane receptor family protein. 
J023056H15CCCAGCCCATCAAGCCCATATNONE 
Os02g0621700011-079-F10CCAGCCCATACNONE 
AK101006CCAGCCCATACSimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta). 
AK103525CCAGCCCATACNONE 
J013026C02CCAGCCCATACNONE 
J013104M10CCAGCCCATACNONE 
J023003D01CCAGCCCATACNONE 
J023007H13CCAGCCCATACNONE 
J023019G09CCAGCCCATACNONE 
J023020L19CCAGCCCATACNONE 
J023022L12CCAGCCCATACNONE 
J023022O14CCAGCCCATACNONE 
J023036F16CCAGCCCATACNONE 
J023047D16CCAGCCCATACNONE 
J023052P08CCAGCCCATACNONE 
J023077C01CCAGCCCATACNONE 
J023083M06CCAGCCCATACNONE 
J023105A11CCAGCCCATACNONE 
J023117F21CCAGCCCATACNONE 
J023119D20CCAGCCCATACNONE 
J023148E03CCAGCCCATACNONE 
J023149B13CCAGCCCATACNONE 
J033029A10CCAGCCCATACNONE 
J033046L17CCAGCCCATACNONE 
J033052M04CCAGCCCATACNONE 
J033057M14CCAGCCCATACNONE 
J033066K24CCAGCCCATACNONE 
J033069K02CCAGCCCATACNONE 
J033079G14CCAGCCCATACNONE 
J033101E06CCAGCCCATACNONE 
J033116E06CCAGCCCATACNONE 
J033118L18CCAGCCCATACNONE 
J033135B13CCAGCCCATACNONE 
J033136C10CCAGCCCATACNONE 
J033136P08CCAGCCCATACNONE 
J043027B13CCAGCCCATACNONE 
J065039I03CCAGCCCATACNONE 
J065185N21CCAGCCCATACNONE 
J090008D14CCAGCCCATACNONE 
J090029K17CCAGCCCATACNONE 
J090047H20CCAGCCCATACNONE 
J090048N17CCAGCCCATACNONE 
J090085G08CCAGCCCATACNONE 
J090089F07CCAGCCCATACNONE 
Os02g0629900AK108563TAAGCCCATAAConserved hypothetical protein. 
J065138O07TAAGCCCATAANONE 
Os02g0649700AK058221AGCCCATANONE 
Os02g0661300016-077-C09AAATGGGCCAGCCCATAANONE 
AK106503AAATGGGCCAGCCCATAAConserved hypothetical protein. 
Os02g0672700AK059611AGCCCATADNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179AGCCCATANONE 
J023098L23AGCCCATANONE 
J065042J21AGCCCATANONE 
J065187L09AGCCCATANONE 
J065190O10AGCCCATANONE 
J080041G14AGCCCATANONE 
J080078K08AGCCCATANONE 
J080089D20AGCCCATANONE 
J080094D04AGCCCATANONE 
Os02g0682600AK108470ATATGGGCTZinc finger, Tim10/DDP-type family protein. 
J065019B06ATATGGGCTNONE 
J065065L01ATATGGGCTNONE 
Os02g0690600AK110831CCAGCCCATATU box domain containing protein. 
Os02g0700100AK102954AAAGCCCATAAAGCCCAGCSimilar to WD-repeat protein. 
Os02g0744100006-070-H12ATATGGGCTTTNONE 
006-115-C05ATATGGGCTTTNONE 
AK061274ATATGGGCTTTSAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0765600011-044-C02TATGGGCTNONE 
011-059-H12TATGGGCTNONE 
012-010-G07TATGGGCTNONE 
012-040-D02TATGGGCTNONE 
012-048-F02TATGGGCTNONE 
012-055-C12TATGGGCTNONE 
012-065-C04TATGGGCTNONE 
012-086-D01TATGGGCTNONE 
012-099-G02TATGGGCTNONE 
015-002-D01TATGGGCTNONE 
015-067-D08TATGGGCTNONE 
016-060-E08TATGGGCTNONE 
AK101744TATGGGCTAlpha-amylase precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase) (Isozyme 1B). 
J033023N15TATGGGCTNONE 
J033061O03TATGGGCTNONE 
J033107J03TATGGGCTNONE 
J033119C02TATGGGCTNONE 
J043001H07TATGGGCTNONE 
J043003H07TATGGGCTNONE 
J043003I05TATGGGCTNONE 
J043009K22TATGGGCTNONE 
J043009L08TATGGGCTNONE 
J043012J02TATGGGCTNONE 
J043015P13TATGGGCTNONE 
J043016H11TATGGGCTNONE 
J043020F17TATGGGCTNONE 
J053027C06TATGGGCTNONE 
J053099F07TATGGGCTNONE 
J065025M06TATGGGCTNONE 
J065029M17TATGGGCTNONE 
J065044H20TATGGGCTNONE 
J065089P12TATGGGCTNONE 
J065098N21TATGGGCTNONE 
J065143N20TATGGGCTNONE 
J065161C24TATGGGCTNONE 
J065170A09TATGGGCTNONE 
J065197N16TATGGGCTNONE 
J065214E11TATGGGCTNONE 
J065216J23TATGGGCTNONE 
J100026D11TATGGGCTNONE 
J100062F01TATGGGCTNONE 
J100080O15TATGGGCTNONE 
J100082F09TATGGGCTNONE 
M24286TATGGGCTNONE 
Os02g0772500AK100349TTATGGGCTGAProtein prenyltransferase domain containing protein. 
