version

Summary of OsREG467 (All List)

OrganismOryza sativa  
IDOsREG467  
SequenceAGCCCATG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
CCATGG  function unknown  
PLACE Motif 
Total Entry Count1255  

Entry Sequences (1255 entries)

LocusGene modelSequenceDescription
Os01g0104800AK067602AAAAGCCCATGTSas10/Utp3 family protein. 
J013109E04AAAAGCCCATGTNONE 
J033057M05AAAAGCCCATGTNONE 
J043021M24AAAAGCCCATGTNONE 
J090014N05AAAAGCCCATGTNONE 
J090077H23AAAAGCCCATGTNONE 
J090084H08AAAAGCCCATGTNONE 
Os01g0134700AK111442AGCCCATGACalmodulin binding protein-like family protein. 
J065141F12AGCCCATGANONE 
J065156K22AGCCCATGANONE 
J065160A12AGCCCATGANONE 
Os01g0139600AK073130CCCAGCCCATGTSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0203300015-045-F03ACATGGGCTTCNONE 
015-045-F03CCATGGGCTTCNONE 
AK106329ACATGGGCTTCConserved hypothetical protein. 
AK106329CCATGGGCTTCConserved hypothetical protein. 
Os01g0210300AK106937AGCCCATGAConserved hypothetical protein. 
Os01g0231700012-002-F11TCATGGGCTTTTNONE 
013-082-F05TCATGGGCTTTTNONE 
AK107453TCATGGGCTTTTSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22TCATGGGCTTTTNONE 
J065023E21TCATGGGCTTTTNONE 
J065036H21TCATGGGCTTTTNONE 
J065037M24TCATGGGCTTTTNONE 
J065049L04TCATGGGCTTTTNONE 
J065072F17TCATGGGCTTTTNONE 
J065085H10TCATGGGCTTTTNONE 
J065109N19TCATGGGCTTTTNONE 
J065117M19TCATGGGCTTTTNONE 
J065144C15TCATGGGCTTTTNONE 
J065159G24TCATGGGCTTTTNONE 
J065164N14TCATGGGCTTTTNONE 
J075025K16TCATGGGCTTTTNONE 
J075057L05TCATGGGCTTTTNONE 
J075070I16TCATGGGCTTTTNONE 
J075089D10TCATGGGCTTTTNONE 
J075138F10TCATGGGCTTTTNONE 
J090018C11TCATGGGCTTTTNONE 
J100018L19TCATGGGCTTTTNONE 
J100024B14TCATGGGCTTTTNONE 
J100048L02TCATGGGCTTTTNONE 
J100055A22TCATGGGCTTTTNONE 
J100069K01TCATGGGCTTTTNONE 
Os01g0233500AB024986ACATGGGCTNONE 
AK063476ACATGGGCTCyclin. 
Os01g0242200AK107468GCAGCCCATGZinc finger, C2H2-type domain containing protein. 
Os01g0574400AK072509ACATGGGCTSimilar to Cell division protein ftsH (EC 3.4.24.-). 
Os01g0590300014-089-E04CCATGGGCTGANONE 
AK063740CCATGGGCTGAConserved hypothetical protein. 
Os01g0700500AK072715GCAGCCCATGGCytochrome P450 family protein. 
AK119264GCAGCCCATGGNONE 
Os01g0706100AK072799TCATGGGCTConserved hypothetical protein. 
J013049G14TCATGGGCTNONE 
J023136E17TCATGGGCTNONE 
Os01g0721900AK059581TCAGCCCATGGNONE 
J065191A18TCAGCCCATGGNONE 
J100064H01TCAGCCCATGGNONE 
J100075M23TCAGCCCATGGNONE 
J100090A11TCAGCCCATGGNONE 
Os01g0738600AK073479CCATGGGCTENTH/VHS domain containing protein. 
AK120616CCATGGGCTNONE 
J013046M12CCATGGGCTNONE 
J013152B11CCATGGGCTNONE 
J023007A09CCATGGGCTNONE 
J023007N03CCATGGGCTNONE 
J023042A01CCATGGGCTNONE 
J023059P06CCATGGGCTNONE 
J023113A05CCATGGGCTNONE 
J033044K11CCATGGGCTNONE 
J033082E04CCATGGGCTNONE 
J090033B13CCATGGGCTNONE 
J090062H08CCATGGGCTNONE 
J100086G23CCATGGGCTNONE 
Os01g0745400AK107872AAAGCCCATGTGGGACCCACSec34-like protein family protein. 
Os01g0784600AK067527ACATGGGCTAATGGGCCTAConserved hypothetical protein. 
Os01g0798500006-106-C11CCAAGCCCATGNONE 
AK061244CCAAGCCCATGNONE 
AK068219CCAAGCCCATGMalate synthase-like family protein. 
J065199O16CCAAGCCCATGNONE 
Os01g0838350J065034O10CCAGCCCATGNONE 
J065151M02CCAGCCCATGConserved hypothetical protein. 
J065187I12CCAGCCCATGNONE 
J075083I04CCAGCCCATGNONE 
J075117N03CCAGCCCATGNONE 
Os01g0848200AK069425AGCCCATGTSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AK101230AGCCCATGTNONE 
Os01g0850900009-089-D11CCAGCCCATGANONE 
AK063822CCAGCCCATGANONE 
AK102887CCAGCCCATGASOUL heme-binding protein family protein. 
J033112K22CCAGCCCATGANONE 
J065087B10CCAGCCCATGANONE 
J065100A05CCAGCCCATGANONE 
J075077M10CCAGCCCATGANONE 
Os01g0889800003-107-A06GAAGCCCATGGGCCTCNONE 
005-016-H12GAAGCCCATGGGCCTCNONE 
AK070087GAAGCCCATGGGCCTCRhodanese-like domain containing protein. 
AK104708GAAGCCCATGGGCCTCNONE 
J013035D13GAAGCCCATGGGCCTCNONE 
J013068K01GAAGCCCATGGGCCTCNONE 
J023042J18GAAGCCCATGGGCCTCNONE 
J053023F13GAAGCCCATGGGCCTCNONE 
J053026M13GAAGCCCATGGGCCTCNONE 
J053033N15GAAGCCCATGGGCCTCNONE 
J053035I16GAAGCCCATGGGCCTCNONE 
J053039A11GAAGCCCATGGGCCTCNONE 
J053039K22GAAGCCCATGGGCCTCNONE 
J053043B08GAAGCCCATGGGCCTCNONE 
J053068K09GAAGCCCATGGGCCTCNONE 
J053082D11GAAGCCCATGGGCCTCNONE 
J053092N12GAAGCCCATGGGCCTCNONE 
J053099A19GAAGCCCATGGGCCTCNONE 
J065027F17GAAGCCCATGGGCCTCNONE 
J065039B13GAAGCCCATGGGCCTCNONE 
J065139N16GAAGCCCATGGGCCTCNONE 
J065205B22GAAGCCCATGGGCCTCNONE 
Os01g0926400AK063916TCATGGGCTTANONE 
AK073976TCATGGGCTTASimilar to Pectin-glucuronyltransferase. 
Os01g0945300003-104-D07TCATGGGCTTTTNONE 
AK065371TCATGGGCTTTTAmino acid/polyamine transporter I family protein. 
AK072189TCATGGGCTTTTNONE 
J013023D09TCATGGGCTTTTNONE 
J013055J18TCATGGGCTTTTNONE 
J013146P21TCATGGGCTTTTNONE 
J075109G14TCATGGGCTTTTNONE 
J075158O19TCATGGGCTTTTNONE 
Os01g0949700AK069037CCAGCCCATGGNONE 
J023004F17CCAGCCCATGGNONE 
J065063D04CCAGCCCATGGNONE 
J065196H02CCAGCCCATGGNONE 
J075198A05CCAGCCCATGGNONE 
Os01g0951800AK069239ACATGGGCTProtein prenyltransferase domain containing protein. 
Os01g0954400003-009-F12ACATGGGCTTTNONE 
012-080-B09ACATGGGCTTTNONE 
AK065709ACATGGGCTTTSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335ACATGGGCTTTNONE 
J013039J02ACATGGGCTTTNONE 
J033081E17ACATGGGCTTTNONE 
J075058B02ACATGGGCTTTNONE 
J075067K19ACATGGGCTTTNONE 
J075120E23ACATGGGCTTTNONE 
J075147I16ACATGGGCTTTNONE 
Os01g0958100AK058574CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
Os01g0976700AK068121CCATGGGCTGCNONE 
AK100571CCATGGGCTGCSimilar to Protein phosphatase 2C-like protein. 
Os02g0135600AK069843TGCGGCCCAATTCAGCCCATGTConserved hypothetical protein. 
J023034H09TGCGGCCCAATTCAGCCCATGTNONE 
J033090D08TGCGGCCCAATTCAGCCCATGTNONE 
J100025N07TGCGGCCCAATTCAGCCCATGTNONE 
J100075G18TGCGGCCCAATTCAGCCCATGTNONE 
Os02g0135700AK100570ACATGGGCTGAATTGGGCCGCADNA polymerase V family protein. 
