version

Summary of OsREG466 (All List)

OrganismOryza sativa  
IDOsREG466  
SequenceAGCCCATC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2000  

Entry Sequences (2000 entries)

LocusGene modelSequenceDescription
Os01g0183500J075016J09CGATGGGCTNONE 
J075041H05CGATGGGCTCytochrome P450 family protein. 
J075165D22CGATGGGCTNONE 
Os01g0212100AK065467AGCCCATCCAAGGTGGGCCCAAATNONE 
AK101456AGCCCATCCAAGGTGGGCCCAAATATP-dependent helicase, DEAH-box family protein. 
Os01g0303300J053035N19AGCCCATCCANONE 
J075042F02AGCCCATCCANONE 
J075068E10AGCCCATCCANONE 
J075116E19AGCCCATCCANONE 
J075131C10AGCCCATCCANONE 
J075145J11AGCCCATCCANONE 
J075157P20AGCCCATCCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12AGCCCATCCANONE 
Os01g0508300AK101435TGATGGGCTTANONE 
AK111287TGATGGGCTTAConserved hypothetical protein. 
J065096N08TGATGGGCTTANONE 
J075003F13TGATGGGCTTANONE 
J075014I16TGATGGGCTTANONE 
J075022D23TGATGGGCTTANONE 
J075040N19TGATGGGCTTANONE 
J075121O06TGATGGGCTTANONE 
J075131E17TGATGGGCTTANONE 
J075136N22TGATGGGCTTANONE 
J075147D01TGATGGGCTTANONE 
J075173C07TGATGGGCTTANONE 
J075196L22TGATGGGCTTANONE 
Os01g0590200011-100-E06CGATGGGCTGGNONE 
011-100-E06TGATGGGCTNONE 
012-005-A05CGATGGGCTGGNONE 
012-005-A05TGATGGGCTNONE 
AK063416CGATGGGCTGGConserved hypothetical protein. 
AK063416TGATGGGCTConserved hypothetical protein. 
AK099235CGATGGGCTGGNONE 
AK099235TGATGGGCTNONE 
AK105022CGATGGGCTGGNONE 
AK105022TGATGGGCTNONE 
J065030D21CGATGGGCTGGNONE 
J065030D21TGATGGGCTNONE 
J065031C10CGATGGGCTGGNONE 
J065031C10TGATGGGCTNONE 
J065105A22CGATGGGCTGGNONE 
J065105A22TGATGGGCTNONE 
J065173M19CGATGGGCTGGNONE 
J065173M19TGATGGGCTNONE 
J075188F15CGATGGGCTGGNONE 
J075188F15TGATGGGCTNONE 
J090050C15CGATGGGCTGGNONE 
J090050C15TGATGGGCTNONE 
J100058K07CGATGGGCTGGNONE 
J100058K07TGATGGGCTNONE 
Os01g0596300016-083-D09AGCCCATCANONE 
AK069151AGCCCATCACyclin-like F-box domain containing protein. 
J023007D17AGCCCATCANONE 
J065141M02AGCCCATCANONE 
Os01g0611000003-117-E07AGCCCATCANONE 
006-051-D01AGCCCATCANONE 
006-085-B10AGCCCATCANONE 
012-092-F03AGCCCATCANONE 
AK060682AGCCCATCANONE 
AK072500AGCCCATCASimilar to Unidentified precursor. 
AK105921AGCCCATCANONE 
J023001D07AGCCCATCANONE 
J023075J23AGCCCATCANONE 
J023127H12AGCCCATCANONE 
J033024H20AGCCCATCANONE 
J033025H03AGCCCATCANONE 
J065057F11AGCCCATCANONE 
J065096C07AGCCCATCANONE 
J065103A08AGCCCATCANONE 
J065137L11AGCCCATCANONE 
J065179I16AGCCCATCANONE 
J065197P22AGCCCATCANONE 
J075089M08AGCCCATCANONE 
J090008N14AGCCCATCANONE 
J090011K16AGCCCATCANONE 
J090075K24AGCCCATCANONE 
J090079E08AGCCCATCANONE 
Os01g0667900013-097-A02TCAGCCCATCANONE 
014-011-C01TCAGCCCATCANONE 
AK105335TCAGCCCATCAGlutaredoxin-like, plant II family protein. 
J065156F10TCAGCCCATCANONE 
J065163D22TCAGCCCATCANONE 
J065197J04TCAGCCCATCANONE 
J075122C02TCAGCCCATCANONE 
J100047L16TCAGCCCATCANONE 
Os01g0680100AK109677AGCCCATCAConserved hypothetical protein. 
Os01g0686800006-098-B12GGATGGGCTTANONE 
006-113-H04GGATGGGCTTANONE 
AK060428GGATGGGCTTANONE 
AK098877GGATGGGCTTANONE 
AK098893GGATGGGCTTANONE 
AK121587GGATGGGCTTAGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231GGATGGGCTTANONE 
J013001E12GGATGGGCTTANONE 
J013001N15GGATGGGCTTANONE 
J013098G22GGATGGGCTTANONE 
J023004P15GGATGGGCTTANONE 
J023014D09GGATGGGCTTANONE 
J023020G09GGATGGGCTTANONE 
J023034A19GGATGGGCTTANONE 
J023050I11GGATGGGCTTANONE 
J023079D13GGATGGGCTTANONE 
J023091B11GGATGGGCTTANONE 
J023099M03GGATGGGCTTANONE 
J023101H20GGATGGGCTTANONE 
J023106P14GGATGGGCTTANONE 
J023111F19GGATGGGCTTANONE 
J023132C22GGATGGGCTTANONE 
J023139O03GGATGGGCTTANONE 
J023146O10GGATGGGCTTANONE 
J033022G16GGATGGGCTTANONE 
J033030C10GGATGGGCTTANONE 
J033032G18GGATGGGCTTANONE 
J033034N09GGATGGGCTTANONE 
J033037K24GGATGGGCTTANONE 
J033038B22GGATGGGCTTANONE 
J033061E06GGATGGGCTTANONE 
J033065F08GGATGGGCTTANONE 
J033065I24GGATGGGCTTANONE 
J033069L01GGATGGGCTTANONE 
J033086N21GGATGGGCTTANONE 
J033102I06GGATGGGCTTANONE 
J033111N07GGATGGGCTTANONE 
J033118K11GGATGGGCTTANONE 
J033125D08GGATGGGCTTANONE 
J033129P22GGATGGGCTTANONE 
J033131L12GGATGGGCTTANONE 
J033139D08GGATGGGCTTANONE 
J033141J08GGATGGGCTTANONE 
J043024B14GGATGGGCTTANONE 
J053048G19GGATGGGCTTANONE 
J065023B15GGATGGGCTTANONE 
J065082C15GGATGGGCTTANONE 
J065087D24GGATGGGCTTANONE 
J065122D11GGATGGGCTTANONE 
J065128P13GGATGGGCTTANONE 
J065149I19GGATGGGCTTANONE 
J065154E16GGATGGGCTTANONE 
J065156K21GGATGGGCTTANONE 
J065166H09GGATGGGCTTANONE 
J065169F24GGATGGGCTTANONE 
J065194I16GGATGGGCTTANONE 
J065213M20GGATGGGCTTANONE 
J075020F19GGATGGGCTTANONE 
J075051J16GGATGGGCTTANONE 
J075093C18GGATGGGCTTANONE 
J075119H02GGATGGGCTTANONE 
J075120J11GGATGGGCTTANONE 
J075173A15GGATGGGCTTANONE 
J080302B05GGATGGGCTTANONE 
J080304G10GGATGGGCTTANONE 
J080305E13GGATGGGCTTANONE 
J080315L11GGATGGGCTTANONE 
J090005H15GGATGGGCTTANONE 
J090021C24GGATGGGCTTANONE 
J090025H24GGATGGGCTTANONE 
J090025M11GGATGGGCTTANONE 
J090026C22GGATGGGCTTANONE 
J090027H15GGATGGGCTTANONE 
J090034B17GGATGGGCTTANONE 
J090045G11GGATGGGCTTANONE 
J090048H02GGATGGGCTTANONE 
J090051N04GGATGGGCTTANONE 
J090052I06GGATGGGCTTANONE 
J090054L17GGATGGGCTTANONE 
J090060M22GGATGGGCTTANONE 
J090075N17GGATGGGCTTANONE 
J090079K13GGATGGGCTTANONE 
J090086H08GGATGGGCTTANONE 
J090094N20GGATGGGCTTANONE 
J100021F03GGATGGGCTTANONE 
J100031M01GGATGGGCTTANONE 
J100033I18GGATGGGCTTANONE 
J100034P07GGATGGGCTTANONE 
J100043M16GGATGGGCTTANONE 
J100046J12GGATGGGCTTANONE 
J100055F09GGATGGGCTTANONE 
J100057D19GGATGGGCTTANONE 
J100060O10GGATGGGCTTANONE 
J100064G09GGATGGGCTTANONE 
J100077F24GGATGGGCTTANONE 
J100080E12GGATGGGCTTANONE 
J100089J04GGATGGGCTTANONE 
Os01g0688200AK120982TAAGCCCATCTGGGCCCAACAAlpha/beta hydrolase family protein. 
Os01g0700200AK100961TAGGCCCAAGCCCATCCASimilar to Chromosome condensation regulator protein (Fragment). 
J023141C11TAGGCCCAAGCCCATCCANONE 
Os01g0705200011-075-B10AGCCCATCCNONE 
014-056-F05AGCCCATCCNONE 
014-072-F08AGCCCATCCNONE 
014-082-E10AGCCCATCCNONE 
014-085-E10AGCCCATCCNONE 
AK064074AGCCCATCCLate embryogenesis abundant protein repeat containing protein. 
AK073837AGCCCATCCNONE 
D26536AGCCCATCCNONE 
J033070H10AGCCCATCCNONE 
J065138A19AGCCCATCCNONE 
J065140A10AGCCCATCCNONE 
Os01g0709500016-042-H01GGATGGGCTNONE 
AK105743GGATGGGCTNONE 
J023075E10GGATGGGCTNONE 
J023106N12GGATGGGCTNONE 
J043016L01GGATGGGCTNONE 
J043026D20GGATGGGCTNONE 
J065086G18GGATGGGCTNONE 
J065137B07GGATGGGCTNONE 
J065202M22GGATGGGCTNONE 
J065207I15GGATGGGCTNONE 
J075038B04GGATGGGCTNONE 
J075044E14GGATGGGCTNONE 
J075120G21GGATGGGCTNONE 
J075149O14GGATGGGCTNONE 
J090003L12GGATGGGCTNONE 
J090006B04GGATGGGCTNONE 
J090009F02GGATGGGCTNONE 
J090014L16GGATGGGCTNONE 
J090017A05GGATGGGCTNONE 
J090018H23GGATGGGCTNONE 
J090039P04GGATGGGCTNONE 
J090058F13GGATGGGCTNONE 
J090077H07GGATGGGCTNONE 
J090084F06GGATGGGCTNONE 
J090091H18GGATGGGCTNONE 
J090097F01GGATGGGCTNONE 
Os01g0714100AK060399AGATGGGCTConserved hypothetical protein. 
Os01g0773200015-072-C12CGATGGGCTNONE 
Os01g0776700J065046N20ACAGCCCATCGConserved hypothetical protein. 
J100086L02ACAGCCCATCGNONE 
Os01g0848300AK120668AGCCCATCAACGGTCProtein prenyltransferase domain containing protein. 
Os01g0850400AJ575220CGATGGGCTNONE 
AJ575220TGGATGGGCTGANONE 
AK108582CGATGGGCTSimilar to MYBY1 protein (Fragment). 
AK108582TGGATGGGCTGASimilar to MYBY1 protein (Fragment). 
Os01g0856500AK103981GGATGGGCTGANONE 
AK103981TGGATGGGCTACTGGGCCCGNONE 
Os01g0861000AK058707GAAGCCCATCAConserved hypothetical protein. 
Os01g0868300AB004461TGATGGGCTSimilar to DNA polymerase alpha catalytic subunit (EC 2.7.7.7). 
Os01g0877500AK101067AGCCCATCCProtein of unknown function UPF0054 family protein. 
Os01g0901000AK065658AGATGGGCTNONE 
J013038N12AGATGGGCTNONE 
Os01g0907300015-031-F03AGATGGGCTTTNONE 
AK103626AGATGGGCTTTConserved hypothetical protein. 
AK108617AGATGGGCTTTNONE 
J013094D23AGATGGGCTTTNONE 
J013106G24AGATGGGCTTTNONE 
J013120M13AGATGGGCTTTNONE 
J023056M16AGATGGGCTTTNONE 
J023092M24AGATGGGCTTTNONE 
J033133N22AGATGGGCTTTNONE 
J043010O12AGATGGGCTTTNONE 
Os01g0921000AK071688CGATGGGCTConserved hypothetical protein. 
Os01g0921600AK071344AGATGGGCTSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22AGATGGGCTNONE 
J013109E03AGATGGGCTNONE 
J023081J12AGATGGGCTNONE 
J023091E24AGATGGGCTNONE 
J033022A01AGATGGGCTNONE 
J033074C13AGATGGGCTNONE 
J065199E03AGATGGGCTNONE 
J075172O04AGATGGGCTNONE 
J090007G18AGATGGGCTNONE 
J090052B17AGATGGGCTNONE 
J090074H01AGATGGGCTNONE 
J100043J09AGATGGGCTNONE 
J100059J05AGATGGGCTNONE 
Os01g0939700AK059803AGCCCATCTNONE 
AK070588AGCCCATCTSimilar to Esterase D (EC 3.1.1.1). 
AK111469AGCCCATCTNONE 
J090021L11AGCCCATCTNONE 
Os01g0946200AK071060CGATGGGCTNo apical meristem (NAM) protein domain containing protein. 
J023080K20CGATGGGCTNONE 
Os01g0949700AK069037ACAGCCCATCCNONE 
J023004F17ACAGCCCATCCNONE 
J065063D04ACAGCCCATCCNONE 
J065196H02ACAGCCCATCCNONE 
J075198A05ACAGCCCATCCNONE 
Os01g0966700006-038-E12GGATGGGCTNONE 
AK061744GGATGGGCTNONE 
Os01g0970900011-018-A07GAGGCCCAGCCCATCTNONE 
011-022-E12GAGGCCCAGCCCATCTNONE 
AK063285GAGGCCCAGCCCATCTNONE 
AK101688GAGGCCCAGCCCATCTProtein prenyltransferase domain containing protein. 
J100042L01GAGGCCCAGCCCATCTNONE 
J100053B11GAGGCCCAGCCCATCTNONE 
Os02g0127900AK102783AGCCCATCCAHypothetical protein. 