J023082M21TTATGGGCTGANONE 
J065047H11TTATGGGCTGANONE 
J065055F20TTATGGGCTGANONE 
J065082I22TTATGGGCTGANONE 
J100074B04TTATGGGCTGANONE 
Os02g0780800J090080O19AAAGCCCATATNONE 
J090091I06AAAGCCCATATNONE 
Os02g0816700009-132-E07TTATGGGCTNONE 
009-132-E07TTATGGGCTNONE 
AK059572TTATGGGCTConserved hypothetical protein. 
AK059572TTATGGGCTConserved hypothetical protein. 
Os02g0816800013-089-A09AGCCCATAANONE 
013-089-A09AGCCCATAANONE 
AK102271AGCCCATAANAD-dependent epimerase/dehydratase family protein. 
AK102271AGCCCATAANAD-dependent epimerase/dehydratase family protein. 
J013105O04AGCCCATAANONE 
J013105O04AGCCCATAANONE 
J013124I08AGCCCATAANONE 
J013124I08AGCCCATAANONE 
J023002E08AGCCCATAANONE 
J023002E08AGCCCATAANONE 
J023025C01AGCCCATAANONE 
J023025C01AGCCCATAANONE 
J023037O12AGCCCATAANONE 
J023037O12AGCCCATAANONE 
J023049N06AGCCCATAANONE 
J023049N06AGCCCATAANONE 
J023069G18AGCCCATAANONE 
J023069G18AGCCCATAANONE 
J033029M02AGCCCATAANONE 
J033029M02AGCCCATAANONE 
J033037L22AGCCCATAANONE 
J033037L22AGCCCATAANONE 
J033089A08AGCCCATAANONE 
J033089A08AGCCCATAANONE 
J033103L07AGCCCATAANONE 
J033103L07AGCCCATAANONE 
J033125L19AGCCCATAANONE 
J033125L19AGCCCATAANONE 
J090008N20AGCCCATAANONE 
J090008N20AGCCCATAANONE 
J090041F23AGCCCATAANONE 
J090041F23AGCCCATAANONE 
J090092H16AGCCCATAANONE 
J090092H16AGCCCATAANONE 
Os02g0820600AK066549TATGGGCTATGGGCCATConserved hypothetical protein. 
J013070F02TATGGGCTATGGGCCATNONE 
Os02g0820700006-025-E04ATGGCCCATAGCCCATANONE 
006-052-F06ATGGCCCATAGCCCATANONE 
006-082-A05ATGGCCCATAGCCCATANONE 
006-089-B06ATGGCCCATAGCCCATANONE 
AK060869ATGGCCCATAGCCCATASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK061365ATGGCCCATAGCCCATANONE 
AK103008ATGGCCCATAGCCCATANONE 
AK104724ATGGCCCATAGCCCATANONE 
J013049H21ATGGCCCATAGCCCATANONE 
J043027N22ATGGCCCATAGCCCATANONE 
J075031I15ATGGCCCATAGCCCATANONE 
J075132D23ATGGCCCATAGCCCATANONE 
Os02g0823800AK120318GCAGCCCATACAACGGGCCCAACTConserved hypothetical protein. 
J075055J16GCAGCCCATACAACGGGCCCAACTNONE 
Os03g0110300006-043-D12AAAAGCCCATANONE 
009-061-E04AAAAGCCCATANONE 
009-181-H02AAAAGCCCATANONE 
009-193-F10AAAAGCCCATANONE 
AK066190AAAAGCCCATANONE 
AK066769AAAAGCCCATANONE 
AK106206AAAAGCCCATAConserved hypothetical protein. 
J065163L08AAAAGCCCATANONE 
J080034A14AAAAGCCCATANONE 
J080052E14AAAAGCCCATANONE 
J090012J01AAAAGCCCATANONE 
J100045M01AAAAGCCCATANONE 
J100065N06AAAAGCCCATANONE 
Os03g0122000AK101458ACAGCCCATAProtein kinase-like domain containing protein. 
J013035K10ACAGCCCATANONE 
J013050E10ACAGCCCATANONE 
J033040C13ACAGCCCATANONE 
Os03g0128100003-107-E07TTATGGGCTTCNONE 
AK062279TTATGGGCTTCSimilar to Callose synthase 1 catalytic subunit. 
AK105008TTATGGGCTTCNONE 
Os03g0135600J065183G03TTATGGGCTTCAnkyrin repeat containing protein. 
Os03g0137500006-040-G01GAAGCCCATATNONE 
015-054-G04GAAGCCCATATNONE 
AK060148GAAGCCCATATNONE 
AK073584GAAGCCCATATNONE 
AK100231GAAGCCCATATSimilar to VDAC3.1. 
J013146L24GAAGCCCATATNONE 
J023022O09GAAGCCCATATNONE 
J023049J19GAAGCCCATATNONE 
J023133L05GAAGCCCATATNONE 
J023143P12GAAGCCCATATNONE 
J033040B12GAAGCCCATATNONE 
J033050O14GAAGCCCATATNONE 
J033066G05GAAGCCCATATNONE 
J065007J18GAAGCCCATATNONE 
J100067H13GAAGCCCATATNONE 
Os03g0138600Os03g0138600AGTTGGGCCGAAGAAGCCCATAProtein of unknown function DUF810 family protein. 
Os03g0138700009-045-H03AGCCCATACNONE 
AK072119AGCCCATACTGF-beta receptor, type I/II extracellular region family protein. 