Os02g0141000009-053-C03AGCCCATGGNONE 
AK121058AGCCCATGGAIG2-like family protein. 
J023054F06AGCCCATGGNONE 
J023056J21AGCCCATGGNONE 
J053031K06AGCCCATGGNONE 
J053098J23AGCCCATGGNONE 
J065178E11AGCCCATGGNONE 
Os02g0158900AK108324GCAGCCCATGSimilar to SNF4. 
Os02g0162500009-181-F03CATGGGCTNONE 
AK058907CATGGGCTNONE 
AK121223CATGGGCTSimilar to 40S ribosomal protein S14. 
J023090I10CATGGGCTNONE 
J023136J11CATGGGCTNONE 
J053097J20CATGGGCTNONE 
J053098F01CATGGGCTNONE 
J065065B09CATGGGCTNONE 
J065082M04CATGGGCTNONE 
J065188O05CATGGGCTNONE 
J075057P15CATGGGCTNONE 
J075061J08CATGGGCTNONE 
J075061N15CATGGGCTNONE 
J075131I08CATGGGCTNONE 
J075141H13CATGGGCTNONE 
J080062E14CATGGGCTNONE 
J080062P15CATGGGCTNONE 
J080318G17CATGGGCTNONE 
J080319G19CATGGGCTNONE 
J090001L10CATGGGCTNONE 
J090024I18CATGGGCTNONE 
J090033F24CATGGGCTNONE 
J090036M16CATGGGCTNONE 
J090040I24CATGGGCTNONE 
J090048P06CATGGGCTNONE 
J090049B12CATGGGCTNONE 
J090068C02CATGGGCTNONE 
J090069O04CATGGGCTNONE 
J090084H22CATGGGCTNONE 
J100022L03CATGGGCTNONE 
J100028O14CATGGGCTNONE 
J100028O18CATGGGCTNONE 
J100032A15CATGGGCTNONE 
J100033D21CATGGGCTNONE 
J100034J23CATGGGCTNONE 
J100043K22CATGGGCTNONE 
J100052M22CATGGGCTNONE 
J100053N03CATGGGCTNONE 
J100074N24CATGGGCTNONE 
J100082J10CATGGGCTNONE 
Os02g0163600AK068043TCATGGGCTTAConserved hypothetical protein. 
J013131O20TCATGGGCTTANONE 
J065006E03TCATGGGCTTANONE 
Os02g0179100AK058557ACATGGGCTMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10ACATGGGCTNONE 
Os02g0198000AK067695AGCCCATGTProtein of unknown function DUF1677, Oryza sativa family protein. 
Os02g0202800011-038-F08AGCCCATGGNONE 
015-041-G02AGCCCATGGNONE 
AK102082AGCCCATGGFAR1 domain containing protein. 
AK102813AGCCCATGGNONE 
AK109243AGCCCATGGNONE 
J033108L18AGCCCATGGNONE 
J033129C24AGCCCATGGNONE 
J065138F15AGCCCATGGNONE 
Os02g0581300AK071553ACATGGGCTTRAM, LAG1 and CLN8 homology domain containing protein. 
J023105G15ACATGGGCTNONE 
J065044A01ACATGGGCTNONE 
J065089D11ACATGGGCTNONE 
J065098K16ACATGGGCTNONE 
J065119D04ACATGGGCTNONE 
J065190M10ACATGGGCTNONE 
J090029F16ACATGGGCTNONE 
J090040K10ACATGGGCTNONE 
J090058J09ACATGGGCTNONE 
J090080C19ACATGGGCTNONE 
Os02g0584700009-044-F06AGCCCATGANONE 
J065178P16AGCCCATGANONE 
J075029H13AGCCCATGANONE 
J075042D04AGCCCATGAHeavy metal transport/detoxification protein domain containing protein. 
J075048C14AGCCCATGANONE 
J075068P06AGCCCATGANONE 
J075094M11AGCCCATGANONE 
J075101D19AGCCCATGANONE 
J075121E10AGCCCATGANONE 
J075170D07AGCCCATGANONE 
J075174C22AGCCCATGANONE 
J075178D09AGCCCATGANONE 
J075187A20AGCCCATGANONE 
J075190I15AGCCCATGANONE 
Os02g0591800AK060611ACATGGGCTAGGCCCACTBrix domain containing protein. 
AK102534ACATGGGCTAGGCCCACTNONE 
J075057H08ACATGGGCTAGGCCCACTNONE 
J075179P18ACATGGGCTAGGCCCACTNONE 
J080011H01ACATGGGCTAGGCCCACTNONE 
J080018E14ACATGGGCTAGGCCCACTNONE 
J080026N17ACATGGGCTAGGCCCACTNONE 
J080047A13ACATGGGCTAGGCCCACTNONE 
J080049C17ACATGGGCTAGGCCCACTNONE 
J080050G07ACATGGGCTAGGCCCACTNONE 
J080064D10ACATGGGCTAGGCCCACTNONE 
J080080A03ACATGGGCTAGGCCCACTNONE 
J080080G20ACATGGGCTAGGCCCACTNONE 
J080080I03ACATGGGCTAGGCCCACTNONE 
J080081H12ACATGGGCTAGGCCCACTNONE 
J080090K07ACATGGGCTAGGCCCACTNONE 
J080092O06ACATGGGCTAGGCCCACTNONE 
J080096B07ACATGGGCTAGGCCCACTNONE 
J080097M08ACATGGGCTAGGCCCACTNONE 
Os02g0600100AK071215TCCGGCCCATGGGCTGTSimilar to 26S proteasome subunit RPN7. 
Os02g0618250009-115-E10CCAAGCCCATGTNONE 
014-076-A03CCAAGCCCATGTNONE 
J065096D10CCAAGCCCATGTSimilar to H/ACA ribonucleoprotein complex subunit 3-like protein. 
J075045G01CCAAGCCCATGTNONE 
J075092J11CCAAGCCCATGTNONE 
J075134F02CCAAGCCCATGTNONE 
Os02g0634800003-004-F03TCAGCCCATGANONE 
AK059694TCAGCCCATGAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17TCAGCCCATGANONE 
J053077G20TCAGCCCATGANONE 
J075195F14TCAGCCCATGANONE 
Os02g0634900006-032-G12TCATGGGCTGANONE 
006-033-E09TCATGGGCTGANONE 
006-117-F10TCATGGGCTGANONE 
006-118-E01TCATGGGCTGANONE 
013-056-G08TCATGGGCTGANONE 
AK059769TCATGGGCTGANONE 
AK068583TCATGGGCTGANONE 
AK072855TCATGGGCTGAProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210TCATGGGCTGANONE 
J023138P05TCATGGGCTGANONE 
J023143J07TCATGGGCTGANONE 
J033022O09TCATGGGCTGANONE 
J033111L02TCATGGGCTGANONE 
J033135O03TCATGGGCTGANONE 
J065005K19TCATGGGCTGANONE 
J065044C17TCATGGGCTGANONE 
J065116K09TCATGGGCTGANONE 
J065119O21TCATGGGCTGANONE 
J075014L05TCATGGGCTGANONE 
J075109H16TCATGGGCTGANONE 
J075117D04TCATGGGCTGANONE 
Os02g0643500AK068423CATGGGCTTTPentapeptide repeat containing protein. 
Os02g0651500AK066333TCAGCCCATGANONE 
AK121865TCAGCCCATGAHypothetical protein. 
J090038J11TCAGCCCATGANONE 
Os02g0681100AK100584AAAGCCCATGAProtein of unknown function DUF604 family protein. 
J023106A15AAAGCCCATGANONE 
Os02g0751600006-048-C01GGGAAAGCCCATGGNONE 
006-059-E07GGGAAAGCCCATGGNONE 
AK060441GGGAAAGCCCATGGNONE 
AK061027GGGAAAGCCCATGGNONE 
AK072946GGGAAAGCCCATGGPeptidylprolyl isomerase, FKBP-type domain containing protein. 
AK104401GGGAAAGCCCATGGNONE 
J023150D22GGGAAAGCCCATGGNONE 
J075005E17GGGAAAGCCCATGGNONE 
J075019F10GGGAAAGCCCATGGNONE 
J075047K24GGGAAAGCCCATGGNONE 
J075052B13GGGAAAGCCCATGGNONE 
J075063M19GGGAAAGCCCATGGNONE 
J075136P10GGGAAAGCCCATGGNONE 
J075139E24GGGAAAGCCCATGGNONE 
J075152K11GGGAAAGCCCATGGNONE 
J075161A10GGGAAAGCCCATGGNONE 
J075187F20GGGAAAGCCCATGGNONE 
Os02g0754500AK069965AGCCCATGACAAGCCCACGGNONE 
AK105696AGCCCATGACAAGCCCACGGAmidase family protein. 