J065042F15AGCCCATCCANONE 
J075005J10AGCCCATCCANONE 
J075038F02AGCCCATCCANONE 
J075048K10AGCCCATCCANONE 
J075064D21AGCCCATCCANONE 
J075074M07AGCCCATCCANONE 
J075078D20AGCCCATCCANONE 
J075109P15AGCCCATCCANONE 
J075115K24AGCCCATCCANONE 
J075135G01AGCCCATCCANONE 
J075156B07AGCCCATCCANONE 
Os02g0146700AK105609AGCCCATCASimilar to PSMD2 subunit (Fragment). 
AK119490AGCCCATCANONE 
AK121963AGCCCATCANONE 
Os02g0178400009-151-B08AGATGGGCTTANONE 
AK063815AGATGGGCTTAProtein transport protein SEC61 gamma subunit. 
AK121516AGATGGGCTTANONE 
J033026A17AGATGGGCTTANONE 
J065011K14AGATGGGCTTANONE 
J065056D01AGATGGGCTTANONE 
J065061L22AGATGGGCTTANONE 
J065076M01AGATGGGCTTANONE 
J075092E14AGATGGGCTTANONE 
Os02g0205000AK060003CCAGCCCATCANONE 
AK073514CCAGCCCATCARibosomal protein L19 family protein. 
J065106I07CCAGCCCATCANONE 
Os02g0232100AK108775GGATGGGCTNONE 
Os02g0241100Os02g0241100AGATGGGCTGAProtein kinase-like domain containing protein. 
Os02g0288100AK107019AGCCCATCGSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
Os02g0321900AK058256TAGGCCCATAGCCCATCANONE 
AK062103TAGGCCCATAGCCCATCASimilar to 60S ribosomal protein L10a-1. 
AK102574TAGGCCCATAGCCCATCANONE 
J065176M06TAGGCCCATAGCCCATCANONE 
J075112D24TAGGCCCATAGCCCATCANONE 
Os02g0564100006-072-A11AGCCCATCANONE 
AK073526AGCCCATCASimilar to EL3 protein. 
AK105951AGCCCATCANONE 
J100045C15AGCCCATCANONE 
Os02g0568100AK107582AGCCCATCGSimilar to Non-phototropic hypocotyl 3. 
Os02g0605600016-017-B02AGCCCATCCAGCCCATCTGGACCNONE 
AK066104AGCCCATCCAGCCCATCTGGACCLUC7 related family protein. 
J013052G16AGCCCATCCAGCCCATCTGGACCNONE 
J043022E03AGCCCATCCAGCCCATCTGGACCNONE 
J065105P10AGCCCATCCAGCCCATCTGGACCNONE 
Os02g0618250009-115-E10CAAGCCCATCANONE 
014-076-A03CAAGCCCATCANONE 
J065096D10CAAGCCCATCASimilar to H/ACA ribonucleoprotein complex subunit 3-like protein. 
J075045G01CAAGCCCATCANONE 
J075092J11CAAGCCCATCANONE 
J075134F02CAAGCCCATCANONE 
Os02g0618700AK070657CCCAGCCCATCAAGCCCATATLung seven transmembrane receptor family protein. 
J023056H15CCCAGCCCATCAAGCCCATATNONE 
Os02g0656500011-045-C08AGCCCATCGNONE 
011-045-E06AGCCCATCGNONE 
016-046-A01AGCCCATCGNONE 
016-046-B01AGCCCATCGNONE 
AK062239AGCCCATCGNONE 
AK066420AGCCCATCGDnaJ-like protein. 
J013067J21AGCCCATCGNONE 
J065047L09AGCCCATCGNONE 
J065104M20AGCCCATCGNONE 
J065134B04AGCCCATCGNONE 
J065152C10AGCCCATCGNONE 
J065161O03AGCCCATCGNONE 
J065169F18AGCCCATCGNONE 
J065210M21AGCCCATCGNONE 
J065217B03AGCCCATCGNONE 
J065218C10AGCCCATCGNONE 
J075041F09AGCCCATCGNONE 
J075048A02AGCCCATCGNONE 
J075083F21AGCCCATCGNONE 
J080005F10AGCCCATCGNONE 
J080013P21AGCCCATCGNONE 
J080027J09AGCCCATCGNONE 
J080037O17AGCCCATCGNONE 
J080039F02AGCCCATCGNONE 
J080039G01AGCCCATCGNONE 
J080041I09AGCCCATCGNONE 
J080043M01AGCCCATCGNONE 
J080060H17AGCCCATCGNONE 
J080062O07AGCCCATCGNONE 
J080079F05AGCCCATCGNONE 
J080093H04AGCCCATCGNONE 
J080096B15AGCCCATCGNONE 
J080097H24AGCCCATCGNONE 
J090032O11AGCCCATCGNONE 
J090044F01AGCCCATCGNONE 
J090045E04AGCCCATCGNONE 
J090048O03AGCCCATCGNONE 
J090049E04AGCCCATCGNONE 
J090070E19AGCCCATCGNONE 
J090079E13AGCCCATCGNONE 
J090089L14AGCCCATCGNONE 
J090095K13AGCCCATCGNONE 
J090096I19AGCCCATCGNONE 
J090098B04AGCCCATCGNONE 
J100027P13AGCCCATCGNONE 
J100048H06AGCCCATCGNONE 
J100060J15AGCCCATCGNONE 
J100070K16AGCCCATCGNONE 
J100074O22AGCCCATCGNONE 
Os02g0681100AK100584AGCCCATCTProtein of unknown function DUF604 family protein. 
J023106A15AGCCCATCTNONE 
Os02g0707100AK062096AGCCCATCTNONE 
Os02g0759800012-036-G11AGCCCATCCNONE 
AK067153AGCCCATCCSimilar to GAMYB-binding protein (Fragment). 
AK071666AGCCCATCCNONE 
J013098N03AGCCCATCCNONE 
J023100L02AGCCCATCCNONE 
J023106G20AGCCCATCCNONE 
J033057G09AGCCCATCCNONE 
J100043H19AGCCCATCCNONE 
J100061H16AGCCCATCCNONE 
J100079O17AGCCCATCCNONE 
Os02g0767900009-154-G01AGGTGGGCCTAGCCCATCGNONE 
009-172-H09AGGTGGGCCTAGCCCATCGNONE 
AK099885AGGTGGGCCTAGCCCATCGGlutaredoxin 2 family protein. 
Os02g0771200011-006-B07AGATGGGCTTTNONE 
AK066823AGATGGGCTTTConserved hypothetical protein. 
AK071059AGATGGGCTTTNONE 
J013075K03AGATGGGCTTTNONE 
Os02g0776800AB042415CCAGCCCATCCANONE 
AK072308CCAGCCCATCCAReplication protein A 70kDa. 
AK101212CCAGCCCATCCANONE 
J033031B02CCAGCCCATCCANONE 
J090004E18CCAGCCCATCCANONE 
J090084C24CCAGCCCATCCANONE 
Os02g0782500013-043-A07TGATGGGCTNONE 
013-068-B10TGATGGGCTNONE 
013-093-A08TGATGGGCTNONE 
014-083-C12TGATGGGCTNONE 
AK063602TGATGGGCTNONE 
AK119261TGATGGGCTSimilar to Small heat stress protein class CIII. 
J065013N12TGATGGGCTNONE 
J075136E01TGATGGGCTNONE 
J075149G04TGATGGGCTNONE 
Os02g0785800005-017-E01TGGATGGGCTTTNONE 
009-104-F05TGGATGGGCTTTNONE 
009-149-A09TGGATGGGCTTTNONE 
009-192-D08TGGATGGGCTTTNONE 
AK063859TGGATGGGCTTTNONE 
AK121768TGGATGGGCTTTSimilar to Ribosomal protein L35A. 
J013037M21TGGATGGGCTTTNONE 
J023009A11TGGATGGGCTTTNONE 
J023010P14TGGATGGGCTTTNONE 
J033092B03TGGATGGGCTTTNONE 
J065009O06TGGATGGGCTTTNONE 
J065024K14TGGATGGGCTTTNONE 
J065053F16TGGATGGGCTTTNONE 
J065056D18TGGATGGGCTTTNONE 
J065056N12TGGATGGGCTTTNONE 
J065071L21TGGATGGGCTTTNONE 
J065075M21TGGATGGGCTTTNONE 
J065087D19TGGATGGGCTTTNONE 
J065111N01TGGATGGGCTTTNONE 
J065172M05TGGATGGGCTTTNONE 
J065176E03TGGATGGGCTTTNONE 
J065184D08TGGATGGGCTTTNONE 
J065188K21TGGATGGGCTTTNONE 
J065194I05TGGATGGGCTTTNONE 
J065196E09TGGATGGGCTTTNONE 
J065196O21TGGATGGGCTTTNONE 
J065204O06TGGATGGGCTTTNONE 
J065212J02TGGATGGGCTTTNONE 
J075066H03TGGATGGGCTTTNONE 
J075067C04TGGATGGGCTTTNONE 
J075070I09TGGATGGGCTTTNONE 
J075081J03TGGATGGGCTTTNONE 
J075086I05TGGATGGGCTTTNONE 
J075092E09TGGATGGGCTTTNONE 
J075096D13TGGATGGGCTTTNONE 
J075098A12TGGATGGGCTTTNONE 
J075110B18TGGATGGGCTTTNONE 
J075116E14TGGATGGGCTTTNONE 
J075117J23TGGATGGGCTTTNONE 
J075117O16TGGATGGGCTTTNONE 
J075130H10TGGATGGGCTTTNONE 
J075151B07TGGATGGGCTTTNONE 
J075156C02TGGATGGGCTTTNONE 
J075159C07TGGATGGGCTTTNONE 
J075172O12TGGATGGGCTTTNONE 
J075181K16TGGATGGGCTTTNONE 
J075185J05TGGATGGGCTTTNONE 
J075186D14TGGATGGGCTTTNONE 
J075187F23TGGATGGGCTTTNONE 
J075193B15TGGATGGGCTTTNONE 
J075194P20TGGATGGGCTTTNONE 
J090002B21TGGATGGGCTTTNONE 
J090018E03TGGATGGGCTTTNONE 
J090029I04TGGATGGGCTTTNONE 
J090065F12TGGATGGGCTTTNONE 
J090066M05TGGATGGGCTTTNONE 
J090078A20TGGATGGGCTTTNONE 
J090084O15TGGATGGGCTTTNONE 
J090088P20TGGATGGGCTTTNONE 
J090098L20TGGATGGGCTTTNONE 
J100025B19TGGATGGGCTTTNONE 
J100038H15TGGATGGGCTTTNONE 
J100045H17TGGATGGGCTTTNONE 
J100058E17TGGATGGGCTTTNONE 
J100060O16TGGATGGGCTTTNONE 
J100067I10TGGATGGGCTTTNONE 
J100082N24TGGATGGGCTTTNONE 
J100083C17TGGATGGGCTTTNONE 
J100085I24TGGATGGGCTTTNONE 
J100087K20TGGATGGGCTTTNONE 
Os02g0788400AK060351AAAAGCCCATCANONE 
AK103497AAAAGCCCATCASimilar to Eukaryotic translation initiation factor 3 subunit-like protein. 
Os02g0819700AK067374TGGATGGGCTGTATTGGGCCTCZinc finger, Zim17-type family protein. 
AK099160TGGATGGGCTGTATTGGGCCTCNONE 
J100086K17TGGATGGGCTGTATTGGGCCTCNONE 
Os02g0824400AK121390AACTGGGCCTTTGATGGGCTTTConserved hypothetical protein. 
J023128P21AACTGGGCCTTTGATGGGCTTTNONE 
J053097O16AACTGGGCCTTTGATGGGCTTTNONE 
J065012I02AACTGGGCCTTTGATGGGCTTTNONE 
J065049C06AACTGGGCCTTTGATGGGCTTTNONE 
J065051H02AACTGGGCCTTTGATGGGCTTTNONE 
J065069A13AACTGGGCCTTTGATGGGCTTTNONE 
J065082E04AACTGGGCCTTTGATGGGCTTTNONE 
J065102N09AACTGGGCCTTTGATGGGCTTTNONE 
J065157O10AACTGGGCCTTTGATGGGCTTTNONE 
J065188N23AACTGGGCCTTTGATGGGCTTTNONE 
J065190J11AACTGGGCCTTTGATGGGCTTTNONE 
J065202M09AACTGGGCCTTTGATGGGCTTTNONE 
Os03g0135300004-017-A10AGCCCATCTGTCAGTGNONE 
006-046-A11AGCCCATCTGTCAGTGNONE 
006-110-B05AGCCCATCTGTCAGTGNONE 
AF309384AGCCCATCTGTCAGTGNONE 
AK071745AGCCCATCTGTCAGTGSimilar to Glutathione S-transferase GST 10 (EC 2.5.1.18). 
AK104680AGCCCATCTGTCAGTGNONE 
J013100M12AGCCCATCTGTCAGTGNONE 
J023107J18AGCCCATCTGTCAGTGNONE 
J033081B13AGCCCATCTGTCAGTGNONE 
J033087L03AGCCCATCTGTCAGTGNONE 
J065120N18AGCCCATCTGTCAGTGNONE 
J075032C15AGCCCATCTGTCAGTGNONE 
J075172P14AGCCCATCTGTCAGTGNONE 
J090049B05AGCCCATCTGTCAGTGNONE 
Os03g0142900011-054-A05GAAGCCCATCTNONE 
AK067103GAAGCCCATCTNONE 
AK120438GAAGCCCATCTProtein of unknown function DUF946, plant family protein. 
J013097D18GAAGCCCATCTNONE 
J013098E18GAAGCCCATCTNONE 
J013099I17GAAGCCCATCTNONE 
J013108C09GAAGCCCATCTNONE 
J023045J15GAAGCCCATCTNONE 
J033034E13GAAGCCCATCTNONE 
J033095F07GAAGCCCATCTNONE 
J033102N22GAAGCCCATCTNONE 
J065016C14GAAGCCCATCTNONE 
J065034E13GAAGCCCATCTNONE 
J065065F21GAAGCCCATCTNONE 
J065159M09GAAGCCCATCTNONE 
J075012C13GAAGCCCATCTNONE 
J075017P18GAAGCCCATCTNONE 
J075018M03GAAGCCCATCTNONE 
J075021H19GAAGCCCATCTNONE 
J075070K23GAAGCCCATCTNONE 
J075077B18GAAGCCCATCTNONE 
J075085E20GAAGCCCATCTNONE 
J075090N23GAAGCCCATCTNONE 
J075137M16GAAGCCCATCTNONE 
J075151E03GAAGCCCATCTNONE 
J090042L02GAAGCCCATCTNONE 
J090060C21GAAGCCCATCTNONE 
J090089I17GAAGCCCATCTNONE 
J100024L19GAAGCCCATCTNONE 
J100025A06GAAGCCCATCTNONE 
J100033C24GAAGCCCATCTNONE 
J100052J17GAAGCCCATCTNONE 
J100063H10GAAGCCCATCTNONE 
J100073P04GAAGCCCATCTNONE 
J100075D01GAAGCCCATCTNONE 
J100077J17GAAGCCCATCTNONE 
J100087F03GAAGCCCATCTNONE 
J100087F09GAAGCCCATCTNONE 
Os03g0182800003-126-E06ACAGCCCATCCNONE 
AJ304840ACAGCCCATCCNONE 
AK073133ACAGCCCATCCNONE 
AY323478ACAGCCCATCCSimilar to Ethylene responsive element binding factor3 (OsERF3). 