J013025I16AGCCCATACNONE 
J013123D02AGCCCATACNONE 
J023048B09AGCCCATACNONE 
J023048C09AGCCCATACNONE 
J065027O03AGCCCATACNONE 
J065028C03AGCCCATACNONE 
J065080H22AGCCCATACNONE 
J065102H03AGCCCATACNONE 
J065137P14AGCCCATACNONE 
J065143C23AGCCCATACNONE 
J065168G06AGCCCATACNONE 
J065192N07AGCCCATACNONE 
J065205I11AGCCCATACNONE 
J075040F03AGCCCATACNONE 
J075052H20AGCCCATACNONE 
J075118L18AGCCCATACNONE 
J075126C19AGCCCATACNONE 
J075173L07AGCCCATACNONE 
Os03g0193225012-084-B12TATGGGCTNONE 
AK069459TATGGGCTFrigida-like family protein. 
J023019D20TATGGGCTNONE 
Os03g0239300AK066038ACAGCCCATATZinc finger, C2H2-type domain containing protein. 
AK068149ACAGCCCATATNONE 
AK071768ACAGCCCATATNONE 
J053027G22ACAGCCCATATNONE 
J075048G23ACAGCCCATATNONE 
J100060G19ACAGCCCATATNONE 
Os03g0263500006-112-E09AGCCCATATNONE 
009-122-C01AGCCCATATNONE 
AK106060AGCCCATATSimilar to Splicing factor 3A subunit 2 (Spliceosome associated protein 62) (SAP 62) (SF3a66). 
Os03g0266900013-080-C12TATGGGCTACAGCCCACCCNONE 
014-010-A09TATGGGCTACAGCCCACCCNONE 
014-013-G10TATGGGCTACAGCCCACCCNONE 
014-019-D06TATGGGCTACAGCCCACCCNONE 
014-030-F08TATGGGCTACAGCCCACCCNONE 
014-039-C05TATGGGCTACAGCCCACCCNONE 
014-053-H08TATGGGCTACAGCCCACCCNONE 
014-089-F06TATGGGCTACAGCCCACCCNONE 
014-094-A05TATGGGCTACAGCCCACCCNONE 
014-098-C12TATGGGCTACAGCCCACCCNONE 
AK119243TATGGGCTACAGCCCACCCLow molecular mass heat shock protein Oshsp17.3. 
AK119717TATGGGCTACAGCCCACCCNONE 
D12635TATGGGCTACAGCCCACCCNONE 
M80186TATGGGCTACAGCCCACCCNONE 
Os03g0276800015-062-A05TTATGGGCTTGNONE 
AK106371TTATGGGCTTGHeat shock protein Hsp70 family protein. 
Os03g0277500014-019-A09AGCCCATACNONE 
AK063650AGCCCATACGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
J065043F18AGCCCATACNONE 
J065092A08AGCCCATACNONE 
J065122E17AGCCCATACNONE 
J065182K12AGCCCATACNONE 
J065197H15AGCCCATACNONE 
J075115A05AGCCCATACNONE 
Os03g0279600006-070-A07CCAGCCCATATNONE 
AK061080CCAGCCCATATConserved hypothetical protein. 
AK071043CCAGCCCATATNONE 
AK103191CCAGCCCATATNONE 
J065077E22CCAGCCCATATNONE 
J065208F22CCAGCCCATATNONE 
J075156K12CCAGCCCATATNONE 
Os03g0333000AK109811TATGGGCTGGGCCAAConserved hypothetical protein. 
J065152D04TATGGGCTGGGCCAANONE 
J090011B05TATGGGCTGGGCCAANONE 
Os03g0333100AK101050TTGGCCCAGCCCATAProtein of unknown function DUF663 domain containing protein. 
Os03g0336000AK100067GCAGCCCATATProtein prenyltransferase domain containing protein. 
J065161K02GCAGCCCATATNONE 
J065162C21GCAGCCCATATNONE 
Os03g0343900009-077-C03TCAGCCCATATNONE 
AK105813TCAGCCCATATPhotosystem II protein PsbX family protein. 
J100059N03TCAGCCCATATNONE 
J100079C20TCAGCCCATATNONE 
Os03g0576900AK071314AGCCCATACAmino acid/polyamine transporter I family protein. 
J023074L08AGCCCATACNONE 
J023084D13AGCCCATACNONE 
J080011C14AGCCCATACNONE 
J080012F24AGCCCATACNONE 
J080018M05AGCCCATACNONE 
J080021G05AGCCCATACNONE 
J080021N18AGCCCATACNONE 
J080023E19AGCCCATACNONE 
J080024H14AGCCCATACNONE 
J080025E15AGCCCATACNONE 
J080038F19AGCCCATACNONE 
J080044N09AGCCCATACNONE 
J080054D05AGCCCATACNONE 
J080057J16AGCCCATACNONE 
J080060A05AGCCCATACNONE 
J080061M12AGCCCATACNONE 
J080063H13AGCCCATACNONE 
J080065O04AGCCCATACNONE 
J080066I17AGCCCATACNONE 
J080066J06AGCCCATACNONE 
J080089J22AGCCCATACNONE 
J080090I03AGCCCATACNONE 
J080091J23AGCCCATACNONE 
J080091K20AGCCCATACNONE 
J080093G24AGCCCATACNONE 
J080094I08AGCCCATACNONE 
J080096A17AGCCCATACNONE 
J090051G12AGCCCATACNONE 
Os03g0598900J053098D07TTATGGGCTNONE 
J065063O13TTATGGGCTDSBA oxidoreductase family protein. 
Os03g0610800AK107194CAAGCCCATACSimilar to Protein zx. 