Os02g0759700AK111935AGCCCATGGNONE 
Os02g0791800AK066282CATGGGCTGCNONE 
AK099697CATGGGCTGCWD-40 repeat containing protein. 
AY445625CATGGGCTGCNONE 
J053065H07CATGGGCTGCNONE 
J065108P05CATGGGCTGCNONE 
J065154P22CATGGGCTGCNONE 
J100037P04CATGGGCTGCNONE 
J100068K05CATGGGCTGCNONE 
Os02g0803600AK064750AGCCCATGALongin-like domain containing protein. 
Os02g0813700Os02g0813700CAAGCCCATGANONE 
Os02g0823400AK105029AGCCCATGTSimilar to S-adenosyl-L-methionine: beta-alanine N-methyltransferase (Fragment). 
J033140N12AGCCCATGTNONE 
J075104C12AGCCCATGTNONE 
J075120E03AGCCCATGTNONE 
J075126M18AGCCCATGTNONE 
J075189P21AGCCCATGTNONE 
Os02g0833900003-009-D08AGCCCATGANONE 
006-021-A06AGCCCATGANONE 
006-021-C05AGCCCATGANONE 
006-026-E10AGCCCATGANONE 
006-030-E06AGCCCATGANONE 
006-057-B10AGCCCATGANONE 
006-063-H09AGCCCATGANONE 
006-068-H02AGCCCATGANONE 
006-074-H10AGCCCATGANONE 
006-077-F08AGCCCATGANONE 
006-078-F01AGCCCATGANONE 
006-079-A12AGCCCATGANONE 
006-086-F02AGCCCATGANONE 
006-086-G01AGCCCATGANONE 
006-101-A03AGCCCATGANONE 
006-108-C11AGCCCATGANONE 
006-113-G12AGCCCATGANONE 
006-117-F12AGCCCATGANONE 
006-119-D10AGCCCATGANONE 
006-119-F09AGCCCATGANONE 
009-106-G05AGCCCATGANONE 
009-126-B08AGCCCATGANONE 
009-166-F06AGCCCATGANONE 
AK060083AGCCCATGANONE 
AK099584AGCCCATGANONE 
AK106092AGCCCATGANONE 
AK106171AGCCCATGASimilar to Peroxidase 64 precursor (EC 1.11.1.7) (Atperox P64) (PRXR4) (ATP17a). 
J013042D08AGCCCATGANONE 
J013042E08AGCCCATGANONE 
J075002G19AGCCCATGANONE 
J075030K18AGCCCATGANONE 
J075065P19AGCCCATGANONE 
J075091B17AGCCCATGANONE 
Os03g0130700015-052-H06TCATGGGCTGTNONE 
AK073872TCATGGGCTGTNONE 
AK100822TCATGGGCTGTNONE 
AK119886TCATGGGCTGTNONE 
J090060L05TCATGGGCTGTNONE 
J100059N01TCATGGGCTGTNONE 
Os03g0139000006-059-C06TCATGGGCTNONE 
009-055-F07TCATGGGCTNONE 
AK060973TCATGGGCTConserved hypothetical protein. 
AK103850TCATGGGCTNONE 
Os03g0171700J065192H12AGCCCATGGGCCAGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0197000AK071163CCATGGGCTGGConserved hypothetical protein. 
J023079A07CCATGGGCTGGNONE 
Os03g0226300AK111731AGCCCATGASimilar to Pto kinase interactor 1. 
Os03g0253100AK119618ACAGCCCATGTPhosphomevalonate kinase Erg8 family protein. 
J033052A14ACAGCCCATGTNONE 
Os03g0266900013-080-C12AGCCCATGNONE 
014-010-A09AGCCCATGNONE 
014-013-G10AGCCCATGNONE 
014-019-D06AGCCCATGNONE 
014-030-F08AGCCCATGNONE 
014-039-C05AGCCCATGNONE 
014-053-H08AGCCCATGNONE 
014-089-F06AGCCCATGNONE 
014-094-A05AGCCCATGNONE 
014-098-C12AGCCCATGNONE 
AK119243AGCCCATGLow molecular mass heat shock protein Oshsp17.3. 
AK119717AGCCCATGNONE 
D12635AGCCCATGNONE 
M80186AGCCCATGNONE 
Os03g0273800AK059223CGCGACGCCATGGGCTTCNONE 
AK067356CGCGACGCCATGGGCTTCNONE 
AK100173CGCGACGCCATGGGCTTCPyrimidine 5-nucleotidase family protein. 
Os03g0282900006-088-H05ACATGGGCTGATGGGCCGTGNONE 
AK061166ACATGGGCTGATGGGCCGTGNONE 
AK102161ACATGGGCTGATGGGCCGTGConserved hypothetical protein. 
AK104514ACATGGGCTGATGGGCCGTGNONE 
Os03g0298800009-079-B10ACATGGGCTGTNONE 
AK103337ACATGGGCTGTSimilar to Spliceosomal protein. 
Os03g0299900AK069075TAGGCCCAGCCCATGASimilar to Plastid aminotransferase (Fragment). 
AY338235TAGGCCCAGCCCATGANONE 
J053077F07TAGGCCCAGCCCATGANONE 
Os03g0302700006-099-F12AGCCCATGTNONE 
AK112010AGCCCATGTZinc finger, RING-type domain containing protein. 
AK121656AGCCCATGTNONE 
J075090A19AGCCCATGTNONE 
J075148M06AGCCCATGTNONE 
Os03g0308100AB116073TAAGCCCATGAPeptidase S14, ClpP family protein. 
AK060518TAAGCCCATGANONE 
AK099107TAAGCCCATGANONE 
AK105977TAAGCCCATGANONE 
J065005O19TAAGCCCATGANONE 
J065007L02TAAGCCCATGANONE 
J065128G15TAAGCCCATGANONE 
J065128N14TAAGCCCATGANONE 
J075010E21TAAGCCCATGANONE 
J075101J24TAAGCCCATGANONE 
J075124O14TAAGCCCATGANONE 
J075126O07TAAGCCCATGANONE 
Os03g0386000AK072984CCAGCCCATGSimilar to WD domain protein-like. 
J065009K18CCAGCCCATGNONE 
J065165P09CCAGCCCATGNONE 
Os03g0441000AK108726ACATGGGCTTranscription initiation factor TFIID component TAF4 domain containing protein. 
Os03g0622300AK107931AGCCCATGGGCTGTConserved hypothetical protein. 
J065184K14AGCCCATGGGCTGTNONE 
Os03g0633800AK073044CATGGGCTGCSimilar to IAA6 (Fragment). 
J065038L22CATGGGCTGCNONE 
J065185C13CATGGGCTGCNONE 
Os03g0668000AK111705TAAGCCCATGGNONE 
AK111783TAAGCCCATGGCyclin-like F-box domain containing protein. 
J023087J12TAAGCCCATGGNONE 
Os03g0669600009-081-F01TCATGGGCTNONE 
AK073152TCATGGGCTNONE 
AK104971TCATGGGCTHypothetical protein. 
J065166I17TCATGGGCTNONE 
Os03g0743200J065049G14TCAGCCCATGANONE 
J065158O18TCAGCCCATGANONE 
Os03g0746700015-015-E02CATGGGCTNONE 
015-059-G01CATGGGCTNONE 
015-073-C05CATGGGCTNONE 
AK068199CATGGGCTConserved hypothetical protein. 
J075066J09CATGGGCTNONE 
J100025E14CATGGGCTNONE 
Os03g0749900006-112-A05CCAGCCCATTGAGGCCCATGGGCTNONE 
AK061252CCAGCCCATTGAGGCCCATGGGCTConserved hypothetical protein. 
J023020I01CCAGCCCATTGAGGCCCATGGGCTNONE 
J033060N21CCAGCCCATTGAGGCCCATGGGCTNONE 
Os03g0766000AK070596CCAAGCCCATGANONE 
AK104743CCAAGCCCATGANONE 
AK106079CCAAGCCCATGANONE 
J013063M09CCAAGCCCATGANONE 
J023056A03CCAAGCCCATGANONE 
J043038L07CCAAGCCCATGANONE 
J053067N16CCAAGCCCATGANONE 
J053073G09CCAAGCCCATGANONE 
J053075I19CCAAGCCCATGANONE 
Os03g0797000AK073440ACATGGGCTTCSimilar to Indole synthase. 
Os03g0824400AK070153TCATGGGCTNONE 
AK104298TCATGGGCTSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0831100AK103115TAGGCCCAGCCCATGGGCArmadillo-like helical domain containing protein. 