J033023E13ACAGCCCATCCNONE 
J033028C22ACAGCCCATCCNONE 
J033042J03ACAGCCCATCCNONE 
J065022E13ACAGCCCATCCNONE 
J065208N24ACAGCCCATCCNONE 
J100034B17ACAGCCCATCCNONE 
J100035J21ACAGCCCATCCNONE 
J100039L16ACAGCCCATCCNONE 
J100040A02ACAGCCCATCCNONE 
J100051L11ACAGCCCATCCNONE 
J100064F07ACAGCCCATCCNONE 
J100070J12ACAGCCCATCCNONE 
Os03g0192600006-033-B01AGATGGGCTNONE 
006-079-H12AGATGGGCTNONE 
009-092-E03AGATGGGCTNONE 
AK061461AGATGGGCTNONE 
AK105970AGATGGGCTPlant lipid transfer protein/Par allergen family protein. 
J065152D05AGATGGGCTNONE 
J100056I22AGATGGGCTNONE 
Os03g0213800AK103114AGATGGGCTGGMitochondrial substrate carrier family protein. 
Os03g0233800AK072396AGATGGGCTProtein of unknown function DUF547 domain containing protein. 
AK108855AGATGGGCTNONE 
Os03g0248300009-063-H02AAAGCCCATCANONE 
AK062535AAAGCCCATCASimilar to Cytochrome P450 76C4 (EC 1.14.-.-). 
Os03g0272400009-134-B08CAAGCCCATCANONE 
AK070454CAAGCCCATCAHypothetical protein. 
J023050K07CAAGCCCATCANONE 
J075075P06CAAGCCCATCANONE 
J090098L07CAAGCCCATCANONE 
Os03g0278900006-049-H12TGGATGGGCTAATGGGCCCAACTNONE 
006-082-A07TGGATGGGCTAATGGGCCCAACTNONE 
009-169-C04TGGATGGGCTAATGGGCCCAACTNONE 
AK066019TGGATGGGCTAATGGGCCCAACTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TGGATGGGCTAATGGGCCCAACTNONE 
AY224460TGGATGGGCTAATGGGCCCAACTNONE 
J065021K17TGGATGGGCTAATGGGCCCAACTNONE 
J065141H24TGGATGGGCTAATGGGCCCAACTNONE 
J065142J20TGGATGGGCTAATGGGCCCAACTNONE 
J065152J03TGGATGGGCTAATGGGCCCAACTNONE 
J065163A13TGGATGGGCTAATGGGCCCAACTNONE 
J065191I21TGGATGGGCTAATGGGCCCAACTNONE 
J065193K12TGGATGGGCTAATGGGCCCAACTNONE 
J075003D01TGGATGGGCTAATGGGCCCAACTNONE 
J075017D24TGGATGGGCTAATGGGCCCAACTNONE 
J075060F20TGGATGGGCTAATGGGCCCAACTNONE 
J075154C11TGGATGGGCTAATGGGCCCAACTNONE 
J075173F04TGGATGGGCTAATGGGCCCAACTNONE 
Os03g0284800AJ550618CGATGGGCTNONE 
AK073184CGATGGGCTSpo11/DNA topoisomerase VI, subunit A family protein. 
Os03g0297800AK107121TGATGGGCTProtein kinase-like domain containing protein. 
Os03g0305400009-198-D04GAAGCCCATCANONE 
013-012-C06GAAGCCCATCANONE 
014-034-D01GAAGCCCATCANONE 
AK071397GAAGCCCATCAUniversal stress protein (Usp) family protein. 
J023012O22GAAGCCCATCANONE 
J023097A13GAAGCCCATCANONE 
J023107P16GAAGCCCATCANONE 
J023113C14GAAGCCCATCANONE 
Os03g0308000016-023-H09AGCCCATCCANONE 
AK100355AGCCCATCCAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05AGCCCATCCANONE 
J023043K04AGCCCATCCANONE 
J023083I20AGCCCATCCANONE 
J033068F22AGCCCATCCANONE 
J033125P21AGCCCATCCANONE 
J065207A22AGCCCATCCANONE 
J100018D20AGCCCATCCANONE 
J100026L17AGCCCATCCANONE 
J100055D14AGCCCATCCANONE 
J100060P03AGCCCATCCANONE 
J100078A20AGCCCATCCANONE 
Os03g0336000AK100067TCAGCCCATCTProtein prenyltransferase domain containing protein. 
J065161K02TCAGCCCATCTNONE 
J065162C21TCAGCCCATCTNONE 
Os03g0347700AK110492AGCCCATCANPH3 domain containing protein. 
Os03g0411500AK058696AGATGGGCTNONE 
AK071057AGATGGGCTPeptidase S14, ClpP family protein. 
Os03g0581800009-177-G11TAAGCCCATCCGGCCCAAATNONE 
AK059201TAAGCCCATCCGGCCCAAATNONE 
AK121839TAAGCCCATCCGGCCCAAATHypothetical protein. 
J023022K06TAAGCCCATCCGGCCCAAATNONE 
J023110K21TAAGCCCATCCGGCCCAAATNONE 
J033100N18TAAGCCCATCCGGCCCAAATNONE 
J033120D11TAAGCCCATCCGGCCCAAATNONE 
J065044P15TAAGCCCATCCGGCCCAAATNONE 
J065102G22TAAGCCCATCCGGCCCAAATNONE 
J065149N14TAAGCCCATCCGGCCCAAATNONE 
J065201L18TAAGCCCATCCGGCCCAAATNONE 
J065205K10TAAGCCCATCCGGCCCAAATNONE 
J075035D19TAAGCCCATCCGGCCCAAATNONE 
J075073E06TAAGCCCATCCGGCCCAAATNONE 
J075134M11TAAGCCCATCCGGCCCAAATNONE 
J090004P12TAAGCCCATCCGGCCCAAATNONE 
J090070H20TAAGCCCATCCGGCCCAAATNONE 
J090087B04TAAGCCCATCCGGCCCAAATNONE 
J100028F10TAAGCCCATCCGGCCCAAATNONE 
J100036M18TAAGCCCATCCGGCCCAAATNONE 
J100065C24TAAGCCCATCCGGCCCAAATNONE 
J100080O13TAAGCCCATCCGGCCCAAATNONE 
Os03g0598200AK068322ACAGCCCATCANop14-like protein family protein. 
Os03g0604600J090093K23CCAGCCCAGATGGGCTConserved hypothetical protein. 
Os03g0622300AK107931AGCCCATCAConserved hypothetical protein. 
J065184K14AGCCCATCANONE 
Os03g0634000014-034-A03ACAGCCCATCTGGACCNONE 
AK063673ACAGCCCATCTGGACCSimilar to THA4. 
Os03g0648400005-003-D07ACAGCCCATCTNONE 
006-048-C12ACAGCCCATCTNONE 
006-049-A03ACAGCCCATCTNONE 
011-008-F07ACAGCCCATCTNONE 
011-039-A07ACAGCCCATCTNONE 
011-044-D10ACAGCCCATCTNONE 
011-099-C01ACAGCCCATCTNONE 
012-051-B09ACAGCCCATCTNONE 
012-051-D08ACAGCCCATCTNONE 
012-056-G07ACAGCCCATCTNONE 
012-062-A01ACAGCCCATCTNONE 
012-079-C03ACAGCCCATCTNONE 
014-003-A06ACAGCCCATCTNONE 
015-010-D02ACAGCCCATCTNONE 
AK102263ACAGCCCATCTSimilar to DnaJ protein homolog (DNAJ-1). 
AK103763ACAGCCCATCTNONE 
AK105028ACAGCCCATCTNONE 
AY224432ACAGCCCATCTNONE 
J013043H01ACAGCCCATCTNONE 
J013134K10ACAGCCCATCTNONE 
J023037D18ACAGCCCATCTNONE 
J023077K20ACAGCCCATCTNONE 
J023105M19ACAGCCCATCTNONE 
J023131M09ACAGCCCATCTNONE 
J033022F05ACAGCCCATCTNONE 
J033051J22ACAGCCCATCTNONE 
J033061D03ACAGCCCATCTNONE 
J033084H04ACAGCCCATCTNONE 
J033088M01ACAGCCCATCTNONE 
J033119H12ACAGCCCATCTNONE 
J033131C18ACAGCCCATCTNONE 
J043030C06ACAGCCCATCTNONE 
J080032A08ACAGCCCATCTNONE 
J090008C11ACAGCCCATCTNONE 
J090014D24ACAGCCCATCTNONE 
J090024C20ACAGCCCATCTNONE 
J090024H08ACAGCCCATCTNONE 
J090029F10ACAGCCCATCTNONE 
J090032K16ACAGCCCATCTNONE 
J090034L14ACAGCCCATCTNONE 
J090035C20ACAGCCCATCTNONE 
J090044H05ACAGCCCATCTNONE 
J090048M09ACAGCCCATCTNONE 
J090056I15ACAGCCCATCTNONE 
J090062B01ACAGCCCATCTNONE 
J090076F06ACAGCCCATCTNONE 
J090077A02ACAGCCCATCTNONE 
J090084E21ACAGCCCATCTNONE 
J090084J09ACAGCCCATCTNONE 
J090086G11ACAGCCCATCTNONE 
J090092C20ACAGCCCATCTNONE 
J100018G14ACAGCCCATCTNONE 
J100018I22ACAGCCCATCTNONE 
J100024N14ACAGCCCATCTNONE 
J100032K09ACAGCCCATCTNONE 
J100036F09ACAGCCCATCTNONE 
J100041M04ACAGCCCATCTNONE 
J100042H05ACAGCCCATCTNONE 
J100043P19ACAGCCCATCTNONE 
J100044B04ACAGCCCATCTNONE 
J100049L24ACAGCCCATCTNONE 
J100050M21ACAGCCCATCTNONE 
J100057F24ACAGCCCATCTNONE 
J100063I11ACAGCCCATCTNONE 
J100064J24ACAGCCCATCTNONE 
J100070B13ACAGCCCATCTNONE 
J100076A13ACAGCCCATCTNONE 
J100081C20ACAGCCCATCTNONE 
J100081L09ACAGCCCATCTNONE 
J100084G23ACAGCCCATCTNONE 
J100088H02ACAGCCCATCTNONE 
Os03g0656900AK066416AGATGGGCTTGNusB/RsmB/TIM44 domain containing protein. 
J065157L23AGATGGGCTTGNONE 
J065166P22AGATGGGCTTGNONE 
Os03g0722000AK069866GCAGCCCATCCANONE 
Os03g0746400AK063445TGATGGGCTGCProtein prenyltransferase domain containing protein. 
AK070923TGATGGGCTGCNONE 
J065008K24TGATGGGCTGCNONE 
Os03g0758800AJ252135AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AJ312906AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
AK060387AAAAGCCCATCCCACGGCCCGCTCTCCGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J023109G09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J033038B14AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J043013C09AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J053096E21AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065026B08AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065062B16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065066E03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065091J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J065164A06AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075014I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075117N07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075142M03AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075175D04AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075188M01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J075199I20AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090010J12AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090025O16AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090041H05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J090078P07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100031K10AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100055F23AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100064G05AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080C24AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100080O07AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
J100090F01AAAAGCCCATCCCACGGCCCGCTCTCCGCNONE 
Os03g0784400AK103474AAAAGCCCATCGProtein of unknown function DUF1692 domain containing protein. 
J023135I15AAAAGCCCATCGNONE 
J033130D12AAAAGCCCATCGNONE 
J043035E20AAAAGCCCATCGNONE 
J065206K15AAAAGCCCATCGNONE 
J075053J20AAAAGCCCATCGNONE 
J075129B11AAAAGCCCATCGNONE 
J090003E22AAAAGCCCATCGNONE 
J100023E23AAAAGCCCATCGNONE 
Os03g0786500016-056-D08AGCCCATCTNONE 
AK106487AGCCCATCTSimilar to Glycine-rich protein 2. 
J080001C23AGCCCATCTNONE 
J080005A02AGCCCATCTNONE 
J080009A14AGCCCATCTNONE 
J080009B11AGCCCATCTNONE 
J080011L03AGCCCATCTNONE 
J080017E21AGCCCATCTNONE 
J080018H08AGCCCATCTNONE 
J080021E11AGCCCATCTNONE 
J080025O20AGCCCATCTNONE 
J080026H21AGCCCATCTNONE 
J080029I10AGCCCATCTNONE 
J080036L01AGCCCATCTNONE 
J080038M15AGCCCATCTNONE 
J080051H09AGCCCATCTNONE 
J080053E18AGCCCATCTNONE 
J080054I12AGCCCATCTNONE 
J080055B14AGCCCATCTNONE 
J080060L16AGCCCATCTNONE 
J080067G06AGCCCATCTNONE 
J080069K14AGCCCATCTNONE 
J080070N14AGCCCATCTNONE 
J080071G10AGCCCATCTNONE 
J080076D08AGCCCATCTNONE 
J080076O11AGCCCATCTNONE 
J080078E10AGCCCATCTNONE 
J080079B15AGCCCATCTNONE 
J080079K03AGCCCATCTNONE 
J080079O15AGCCCATCTNONE 
J080087B18AGCCCATCTNONE 
Os03g0797600006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
Os03g0840200AK067797TCAGCCCATCATolB, C-terminal domain containing protein. 
AK100408TCAGCCCATCANONE 
J075027I23TCAGCCCATCANONE 
J075049N10TCAGCCCATCANONE 
J100058E07TCAGCCCATCANONE 
Os03g0856200009-070-B07GCAGCCCATCANONE 
009-135-H05GCAGCCCATCANONE 
J100067D22GCAGCCCATCANONE 
J100067L13GCAGCCCATCANONE 
J100073I07GCAGCCCATCANONE 
J100080D01GCAGCCCATCANONE 
Os03g0861700AK066129CGATGGGCTTARhodanese-like domain containing protein. 