Os03g0701100014-015-E11GTATGGGCTTTNONE 
AK109455GTATGGGCTTTNONE 
AK110740GTATGGGCTTTNONE 
Os03g0746400AK063445CCCAGCCCATACCAGCCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK070923CCCAGCCCATACCAGCCCAGCCCATTANONE 
J065008K24CCCAGCCCATACCAGCCCAGCCCATTANONE 
Os03g0752700011-093-A02AAAAGCCCATAANONE 
AK122157AAAAGCCCATAAHeat shock protein DnaJ, N-terminal domain containing protein. 
J013135C03AAAAGCCCATAANONE 
J033096O19AAAAGCCCATAANONE 
J033145P19AAAAGCCCATAANONE 
J065008K09AAAAGCCCATAANONE 
J065027J08AAAAGCCCATAANONE 
J065073H12AAAAGCCCATAANONE 
J065078G14AAAAGCCCATAANONE 
J065092L12AAAAGCCCATAANONE 
J065108D11AAAAGCCCATAANONE 
J065140G10AAAAGCCCATAANONE 
J065161D24AAAAGCCCATAANONE 
J065170F04AAAAGCCCATAANONE 
J075004K20AAAAGCCCATAANONE 
J075069F16AAAAGCCCATAANONE 
J075085B12AAAAGCCCATAANONE 
J075087D24AAAAGCCCATAANONE 
J075102G15AAAAGCCCATAANONE 
J075123M06AAAAGCCCATAANONE 
J090058D24AAAAGCCCATAANONE 
J090068I12AAAAGCCCATAANONE 
J090094A19AAAAGCCCATAANONE 
Os03g0786700AK067936AAAAGCCCATAN2,N2-dimethylguanosine tRNA methyltransferase family protein. 
Os03g0821900AK070847AGCCCATAASimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0822900AK099787ATATGGGCTGCZinc finger, BED-type predicted domain containing protein. 
J013042C24ATATGGGCTGCNONE 
J013096O21ATATGGGCTGCNONE 
J023109I23ATATGGGCTGCNONE 
J033106N09ATATGGGCTGCNONE 
J033107H03ATATGGGCTGCNONE 
J033118G03ATATGGGCTGCNONE 
J033145I24ATATGGGCTGCNONE 
J065138D15ATATGGGCTGCNONE 
J065140L13ATATGGGCTGCNONE 
J065179M13ATATGGGCTGCNONE 
J065200F05ATATGGGCTGCNONE 
J075104F20ATATGGGCTGCNONE 
J075143A15ATATGGGCTGCNONE 
J075197J11ATATGGGCTGCNONE 
Os03g0854000009-186-C03GCAGCCCATATNONE 
AK061374GCAGCCCATATProtein of unknown function UPF0131 family protein. 
J065138B11GCAGCCCATATNONE 
Os03g0856200009-070-B07TTATGGGCTGTNONE 
009-135-H05TTATGGGCTGTNONE 
J100067D22TTATGGGCTGTNONE 
J100067L13TTATGGGCTGTNONE 
J100073I07TTATGGGCTGTNONE 
J100080D01TTATGGGCTGTNONE 
Os04g0381000AK105435CCAGCCCATAADynamin family protein. 
J075003I06CCAGCCCATAANONE 
Os04g0431000009-127-C01CCAGCCCATANONE 
Os04g0527900AK108116AAAGCCCATASimilar to Tonoplast membrane integral protein ZmTIP3-2. 
J075013N09AAAGCCCATANONE 
J075023I21AAAGCCCATANONE 
Os04g0555900009-154-G03ATATGGGCTGANONE 
AK063168ATATGGGCTGAPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
J065012D11ATATGGGCTGANONE 
Os04g0589600011-100-F04ATATGGGCTACTGGGCCGTANONE 
AK061833ATATGGGCTACTGGGCCGTAGlycosyl transferase, group 1 domain containing protein. 
AK098964ATATGGGCTACTGGGCCGTANONE 
AK100053ATATGGGCTACTGGGCCGTANONE 
Os04g0602900AK065982TATGGGCTTANONE 
AK100414TATGGGCTTAIsoprenylcysteine carboxyl methyltransferase family protein. 
J013045J05TATGGGCTTANONE 
J065196I21TATGGGCTTANONE 
J065205B13TATGGGCTTANONE 
J090017J24TATGGGCTTANONE 
Os04g0604200013-087-H05CCAGCCCATAANONE 
AK063614CCAGCCCATAASimilar to Xyloglucan endotransglycosylase (Fragment). 
Os04g0610500006-115-C07ATATGGGCTGCAGCCCATGTNONE 
AK066289ATATGGGCTGCAGCCCATGTPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817ATATGGGCTGCAGCCCATGTNONE 
J013096N09ATATGGGCTGCAGCCCATGTNONE 
J023054I11ATATGGGCTGCAGCCCATGTNONE 
J023121P20ATATGGGCTGCAGCCCATGTNONE 
J053039O20ATATGGGCTGCAGCCCATGTNONE 
J053071L20ATATGGGCTGCAGCCCATGTNONE 
J053088H23ATATGGGCTGCAGCCCATGTNONE 
J053096J03ATATGGGCTGCAGCCCATGTNONE 
Os04g0636000015-046-E08AGCCCATAAGGCCCGCANONE 
AK065639AGCCCATAAGGCCCGCASPla/RYanodine receptor SPRY domain containing protein. 
AK099615AGCCCATAAGGCCCGCANONE 
Os04g0667000AK069874CCAGCCCATAATafazzin family protein. 