J033119F15TAGGCCCAGCCCATGGGCNONE 
J065011M19TAGGCCCAGCCCATGGGCNONE 
J075019I08TAGGCCCAGCCCATGGGCNONE 
J075047A01TAGGCCCAGCCCATGGGCNONE 
J075096P21TAGGCCCAGCCCATGGGCNONE 
J075121I05TAGGCCCAGCCCATGGGCNONE 
J075121I07TAGGCCCAGCCCATGGGCNONE 
J090063F13TAGGCCCAGCCCATGGGCNONE 
J090068F16TAGGCCCAGCCCATGGGCNONE 
J090094E14TAGGCCCAGCCCATGGGCNONE 
Os03g0833500AK119356CCATGGGCTGGSimilar to 98kDa HDM allergen. 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800CAGGCCCATGGGCTGGCCCACCCGNONE 
AK104068CAGGCCCATGGGCTGGCCCACCCGNONE 
J075031J11CAGGCCCATGGGCTGGCCCACCCGNONE 
J075051N01CAGGCCCATGGGCTGGCCCACCCGNONE 
J075166D18CAGGCCCATGGGCTGGCCCACCCGNONE 
J075171E14CAGGCCCATGGGCTGGCCCACCCGNONE 
Os03g0846400AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE 
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0850100AK101126AGCCCATGGNLI interacting factor domain containing protein. 
Os04g0220300AK058435GCCCATGGGCTConserved hypothetical protein. 
Os04g0270100AK063713TCATGGGCTGANONE 
AK107968TCATGGGCTGANONE 
Os04g0283700AK063831CATGGGCTChromo domain containing protein. 
Os04g0304200AB018443ACATGGGCTTTNONE 
AK067128ACATGGGCTTTSimilar to Nonphototropic hypocotyl protein 1 (EC 2.7.1.37) (Phototropin). 
Os04g0416000J065041L09TCATGGGCTGGGCTTCNONE 
J065050F15TCATGGGCTGGGCTTCNONE 
J065053M14TCATGGGCTGGGCTTCProtein of unknown function DUF1279 domain containing protein. 
J065057I09TCATGGGCTGGGCTTCNONE 
J065132E14TCATGGGCTGGGCTTCNONE 
J065144L23TCATGGGCTGGGCTTCNONE 
J065154N13TCATGGGCTGGGCTTCNONE 
J065158P16TCATGGGCTGGGCTTCNONE 
J080302F01TCATGGGCTGGGCTTCNONE 
J080308G20TCATGGGCTGGGCTTCNONE 
Os04g0447300AK111006TCATGGGCTConserved hypothetical protein. 
Os04g0457100AK108672AGCCCATGConserved hypothetical protein. 
Os04g0479800AK121430GCAGCCCATGGGCTGGCACGGCCCATGCyclin-like F-box domain containing protein. 
J033099N03GCAGCCCATGGGCTGGCACGGCCCATGNONE 
J090035E10GCAGCCCATGGGCTGGCACGGCCCATGNONE 
Os04g0481800AK109152ACATGGGCTGTMembrane bound O-acyl transferase, MBOAT family protein. 
J065002K24ACATGGGCTGTNONE 
Os04g0494600AK110895AGCCCATGGGCTTCProtein of unknown function DUF642 family protein. 
Os04g0506800006-044-G02ACATGGGCTNONE 
AK070719ACATGGGCTGlycosyl transferase, family 29 protein. 
AK104647ACATGGGCTNONE 
AK104762ACATGGGCTNONE 
J013096J11ACATGGGCTNONE 
J023058L14ACATGGGCTNONE 
J065057C09ACATGGGCTNONE 
J065101H18ACATGGGCTNONE 
J065107F03ACATGGGCTNONE 
J065154O19ACATGGGCTNONE 
J065179I09ACATGGGCTNONE 
J065189E21ACATGGGCTNONE 
Os04g0525900AK065806AGCCCATGAMajor facilitator superfamily protein. 
Os04g0542900AK068610TCATGGGCTTAConserved hypothetical protein. 
Os04g0569900AK059100CATGGGCTNONE 
Os04g0573900AK101618GGATGGGCCAAGCCCATGTSimilar to Cytochrome P450-like protein. 
AK103182GGATGGGCCAAGCCCATGTNONE 
AK119612GGATGGGCCAAGCCCATGTNONE 
AK120901GGATGGGCCAAGCCCATGTNONE 
Os04g0577000AK073711ACATGGGCTGAUbiquitin fusion degradation protein UFD1 family protein. 
AK119957ACATGGGCTGANONE 
J013127H04ACATGGGCTGANONE 
J033035G06ACATGGGCTGANONE 
J033061G23ACATGGGCTGANONE 
J033127L07ACATGGGCTGANONE 
J065015F17ACATGGGCTGANONE 
J065062G08ACATGGGCTGANONE 
J065132M07ACATGGGCTGANONE 
J065155C12ACATGGGCTGANONE 
J075055I08ACATGGGCTGANONE 
J075140D07ACATGGGCTGANONE 
J090055B21ACATGGGCTGANONE 
J100031D23ACATGGGCTGANONE 
Os04g0581100AK100853TCATGGGCTIsopenicillin N synthase family protein. 
J023123J08TCATGGGCTNONE 
Os04g0595000AK106907TCATGGGCTTGPeptidase A1, pepsin family protein. 
Os04g0599000AK111508AGCCCATGEGF-like, type 3 domain containing protein. 
Os04g0610500006-115-C07ATATGGGCTGCAGCCCATGTNONE 
AK066289ATATGGGCTGCAGCCCATGTPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817ATATGGGCTGCAGCCCATGTNONE 
J013096N09ATATGGGCTGCAGCCCATGTNONE 
J023054I11ATATGGGCTGCAGCCCATGTNONE 
J023121P20ATATGGGCTGCAGCCCATGTNONE 
J053039O20ATATGGGCTGCAGCCCATGTNONE 
J053071L20ATATGGGCTGCAGCCCATGTNONE 
J053088H23ATATGGGCTGCAGCCCATGTNONE 
J053096J03ATATGGGCTGCAGCCCATGTNONE 
Os04g0656800011-008-B09AGCCCATGGNONE 
Os04g0681500AK105582CATGGGCTEF-Hand type domain containing protein. 
Os05g0116600AK109828AGGTGGGCCGCATGGGCTTTF-box associated type 1 domain containing protein. 
Os05g0123400AK069521CCAGCCCATGAConserved hypothetical protein. 
J023022O05CCAGCCCATGANONE 
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein. 
Os05g0155100006-075-B02TCAGCCCATGNONE 
AK061929TCAGCCCATGNONE 
AK102810TCAGCCCATGNONE 
AK120877TCAGCCCATGSimilar to 60S ribosomal protein L18. 
J013023E03TCAGCCCATGNONE 
J013038C16TCAGCCCATGNONE 
J013120M14TCAGCCCATGNONE 
J013153B04TCAGCCCATGNONE 
J013159B07TCAGCCCATGNONE 
J023012A02TCAGCCCATGNONE 
J023027F08TCAGCCCATGNONE 
J023027I12TCAGCCCATGNONE 
J023120F05TCAGCCCATGNONE 
J023138O03TCAGCCCATGNONE 
J023142H13TCAGCCCATGNONE 
J023143P06TCAGCCCATGNONE 
J033023P09TCAGCCCATGNONE 
J033035O14TCAGCCCATGNONE 
J033042N19TCAGCCCATGNONE 
J033043B12TCAGCCCATGNONE 
J033065D10TCAGCCCATGNONE 
J033081A12TCAGCCCATGNONE 
J033084N05TCAGCCCATGNONE 
J033085M03TCAGCCCATGNONE 
J033112D15TCAGCCCATGNONE 
J033114O07TCAGCCCATGNONE 
J033119D15TCAGCCCATGNONE 
J033140E06TCAGCCCATGNONE 
J033141K23TCAGCCCATGNONE 
J043040I22TCAGCCCATGNONE 
J053050B21TCAGCCCATGNONE 
J053065I18TCAGCCCATGNONE 
J053074O16TCAGCCCATGNONE 
J065072K13TCAGCCCATGNONE 
J065211I09TCAGCCCATGNONE 
J090004K04TCAGCCCATGNONE 
J090016L06TCAGCCCATGNONE 
J090040F22TCAGCCCATGNONE 
J090063F22TCAGCCCATGNONE 
J090081J09TCAGCCCATGNONE 
J100032A10TCAGCCCATGNONE 
J100037G20TCAGCCCATGNONE 
J100056O10TCAGCCCATGNONE 
J100071D10TCAGCCCATGNONE 
J100075K13TCAGCCCATGNONE 
J100079F16TCAGCCCATGNONE 
J100080O16TCAGCCCATGNONE 
J100086N05TCAGCCCATGNONE 
Os05g0186000006-103-D10TCATGGGCTTGGNONE 
009-047-D06TCATGGGCTTGGNONE 
009-073-G05TCATGGGCTTGGNONE 
009-084-G09TCATGGGCTTGGNONE 
009-097-G04TCATGGGCTTGGNONE 
009-111-D11TCATGGGCTTGGNONE 
009-115-G01TCATGGGCTTGGNONE 
009-131-B04TCATGGGCTTGGNONE 
009-144-F05TCATGGGCTTGGNONE 
009-154-D08TCATGGGCTTGGNONE 
014-004-H02TCATGGGCTTGGNONE 
AK058675TCATGGGCTTGGNONE 
AK060420TCATGGGCTTGGSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231TCATGGGCTTGGNONE 
J065155C08TCATGGGCTTGGNONE 
J075143K12TCATGGGCTTGGNONE 
Os05g0193800AK058865TATTGGGCCAGCCCATGNONE 
AK067940TATTGGGCCAGCCCATGConserved hypothetical protein. 