J013051M12CGATGGGCTTANONE 
J013104N13CGATGGGCTTANONE 
J065052E12CGATGGGCTTANONE 
Os03g0861800AF358762TAAGCCCATCGNONE 
AK068434TAAGCCCATCGCyclin-like F-box domain containing protein. 
AK109388TAAGCCCATCGNONE 
J013154L15TAAGCCCATCGNONE 
J013170I23TAAGCCCATCGNONE 
J023031D05TAAGCCCATCGNONE 
J023082E07TAAGCCCATCGNONE 
J023095M10TAAGCCCATCGNONE 
J023127D14TAAGCCCATCGNONE 
J023138M15TAAGCCCATCGNONE 
J023138M16TAAGCCCATCGNONE 
J033060B18TAAGCCCATCGNONE 
J033060F13TAAGCCCATCGNONE 
J033096J11TAAGCCCATCGNONE 
J033122C07TAAGCCCATCGNONE 
J053029A10TAAGCCCATCGNONE 
J053062O16TAAGCCCATCGNONE 
J053064J08TAAGCCCATCGNONE 
J053086F22TAAGCCCATCGNONE 
J065036C04TAAGCCCATCGNONE 
J065072J23TAAGCCCATCGNONE 
J065120D04TAAGCCCATCGNONE 
J065161D04TAAGCCCATCGNONE 
J065172H02TAAGCCCATCGNONE 
J065207B01TAAGCCCATCGNONE 
J075019H18TAAGCCCATCGNONE 
J075082E16TAAGCCCATCGNONE 
J075089A10TAAGCCCATCGNONE 
J075099G02TAAGCCCATCGNONE 
J075134M04TAAGCCCATCGNONE 
J075144K19TAAGCCCATCGNONE 
J075147F17TAAGCCCATCGNONE 
J090004O14TAAGCCCATCGNONE 
J090013A07TAAGCCCATCGNONE 
J090047K14TAAGCCCATCGNONE 
Os04g0107900013-017-E10AGATGGGCTGCNONE 
014-025-A02AGATGGGCTGCNONE 
014-100-C01AGATGGGCTGCNONE 
AK063568AGATGGGCTGCNONE 
AK063698AGATGGGCTGCNONE 
AK063751AGATGGGCTGCSimilar to Heat shock protein 80. 
J013118G22AGATGGGCTGCNONE 
J033131C17AGATGGGCTGCNONE 
J065036G05AGATGGGCTGCNONE 
J065106E24AGATGGGCTGCNONE 
J065171K16AGATGGGCTGCNONE 
J065213C11AGATGGGCTGCNONE 
J065218L17AGATGGGCTGCNONE 
Os04g0432000AB125308CCAGCCCATCCCCCSerine/threonine-protein kinase SAPK7 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 7). 
AK122087CCAGCCCATCCCCCNONE 
J065206O17CCAGCCCATCCCCCNONE 
Os04g0451100AK106764GAAGCCCATCTConserved hypothetical protein. 
Os04g0462600AK111125AGATGGGCTDynein light chain, type 1 family protein. 
Os04g0470300AK059742AGCCCATCTNONE 
AK070483AGCCCATCTProtein of unknown function UPF0136, Transmembrane family protein. 
J065200F06AGCCCATCTNONE 
J090047A18AGCCCATCTNONE 
Os04g0500700AK072528AGCCCATCGSimilar to Hydroxyanthranilate hydroxycinnamoyltransferase 3. 
AK104637AGCCCATCGNONE 
AK119237AGCCCATCGNONE 
Os04g0514500AK073502AGATGGGCTNONE 
J090058N12AGATGGGCTNONE 
Os04g0525000AK067753TCAGGCCCAGCCCATCTConserved hypothetical protein. 
J013118G14TCAGGCCCAGCCCATCTNONE 
J065026J15TCAGGCCCAGCCCATCTNONE 
J065184H21TCAGGCCCAGCCCATCTNONE 
J065186H22TCAGGCCCAGCCCATCTNONE 
J065193D20TCAGGCCCAGCCCATCTNONE 
J075060D12TCAGGCCCAGCCCATCTNONE 
J075179L24TCAGGCCCAGCCCATCTNONE 
Os04g0528100009-090-G06AGCCCATCTNONE 
009-168-C11AGCCCATCTNONE 
AK065957AGCCCATCTConserved hypothetical protein. 
J013039G20AGCCCATCTNONE 
J013044D08AGCCCATCTNONE 
J065013L14AGCCCATCTNONE 
J065143H08AGCCCATCTNONE 
J065146C14AGCCCATCTNONE 
J065149K22AGCCCATCTNONE 
J065156B18AGCCCATCTNONE 
J065201A04AGCCCATCTNONE 
J065209A04AGCCCATCTNONE 
Os04g0556000AK063759GGATGGGCTNONE 
Os04g0584600006-042-D11CAAGCCCATCANONE 
006-065-G07CAAGCCCATCANONE 
AB042550CAAGCCCATCANONE 
AK059786CAAGCCCATCANONE 
AK061881CAAGCCCATCANONE 
AK066495CAAGCCCATCASimilar to Calcium dependent protein kinase. 
J090067J05CAAGCCCATCANONE 
J100037I23CAAGCCCATCANONE 
Os04g0600200AB004864AAAGCCCATCTNONE 
AB007452AAAGCCCATCTNONE 
AK064040AAAGCCCATCTSimilar to Alternative oxidase 1a (Fragment). 
Os04g0638800AK070319AAAGCCCATCAProtein of unknown function DUF617, plant family protein. 
AK070319TGATGGGCTProtein of unknown function DUF617, plant family protein. 
AK071753AAAGCCCATCANONE 
AK071753TGATGGGCTNONE 
Os04g0681600AK105243CAAGCCCATCAProtein of unknown function DUF580 family protein. 
Os04g0683900004-009-A11GCCCACCCAGCCCATCCNONE 
014-076-H12GCCCACCCAGCCCATCCNONE 
AK060880GCCCACCCAGCCCATCCNONE 
AK099749GCCCACCCAGCCCATCCHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309GCCCACCCAGCCCATCCNONE 
J013050K21GCCCACCCAGCCCATCCNONE 
J013092E09GCCCACCCAGCCCATCCNONE 
J013095N06GCCCACCCAGCCCATCCNONE 
J013095P07GCCCACCCAGCCCATCCNONE 
J013130D22GCCCACCCAGCCCATCCNONE 
J013134O15GCCCACCCAGCCCATCCNONE 
J023022I06GCCCACCCAGCCCATCCNONE 
J023062L11GCCCACCCAGCCCATCCNONE 
J023078J11GCCCACCCAGCCCATCCNONE 
J023086J01GCCCACCCAGCCCATCCNONE 
J033125A20GCCCACCCAGCCCATCCNONE 
J065023K13GCCCACCCAGCCCATCCNONE 
J065045N02GCCCACCCAGCCCATCCNONE 
J065129F01GCCCACCCAGCCCATCCNONE 
J065164H14GCCCACCCAGCCCATCCNONE 
J065192H09GCCCACCCAGCCCATCCNONE 
J075064P15GCCCACCCAGCCCATCCNONE 
J075088G17GCCCACCCAGCCCATCCNONE 
J075199D20GCCCACCCAGCCCATCCNONE 
Os05g0103100AK103317GGATGGGCTTGTranslocon-associated beta family protein. 
J033125H15GGATGGGCTTGNONE 
J065021L01GGATGGGCTTGNONE 
J065029M01GGATGGGCTTGNONE 
J065089F17GGATGGGCTTGNONE 
J065112N04GGATGGGCTTGNONE 
J065163L03GGATGGGCTTGNONE 
J065175B04GGATGGGCTTGNONE 
J065192E02GGATGGGCTTGNONE 
J075046C20GGATGGGCTTGNONE 
J075192A01GGATGGGCTTGNONE 
J100018H13GGATGGGCTTGNONE 
J100067K20GGATGGGCTTGNONE 
J100080N03GGATGGGCTTGNONE 
Os05g0129900AK060436AGCCCATCGTetratricopeptide-like helical domain containing protein. 
AK102515AGCCCATCGNONE 
Os05g0134400006-081-H06AGCCCATCANONE 
006-116-E07AGCCCATCANONE 
009-037-B01AGCCCATCANONE 
009-151-H03AGCCCATCANONE 
016-005-E01AGCCCATCANONE 
AK061809AGCCCATCAHaem peroxidase, plant/fungal/bacterial family protein. 
AK119205AGCCCATCANONE 
AK122031AGCCCATCANONE 
J013088F04AGCCCATCANONE 
J013106F18AGCCCATCANONE 
J033139E06AGCCCATCANONE 
J065152O06AGCCCATCANONE 
J090086A11AGCCCATCANONE 
Os05g0144800AK099724CCAGCCCATCTSimilar to TFIIH basal transcription factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementing XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). 
Os05g0152400Os05g0152400AGCCCATCCGlycosyl transferase, family 14 protein. 
Os05g0182100006-094-F11AGCCCATCGNONE 
015-006-H06AGCCCATCGNONE 
AK071095AGCCCATCGTetratricopeptide-like helical domain containing protein. 
AK106020AGCCCATCGNONE 
J023079N14AGCCCATCGNONE 
J065059G19AGCCCATCGNONE 
J065193B20AGCCCATCGNONE 
J075097H12AGCCCATCGNONE 
J075103B21AGCCCATCGNONE 
J075150G24AGCCCATCGNONE 
J075177C14AGCCCATCGNONE 
J100056A14AGCCCATCGNONE 
Os05g0210100AK122049AGCCCATAGCCCATCCALipolytic enzyme, G-D-S-L family protein. 
Os05g0316200AK060608CCAGCCCATCCANONE 
AK101705CCAGCCCATCCAConserved hypothetical protein. 
AK111481CCAGCCCATCCANONE 
Os05g0346300009-033-C06AGATGGGCTTGGGCTTTNONE 
AF529175AGATGGGCTTGGGCTTTNONE 
AK061627AGATGGGCTTGGGCTTTSimilar to 40S ribosomal protein S7. 
AK103081AGATGGGCTTGGGCTTTNONE 
AK104191AGATGGGCTTGGGCTTTNONE 
J013049B09AGATGGGCTTGGGCTTTNONE 
J023142E24AGATGGGCTTGGGCTTTNONE 
J033052M14AGATGGGCTTGGGCTTTNONE 
J033089N04AGATGGGCTTGGGCTTTNONE 
J033118F01AGATGGGCTTGGGCTTTNONE 
J065054E07AGATGGGCTTGGGCTTTNONE 
J065066L18AGATGGGCTTGGGCTTTNONE 
J065078C21AGATGGGCTTGGGCTTTNONE 
J065127G23AGATGGGCTTGGGCTTTNONE 
J065128N24AGATGGGCTTGGGCTTTNONE 
J065144P17AGATGGGCTTGGGCTTTNONE 
J065147P14AGATGGGCTTGGGCTTTNONE 
J065170E16AGATGGGCTTGGGCTTTNONE 
J065175D17AGATGGGCTTGGGCTTTNONE 
J065176M05AGATGGGCTTGGGCTTTNONE 
J065218G20AGATGGGCTTGGGCTTTNONE 
J090074J12AGATGGGCTTGGGCTTTNONE 
J100019H16AGATGGGCTTGGGCTTTNONE 
J100031N24AGATGGGCTTGGGCTTTNONE 
J100072G08AGATGGGCTTGGGCTTTNONE 
J100086I23AGATGGGCTTGGGCTTTNONE 
Os05g0346400AK058872CCAAGCCCATCTNONE 
AK102727CCAAGCCCATCTProtein of unknown function DUF538 family protein. 
J033105N07CCAAGCCCATCTNONE 
J100077I17CCAAGCCCATCTNONE 
Os05g0378900AK103841ACAGCCCATCAConserved hypothetical protein. 
AK103841CCAGCCCATCAConserved hypothetical protein. 
J033148I18ACAGCCCATCANONE 
J033148I18CCAGCCCATCANONE 
J065085F12ACAGCCCATCANONE 
J065085F12CCAGCCCATCANONE 
J075041H24ACAGCCCATCANONE 
J075041H24CCAGCCCATCANONE 
J075180P06ACAGCCCATCANONE 
J075180P06CCAGCCCATCANONE 
Os05g0437800015-045-B10AGATGGGCTNONE 
AK106328AGATGGGCTConserved hypothetical protein. 
Os05g0500500AK110627CGATGGGCTTCHSP20-like chaperone domain containing protein. 
Os05g0541500AK101190AGATGGGCTGGCyclin-like F-box domain containing protein. 
AK101531AGATGGGCTGGNONE 
J033030F10AGATGGGCTGGNONE 
Os05g0542200AK071306AGCCCATCCAEpoxide hydrolase family protein. 
AK071703AGCCCATCCANONE 
Os05g0554100AK073023GCCCAGCCCATCARibosomal protein L7/L12 family protein. 
AK101756GCCCAGCCCATCANONE 
Os05g0558900AK101679TAAGCCCATCGSimilar to Frsb-prov protein. 
J013028M08TAAGCCCATCGNONE 
J013074E16TAAGCCCATCGNONE 
J013096L01TAAGCCCATCGNONE 
J023085M19TAAGCCCATCGNONE 
J033058I10TAAGCCCATCGNONE 
J033091D18TAAGCCCATCGNONE 
J033111H13TAAGCCCATCGNONE 
J033114C18TAAGCCCATCGNONE 
Os05g0565100011-013-H02AGCCCATCTNONE 
AK063277AGCCCATCTCytochrome b561 / ferric reductase transmembrane domain containing protein. 
Os05g0566500AK073468TGATGGGCTNONE 
AK099052TGATGGGCTSimilar to Initiation factor 3d (Fragment). 
AK104093TGATGGGCTNONE 
J090025I18TGATGGGCTNONE 
Os05g0587400AK102121AGCCCATCTPrefoldin domain containing protein. 
J033084N12AGCCCATCTNONE 
Os06g0116600AK103500AAAAGCCCATCTProteinase inhibitor, propeptide domain containing protein. 
J033131B10AAAAGCCCATCTNONE 
J075154F17AAAAGCCCATCTNONE 
J075169L23AAAAGCCCATCTNONE 
Os06g0134900AK103205GGATGGGCTGTGTTGGGCCAAGCCCAGConserved hypothetical protein. 