J100055P09CCAGCCCATAANONE 
J100057O12CCAGCCCATAANONE 
J100067H07CCAGCCCATAANONE 
J100070D06CCAGCCCATAANONE 
J100071J16CCAGCCCATAANONE 
J100072C15CCAGCCCATAANONE 
Os04g0688500013-068-C11TCAGCCCATATNONE 
013-082-D10TCAGCCCATATNONE 
AK067667TCAGCCCATATPeroxidase (EC 1.11.1.7). 
J013044F01TCAGCCCATATNONE 
J013068J12TCAGCCCATATNONE 
J013075A19TCAGCCCATATNONE 
J013118D03TCAGCCCATATNONE 
J013126C19TCAGCCCATATNONE 
J013162J15TCAGCCCATATNONE 
J075110L20TCAGCCCATATNONE 
J075156K24TCAGCCCATATNONE 
Os05g0210100AK122049AGCCCATAGCCCATCCALipolytic enzyme, G-D-S-L family protein. 
Os05g0249100016-087-B02CTGGGCTGCATATGGGCTGGNONE 
AK064291CTGGGCTGCATATGGGCTGGConserved hypothetical protein. 
AK103049CTGGGCTGCATATGGGCTGGNONE 
J033117G22CTGGGCTGCATATGGGCTGGNONE 
J065021C19CTGGGCTGCATATGGGCTGGNONE 
J065205P17CTGGGCTGCATATGGGCTGGNONE 
Os05g0255600AK073067ATATGGGCTTAThioredoxin domain 2 containing protein. 
J033022A04ATATGGGCTTANONE 
J033022B03ATATGGGCTTANONE 
J033116F22ATATGGGCTTANONE 
J065017H13ATATGGGCTTANONE 
J065038G20ATATGGGCTTANONE 
J065076J16ATATGGGCTTANONE 
J065135D06ATATGGGCTTANONE 
J065168P22ATATGGGCTTANONE 
J065188G21ATATGGGCTTANONE 
J065207C14ATATGGGCTTANONE 
J080014C23ATATGGGCTTANONE 
J080018G12ATATGGGCTTANONE 
J080021F03ATATGGGCTTANONE 
J100068C14ATATGGGCTTANONE 
Os05g0378900AK103841GTATGGGCTGGConserved hypothetical protein. 
J033148I18GTATGGGCTGGNONE 
J065085F12GTATGGGCTGGNONE 
J075041H24GTATGGGCTGGNONE 
J075180P06GTATGGGCTGGNONE 
Os05g0399700AB012855AAAAGCCCATACNONE 
AB018248AAAAGCCCATACNONE 
AB096139AAAAGCCCATACNONE 
AK071196AAAAGCCCATACChitinase (EC 3.2.1.14). 
J023012C04AAAAGCCCATACNONE 
J023086B11AAAAGCCCATACNONE 
J023143A20AAAAGCCCATACNONE 
J080040G15AAAAGCCCATACNONE 
J080306P19AAAAGCCCATACNONE 
J080307K24AAAAGCCCATACNONE 
J090040G17AAAAGCCCATACNONE 
J090047J17AAAAGCCCATACNONE 
J090075E21AAAAGCCCATACNONE 
J090088L05AAAAGCCCATACNONE 
Os05g0417200AK071955AGCCCATATThioredoxin-like fold domain containing protein. 
Os05g0447000AK108280TAAGCCCATACSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0458100006-084-A05AAAGCCCATACNONE 
009-091-H05AAAGCCCATACNONE 
AJ557547AAAGCCCATACNONE 
AK059467AAAGCCCATACNONE 
AK061127AAAGCCCATACNONE 
AK101652AAAGCCCATACSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06AAAGCCCATACNONE 
J033057B20AAAGCCCATACNONE 
J033087A05AAAGCCCATACNONE 
J043009C05AAAGCCCATACNONE 
J090009E10AAAGCCCATACNONE 
Os05g0467300006-113-H02AGCCCATATNONE 
AK061873AGCCCATATSelT/selW/selH selenoprotein family protein. 
AK098945AGCCCATATNONE 
J013050H09AGCCCATATNONE 
J023108B17AGCCCATATNONE 
J065189J01AGCCCATATNONE 
J075011H05AGCCCATATNONE 
J075019G20AGCCCATATNONE 
Os05g0500500AK110627ATATGGGCTTGHSP20-like chaperone domain containing protein. 
Os05g0526800016-054-G05ATATGGGCTGATGGGCCATNONE 
AK066551ATATGGGCTGATGGGCCATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013074J04ATATGGGCTGATGGGCCATNONE 
J013095M02ATATGGGCTGATGGGCCATNONE 
J065195O21ATATGGGCTGATGGGCCATNONE 
Os05g0533800Os05g0533800ATATGGGCTATPase, F0 complex, subunit G, mitochondrial family protein. 
Os05g0545500AK101095ATATGGGCTConserved hypothetical protein. 
AK119499ATATGGGCTNONE 
Os06g0167600AK067977CCAGCCCATAASimilar to Proteasome subunit alpha-3 (Fragment). 
J013123K20CCAGCCCATAANONE 
J033125P19CCAGCCCATAANONE 
J065002M08CCAGCCCATAANONE 
J065045C13CCAGCCCATAANONE 
J065045J07CCAGCCCATAANONE 
J065098M04CCAGCCCATAANONE 
J065110M02CCAGCCCATAANONE 
J065113H12CCAGCCCATAANONE 
J065214E15CCAGCCCATAANONE 
Os06g0194000006-041-H12CCAGCCCATATNONE 
006-077-B02CCAGCCCATATNONE 
013-029-A09CCAGCCCATATNONE 
AF190770CCAGCCCATATNONE 
AK060742CCAGCCCATATNONE 
AK069833CCAGCCCATATSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3 homolog) (EREBP-5) (NtERF5). 