J065043K19TATTGGGCCAGCCCATGNONE 
J065095O10TATTGGGCCAGCCCATGNONE 
J065095O12TATTGGGCCAGCCCATGNONE 
J080002K02TATTGGGCCAGCCCATGNONE 
J080012L17TATTGGGCCAGCCCATGNONE 
J080013J02TATTGGGCCAGCCCATGNONE 
J080013O11TATTGGGCCAGCCCATGNONE 
J080020A17TATTGGGCCAGCCCATGNONE 
J080028E18TATTGGGCCAGCCCATGNONE 
J080036P11TATTGGGCCAGCCCATGNONE 
J080042E10TATTGGGCCAGCCCATGNONE 
J080042L10TATTGGGCCAGCCCATGNONE 
J080047B11TATTGGGCCAGCCCATGNONE 
J080048N05TATTGGGCCAGCCCATGNONE 
J080057E20TATTGGGCCAGCCCATGNONE 
J080057K13TATTGGGCCAGCCCATGNONE 
J080058L03TATTGGGCCAGCCCATGNONE 
J080063H07TATTGGGCCAGCCCATGNONE 
J080066L23TATTGGGCCAGCCCATGNONE 
J080069G22TATTGGGCCAGCCCATGNONE 
J080072E12TATTGGGCCAGCCCATGNONE 
J080076D06TATTGGGCCAGCCCATGNONE 
J080077A22TATTGGGCCAGCCCATGNONE 
J080081A01TATTGGGCCAGCCCATGNONE 
J080090M13TATTGGGCCAGCCCATGNONE 
J080093G07TATTGGGCCAGCCCATGNONE 
J080094O20TATTGGGCCAGCCCATGNONE 
J080097F13TATTGGGCCAGCCCATGNONE 
Os05g0195700006-027-E05TCATGGGCTNONE 
AK061427TCATGGGCTNONE 
AK065594TCATGGGCTSimilar to Transcription factor MYBS2. 
J013029P13TCATGGGCTNONE 
J065048A06TCATGGGCTNONE 
J065080L03TCATGGGCTNONE 
J065103D11TCATGGGCTNONE 
J065106I19TCATGGGCTNONE 
J065198K16TCATGGGCTNONE 
Os05g0252000AK068865CATGGGCTOligopeptide transporter OPT superfamily protein. 
Os05g0267100009-106-H07ACATGGGCTTGNONE 
009-177-H02ACATGGGCTTGNONE 
AK062790ACATGGGCTTGNONE 
AK065811ACATGGGCTTGNONE 
J013026N17ACATGGGCTTGNONE 
J013039F07ACATGGGCTTGNONE 
Os05g0383100AK121835AGCCCATGGGCTClathrin adaptor complex, medium chain family protein. 
Os05g0413000AK058277AAAAGCCCATGMitochodrial transcription termination factor-related family protein. 
Os05g0430200J090095K16ACAGCCCATGNONE 
Os05g0445500009-021-C05GCAGCCCATGNONE 
009-021-C05TCATGGGCTNONE 
009-129-D11GCAGCCCATGNONE 
009-129-D11TCATGGGCTNONE 
009-147-E04GCAGCCCATGNONE 
009-147-E04TCATGGGCTNONE 
009-169-C11GCAGCCCATGNONE 
009-169-C11TCATGGGCTNONE 
AK121459GCAGCCCATGSimilar to 60S acidic ribosomal protein P2B. 
AK121459TCATGGGCTSimilar to 60S acidic ribosomal protein P2B. 
D21114GCAGCCCATGNONE 
D21114TCATGGGCTNONE 
J023001K23GCAGCCCATGNONE 
J023001K23TCATGGGCTNONE 
J023107J19GCAGCCCATGNONE 
J023107J19TCATGGGCTNONE 
J023143J09GCAGCCCATGNONE 
J023143J09TCATGGGCTNONE 
J065049D04GCAGCCCATGNONE 
J065049D04TCATGGGCTNONE 
J065092I06GCAGCCCATGNONE 
J065092I06TCATGGGCTNONE 
J065188H04GCAGCCCATGNONE 
J065188H04TCATGGGCTNONE 
Os05g0447000AK108280AATTGGGCTTTTAGCCCATGTSimilar to Pleckstrin homology domain-containing protein 1 (AtPH1). 
Os05g0509200AK061566TAAGCCCATGANADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK099007TAAGCCCATGANONE 
AK100226TAAGCCCATGANONE 
J013114B12TAAGCCCATGANONE 
J023048D09TAAGCCCATGANONE 
Os05g0558900AK101679ACATGGGCTGGSimilar to Frsb-prov protein. 
J013028M08ACATGGGCTGGNONE 
J013074E16ACATGGGCTGGNONE 
J013096L01ACATGGGCTGGNONE 
J023085M19ACATGGGCTGGNONE 
J033058I10ACATGGGCTGGNONE 
J033091D18ACATGGGCTGGNONE 
J033111H13ACATGGGCTGGNONE 
J033114C18ACATGGGCTGGNONE 
Os05g0563500AK121924TCATGGGCTConserved hypothetical protein. 
J033106F17TCATGGGCTNONE 
Os05g0567300013-039-F11CCATGGGCTTTGTTGGGCCGGTNONE 
AK112068CCATGGGCTTTGTTGGGCCGGTGTP-binding protein, HSR1-related domain containing protein. 
Os05g0571400009-019-B04AGCCCATGCGGCCCAAAANONE 
009-043-H02AGCCCATGCGGCCCAAAANONE 
AK062369AGCCCATGCGGCCCAAAAConserved hypothetical protein. 
Os06g0106000006-086-D02TCATGGGCTTANONE 
AK059897TCATGGGCTTASeptum site-determining protein MinD family protein. 
AK105653TCATGGGCTTANONE 
J065059N03TCATGGGCTTANONE 
J065138F18TCATGGGCTTANONE 
J065158D02TCATGGGCTTANONE 
Os06g0116400006-082-G06ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK058327ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK105979ACATGGGCTCGGCCCAAGCCACGTCHigh-affinity nickel-transporter family protein. 
J065083I24ACATGGGCTCGGCCCAAGCCACGTCNONE 
J100072O18ACATGGGCTCGGCCCAAGCCACGTCNONE 
Os06g0128400AK064390AATGGGCTGATAAGCCCATGGNONE 
AK121983AATGGGCTGATAAGCCCATGGWD40-like domain containing protein. 
Os06g0130000AK064427TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK070084TATTGGGCTCAGCCCATGAGCCCATGTNONE 
AK119321TATTGGGCTCAGCCCATGAGCCCATGTSimilar to Tobacco mosaic virus helicase domain-binding protein (Fragment). 
Os06g0135340J065061D17TAAGCCCATGANONE 
J065159A10TAAGCCCATGAConserved hypothetical protein. 
Os06g0137500AK072896ACAGCCCATGGGCBrix domain containing protein. 
AK121945ACAGCCCATGGGCNONE 
Os06g0325500011-037-D06AAAGCCCATGTNONE 
011-093-G07AAAGCCCATGTNONE 
AK063974AAAGCCCATGTProtein of unknown function DUF89 family protein. 
AK099286AAAGCCCATGTNONE 
J065124G18AAAGCCCATGTNONE 
J065160K08AAAGCCCATGTNONE 
J065207O08AAAGCCCATGTNONE 
J075011D18AAAGCCCATGTNONE 
J075012D02AAAGCCCATGTNONE 
J075090F13AAAGCCCATGTNONE 
J075164A04AAAGCCCATGTNONE 
J075198I19AAAGCCCATGTNONE 
Os06g0609700AK067228AGCCCATGGEsterase/lipase/thioesterase domain containing protein. 
Os06g0638700AK108500ACAGCCCATGTPutative cyclase family protein. 
Os06g0647900AK073750TCATGGGCTConserved hypothetical protein. 
J033029K17TCATGGGCTNONE 
J033070L21TCATGGGCTNONE 
Os06g0694500AK067484CCATGGGCTGTATGGGCTTTTSimilar to Nitrogen fixation like protein. 