J033122E01GGATGGGCTGTGTTGGGCCAAGCCCAGNONE 
Os06g0135000J075008J15CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075166F23CTGGGCTTGGCCCAACACAGCCCATCCNONE 
J075185F03CTGGGCTTGGCCCAACACAGCCCATCCNONE 
Os06g0137500AK072896AAAGCCCATCTBrix domain containing protein. 
AK121945AAAGCCCATCTNONE 
Os06g0139700006-052-C07TAAGCCCATCCACCNONE 
009-009-A08TAAGCCCATCCACCNONE 
015-020-D09TAAGCCCATCCACCNONE 
015-087-H06TAAGCCCATCCACCNONE 
016-078-A03TAAGCCCATCCACCNONE 
AK067884TAAGCCCATCCACCNONE 
AK103245TAAGCCCATCCACCConserved hypothetical protein. 
AK106116TAAGCCCATCCACCNONE 
AK106220TAAGCCCATCCACCNONE 
Os06g0168000AK059250TGATGGGCTTCNONE 
AK099356TGATGGGCTTCGlutathione S-transferase, C-terminal-like domain containing protein. 
J033040E19TGATGGGCTTCNONE 
J033097H04TGATGGGCTTCNONE 
J075087M11TGATGGGCTTCNONE 
J075146H06TGATGGGCTTCNONE 
J075188H11TGATGGGCTTCNONE 
J090071D03TGATGGGCTTCNONE 
J090097L20TGATGGGCTTCNONE 
J100051M05TGATGGGCTTCNONE 
J100082H13TGATGGGCTTCNONE 
Os06g0192500AK067746TTTCGGCCCATACAGCCCATCAATP-dependent helicase, DEAH-box family protein. 
J065023K06TTTCGGCCCATACAGCCCATCANONE 
J100063P08TTTCGGCCCATACAGCCCATCANONE 
J100065N03TTTCGGCCCATACAGCCCATCANONE 
Os06g0202900AK109607TAAGCCCATCGProtein kinase-like domain containing protein. 
Os06g0219800011-090-C04CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
AK072030CTGGCCCATGGAGCCCATCAGCCCAAACSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3. 
AK100405CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J065063P03CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100032E17CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100081I18CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
Os06g0326500AK068142GGATGGGCTMitochondrial glycoprotein family protein. 
AK071483GGATGGGCTNONE 
J053065A20GGATGGGCTNONE 
J065082D14GGATGGGCTNONE 
Os06g0343900AK070940CGATGGGCTConserved hypothetical protein. 
Os06g0487900AK064330AGATGGGCTPeptidase C48, SUMO/Sentrin/Ubl1 family protein. 
J033045C16AGATGGGCTNONE 
J090071I20AGATGGGCTNONE 
Os06g0494400AK067594ACAGCCCATCCMulti antimicrobial extrusion protein MatE family protein. 
Os06g0499900J065053E01CGATGGGCCGGCCGATGGGCTNONE 
J065078C19CGATGGGCCGGCCGATGGGCTNONE 
J065122P11CGATGGGCCGGCCGATGGGCTNONE 
J065209B15CGATGGGCCGGCCGATGGGCTNONE 
J065218E19CGATGGGCCGGCCGATGGGCTNONE 
Os06g0564700AK070508AGCCCATCTSimilar to Cysteine synthase (EC 4.2.99.8). 
J023050D23AGCCCATCTNONE 
Os06g0592500AK119729AGCCCATCCSimilar to Ethylene-responsive transcriptional coactivator. 
AK122052AGCCCATCCNONE 
Os06g0600100AK065619ACAGCCCATCASimilar to TAT-binding protein homolog (Fragment). 
Os06g0608500AK060097CCAGCCCATCTTGGCCCACCNONE 
AK070667CCAGCCCATCTTGGCCCACCSnf7 family protein. 
Os06g0639000AK102470TGGGCCTGATGGGCTNONE 
J013106M02TGGGCCTGATGGGCTNONE 
J100051K23TGGGCCTGATGGGCTNONE 
Os06g0673500J100018J12ATATGGGCTCAGCCCAGCCCATCANONE 
J100072F13ATATGGGCTCAGCCCAGCCCATCASimilar to Ubiquitin. 
Os06g0681000009-105-G11AGATGGGCTNONE 
009-105-G11AGATGGGCTGTNONE 
009-105-G11AGATGGGCTTGNONE 
AK062780AGATGGGCTConserved hypothetical protein. 
AK062780AGATGGGCTGTConserved hypothetical protein. 
AK062780AGATGGGCTTGConserved hypothetical protein. 
J100021E01AGATGGGCTNONE 
J100021E01AGATGGGCTGTNONE 
J100021E01AGATGGGCTTGNONE 
Os06g0704900AK103054AGCCCATCASimilar to Cell division-like protein. 
J033117I21AGCCCATCANONE 
Os06g0714100AK121079AGCCCATCAComplex 1 LYR protein family protein. 
J023062M13AGCCCATCANONE 
J043020D18AGCCCATCANONE 
J065073A17AGCCCATCANONE 
J065158D09AGCCCATCANONE 
J065195H04AGCCCATCANONE 
J065214P13AGCCCATCANONE 
J080079I22AGCCCATCANONE 
J100031M06AGCCCATCANONE 
J100036I12AGCCCATCANONE 
Os06g0724300012-097-C06TGATGGGCTNONE 
AK059191TGATGGGCTNONE 
AK121941TGATGGGCTProtein of unknown function DUF616 family protein. 
J023084D02TGATGGGCTNONE 
J033107E19TGATGGGCTNONE 
Os07g0106000015-044-D09TGATGGGCTGCNONE 
AK064319TGATGGGCTGCNONE 
Os07g0108800AK109604AGCCCATCTSimilar to Calcium-activated outward-rectifying potassium channel 1 (AtKCO1). 
J100055H18AGCCCATCTNONE 
Os07g0123300AK108490GCAGCCCATCAConserved hypothetical protein. 
J065197L01GCAGCCCATCANONE 
J065206N07GCAGCCCATCANONE 
J080011N05GCAGCCCATCANONE 
J080021N11GCAGCCCATCANONE 
J080025M24GCAGCCCATCANONE 
J080031E13GCAGCCCATCANONE 
J080047B07GCAGCCCATCANONE 
J080061L03GCAGCCCATCANONE 
J080062C18GCAGCCCATCANONE 
J080063E20GCAGCCCATCANONE 
J080063O12GCAGCCCATCANONE 
J080070D20GCAGCCCATCANONE 
J080074J17GCAGCCCATCANONE 
J080076K17GCAGCCCATCANONE 
J080079K21GCAGCCCATCANONE 
J080080D02GCAGCCCATCANONE 
J080088E12GCAGCCCATCANONE 
J080092I18GCAGCCCATCANONE 
Os07g0187300AK103069GCAGCCCATCTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12GCAGCCCATCTNONE 
J033117P16GCAGCCCATCTNONE 
Os07g0520400J065124A13AGATGGGCTGGConserved hypothetical protein. 
Os07g0568900009-083-H02AACTGGGCCCATTTTGGGCTAAGCCCATCGNONE 
AK062660AACTGGGCCCATTTTGGGCTAAGCCCATCGConserved hypothetical protein. 
Os07g0569000AK073915CGATGGGCTTAGCCCAAAATGGGCCCAGTTConserved hypothetical protein. 
Os07g0570300AK100076TCCGGCCCAGCCCATCTPeptidase M16, C-terminal domain containing protein. 
J100033J04TCCGGCCCAGCCCATCTNONE 
J100065L10TCCGGCCCAGCCCATCTNONE 
Os07g0614100AB032062AGATGGGCTNONE 
AK058885AGATGGGCTNONE 
AK069145AGATGGGCTNONE 
AK102448AGATGGGCTAlpha 1-2 subunit of 20S proteasome. 
J023007E07AGATGGGCTNONE 
J033093O06AGATGGGCTNONE 
Os07g0620200AK099859AGCCCATCTHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04AGCCCATCTNONE 
Os07g0641400009-078-A04TTGGCCCATGTCCAGCCCATCGNONE 
AK062634TTGGCCCATGTCCAGCCCATCGHypothetical protein. 
Os07g0649200AK072510AGATGGGCTGTConserved hypothetical protein. 
Os07g0688100AK101635ACAGCCCATCTProtein prenyltransferase domain containing protein. 
J033055B02ACAGCCCATCTNONE 
J090013O08ACAGCCCATCTNONE 
J090074A17ACAGCCCATCTNONE 
Os08g0113800J033069I12AAAGCCCATCANONE 
J053050I07AAAGCCCATCANONE 
J065006J11AAAGCCCATCANONE 
J065013D02AAAGCCCATCANONE 
J065055L24AAAGCCCATCANONE 
J065071I11AAAGCCCATCAConserved hypothetical protein. 
J065093G12AAAGCCCATCANONE 
J065101N03AAAGCCCATCANONE 
Os08g0117400006-086-A09GAAGCCCATCGNONE 
006-103-C02GAAGCCCATCGNONE 
AK059891GAAGCCCATCGSimilar to Calmodulin 1 (Fragment). 
AK103863GAAGCCCATCGNONE 
AY224521GAAGCCCATCGNONE 
J033149E23GAAGCCCATCGNONE 
J065062E05GAAGCCCATCGNONE 
J065083O05GAAGCCCATCGNONE 
J065116D14GAAGCCCATCGNONE 
J065158F16GAAGCCCATCGNONE 
J065179N16GAAGCCCATCGNONE 
J065206N23GAAGCCCATCGNONE 
Os08g0130500006-024-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-032-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-047-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-058-H06CCAAGCCCATCAGGCCCACCAACNONE 
006-062-D07CCAAGCCCATCAGGCCCACCAACNONE 
006-083-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-084-A11CCAAGCCCATCAGGCCCACCAACNONE 
006-096-F12CCAAGCCCATCAGGCCCACCAACNONE 
006-105-A04CCAAGCCCATCAGGCCCACCAACNONE 
006-110-D11CCAAGCCCATCAGGCCCACCAACNONE 
011-022-D11CCAAGCCCATCAGGCCCACCAACNONE 
AK064857CCAAGCCCATCAGGCCCACCAAC60S acidic ribosomal protein P0. 
D21130CCAAGCCCATCAGGCCCACCAACNONE 
J013000H12CCAAGCCCATCAGGCCCACCAACNONE 
J013024M17CCAAGCCCATCAGGCCCACCAACNONE 
J013028H09CCAAGCCCATCAGGCCCACCAACNONE 
J013045N22CCAAGCCCATCAGGCCCACCAACNONE 
J013092K19CCAAGCCCATCAGGCCCACCAACNONE 
J013106L12CCAAGCCCATCAGGCCCACCAACNONE 
J013107A03CCAAGCCCATCAGGCCCACCAACNONE 
J013109E12CCAAGCCCATCAGGCCCACCAACNONE 
J013114N08CCAAGCCCATCAGGCCCACCAACNONE 
J013120J12CCAAGCCCATCAGGCCCACCAACNONE 
J013121E21CCAAGCCCATCAGGCCCACCAACNONE 
J013135P20CCAAGCCCATCAGGCCCACCAACNONE 
J023006J08CCAAGCCCATCAGGCCCACCAACNONE 
J023014L16CCAAGCCCATCAGGCCCACCAACNONE 
J023020N03CCAAGCCCATCAGGCCCACCAACNONE 
J023027M24CCAAGCCCATCAGGCCCACCAACNONE 
J023029D18CCAAGCCCATCAGGCCCACCAACNONE 
J023030A14CCAAGCCCATCAGGCCCACCAACNONE 
J023041G23CCAAGCCCATCAGGCCCACCAACNONE 
J023049H05CCAAGCCCATCAGGCCCACCAACNONE 
J023060I23CCAAGCCCATCAGGCCCACCAACNONE 
J023099D07CCAAGCCCATCAGGCCCACCAACNONE 
J023104A20CCAAGCCCATCAGGCCCACCAACNONE 
J023105F18CCAAGCCCATCAGGCCCACCAACNONE 
J023112D21CCAAGCCCATCAGGCCCACCAACNONE 
J023122M18CCAAGCCCATCAGGCCCACCAACNONE 
J023139J20CCAAGCCCATCAGGCCCACCAACNONE 
J023149L20CCAAGCCCATCAGGCCCACCAACNONE 
J023150G04CCAAGCCCATCAGGCCCACCAACNONE 
J033036G02CCAAGCCCATCAGGCCCACCAACNONE 
J033045P13CCAAGCCCATCAGGCCCACCAACNONE 
J033046A22CCAAGCCCATCAGGCCCACCAACNONE 
J033086H16CCAAGCCCATCAGGCCCACCAACNONE 
J033087D07CCAAGCCCATCAGGCCCACCAACNONE 
J033089M14CCAAGCCCATCAGGCCCACCAACNONE 
J033095F14CCAAGCCCATCAGGCCCACCAACNONE 
J033108M01CCAAGCCCATCAGGCCCACCAACNONE 
J033117A17CCAAGCCCATCAGGCCCACCAACNONE 
J033122F03CCAAGCCCATCAGGCCCACCAACNONE 
J033126A04CCAAGCCCATCAGGCCCACCAACNONE 
J033144D13CCAAGCCCATCAGGCCCACCAACNONE 
J033145D13CCAAGCCCATCAGGCCCACCAACNONE 