J013021K18CCAGCCCATATNONE 
J013060G01CCAGCCCATATNONE 
J013069I06CCAGCCCATATNONE 
J013134D15CCAGCCCATATNONE 
J013149A16CCAGCCCATATNONE 
J023031B06CCAGCCCATATNONE 
J023074E17CCAGCCCATATNONE 
J023091C14CCAGCCCATATNONE 
J023101P18CCAGCCCATATNONE 
J023106O14CCAGCCCATATNONE 
J023110J17CCAGCCCATATNONE 
J023110N02CCAGCCCATATNONE 
J023128D07CCAGCCCATATNONE 
J033024O19CCAGCCCATATNONE 
J033068G19CCAGCCCATATNONE 
J033095G01CCAGCCCATATNONE 
J033108C12CCAGCCCATATNONE 
J033114C23CCAGCCCATATNONE 
J043003E04CCAGCCCATATNONE 
J053023J03CCAGCCCATATNONE 
J053026B01CCAGCCCATATNONE 
J065172F15CCAGCCCATATNONE 
J075036K13CCAGCCCATATNONE 
J090020A10CCAGCCCATATNONE 
J090073E10CCAGCCCATATNONE 
J100034P18CCAGCCCATATNONE 
J100048O18CCAGCCCATATNONE 
J100064K09CCAGCCCATATNONE 
Os06g0298400AK066952GAAGCCCATATWW/Rsp5/WWP domain containing protein. 
J013090J20GAAGCCCATATNONE 
J033024J05GAAGCCCATATNONE 
J033033H19GAAGCCCATATNONE 
J033057J15GAAGCCCATATNONE 
J065047L24GAAGCCCATATNONE 
J065198L23GAAGCCCATATNONE 
J065218N03GAAGCCCATATNONE 
J090001F10GAAGCCCATATNONE 
J090025N24GAAGCCCATATNONE 
J090073E16GAAGCCCATATNONE 
Os06g0493100AK063797AGCCCATAConserved hypothetical protein. 
AY256682AGCCCATANONE 
J065033K13AGCCCATANONE 
J065033L07AGCCCATANONE 
J065061G09AGCCCATANONE 
J065106I04AGCCCATANONE 
J065123M20AGCCCATANONE 
J075087I17AGCCCATANONE 
J075152G18AGCCCATANONE 
J075159B13AGCCCATANONE 
Os06g0535300AK059642GTATGGGCTNONE 
Os06g0556000011-042-F02AGCCCATATNONE 
012-064-G09AGCCCATATNONE 
015-076-A04AGCCCATATNONE 
AK058304AGCCCATATNONE 
AK102763AGCCCATATSimilar to Amino acid carrier (Fragment). 
J033107D14AGCCCATATNONE 
J090050O09AGCCCATATNONE 
J100048H19AGCCCATATNONE 
J100056H17AGCCCATATNONE 
J100064D16AGCCCATATNONE 
J100080A13AGCCCATATNONE 
J100090G17AGCCCATATNONE 
Os06g0581300AK070987CCAGCCCATAProtein of unknown function DUF1475 family protein. 
AK073185CCAGCCCATANONE 
J065209C10CCAGCCCATANONE 
J075060B03CCAGCCCATANONE 
J075117M08CCAGCCCATANONE 
J075126E04CCAGCCCATANONE 
J075189G04CCAGCCCATANONE 
J075189L16CCAGCCCATANONE 
J100061E16CCAGCCCATANONE 
Os06g0601000AK071330TTATGGGCTHomeodomain-like containing protein. 
AY224485TTATGGGCTNONE 
Os06g0673500J100018J12ATATGGGCTCAGCCCAGCCCATCANONE 
J100072F13ATATGGGCTCAGCCCAGCCCATCASimilar to Ubiquitin. 
Os06g0694500AK067484CCATGGGCTGTATGGGCTTTTSimilar to Nitrogen fixation like protein. 
AK103983CCATGGGCTGTATGGGCTTTTNONE 
Os06g0702800009-039-E05ACAGCCCATAANONE 
AK073948ACAGCCCATAAHypothetical protein. 
J023108K23ACAGCCCATAANONE 
J033072H04ACAGCCCATAANONE 
J065008G05ACAGCCCATAANONE 
J065128J12ACAGCCCATAANONE 
J065131A01ACAGCCCATAANONE 
J065173B12ACAGCCCATAANONE 
Os07g0179000AK100008TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
AK119398TTCGGCCCATTAAAGCCCATATAGGCCCACGAProtein prenyltransferase domain containing protein. 
AK119505TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
Os07g0202100AK101736AAAAGCCCATACSimilar to ATP-dependent RNA helicase ded1. 
Os07g0242600AK065752CCCAGCCCATATCyclin-like F-box domain containing protein. 
AK065752GTTTGGGCCCAGCCCATAACyclin-like F-box domain containing protein. 
J013037K22CCCAGCCCATATNONE 
J013037K22GTTTGGGCCCAGCCCATAANONE 
Os07g0415200006-105-B10ATATGGGCTNONE 
AK061243ATATGGGCTNONE 
AK101796ATATGGGCTRibosomal L23 and L15e, core domain containing protein. 