AK103983CCATGGGCTGTATGGGCTTTTNONE 
Os06g0701400013-010-G06ACATGGGCTTTTCATGGGCCAGANONE 
AK121229ACATGGGCTTTTCATGGGCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16ACATGGGCTTTTCATGGGCCAGANONE 
J033023L12ACATGGGCTTTTCATGGGCCAGANONE 
J065043I07ACATGGGCTTTTCATGGGCCAGANONE 
J065049E09ACATGGGCTTTTCATGGGCCAGANONE 
J065054I05ACATGGGCTTTTCATGGGCCAGANONE 
J065072H13ACATGGGCTTTTCATGGGCCAGANONE 
J065073L10ACATGGGCTTTTCATGGGCCAGANONE 
J065079P09ACATGGGCTTTTCATGGGCCAGANONE 
J065112I06ACATGGGCTTTTCATGGGCCAGANONE 
J065167C03ACATGGGCTTTTCATGGGCCAGANONE 
J065167I03ACATGGGCTTTTCATGGGCCAGANONE 
J065176P13ACATGGGCTTTTCATGGGCCAGANONE 
J065205M07ACATGGGCTTTTCATGGGCCAGANONE 
J075018E13ACATGGGCTTTTCATGGGCCAGANONE 
J075021E04ACATGGGCTTTTCATGGGCCAGANONE 
J075038F13ACATGGGCTTTTCATGGGCCAGANONE 
J075051E05ACATGGGCTTTTCATGGGCCAGANONE 
J075067C10ACATGGGCTTTTCATGGGCCAGANONE 
J075079A12ACATGGGCTTTTCATGGGCCAGANONE 
J075084A13ACATGGGCTTTTCATGGGCCAGANONE 
J075103E20ACATGGGCTTTTCATGGGCCAGANONE 
J075116E09ACATGGGCTTTTCATGGGCCAGANONE 
J075118F15ACATGGGCTTTTCATGGGCCAGANONE 
J075121I15ACATGGGCTTTTCATGGGCCAGANONE 
J075129B01ACATGGGCTTTTCATGGGCCAGANONE 
J075138A22ACATGGGCTTTTCATGGGCCAGANONE 
J075159B22ACATGGGCTTTTCATGGGCCAGANONE 
J075165I11ACATGGGCTTTTCATGGGCCAGANONE 
J075186E09ACATGGGCTTTTCATGGGCCAGANONE 
J075190J09ACATGGGCTTTTCATGGGCCAGANONE 
J075191I07ACATGGGCTTTTCATGGGCCAGANONE 
J080301C05ACATGGGCTTTTCATGGGCCAGANONE 
J080302L02ACATGGGCTTTTCATGGGCCAGANONE 
J100035C19ACATGGGCTTTTCATGGGCCAGANONE 
J100059P06ACATGGGCTTTTCATGGGCCAGANONE 
Os06g0711600016-047-G09TCATGGGCTGGNONE 
AK064384TCATGGGCTGGmRNA splicing factor SYF2 family protein. 
AK102831TCATGGGCTGGNONE 
J013072P18TCATGGGCTGGNONE 
J023049G01TCATGGGCTGGNONE 
J023088I01TCATGGGCTGGNONE 
J033023I22TCATGGGCTGGNONE 
J033106I12TCATGGGCTGGNONE 
J033109G07TCATGGGCTGGNONE 
J065030F22TCATGGGCTGGNONE 
J065132H19TCATGGGCTGGNONE 
J080301D07TCATGGGCTGGNONE 
J080305C09TCATGGGCTGGNONE 
J080312C03TCATGGGCTGGNONE 
J080313I15TCATGGGCTGGNONE 
J080315B09TCATGGGCTGGNONE 
J090056N21TCATGGGCTGGNONE 
J100027B07TCATGGGCTGGNONE 
Os07g0110100009-059-D11AGCCCATGANONE 
AK071499AGCCCATGAConserved hypothetical protein. 
J065064P17AGCCCATGANONE 
J065111B09AGCCCATGANONE 
J075099A14AGCCCATGANONE 
J075139C23AGCCCATGANONE 
Os07g0122300015-004-G08GCAGCCCATGGGCCTTNONE 
AK103212GCAGCCCATGGGCCTTNONE 
AK119295GCAGCCCATGGGCCTTProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09GCAGCCCATGGGCCTTNONE 
J090007P13GCAGCCCATGGGCCTTNONE 
Os07g0146700014-006-H11AGCCCATGGGCCAGANONE 
AK063631AGCCCATGGGCCAGAConserved hypothetical protein. 
AK101150AGCCCATGGGCCAGANONE 
J065038C21AGCCCATGGGCCAGANONE 
Os07g0150200009-152-C07AGCCCATGANONE 
AK058680AGCCCATGANONE 
AK121635AGCCCATGASimilar to 40S ribosomal protein S12-1. 
J033051C16AGCCCATGANONE 
J033123H15AGCCCATGANONE 
J065093I01AGCCCATGANONE 
J065197C05AGCCCATGANONE 
J075037B11AGCCCATGANONE 
J075114B08AGCCCATGANONE 
J075123N01AGCCCATGANONE 
J075129O04AGCCCATGANONE 
J075160H17AGCCCATGANONE 
J075166H17AGCCCATGANONE 
J080310F11AGCCCATGANONE 
J080315P11AGCCCATGANONE 
J090025A22AGCCCATGANONE 
Os07g0164500J013094M18TCAGGCCCATGGGCTNONE 
J013153L05TCAGGCCCATGGGCTNONE 
J023011J18TCAGGCCCATGGGCTNONE 
J023106H21TCAGGCCCATGGGCTNONE 
J033105F10TCAGGCCCATGGGCTNONE 
J065210M20TCAGGCCCATGGGCTSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05TCAGGCCCATGGGCTNONE 
J090061C13TCAGGCCCATGGGCTNONE 
J090074K15TCAGGCCCATGGGCTNONE 
Os07g0191700AK066389CCAAGCCCATGSimilar to AT.I.24-9 protein (Fragment). 
AK103768CCAAGCCCATGNONE 
Os07g0247000AK072232TCAGCCCATGPectinesterase inhibitor domain containing protein. 
AK099091TCAGCCCATGNONE 
Os07g0290800AK071498GCAGCCCATGGCCGAAAAAGCCCAACTic22-like family protein. 
J075099P10GCAGCCCATGGCCGAAAAAGCCCAACNONE 
Os07g0481100003-130-F04ACAGCCCATGTNONE 
AK062302ACAGCCCATGTProtein of unknown function DUF315 domain containing protein. 
J090048K21ACAGCCCATGTNONE 
Os07g0498300009-045-C02CCATGGGCTTCNONE 
009-045-C02TTTCGGCCCATGGGCTTTTNONE 
009-060-A09CCATGGGCTTCNONE 
009-060-A09TTTCGGCCCATGGGCTTTTNONE 
009-121-C04CCATGGGCTTCNONE 
009-121-C04TTTCGGCCCATGGGCTTTTNONE 
009-157-G09CCATGGGCTTCNONE 
009-157-G09TTTCGGCCCATGGGCTTTTNONE 
009-197-B02CCATGGGCTTCNONE 
009-197-B02TTTCGGCCCATGGGCTTTTNONE 
AK059124CCATGGGCTTCConserved hypothetical protein. 
AK059124TTTCGGCCCATGGGCTTTTConserved hypothetical protein. 
AK119800CCATGGGCTTCNONE 
AK119800TTTCGGCCCATGGGCTTTTNONE 
J065184M18CCATGGGCTTCNONE 
J065184M18TTTCGGCCCATGGGCTTTTNONE 
J075009G21CCATGGGCTTCNONE 
J075009G21TTTCGGCCCATGGGCTTTTNONE 
J075013O03CCATGGGCTTCNONE 
J075013O03TTTCGGCCCATGGGCTTTTNONE 
J075061C22CCATGGGCTTCNONE 
J075061C22TTTCGGCCCATGGGCTTTTNONE 
J075094E12CCATGGGCTTCNONE 
J075094E12TTTCGGCCCATGGGCTTTTNONE 
J075148C01CCATGGGCTTCNONE 
J075148C01TTTCGGCCCATGGGCTTTTNONE 
Os07g0516200AK061373ACATGGGCTTCSimilar to Endoribonuclease, L-PSP family. 
Os07g0530700AK060014CCATGGGCTTCNONE 
AK099533CCATGGGCTTCConserved hypothetical protein. 
Os07g0558000AK069272ACATGGGCTTANONE 
AK101867ACATGGGCTTAABC-1 domain containing protein. 
Os07g0558800AK100986CAAGCCCATGAMajor sperm protein domain containing protein. 
Os07g0568100AK099778AGCCCATGGGCCGASimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0641600AK068478AGCCCATGASAM (and some other nucleotide) binding motif domain containing protein. 
AK073802AGCCCATGANONE 
Os07g0673100AK060100TCATGGGCTNONE 
AK103678TCATGGGCTRibosomal protein S8E family protein. 
AK104794TCATGGGCTNONE 
Os07g0683200013-007-C05AGCCCATGNONE 
013-065-B12AGCCCATGNONE 
AK068606AGCCCATGSimilar to OsNAC6 protein. 