J043022M09CCAAGCCCATCAGGCCCACCAACNONE 
J053025I11CCAAGCCCATCAGGCCCACCAACNONE 
J053027K06CCAAGCCCATCAGGCCCACCAACNONE 
J053029D15CCAAGCCCATCAGGCCCACCAACNONE 
J053048I22CCAAGCCCATCAGGCCCACCAACNONE 
J053055I01CCAAGCCCATCAGGCCCACCAACNONE 
J053079P07CCAAGCCCATCAGGCCCACCAACNONE 
J053090J23CCAAGCCCATCAGGCCCACCAACNONE 
J053094C24CCAAGCCCATCAGGCCCACCAACNONE 
J065023F18CCAAGCCCATCAGGCCCACCAACNONE 
J065029I12CCAAGCCCATCAGGCCCACCAACNONE 
J065044B18CCAAGCCCATCAGGCCCACCAACNONE 
J065045C07CCAAGCCCATCAGGCCCACCAACNONE 
J065063K22CCAAGCCCATCAGGCCCACCAACNONE 
J065093D11CCAAGCCCATCAGGCCCACCAACNONE 
J065096P09CCAAGCCCATCAGGCCCACCAACNONE 
J065099N04CCAAGCCCATCAGGCCCACCAACNONE 
J065103K24CCAAGCCCATCAGGCCCACCAACNONE 
J065110H12CCAAGCCCATCAGGCCCACCAACNONE 
J065132F24CCAAGCCCATCAGGCCCACCAACNONE 
J065157K16CCAAGCCCATCAGGCCCACCAACNONE 
J065185D11CCAAGCCCATCAGGCCCACCAACNONE 
J065202E16CCAAGCCCATCAGGCCCACCAACNONE 
J065217D07CCAAGCCCATCAGGCCCACCAACNONE 
J075053I19CCAAGCCCATCAGGCCCACCAACNONE 
J075055L24CCAAGCCCATCAGGCCCACCAACNONE 
J075056H24CCAAGCCCATCAGGCCCACCAACNONE 
J075070D02CCAAGCCCATCAGGCCCACCAACNONE 
J075084O15CCAAGCCCATCAGGCCCACCAACNONE 
J075090F24CCAAGCCCATCAGGCCCACCAACNONE 
J075135E03CCAAGCCCATCAGGCCCACCAACNONE 
J075174A01CCAAGCCCATCAGGCCCACCAACNONE 
J075188F05CCAAGCCCATCAGGCCCACCAACNONE 
J075192C17CCAAGCCCATCAGGCCCACCAACNONE 
J080001B02CCAAGCCCATCAGGCCCACCAACNONE 
J080001C08CCAAGCCCATCAGGCCCACCAACNONE 
J080002D15CCAAGCCCATCAGGCCCACCAACNONE 
J080002I03CCAAGCCCATCAGGCCCACCAACNONE 
J080003E24CCAAGCCCATCAGGCCCACCAACNONE 
J080004M10CCAAGCCCATCAGGCCCACCAACNONE 
J080005C18CCAAGCCCATCAGGCCCACCAACNONE 
J080006A12CCAAGCCCATCAGGCCCACCAACNONE 
J080006F04CCAAGCCCATCAGGCCCACCAACNONE 
J080006M11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J22CCAAGCCCATCAGGCCCACCAACNONE 
J080009F14CCAAGCCCATCAGGCCCACCAACNONE 
J080010B12CCAAGCCCATCAGGCCCACCAACNONE 
J080010G14CCAAGCCCATCAGGCCCACCAACNONE 
J080010N07CCAAGCCCATCAGGCCCACCAACNONE 
J080011D04CCAAGCCCATCAGGCCCACCAACNONE 
J080011G10CCAAGCCCATCAGGCCCACCAACNONE 
J080011O19CCAAGCCCATCAGGCCCACCAACNONE 
J080013K23CCAAGCCCATCAGGCCCACCAACNONE 
J080013M09CCAAGCCCATCAGGCCCACCAACNONE 
J080013N12CCAAGCCCATCAGGCCCACCAACNONE 
J080013O15CCAAGCCCATCAGGCCCACCAACNONE 
J080014C13CCAAGCCCATCAGGCCCACCAACNONE 
J080014D21CCAAGCCCATCAGGCCCACCAACNONE 
J080014F08CCAAGCCCATCAGGCCCACCAACNONE 
J080014N08CCAAGCCCATCAGGCCCACCAACNONE 
J080014P19CCAAGCCCATCAGGCCCACCAACNONE 
J080015L09CCAAGCCCATCAGGCCCACCAACNONE 
J080015P15CCAAGCCCATCAGGCCCACCAACNONE 
J080018P10CCAAGCCCATCAGGCCCACCAACNONE 
J080020C06CCAAGCCCATCAGGCCCACCAACNONE 
J080022C14CCAAGCCCATCAGGCCCACCAACNONE 
J080022E01CCAAGCCCATCAGGCCCACCAACNONE 
J080022P04CCAAGCCCATCAGGCCCACCAACNONE 
J080022P10CCAAGCCCATCAGGCCCACCAACNONE 
J080023B20CCAAGCCCATCAGGCCCACCAACNONE 
J080023G19CCAAGCCCATCAGGCCCACCAACNONE 
J080024N15CCAAGCCCATCAGGCCCACCAACNONE 
J080025E11CCAAGCCCATCAGGCCCACCAACNONE 
J080025G24CCAAGCCCATCAGGCCCACCAACNONE 
J080026B01CCAAGCCCATCAGGCCCACCAACNONE 
J080026B05CCAAGCCCATCAGGCCCACCAACNONE 
J080027L17CCAAGCCCATCAGGCCCACCAACNONE 
J080028K02CCAAGCCCATCAGGCCCACCAACNONE 
J080029L23CCAAGCCCATCAGGCCCACCAACNONE 
J080030D08CCAAGCCCATCAGGCCCACCAACNONE 
J080031C03CCAAGCCCATCAGGCCCACCAACNONE 
J080031K02CCAAGCCCATCAGGCCCACCAACNONE 
J080032C16CCAAGCCCATCAGGCCCACCAACNONE 
J080033F10CCAAGCCCATCAGGCCCACCAACNONE 
J080033G12CCAAGCCCATCAGGCCCACCAACNONE 
J080033K03CCAAGCCCATCAGGCCCACCAACNONE 
J080034B03CCAAGCCCATCAGGCCCACCAACNONE 
J080034N21CCAAGCCCATCAGGCCCACCAACNONE 
J080034O03CCAAGCCCATCAGGCCCACCAACNONE 
J080035G10CCAAGCCCATCAGGCCCACCAACNONE 
J080038E14CCAAGCCCATCAGGCCCACCAACNONE 
J080039A19CCAAGCCCATCAGGCCCACCAACNONE 
J080039G10CCAAGCCCATCAGGCCCACCAACNONE 
J080039J01CCAAGCCCATCAGGCCCACCAACNONE 
J080039J09CCAAGCCCATCAGGCCCACCAACNONE 
J080040F07CCAAGCCCATCAGGCCCACCAACNONE 
J080040H18CCAAGCCCATCAGGCCCACCAACNONE 
J080041E08CCAAGCCCATCAGGCCCACCAACNONE 
J080041E16CCAAGCCCATCAGGCCCACCAACNONE 
J080041L08CCAAGCCCATCAGGCCCACCAACNONE 
J080042A07CCAAGCCCATCAGGCCCACCAACNONE 
J080044E02CCAAGCCCATCAGGCCCACCAACNONE 
J080045K03CCAAGCCCATCAGGCCCACCAACNONE 
J080046O03CCAAGCCCATCAGGCCCACCAACNONE 
J080047F08CCAAGCCCATCAGGCCCACCAACNONE 
J080048H01CCAAGCCCATCAGGCCCACCAACNONE 
J080048I05CCAAGCCCATCAGGCCCACCAACNONE 
J080048N06CCAAGCCCATCAGGCCCACCAACNONE 
J080050A07CCAAGCCCATCAGGCCCACCAACNONE 
J080050B04CCAAGCCCATCAGGCCCACCAACNONE 
J080050E21CCAAGCCCATCAGGCCCACCAACNONE 
J080051J01CCAAGCCCATCAGGCCCACCAACNONE 
J080051K02CCAAGCCCATCAGGCCCACCAACNONE 
J080051L02CCAAGCCCATCAGGCCCACCAACNONE 
J080052C20CCAAGCCCATCAGGCCCACCAACNONE 
J080052I22CCAAGCCCATCAGGCCCACCAACNONE 
J080052J21CCAAGCCCATCAGGCCCACCAACNONE 
J080052K22CCAAGCCCATCAGGCCCACCAACNONE 
J080055A05CCAAGCCCATCAGGCCCACCAACNONE 
J080055I12CCAAGCCCATCAGGCCCACCAACNONE 
J080056A21CCAAGCCCATCAGGCCCACCAACNONE 
J080056N11CCAAGCCCATCAGGCCCACCAACNONE 
J080057D02CCAAGCCCATCAGGCCCACCAACNONE 
J080058H21CCAAGCCCATCAGGCCCACCAACNONE 
J080058P16CCAAGCCCATCAGGCCCACCAACNONE 
J080059M03CCAAGCCCATCAGGCCCACCAACNONE 
J080059N17CCAAGCCCATCAGGCCCACCAACNONE 
J080060F13CCAAGCCCATCAGGCCCACCAACNONE 
J080060H06CCAAGCCCATCAGGCCCACCAACNONE 
J080060J03CCAAGCCCATCAGGCCCACCAACNONE 
J080060O09CCAAGCCCATCAGGCCCACCAACNONE 
J080060P22CCAAGCCCATCAGGCCCACCAACNONE 
J080061F06CCAAGCCCATCAGGCCCACCAACNONE 
J080061H21CCAAGCCCATCAGGCCCACCAACNONE 
J080061O13CCAAGCCCATCAGGCCCACCAACNONE 
J080062J07CCAAGCCCATCAGGCCCACCAACNONE 
J080063A08CCAAGCCCATCAGGCCCACCAACNONE 
J080063F19CCAAGCCCATCAGGCCCACCAACNONE 
J080063O18CCAAGCCCATCAGGCCCACCAACNONE 
J080065D15CCAAGCCCATCAGGCCCACCAACNONE 
J080066E13CCAAGCCCATCAGGCCCACCAACNONE 
J080068L01CCAAGCCCATCAGGCCCACCAACNONE 
J080068P07CCAAGCCCATCAGGCCCACCAACNONE 
J080069I21CCAAGCCCATCAGGCCCACCAACNONE 
J080070M04CCAAGCCCATCAGGCCCACCAACNONE 
J080071E01CCAAGCCCATCAGGCCCACCAACNONE 
J080071J08CCAAGCCCATCAGGCCCACCAACNONE 
J080071M23CCAAGCCCATCAGGCCCACCAACNONE 
J080072A03CCAAGCCCATCAGGCCCACCAACNONE 
J080072G18CCAAGCCCATCAGGCCCACCAACNONE 
J080075A04CCAAGCCCATCAGGCCCACCAACNONE 
J080075E19CCAAGCCCATCAGGCCCACCAACNONE 
J080075P18CCAAGCCCATCAGGCCCACCAACNONE 
J080076N11CCAAGCCCATCAGGCCCACCAACNONE 
J080077A11CCAAGCCCATCAGGCCCACCAACNONE 
J080077D22CCAAGCCCATCAGGCCCACCAACNONE 
J080077H18CCAAGCCCATCAGGCCCACCAACNONE 
J080077L03CCAAGCCCATCAGGCCCACCAACNONE 
J080078D02CCAAGCCCATCAGGCCCACCAACNONE 
J080078L05CCAAGCCCATCAGGCCCACCAACNONE 
J080078N20CCAAGCCCATCAGGCCCACCAACNONE 
J080079I20CCAAGCCCATCAGGCCCACCAACNONE 
J080081D04CCAAGCCCATCAGGCCCACCAACNONE 
J080082A07CCAAGCCCATCAGGCCCACCAACNONE 
J080082E24CCAAGCCCATCAGGCCCACCAACNONE 
J080084A22CCAAGCCCATCAGGCCCACCAACNONE 
J080084E15CCAAGCCCATCAGGCCCACCAACNONE 
J080084G06CCAAGCCCATCAGGCCCACCAACNONE 
J080086A05CCAAGCCCATCAGGCCCACCAACNONE 
J080086F09CCAAGCCCATCAGGCCCACCAACNONE 
J080087B11CCAAGCCCATCAGGCCCACCAACNONE 
J080087H12CCAAGCCCATCAGGCCCACCAACNONE 
J080088I05CCAAGCCCATCAGGCCCACCAACNONE 
J080088N08CCAAGCCCATCAGGCCCACCAACNONE 
J080088P07CCAAGCCCATCAGGCCCACCAACNONE 
J080089A09CCAAGCCCATCAGGCCCACCAACNONE 
J080089D21CCAAGCCCATCAGGCCCACCAACNONE 
J080089F24CCAAGCCCATCAGGCCCACCAACNONE 
J080089H22CCAAGCCCATCAGGCCCACCAACNONE 
J080089I04CCAAGCCCATCAGGCCCACCAACNONE 
J080090D01CCAAGCCCATCAGGCCCACCAACNONE 
J080091F09CCAAGCCCATCAGGCCCACCAACNONE 
J080091G18CCAAGCCCATCAGGCCCACCAACNONE 
J080091L24CCAAGCCCATCAGGCCCACCAACNONE 
J080091M12CCAAGCCCATCAGGCCCACCAACNONE 
J080091N12CCAAGCCCATCAGGCCCACCAACNONE 
J080093A15CCAAGCCCATCAGGCCCACCAACNONE 
J080093C08CCAAGCCCATCAGGCCCACCAACNONE 
J080093I08CCAAGCCCATCAGGCCCACCAACNONE 
J080093P21CCAAGCCCATCAGGCCCACCAACNONE 
J080094E18CCAAGCCCATCAGGCCCACCAACNONE 
J080094F15CCAAGCCCATCAGGCCCACCAACNONE 
J080094J21CCAAGCCCATCAGGCCCACCAACNONE 
J080095A09CCAAGCCCATCAGGCCCACCAACNONE 
J080096G05CCAAGCCCATCAGGCCCACCAACNONE 
J080096K07CCAAGCCCATCAGGCCCACCAACNONE 
J080097M17CCAAGCCCATCAGGCCCACCAACNONE 
J080097P21CCAAGCCCATCAGGCCCACCAACNONE 
J080302B15CCAAGCCCATCAGGCCCACCAACNONE 
J080306J15CCAAGCCCATCAGGCCCACCAACNONE 
J080306O13CCAAGCCCATCAGGCCCACCAACNONE 
J080307C15CCAAGCCCATCAGGCCCACCAACNONE 
J080307I04CCAAGCCCATCAGGCCCACCAACNONE 
J080307L05CCAAGCCCATCAGGCCCACCAACNONE 
J080308F11CCAAGCCCATCAGGCCCACCAACNONE 
J080311C04CCAAGCCCATCAGGCCCACCAACNONE 
J080311I07CCAAGCCCATCAGGCCCACCAACNONE 
J080312C01CCAAGCCCATCAGGCCCACCAACNONE 
J080312O08CCAAGCCCATCAGGCCCACCAACNONE 
J080315F14CCAAGCCCATCAGGCCCACCAACNONE 
J080318K13CCAAGCCCATCAGGCCCACCAACNONE 
J080319A17CCAAGCCCATCAGGCCCACCAACNONE 
J090001I01CCAAGCCCATCAGGCCCACCAACNONE 
J090002O18CCAAGCCCATCAGGCCCACCAACNONE 
J090007A08CCAAGCCCATCAGGCCCACCAACNONE 
J090007F22CCAAGCCCATCAGGCCCACCAACNONE 
J090008D09CCAAGCCCATCAGGCCCACCAACNONE 
J090008L07CCAAGCCCATCAGGCCCACCAACNONE 
J090008O08CCAAGCCCATCAGGCCCACCAACNONE 