AK104106ATATGGGCTNONE 
J033066C05ATATGGGCTNONE 
J065188B11ATATGGGCTNONE 
J065211E07ATATGGGCTNONE 
J090003E03ATATGGGCTNONE 
Os07g0496200AK064866TATGGGCTNONE 
AK065801TATGGGCTSimilar to NAD-dependent malic enzyme 62 kDa isoform, mitochondrial precursor (EC 1.1.1.39) (NAD-ME). 
Os07g0611700AK109158GAAGCCCATACTGGCCCAATTPeptidase C1A, papain family protein. 
Os07g0611800Os07g0611800GAAGCCCATACTGGCCCAATTNONE 
Os07g0625500AK064628ATATGGGCTGASimilar to Fimbriata-associated protein (Fragment). 
Os07g0630800AK059570AGCCCATANONE 
AK068064AGCCCATANONE 
AK071297AGCCCATASimilar to Nodule-enhanced malate dehydrogenase. 
AK106083AGCCCATANONE 
J013130E16AGCCCATANONE 
J080024I02AGCCCATANONE 
J080037G22AGCCCATANONE 
J080047G13AGCCCATANONE 
J080060J19AGCCCATANONE 
J080075A13AGCCCATANONE 
J080088F01AGCCCATANONE 
J080094F14AGCCCATANONE 
Os07g0691200AK060763ATATGGGCTGTNONE 
Os08g0130500AK062008ATATGGGCTGGNONE 
Os08g0139100006-027-E12ACAGCCCATAANONE 
006-089-E06ACAGCCCATAANONE 
006-113-G02ACAGCCCATAANONE 
AK061429ACAGCCCATAANONE 
AK099590ACAGCCCATAASimilar to DAG protein, chloroplast precursor. 
AK104727ACAGCCCATAANONE 
J013043H11ACAGCCCATAANONE 
J013049N13ACAGCCCATAANONE 
J065079F01ACAGCCCATAANONE 
J065122N24ACAGCCCATAANONE 
J065142J24ACAGCCCATAANONE 
J065193N03ACAGCCCATAANONE 
J075041I21ACAGCCCATAANONE 
J075145E04ACAGCCCATAANONE 
Os08g0155000004-001-C12TTATGGGCTCGGCCCATATNONE 
014-030-C11TTATGGGCTCGGCCCATATNONE 
AK060859TTATGGGCTCGGCCCATATNONE 
AK099613TTATGGGCTCGGCCCATATBrix domain containing protein. 
J013154C17TTATGGGCTCGGCCCATATNONE 
J033039F14TTATGGGCTCGGCCCATATNONE 
J033126I18TTATGGGCTCGGCCCATATNONE 
J043005A17TTATGGGCTCGGCCCATATNONE 
J053027C13TTATGGGCTCGGCCCATATNONE 
J053033I07TTATGGGCTCGGCCCATATNONE 
J053054P04TTATGGGCTCGGCCCATATNONE 
J053060F22TTATGGGCTCGGCCCATATNONE 
J053061P10TTATGGGCTCGGCCCATATNONE 
J053065L13TTATGGGCTCGGCCCATATNONE 
J053099H19TTATGGGCTCGGCCCATATNONE 
J053101D09TTATGGGCTCGGCCCATATNONE 
J075062C16TTATGGGCTCGGCCCATATNONE 
J075129P09TTATGGGCTCGGCCCATATNONE 
J075135C02TTATGGGCTCGGCCCATATNONE 
J075147P13TTATGGGCTCGGCCCATATNONE 
J090007K03TTATGGGCTCGGCCCATATNONE 
J090050M06TTATGGGCTCGGCCCATATNONE 
J090057M20TTATGGGCTCGGCCCATATNONE 
J090070B06TTATGGGCTCGGCCCATATNONE 
J090080D11TTATGGGCTCGGCCCATATNONE 
J100021D15TTATGGGCTCGGCCCATATNONE 
Os08g0468400011-057-F06GCAGCCCATACNONE 
AK063363GCAGCCCATACHEC/Ndc80p family protein. 
J100048N11GCAGCCCATACNONE 
Os08g0485700AK068131TCAGCCCATATNONE 
AK069097TCAGCCCATATMethyl-CpG binding domain containing protein. 
J013130L03TCAGCCCATATNONE 
Os08g0489300AK059000GAAGCCCATATNONE 
AK104597GAAGCCCATATDNA glycosylase family protein. 
J013160G13GAAGCCCATATNONE 
J100078P21GAAGCCCATATNONE 
Os08g0510500011-038-F01ATATGGGCTNONE 
AK070907ATATGGGCTENT domain containing protein. 
AK100370ATATGGGCTNONE 
J100078O11ATATGGGCTNONE 
Os08g0527400AK119389AGCCCATACCAGCCCACCCPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0558000J080005K14GAAGCCCATACNONE 
Os09g0103300009-007-D10AAAAGCCCATATNONE 
AK062317AAAAGCCCATATHypothetical protein. 
Os09g0109500AK067482GTATGGGCTGGCCCAATTUNC-50 family protein. 
J013107E18GTATGGGCTGGCCCAATTNONE 
J023138C21GTATGGGCTGGCCCAATTNONE 
J065117D01GTATGGGCTGGCCCAATTNONE 
J065179F23GTATGGGCTGGCCCAATTNONE 
J100029N14GTATGGGCTGGCCCAATTNONE 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0329800AK069775TTTTGGGCCTAACAGCCCATATConserved hypothetical protein. 
Os09g0329900Os09g0329900TTTTGGGCCTAACAGCCCATATNONE 
Os09g0397900AK101306ATATGGGCTTASimilar to FEG protein. 