J013157G23AGCCCATGNONE 
J065027I23AGCCCATGNONE 
J065030M02AGCCCATGNONE 
J065056J02AGCCCATGNONE 
J065124H04AGCCCATGNONE 
J065142K03AGCCCATGNONE 
J065142M16AGCCCATGNONE 
J065201J05AGCCCATGNONE 
J065215H19AGCCCATGNONE 
J075195N15AGCCCATGNONE 
J090073O17AGCCCATGNONE 
J100069P10AGCCCATGNONE 
Os07g0686600AK108527CATGGGCTVQ domain containing protein. 
Os07g0688100AK101635TCATGGGCTTCProtein prenyltransferase domain containing protein. 
J033055B02TCATGGGCTTCNONE 
J090013O08TCATGGGCTTCNONE 
J090074A17TCATGGGCTTCNONE 
Os07g0691100AK071728TCATGGGCTGASimilar to Pectin methylesterase 6 (Fragment). 
J023108P03TCATGGGCTGANONE 
J023112F11TCATGGGCTGANONE 
J023143A10TCATGGGCTGANONE 
Os08g0139000009-092-A05TCAGCCCATGANONE 
009-150-B08TCAGCCCATGANONE 
AK070704TCAGCCCATGANONE 
AK119802TCAGCCCATGASimilar to RNA-binding glycine rich protein (RGP-2). 
J023024E19TCAGCCCATGANONE 
J023056N10TCAGCCCATGANONE 
J065028B04TCAGCCCATGANONE 
J065119H20TCAGCCCATGANONE 
J065121E01TCAGCCCATGANONE 
J065139C18TCAGCCCATGANONE 
J065160O15TCAGCCCATGANONE 
J065211A15TCAGCCCATGANONE 
J090038G23TCAGCCCATGANONE 
J100024D11TCAGCCCATGANONE 
J100032C04TCAGCCCATGANONE 
J100038G14TCAGCCCATGANONE 
J100051E19TCAGCCCATGANONE 
Os08g0156900AJ605583AAAGCCCATGTNONE 
AK073344AAAGCCCATGTSpo11/DNA topoisomerase VI, subunit A family protein. 
AK106397AAAGCCCATGTNONE 
Os08g0192900AK103422AGTGGGCCAGCCCATGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645AGTGGGCCAGCCCATGANONE 
Os08g0260600AK108529CCCAGCCCATGCCCATGTCD9/CD37/CD63 antigen family protein. 
Os08g0270200AK101221CCATGGGCTGGExosome-associated family protein. 
J090067H03CCATGGGCTGGNONE 
Os08g0322400AK120116TGGTGGGCTGCATGGGCTGCNucleotide-binding, alpha-beta plait domain containing protein. 
J013025M20TGGTGGGCTGCATGGGCTGCNONE 
J013096J15TGGTGGGCTGCATGGGCTGCNONE 
Os08g0346400003-103-D08ACATGGGCTTTTNONE 
009-135-G12ACATGGGCTTTTNONE 
AK059644ACATGGGCTTTTNONE 
AK062928ACATGGGCTTTTNONE 
AK103873ACATGGGCTTTTSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
J033149L11ACATGGGCTTTTNONE 
J065137E08ACATGGGCTTTTNONE 
J065194M22ACATGGGCTTTTNONE 
J075083O16ACATGGGCTTTTNONE 
Os08g0435800AK121712ACATGGGCTGGSimilar to Lipoate protein ligase-like protein. 
J065121P15ACATGGGCTGGNONE 
Os08g0504400014-015-C10CCAAGCCCATGGGCCCTNONE 
AK069190CCAAGCCCATGGGCCCTSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089CCAAGCCCATGGGCCCTNONE 
J023006O19CCAAGCCCATGGGCCCTNONE 
J033041C11CCAAGCCCATGGGCCCTNONE 
Os08g0515800006-067-C11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
009-131-F05AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
016-026-E03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
AK061787AGCCCATGGGCCTTATCTCGGCCCAAGMitochodrial transcription termination factor-related family protein. 
J013032E15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J013032E16AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J033140O22AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065058M21AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065090D03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065115G12AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065124N11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100021K19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100035P15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100043J19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
Os08g0521400006-047-C11TAAGCCCATGGNONE 
016-014-E07TAAGCCCATGGNONE 
AK070148TAAGCCCATGGNONE 
AK101704TAAGCCCATGGZinc finger, RanBP2-type domain containing protein. 
AK105045TAAGCCCATGGNONE 
J013108K14TAAGCCCATGGNONE 
J013129E16TAAGCCCATGGNONE 
J013159M23TAAGCCCATGGNONE 
J023041G22TAAGCCCATGGNONE 
J033060G13TAAGCCCATGGNONE 
J033060J15TAAGCCCATGGNONE 
J065120J24TAAGCCCATGGNONE 
J065160I01TAAGCCCATGGNONE 
J065179A16TAAGCCCATGGNONE 
J065189K04TAAGCCCATGGNONE 
J090032O15TAAGCCCATGGNONE 
J090045A18TAAGCCCATGGNONE 
J090060B21TAAGCCCATGGNONE 
J090086F23TAAGCCCATGGNONE 
J090098O22TAAGCCCATGGNONE 
J100018K20TAAGCCCATGGNONE 
J100048P22TAAGCCCATGGNONE 
J100052I06TAAGCCCATGGNONE 
Os08g0548900006-043-D07CCATGGGCTTTNONE 
006-043-H11CCATGGGCTTTNONE 
006-081-G06CCATGGGCTTTNONE 
006-109-E04CCATGGGCTTTNONE 
011-033-E04CCATGGGCTTTNONE 
AK061808CCATGGGCTTTSimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK098875CCATGGGCTTTNONE 
J013001D12CCATGGGCTTTNONE 
J033126N14CCATGGGCTTTNONE 
J053069M09CCATGGGCTTTNONE 
J053098E10CCATGGGCTTTNONE 
J053101C24CCATGGGCTTTNONE 
J065002F21CCATGGGCTTTNONE 
J065006C22CCATGGGCTTTNONE 
J065076J02CCATGGGCTTTNONE 
J065134M22CCATGGGCTTTNONE 
J075007M19CCATGGGCTTTNONE 
J075040I11CCATGGGCTTTNONE 
J075047E20CCATGGGCTTTNONE 
J075052D22CCATGGGCTTTNONE 
J075076L13CCATGGGCTTTNONE 
J075157P22CCATGGGCTTTNONE 
J075161M18CCATGGGCTTTNONE 
J075168P22CCATGGGCTTTNONE 
J075181E04CCATGGGCTTTNONE 
U92540CCATGGGCTTTNONE 
Os08g0553450Os08g0553450GAAGCCCATGAHypothetical protein. 
Os08g0557000AK059917AGCCCATGGNONE 
AK100496AGCCCATGGSimilar to Protein-L-isoaspartate O-methyltransferase. 
Os09g0251800006-100-E12AGCCCATGGCCCATGGNONE 
AK061218AGCCCATGGCCCATGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010AGCCCATGGCCCATGGNONE 
J065048A02AGCCCATGGCCCATGGNONE 
J065073P10AGCCCATGGCCCATGGNONE 
J065075B09AGCCCATGGCCCATGGNONE 
J065112B05AGCCCATGGCCCATGGNONE 
J090014H10AGCCCATGGCCCATGGNONE 
Os09g0397900AK101306AGGGCCCATGGGCTSimilar to FEG protein. 
Os09g0498100015-046-G11TTGGCCCATGGGCTAAAGCCCAGNONE 
AK064108TTGGCCCATGGGCTAAAGCCCAGSimilar to 30S ribosomal protein S16. 
J065040H21TTGGCCCATGGGCTAAAGCCCAGNONE 
J065062F05TTGGCCCATGGGCTAAAGCCCAGNONE 
J065147B17TTGGCCCATGGGCTAAAGCCCAGNONE 
J075098J22TTGGCCCATGGGCTAAAGCCCAGNONE 
Os09g0532600J013002F02TTTGGGCCAAGCCCATGTNONE 
Os09g0532800J065167K16CCAAGCCCATGTProtein prenyltransferase domain containing protein. 
Os09g0547200016-021-H03CAAGCCCATGNONE 
AK073078CAAGCCCATGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984CAAGCCCATGNONE 
J065005L05CAAGCCCATGNONE 
J065039C06CAAGCCCATGNONE 
J065116H17CAAGCCCATGNONE 
J100046A17CAAGCCCATGNONE 
Os09g0548100009-134-B12AGCCCATGGNONE 
AK062925AGCCCATGGHypothetical protein. 
Os11g0100100009-122-C12ACATGGGCTGGGCTSimilar to Gamma-aminobutyric acid receptor-associated protein-like 2 (GABA(A) receptor-associated protein-like 2) (Ganglioside expression factor 2) (GEF-2) (General protein transport factor p16) (MAP1 light chain 3 related protein). 