J090012N11CCAAGCCCATCAGGCCCACCAACNONE 
J090013M05CCAAGCCCATCAGGCCCACCAACNONE 
J090020E08CCAAGCCCATCAGGCCCACCAACNONE 
J090020O20CCAAGCCCATCAGGCCCACCAACNONE 
J090021I10CCAAGCCCATCAGGCCCACCAACNONE 
J090023D07CCAAGCCCATCAGGCCCACCAACNONE 
J090023K22CCAAGCCCATCAGGCCCACCAACNONE 
J090023O08CCAAGCCCATCAGGCCCACCAACNONE 
J090028D21CCAAGCCCATCAGGCCCACCAACNONE 
J090029H14CCAAGCCCATCAGGCCCACCAACNONE 
J090029L12CCAAGCCCATCAGGCCCACCAACNONE 
J090030C05CCAAGCCCATCAGGCCCACCAACNONE 
J090031D18CCAAGCCCATCAGGCCCACCAACNONE 
J090032G10CCAAGCCCATCAGGCCCACCAACNONE 
J090034J22CCAAGCCCATCAGGCCCACCAACNONE 
J090034K16CCAAGCCCATCAGGCCCACCAACNONE 
J090036D10CCAAGCCCATCAGGCCCACCAACNONE 
J090037N17CCAAGCCCATCAGGCCCACCAACNONE 
J090043P17CCAAGCCCATCAGGCCCACCAACNONE 
J090044L20CCAAGCCCATCAGGCCCACCAACNONE 
J090045N16CCAAGCCCATCAGGCCCACCAACNONE 
J090048K03CCAAGCCCATCAGGCCCACCAACNONE 
J090048K10CCAAGCCCATCAGGCCCACCAACNONE 
J090049O07CCAAGCCCATCAGGCCCACCAACNONE 
J090055H23CCAAGCCCATCAGGCCCACCAACNONE 
J090056G12CCAAGCCCATCAGGCCCACCAACNONE 
J090056G16CCAAGCCCATCAGGCCCACCAACNONE 
J090059B16CCAAGCCCATCAGGCCCACCAACNONE 
J090066H21CCAAGCCCATCAGGCCCACCAACNONE 
J090067D22CCAAGCCCATCAGGCCCACCAACNONE 
J090072M07CCAAGCCCATCAGGCCCACCAACNONE 
J090073J21CCAAGCCCATCAGGCCCACCAACNONE 
J090075A15CCAAGCCCATCAGGCCCACCAACNONE 
J090079J09CCAAGCCCATCAGGCCCACCAACNONE 
J090080L07CCAAGCCCATCAGGCCCACCAACNONE 
J090084A03CCAAGCCCATCAGGCCCACCAACNONE 
J090085B07CCAAGCCCATCAGGCCCACCAACNONE 
J090088H11CCAAGCCCATCAGGCCCACCAACNONE 
J090090J12CCAAGCCCATCAGGCCCACCAACNONE 
J090091I21CCAAGCCCATCAGGCCCACCAACNONE 
J090091L02CCAAGCCCATCAGGCCCACCAACNONE 
J090093G18CCAAGCCCATCAGGCCCACCAACNONE 
J090094D23CCAAGCCCATCAGGCCCACCAACNONE 
J090098L19CCAAGCCCATCAGGCCCACCAACNONE 
J100017I22CCAAGCCCATCAGGCCCACCAACNONE 
J100018F08CCAAGCCCATCAGGCCCACCAACNONE 
J100018G19CCAAGCCCATCAGGCCCACCAACNONE 
J100019B05CCAAGCCCATCAGGCCCACCAACNONE 
J100019J18CCAAGCCCATCAGGCCCACCAACNONE 
J100019L04CCAAGCCCATCAGGCCCACCAACNONE 
J100023M06CCAAGCCCATCAGGCCCACCAACNONE 
J100024J23CCAAGCCCATCAGGCCCACCAACNONE 
J100024P09CCAAGCCCATCAGGCCCACCAACNONE 
J100027I05CCAAGCCCATCAGGCCCACCAACNONE 
J100029G03CCAAGCCCATCAGGCCCACCAACNONE 
J100029K08CCAAGCCCATCAGGCCCACCAACNONE 
J100031J17CCAAGCCCATCAGGCCCACCAACNONE 
J100037L16CCAAGCCCATCAGGCCCACCAACNONE 
J100038C05CCAAGCCCATCAGGCCCACCAACNONE 
J100039D19CCAAGCCCATCAGGCCCACCAACNONE 
J100041L02CCAAGCCCATCAGGCCCACCAACNONE 
J100045B08CCAAGCCCATCAGGCCCACCAACNONE 
J100045B15CCAAGCCCATCAGGCCCACCAACNONE 
J100047G07CCAAGCCCATCAGGCCCACCAACNONE 
J100047P19CCAAGCCCATCAGGCCCACCAACNONE 
J100048I15CCAAGCCCATCAGGCCCACCAACNONE 
J100049M16CCAAGCCCATCAGGCCCACCAACNONE 
J100049P18CCAAGCCCATCAGGCCCACCAACNONE 
J100050E21CCAAGCCCATCAGGCCCACCAACNONE 
J100051N02CCAAGCCCATCAGGCCCACCAACNONE 
J100052M02CCAAGCCCATCAGGCCCACCAACNONE 
J100055M24CCAAGCCCATCAGGCCCACCAACNONE 
J100056K11CCAAGCCCATCAGGCCCACCAACNONE 
J100059F20CCAAGCCCATCAGGCCCACCAACNONE 
J100059J15CCAAGCCCATCAGGCCCACCAACNONE 
J100068C19CCAAGCCCATCAGGCCCACCAACNONE 
J100068G06CCAAGCCCATCAGGCCCACCAACNONE 
J100069N02CCAAGCCCATCAGGCCCACCAACNONE 
J100073N04CCAAGCCCATCAGGCCCACCAACNONE 
J100074B05CCAAGCCCATCAGGCCCACCAACNONE 
J100080P13CCAAGCCCATCAGGCCCACCAACNONE 
J100083P09CCAAGCCCATCAGGCCCACCAACNONE 
J100084B11CCAAGCCCATCAGGCCCACCAACNONE 
J100085B07CCAAGCCCATCAGGCCCACCAACNONE 
J100086O20CCAAGCCCATCAGGCCCACCAACNONE 
J100087B02CCAAGCCCATCAGGCCCACCAACNONE 
J100089B14CCAAGCCCATCAGGCCCACCAACNONE 
Os08g0134900012-044-H02AGCCCAGCCCATCANONE 
015-040-D07AGCCCAGCCCATCANONE 
AK066009AGCCCAGCCCATCAConserved hypothetical protein. 
J013047E17AGCCCAGCCCATCANONE 
J065064A15AGCCCAGCCCATCANONE 
J065116E14AGCCCAGCCCATCANONE 
J090067O03AGCCCAGCCCATCANONE 
Os08g0137250J075030L12AAAAGCCCATTTAGCCCATCCANONE 
J075037O21AAAAGCCCATTTAGCCCATCCANONE 
J075078E23AAAAGCCCATTTAGCCCATCCANONE 
J075079C23AAAAGCCCATTTAGCCCATCCANONE 
J075092K02AAAAGCCCATTTAGCCCATCCANONE 
J075108M04AAAAGCCCATTTAGCCCATCCANONE 
J075112N13AAAAGCCCATTTAGCCCATCCANONE 
J075132M13AAAAGCCCATTTAGCCCATCCANONE 
J075146E07AAAAGCCCATTTAGCCCATCCANONE 
J075159F16AAAAGCCCATTTAGCCCATCCANONE 
J075166M12AAAAGCCCATTTAGCCCATCCANONE 
J075185B10AAAAGCCCATTTAGCCCATCCANONE 
J075193J10AAAAGCCCATTTAGCCCATCCANONE 
Os08g0139100006-027-E12TAAGCCCATCTNONE 
006-089-E06TAAGCCCATCTNONE 
006-113-G02TAAGCCCATCTNONE 
AK061429TAAGCCCATCTNONE 
AK099590TAAGCCCATCTSimilar to DAG protein, chloroplast precursor. 
AK104727TAAGCCCATCTNONE 
J013043H11TAAGCCCATCTNONE 
J013049N13TAAGCCCATCTNONE 
J065079F01TAAGCCCATCTNONE 
J065122N24TAAGCCCATCTNONE 
J065142J24TAAGCCCATCTNONE 
J065193N03TAAGCCCATCTNONE 
J075041I21TAAGCCCATCTNONE 
J075145E04TAAGCCCATCTNONE 
Os08g0151400AK059440CCCAGCCCATCGSimilar to Small nuclear ribonucleoprotein homolog. 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0156900AJ605583ACAGCCCATCANONE 
AK073344ACAGCCCATCASpo11/DNA topoisomerase VI, subunit A family protein. 
AK106397ACAGCCCATCANONE 
Os08g0187700AK099689GATCGGACGGCCGAGAGCCCATCARegulation of nuclear pre-mRNA protein domain containing protein. 
Os08g0206600AK064336AAAGCCCATCAAICARFT/IMPCHase bienzyme family protein. 
AK102764AAAGCCCATCANONE 
Os08g0278100014-004-D02TAAGCCCATCANONE 
AK063626TAAGCCCATCAConserved hypothetical protein. 
Os08g0327400AK070992CGATGGGCTTCSimilar to Enoyl-ACP reductase (Fragment). 
J023077K10CGATGGGCTTCNONE 
J065075F06CGATGGGCTTCNONE 
J065112N14CGATGGGCTTCNONE 
J090028K07CGATGGGCTTCNONE 
J090039C15CGATGGGCTTCNONE 
J090048I11CGATGGGCTTCNONE 
J090083M10CGATGGGCTTCNONE 
Os08g0359500003-107-F09CCAAGCCCAGCCCATCCCCCNONE 
006-091-E08CCAAGCCCAGCCCATCCCCCNONE 
006-096-E12CCAAGCCCAGCCCATCCCCCNONE 
006-111-F11CCAAGCCCAGCCCATCCCCCNONE 
009-090-H10CCAAGCCCAGCCCATCCCCCNONE 
014-013-B02CCAAGCCCAGCCCATCCCCCNONE 
014-083-E03CCAAGCCCAGCCCATCCCCCNONE 
014-100-F05CCAAGCCCAGCCCATCCCCCNONE 
AK104798CCAAGCCCAGCCCATCCCCCNONE 
AK112034CCAAGCCCAGCCCATCCCCCHSP20-like chaperone domain containing protein. 
J013060J18CCAAGCCCAGCCCATCCCCCNONE 
J033042C22CCAAGCCCAGCCCATCCCCCNONE 
J065168I06CCAAGCCCAGCCCATCCCCCNONE 
J075077E12CCAAGCCCAGCCCATCCCCCNONE 
J075094M21CCAAGCCCAGCCCATCCCCCNONE 
J090068D17CCAAGCCCAGCCCATCCCCCNONE 
J100027E21CCAAGCCCAGCCCATCCCCCNONE 
J100058D21CCAAGCCCAGCCCATCCCCCNONE 
J100067B02CCAAGCCCAGCCCATCCCCCNONE 
Os08g0379000AK105647ACAGCCCATCCProtein prenyltransferase domain containing protein. 
Os08g0398700AK105074AGCCCATCTNONE 
Os08g0459300AK060409AGCCCATCGConserved hypothetical protein. 
AK101386AGCCCATCGNONE 
J033034E20AGCCCATCGNONE 
J033036F14AGCCCATCGNONE 
J065047G22AGCCCATCGNONE 
J065173C14AGCCCATCGNONE 
J065188O22AGCCCATCGNONE 
J065189C17AGCCCATCGNONE 
J065197I16AGCCCATCGNONE 
J065202E05AGCCCATCGNONE 
J075022D03AGCCCATCGNONE 
J075023K21AGCCCATCGNONE 
J075096D12AGCCCATCGNONE 
J075129K24AGCCCATCGNONE 
Os08g0526500016-063-D04TGATGGGCTTTNONE 
AK073431TGATGGGCTTTSimilar to SOX-1 protein. 
J033042D10TGATGGGCTTTNONE 
J065019E02TGATGGGCTTTNONE 
Os08g0527100AK119411AGCCCATCAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J090013J12AGCCCATCANONE 
J090029K18AGCCCATCANONE 
Os08g0535600AK121683AGATGGGCTZinc finger, Tim10/DDP-type family protein. 
J065077E05AGATGGGCTNONE 
J075088M24AGATGGGCTNONE 
J075140B03AGATGGGCTNONE 
J090014B14AGATGGGCTNONE 
Os08g0545700Os08g0545700AGCCCATCTTraB determinant family protein. 
Os08g0558400AK071334AGCCCATCGSimilar to Kinesin heavy chain (Fragment). 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os08g0565900AK106778TGATGGGCTLipolytic enzyme, G-D-S-L family protein. 
Os09g0133600006-034-E08CCCAGCCCATCANONE 
AK061477CCCAGCCCATCAPAP fibrillin family protein. 
AK099394CCCAGCCCATCANONE 
AK104742CCCAGCCCATCANONE 
AY224474CCCAGCCCATCANONE 
Os09g0416200AK065807CCAGCCCATCCSimilar to Glucose transporter (Fragment). 
Os09g0445600AK107839CGATGGGCTConserved hypothetical protein. 
Os09g0459200AK110733AGCCCATCCAConserved hypothetical protein. 
J065131C07AGCCCATCCANONE 
Os09g0509200AK069525AAAGCCCATCASimilar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1). 
Os09g0512900006-066-A10AGATGGGCTNONE 
AK061814AGATGGGCTConserved hypothetical protein. 
AK066925AGATGGGCTNONE 
AK104595AGATGGGCTNONE 
J013092F14AGATGGGCTNONE 
J023148N20AGATGGGCTNONE 
J033131F06AGATGGGCTNONE 
J053025L20AGATGGGCTNONE 
J075003B20AGATGGGCTNONE 
J075019N18AGATGGGCTNONE 
J075032D10AGATGGGCTNONE 
J075037G14AGATGGGCTNONE 
J075098D24AGATGGGCTNONE 
J075106M13AGATGGGCTNONE 
J075122N14AGATGGGCTNONE 
J075146E22AGATGGGCTNONE 
J075187E06AGATGGGCTNONE 
J075198I17AGATGGGCTNONE 
J090023O05AGATGGGCTNONE 
J100040E10AGATGGGCTNONE 
J100080P12AGATGGGCTNONE 
J100088B06AGATGGGCTNONE 
Os09g0521700014-005-C08AGCCCATCCNONE 
AK063628AGCCCATCCSimilar to H/ACA ribonucleoprotein complex subunit 1 (Nucleolar protein family A member 1) (snoRNP protein GAR1). 