AK101306ATATGGGCTTASimilar to FEG protein. 
Os09g0456900AK073236TATGGGCTTGGNucleic acid-binding, OB-fold domain containing protein. 
Os09g0532600J013002F02ACAGCCCATATNONE 
Os09g0532800J065167K16GGTCCAGAGCCCATATProtein prenyltransferase domain containing protein. 
Os09g0540600AK101798ATATGGGCTTTACGGCCCATAAAAGCCCATTANONE 
AK103397ATATGGGCTTTACGGCCCATAAAAGCCCATTASimilar to WD-40 repeat protein MSI1. 
Os09g0554000J065123C23TTATGGGCTTATGGCCCATCASimilar to Mitochondrial phosphate transporter. 
Os09g0573200J013027J02TATGGGCTTGGNONE 
J013034M08TATGGGCTTGGNONE 
J013037L03TATGGGCTTGGNONE 
J013041D10TATGGGCTTGGNONE 
J013042D15TATGGGCTTGGNONE 
J013109H17TATGGGCTTGGNONE 
J013132A18TATGGGCTTGGNONE 
J013160N13TATGGGCTTGGNONE 
J013169I09TATGGGCTTGGNONE 
J023029F18TATGGGCTTGGNONE 
J023041A02TATGGGCTTGGNONE 
J023097B14TATGGGCTTGGNONE 
J023142I04TATGGGCTTGGNONE 
J023142N06TATGGGCTTGGNONE 
J033023I21TATGGGCTTGGNONE 
J033032G15TATGGGCTTGGNONE 
J033042M17TATGGGCTTGGNONE 
J033070F09TATGGGCTTGGNONE 
J053063L09TATGGGCTTGGNONE 
J053064A09TATGGGCTTGGNONE 
J065073M19TATGGGCTTGGNONE 
J075005H11TATGGGCTTGGNONE 
J075026D12TATGGGCTTGGNONE 
J075043G07TATGGGCTTGGNONE 
J075084N05TATGGGCTTGGNONE 
J075092D05TATGGGCTTGGNONE 
J075110E24TATGGGCTTGGNONE 
J075176I05TATGGGCTTGGNONE 
J090009H19TATGGGCTTGGNONE 
J090025K11TATGGGCTTGGNONE 
J090049E20TATGGGCTTGGNONE 
J090070G02TATGGGCTTGGNONE 
Os11g0128400AK102291GAAGCCCATATCDC45-like protein family protein. 
J033089K18GAAGCCCATATNONE 
Os11g0130500J065119D16ATATGGGCTGANONE 
J065169E14ATATGGGCTGACyclin-like F-box domain containing protein. 
Os11g0130600AK066342TCAGCCCATATConserved hypothetical protein. 
J065192M10TCAGCCCATATNONE 
Os11g0139500AK121845TCGTGGGCTGTATATGGGCTGANONE 
Os11g0497000AK111924GGGCCTGGCCCATCAGCCCATATAGCCCATCASimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065097A08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065123J10GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J075096F04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J080065C15GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090033J04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090072N23GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100021E08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100063H21GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
Os11g0616200AK069189ATATGGGCTConserved hypothetical protein. 
AK069189ATATGGGCTGCConserved hypothetical protein. 
AK069189ATATGGGCTTTCGGCCCAAATConserved hypothetical protein. 
J023004N19ATATGGGCTNONE 
J023004N19ATATGGGCTGCNONE 
J023004N19ATATGGGCTTTCGGCCCAAATNONE 
Os11g0630900AK107482ATATGGGCTMATH domain containing protein. 
Os11g0641800AK066963ATATGGGCTTGGCupredoxin domain containing protein. 
J013023J11ATATGGGCTTGGNONE 
J013058D03ATATGGGCTTGGNONE 
J013093P21ATATGGGCTTGGNONE 
J013120G19ATATGGGCTTGGNONE 
Os12g0120000011-024-E09AAAGCCCATATNONE 
AK105399AAAGCCCATATProtein of unknown function DUF936, plant family protein. 
Os12g0127500AK064595TCAGCCCATATConserved hypothetical protein. 
J065067F11TCAGCCCATATNONE 
J090007D02TCAGCCCATATNONE 
J100035G10TCAGCCCATATNONE 
J100077J10TCAGCCCATATNONE 
Os12g0233500Os12g0233500TTATGGGCTNONE 
Os12g0552200015-064-H06ATATGGGCTNONE 
AK106375ATATGGGCTSimilar to Patatin-like protein 3. 
Os12g0556100J065083C21ACAGCCCATAADrought induced 19 family protein. 
J065124M18ACAGCCCATAANONE 
J100032P22ACAGCCCATAANONE 
J100048N01ACAGCCCATAANONE 
Os12g0564800AK103886ATATGGGCTTADisease resistance protein family protein. 
Os12g0565800AK072828AGCCCATAZinc finger, TTF-type domain containing protein. 
Os12g0572400016-084-F04AAAGCCCATAAGGCCCACCCNONE 
AK065531AAAGCCCATAAGGCCCACCCSimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03AAAGCCCATAAGGCCCACCCNONE 
J013034H02AAAGCCCATAAGGCCCACCCNONE 
J033117N05AAAGCCCATAAGGCCCACCCNONE 
J065027L09AAAGCCCATAAGGCCCACCCNONE 
J065037D09AAAGCCCATAAGGCCCACCCNONE 
J065197I09AAAGCCCATAAGGCCCACCCNONE 
J090045C01AAAGCCCATAAGGCCCACCCNONE 
J100031E11AAAGCCCATAAGGCCCACCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.