Os11g0146700AK065900AGCCCATGTNONE 
AK072412AGCCCATGTRED-like, C-terminal family protein. 
Os11g0169600J075003I07AGCCCATGGNONE 
J100025P12AGCCCATGGNONE 
J100056P17AGCCCATGGNONE 
J100073F05AGCCCATGGNONE 
J100084H07AGCCCATGGNONE 
J100085M11AGCCCATGGConserved hypothetical protein. 
Os11g0175500015-087-F02TCAGGCCCATGAAAGCCCATGTNONE 
AK064320TCAGGCCCATGAAAGCCCATGTZinc finger, RING-type domain containing protein. 
AK101592TCAGGCCCATGAAAGCCCATGTNONE 
Os11g0187500012-002-D06TCATGGGCTATGGCCCACGTNONE 
012-035-H04TCATGGGCTATGGCCCACGTNONE 
012-065-F08TCATGGGCTATGGCCCACGTNONE 
AK063977TCATGGGCTATGGCCCACGTSimilar to Heat shock protein 70. 
AK103083TCATGGGCTATGGCCCACGTNONE 
J033118G15TCATGGGCTATGGCCCACGTNONE 
J065115E02TCATGGGCTATGGCCCACGTNONE 
J065178K04TCATGGGCTATGGCCCACGTNONE 
J065178L03TCATGGGCTATGGCCCACGTNONE 
J090064A22TCATGGGCTATGGCCCACGTNONE 
Os11g0414000012-012-F01AGCCCATGNONE 
AK071277AGCCCATGeIF4-gamma/eIF5/eIF2-epsilon domain containing protein. 
J023082M08AGCCCATGNONE 
J023083E17AGCCCATGNONE 
J023128I07AGCCCATGNONE 
J033098J04AGCCCATGNONE 
J033135G10AGCCCATGNONE 
J043007L23AGCCCATGNONE 
J065011N07AGCCCATGNONE 
J065016E01AGCCCATGNONE 
J065162N12AGCCCATGNONE 
J065164O22AGCCCATGNONE 
J065173J06AGCCCATGNONE 
J065200E24AGCCCATGNONE 
J065203K20AGCCCATGNONE 
J075033N16AGCCCATGNONE 
J075047L06AGCCCATGNONE 
J075064J24AGCCCATGNONE 
J075100O07AGCCCATGNONE 
J075121G11AGCCCATGNONE 
J075134A13AGCCCATGNONE 
J075190F20AGCCCATGNONE 
J075190H08AGCCCATGNONE 
J080033L04AGCCCATGNONE 
J080045O09AGCCCATGNONE 
J080064J07AGCCCATGNONE 
J080066N22AGCCCATGNONE 
J080075C09AGCCCATGNONE 
J090002C08AGCCCATGNONE 
J090058G21AGCCCATGNONE 
J090074M07AGCCCATGNONE 
J100090G06AGCCCATGNONE 
Os11g0423200AK111297ACAGCCCATGGHypothetical protein. 
Os11g0543100AK108274ACATGGGCTTTTConserved hypothetical protein. 
Os11g0582400AF049348AGCCCATGGConserved hypothetical protein. 
AF516927AGCCCATGGNONE 
AK073083AGCCCATGGNONE 
AK108352AGCCCATGGNONE 
J075005O16AGCCCATGGNONE 
J075007D15AGCCCATGGNONE 
J075007L04AGCCCATGGNONE 
J075009C11AGCCCATGGNONE 
J075012L11AGCCCATGGNONE 
J075013A14AGCCCATGGNONE 
J075015K01AGCCCATGGNONE 
J075019O21AGCCCATGGNONE 
J075020G20AGCCCATGGNONE 
J075020H06AGCCCATGGNONE 
J075022D07AGCCCATGGNONE 
J075024M12AGCCCATGGNONE 
J075025G04AGCCCATGGNONE 
J075026F09AGCCCATGGNONE 
J075027D19AGCCCATGGNONE 
J075030A12AGCCCATGGNONE 
J075030C16AGCCCATGGNONE 
J075030D15AGCCCATGGNONE 
J075034M20AGCCCATGGNONE 
J075041H12AGCCCATGGNONE 
J075052D12AGCCCATGGNONE 
J075052G11AGCCCATGGNONE 
J075053L09AGCCCATGGNONE 
J075064G05AGCCCATGGNONE 
J075067J01AGCCCATGGNONE 
J075071O03AGCCCATGGNONE 
J075072G12AGCCCATGGNONE 
J075078H06AGCCCATGGNONE 
J075081D06AGCCCATGGNONE 
J075084G23AGCCCATGGNONE 
J075085M10AGCCCATGGNONE 
J075087N20AGCCCATGGNONE 
J075088E11AGCCCATGGNONE 
J075088O22AGCCCATGGNONE 
J075091E10AGCCCATGGNONE 
J075092B12AGCCCATGGNONE 
J075093E08AGCCCATGGNONE 
J075095D04AGCCCATGGNONE 
J075095J10AGCCCATGGNONE 
J075095O19AGCCCATGGNONE 
J075096H20AGCCCATGGNONE 
J075098F10AGCCCATGGNONE 
J075100H10AGCCCATGGNONE 
J075104C23AGCCCATGGNONE 
J075105B10AGCCCATGGNONE 
J075106I24AGCCCATGGNONE 
J075109H23AGCCCATGGNONE 
J075115A03AGCCCATGGNONE 
J075118M06AGCCCATGGNONE 
J075121G08AGCCCATGGNONE 
J075122C09AGCCCATGGNONE 
J075122J12AGCCCATGGNONE 
J075123E06AGCCCATGGNONE 
J075123E16AGCCCATGGNONE 
J075124N09AGCCCATGGNONE 
J075127F23AGCCCATGGNONE 
J075128H17AGCCCATGGNONE 
J075129C02AGCCCATGGNONE 
J075139P18AGCCCATGGNONE 
J075140H17AGCCCATGGNONE 
J075146E12AGCCCATGGNONE 
J075146I07AGCCCATGGNONE 
J075150A08AGCCCATGGNONE 
J075150I22AGCCCATGGNONE 
J075155D01AGCCCATGGNONE 
J075155N10AGCCCATGGNONE 
J075155O09AGCCCATGGNONE 
J075156K11AGCCCATGGNONE 
J075157N01AGCCCATGGNONE 
J075164L09AGCCCATGGNONE 
J075166F14AGCCCATGGNONE 
J075169E20AGCCCATGGNONE 
J075170B13AGCCCATGGNONE 
J075170F24AGCCCATGGNONE 
J075170N16AGCCCATGGNONE 
J075172H22AGCCCATGGNONE 
J075172I02AGCCCATGGNONE 
J075176E08AGCCCATGGNONE 
J075177H17AGCCCATGGNONE 
J075179C18AGCCCATGGNONE 
J075182H23AGCCCATGGNONE 
J075187B10AGCCCATGGNONE 
J075192L10AGCCCATGGNONE 
J075195C04AGCCCATGGNONE 
U25969AGCCCATGGNONE 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os11g0634200AK066700CCATGGGCTGTConserved hypothetical protein. 
J013073J21CCATGGGCTGTNONE 
Os11g0657200AK059959TCATGGGCTTT2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07AAAGCCCATGANONE 
AK062752AAAGCCCATGASimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0660000AK066709CATGGGCTSodium/calcium exchanger membrane region domain containing protein. 
J013074O18CATGGGCTNONE 
J023081H12CATGGGCTNONE 
J065072E24CATGGGCTNONE 
J065186K08CATGGGCTNONE 
J075079E19CATGGGCTNONE 
J075093J05CATGGGCTNONE 
J075124I21CATGGGCTNONE 
J075187F09CATGGGCTNONE 
J090037O16CATGGGCTNONE 
Os12g0100050Os12g0100050ACATGGGCTGGGCTGGGCTGGGCTLight chain 3 (LC3) family protein. 
Os12g0100100006-036-G03AGCCCAGCCCAGCCCAGCCCATGTNONE 
AK061492AGCCCAGCCCAGCCCAGCCCATGTSimilar to ALY protein. 
AK068452AGCCCAGCCCAGCCCAGCCCATGTNONE 
J013153E18AGCCCAGCCCAGCCCAGCCCATGTNONE 
J033140D06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065046A19AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065061F08AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065101I03AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065158B05AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065162H06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065195I23AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065218E07AGCCCAGCCCAGCCCAGCCCATGTNONE 
Os12g0193800AK111754CCATGGGCTGGGCConserved hypothetical protein. 
Os12g0489400AK062351CATGGGCTTGHypothetical protein. 
Os12g0597500AK101904CCAGCCCATGGGCCTCNONE 
AK103799CCAGCCCATGGGCCTCAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CCAGCCCATGGGCCTCNONE 
J100078O15CCAGCCCATGGGCCTCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.