AK064507AGCCCATCCNONE 
Os09g0533900003-104-E05AAAGCCCACGCGAGCCCATCCNONE 
012-076-C03AAAGCCCACGCGAGCCCATCCNONE 
AK067774AAAGCCCACGCGAGCCCATCCNONE 
AK100449AAAGCCCACGCGAGCCCATCCSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07AAAGCCCACGCGAGCCCATCCNONE 
J023026E11AAAGCCCACGCGAGCCCATCCNONE 
J023028B20AAAGCCCACGCGAGCCCATCCNONE 
J023050P11AAAGCCCACGCGAGCCCATCCNONE 
J023052K08AAAGCCCACGCGAGCCCATCCNONE 
J023075J03AAAGCCCACGCGAGCCCATCCNONE 
J023078E15AAAGCCCACGCGAGCCCATCCNONE 
J023090P12AAAGCCCACGCGAGCCCATCCNONE 
J023120E01AAAGCCCACGCGAGCCCATCCNONE 
J023142K01AAAGCCCACGCGAGCCCATCCNONE 
J033027K23AAAGCCCACGCGAGCCCATCCNONE 
J033058A09AAAGCCCACGCGAGCCCATCCNONE 
J033058C12AAAGCCCACGCGAGCCCATCCNONE 
J033125A04AAAGCCCACGCGAGCCCATCCNONE 
J043040L01AAAGCCCACGCGAGCCCATCCNONE 
J053061D06AAAGCCCACGCGAGCCCATCCNONE 
J053096N13AAAGCCCACGCGAGCCCATCCNONE 
J065193H10AAAGCCCACGCGAGCCCATCCNONE 
J090075L17AAAGCCCACGCGAGCCCATCCNONE 
J100050D10AAAGCCCACGCGAGCCCATCCNONE 
Os09g0559800AK071542AGATGGGCTGASimilar to Transporter-like protein. 
J013063N24AGATGGGCTGANONE 
Os11g0116400AK059833GCTGGGCCGATGGGCTTCSimilar to Elongation factor P (EF-P). 
Os11g0131200J065024D18AAAGCCCATCAMpv17/PMP22 family protein. 
J065206C17AAAGCCCATCANONE 
Os11g0139500AK121845GGATGGGCTNONE 
Os11g0145400009-117-C07ACAGCCCATCASimilar to Ubiquitin-like protein 5. 
009-117-C07GAGGCCCATAGCCCATCGSimilar to Ubiquitin-like protein 5. 
009-189-E08ACAGCCCATCANONE 
009-189-E08GAGGCCCATAGCCCATCGNONE 
J023127F18ACAGCCCATCANONE 
J023127F18GAGGCCCATAGCCCATCGNONE 
J065071G10ACAGCCCATCANONE 
J065071G10GAGGCCCATAGCCCATCGNONE 
J065118J21ACAGCCCATCANONE 
J065118J21GAGGCCCATAGCCCATCGNONE 
J065184P05ACAGCCCATCANONE 
J065184P05GAGGCCCATAGCCCATCGNONE 
J080301B06ACAGCCCATCANONE 
J080301B06GAGGCCCATAGCCCATCGNONE 
J080303C06ACAGCCCATCANONE 
J080303C06GAGGCCCATAGCCCATCGNONE 
J080304F18ACAGCCCATCANONE 
J080304F18GAGGCCCATAGCCCATCGNONE 
J080308D02ACAGCCCATCANONE 
J080308D02GAGGCCCATAGCCCATCGNONE 
J080309H09ACAGCCCATCANONE 
J080309H09GAGGCCCATAGCCCATCGNONE 
J080311O09ACAGCCCATCANONE 
J080311O09GAGGCCCATAGCCCATCGNONE 
J080311O15ACAGCCCATCANONE 
J080311O15GAGGCCCATAGCCCATCGNONE 
J080312N11ACAGCCCATCANONE 
J080312N11GAGGCCCATAGCCCATCGNONE 
J080313G04ACAGCCCATCANONE 
J080313G04GAGGCCCATAGCCCATCGNONE 
J080313I06ACAGCCCATCANONE 
J080313I06GAGGCCCATAGCCCATCGNONE 
J100077F22ACAGCCCATCANONE 
J100077F22GAGGCCCATAGCCCATCGNONE 
Os11g0162200009-059-H04AGCCCAATTCAGCCCATCTNONE 
AK060396AGCCCAATTCAGCCCATCTSimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11AGCCCAATTCAGCCCATCTNONE 
J065105K09AGCCCAATTCAGCCCATCTNONE 
J075024G12AGCCCAATTCAGCCCATCTNONE 
J075040K04AGCCCAATTCAGCCCATCTNONE 
J075066D13AGCCCAATTCAGCCCATCTNONE 
J075108A11AGCCCAATTCAGCCCATCTNONE 
J100031D04AGCCCAATTCAGCCCATCTNONE 
J100060O05AGCCCAATTCAGCCCATCTNONE 
J100075M22AGCCCAATTCAGCCCATCTNONE 
Os11g0168200005-010-H01TTGTGGGCCAGAGCCCATCCNONE 
009-156-F07TTGTGGGCCAGAGCCCATCCNONE 
012-025-F01TTGTGGGCCAGAGCCCATCCNONE 
012-089-A02TTGTGGGCCAGAGCCCATCCNONE 
016-016-E08TTGTGGGCCAGAGCCCATCCNONE 
AK073392TTGTGGGCCAGAGCCCATCC60S ribosomal protein L3. 
AK099225TTGTGGGCCAGAGCCCATCCNONE 
AK101469TTGTGGGCCAGAGCCCATCCNONE 
AY236158TTGTGGGCCAGAGCCCATCCNONE 
J013152M22TTGTGGGCCAGAGCCCATCCNONE 
J023013N11TTGTGGGCCAGAGCCCATCCNONE 
J023038J11TTGTGGGCCAGAGCCCATCCNONE 
J023054N21TTGTGGGCCAGAGCCCATCCNONE 
J033041E13TTGTGGGCCAGAGCCCATCCNONE 
J033050O09TTGTGGGCCAGAGCCCATCCNONE 
J033093G05TTGTGGGCCAGAGCCCATCCNONE 
J033094J17TTGTGGGCCAGAGCCCATCCNONE 
J033112J24TTGTGGGCCAGAGCCCATCCNONE 
J033113D05TTGTGGGCCAGAGCCCATCCNONE 
J033120K10TTGTGGGCCAGAGCCCATCCNONE 
J033121H19TTGTGGGCCAGAGCCCATCCNONE 
J033129C08TTGTGGGCCAGAGCCCATCCNONE 
J033140H24TTGTGGGCCAGAGCCCATCCNONE 
J065020I18TTGTGGGCCAGAGCCCATCCNONE 
J065058L01TTGTGGGCCAGAGCCCATCCNONE 
J065059G22TTGTGGGCCAGAGCCCATCCNONE 
J065212L09TTGTGGGCCAGAGCCCATCCNONE 
J075047P09TTGTGGGCCAGAGCCCATCCNONE 
J075063C18TTGTGGGCCAGAGCCCATCCNONE 
J075076E07TTGTGGGCCAGAGCCCATCCNONE 
J075077F14TTGTGGGCCAGAGCCCATCCNONE 
J075086C22TTGTGGGCCAGAGCCCATCCNONE 
J075161L09TTGTGGGCCAGAGCCCATCCNONE 
J075177K20TTGTGGGCCAGAGCCCATCCNONE 
J090007L06TTGTGGGCCAGAGCCCATCCNONE 
J090010M02TTGTGGGCCAGAGCCCATCCNONE 
J090013M20TTGTGGGCCAGAGCCCATCCNONE 
J090044I15TTGTGGGCCAGAGCCCATCCNONE 
J090045O06TTGTGGGCCAGAGCCCATCCNONE 
J090060L04TTGTGGGCCAGAGCCCATCCNONE 
J090061C17TTGTGGGCCAGAGCCCATCCNONE 
J090062F10TTGTGGGCCAGAGCCCATCCNONE 
J090066L03TTGTGGGCCAGAGCCCATCCNONE 
J090089E13TTGTGGGCCAGAGCCCATCCNONE 
J090096D21TTGTGGGCCAGAGCCCATCCNONE 
J100039F12TTGTGGGCCAGAGCCCATCCNONE 
J100053N06TTGTGGGCCAGAGCCCATCCNONE 
Os11g0199600AK101774TCAGCCCATCAZinc finger, CCHC-type domain containing protein. 
AK120040TCAGCCCATCANONE 
J023047I06TCAGCCCATCANONE 
J033064L23TCAGCCCATCANONE 
J033117I01TCAGCCCATCANONE 
J033123I18TCAGCCCATCANONE 
J053026H17TCAGCCCATCANONE 
J053078G05TCAGCCCATCANONE 
J065102A09TCAGCCCATCANONE 
J065113G11TCAGCCCATCANONE 
J065207F20TCAGCCCATCANONE 
J075027K21TCAGCCCATCANONE 
Os11g0210500AK070886GAAGCCCATCTNONE 
J023069O03GAAGCCCATCTNONE 
J100038M22GAAGCCCATCTNONE 
J100066M06GAAGCCCATCTNONE 
Os11g0219400AK069850AGCCCATCAAnkyrin repeat containing protein. 
AK099123AGCCCATCANONE 
J023143G18AGCCCATCANONE 
Os11g0299300AK119915AGCCCATCTLipase, class 3 family protein. 
Os11g0497000AK111924GGGCCTGGCCCATCAGCCCATATAGCCCATCASimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065097A08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065123J10GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J075096F04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J080065C15GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090033J04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090072N23GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100021E08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100063H21GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
Os11g0531700006-023-B12GAAGCCCATCTNONE 
AK059751GAAGCCCATCTNUDIX hydrolase domain containing protein. 
AK099204GAAGCCCATCTNONE 
Os11g0545800AK073687CCACGGCCCACCAAGCCCATCCARegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCACGGCCCACCAAGCCCATCCANONE 
Os11g0549655J065008P04AGATGGGCTAATTGGGCCGGTGGCCCGGCNONE 
J065148G18AGATGGGCTAATTGGGCCGGTGGCCCGGCMaf-like protein family protein. 
Os12g0120400AK099904AGCCCATCASimilar to ATPase-like protein. 
AK099904TGATGGGCTTGSimilar to ATPase-like protein. 
J065169A07AGCCCATCANONE 
J065169A07TGATGGGCTTGNONE 
Os12g0133600AK103096AGATGGGCTTGConserved hypothetical protein. 
J033118M03AGATGGGCTTGNONE 
Os12g0146300J065162K17TAAGCCCATCAHypothetical protein. 
Os12g0154000AK101335GGATGGGCTGGNONE 
AK105118GGATGGGCTGGProtein of unknown function DUF250 domain containing protein. 
Os12g0170400012-013-C12AGCCCATCCNONE 
012-078-F04AGCCCATCCNONE 
016-038-B08AGCCCATCCNONE 
AK121826AGCCCATCCZinc finger, C2H2-type domain containing protein. 
J033086P08AGCCCATCCNONE 
J033099G14AGCCCATCCNONE 
J065019L01AGCCCATCCNONE 
J065093E18AGCCCATCCNONE 
J065138J04AGCCCATCCNONE 
J065139B14AGCCCATCCNONE 
J065193K21AGCCCATCCNONE 
J075005D01AGCCCATCCNONE 
J075057B19AGCCCATCCNONE 
J075061A15AGCCCATCCNONE 
J075105N16AGCCCATCCNONE 
J075146K15AGCCCATCCNONE 
J100026B22AGCCCATCCNONE 
Os12g0190100AK109819TCAGCCCATCASimilar to Auxin-independent growth promoter-like protein. 
AK109819TCAGCCCATCASimilar to Auxin-independent growth promoter-like protein. 
AK109819TCAGCCCATCASimilar to Auxin-independent growth promoter-like protein. 
Os12g0277500006-025-D06AGATGGGCTTCNONE 
AK061410AGATGGGCTTCNONE 
AK119217AGATGGGCTTCNONE 
AK119223AGATGGGCTTCNONE 
Os12g0442700AK111062AGCCCATCTHypothetical protein. 
J065080H14AGCCCATCTNONE 
J075019H22AGCCCATCTNONE 
J075088M09AGCCCATCTNONE 
Os12g0481100AK073151GACGGCCCACGAAAGCCCATCASimilar to RNA helicase. 
Os12g0490000J100030D22TGATGGGCTHypothetical protein. 
Os12g0517100012-071-A03AGCCCATCCAGCCCAATTNONE 
AK073020AGCCCATCCAGCCCAATTCyclin-like F-box domain containing protein. 
J023149K21AGCCCATCCAGCCCAATTNONE 
Os12g0554400AK072345CCCAGCCCATCCTetratricopeptide-like helical domain containing protein. 
Os12g0592200Os12g0592200TAAGCCCATCGConserved hypothetical protein. 
Os12g0597500AK101904CCCACTCCTGGGCCCAGCCCATCCANONE 
AK103799CCCACTCCTGGGCCCAGCCCATCCAAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CCCACTCCTGGGCCCAGCCCATCCANONE 
J100078O15CCCACTCCTGGGCCCAGCCCATCCANONE 
Os12g0609800AK101303ACAGCCCATCACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
AK101303AGATGGGCTGGGCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
AK101303CTGGCCCATGGAGCCCATCACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01ACAGCCCATCANONE 
J033032I01AGATGGGCTGGGNONE 
J033032I01CTGGCCCATGGAGCCCATCANONE 
J033033K21ACAGCCCATCANONE 
J033033K21AGATGGGCTGGGNONE 
J033033K21CTGGCCCATGGAGCCCATCANONE 
J033082L13ACAGCCCATCANONE 
J033082L13AGATGGGCTGGGNONE 
J033082L13CTGGCCCATGGAGCCCATCANONE 
J043034M20ACAGCCCATCANONE 
J043034M20AGATGGGCTGGGNONE 
J043034M20CTGGCCCATGGAGCCCATCANONE 
J065137J24ACAGCCCATCANONE 
J065137J24AGATGGGCTGGGNONE 
J065137J24CTGGCCCATGGAGCCCATCANONE 
J065141A11ACAGCCCATCANONE 
J065141A11AGATGGGCTGGGNONE 
J065141A11CTGGCCCATGGAGCCCATCANONE 
J065217H09ACAGCCCATCANONE 
J065217H09AGATGGGCTGGGNONE 
J065217H09CTGGCCCATGGAGCCCATCANONE 
Os12g0630600J100033A04GCAGCCCATCTConserved hypothetical protein. 
Os12g0636600AK111056GGATGGGCTGAConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.