version

Summary of OsREG468 (All List)

OrganismOryza sativa  
IDOsREG468  
SequenceAGCCGTCC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count979  

Entry Sequences (979 entries)

LocusGene modelSequenceDescription
Os01g0141600016-051-A03GATCGGACGGCTNONE 
016-051-A03GATCGGACGGCTNONE 
AK066922GATCGGACGGCTProtein of unknown function DUF647 family protein. 
AK066922GATCGGACGGCTProtein of unknown function DUF647 family protein. 
Os01g0238500006-086-E04GGACGGCTNONE 
AK067076GGACGGCTSimilar to Branched-chain-amino-acid aminotransferase-like protein 3, chloroplast precursor. 
AK104302GGACGGCTNONE 
J013093D15GGACGGCTNONE 
J065038O05GGACGGCTNONE 
J075089I20GGACGGCTNONE 
J075122B01GGACGGCTNONE 
J090086G20GGACGGCTNONE 
Os01g0283700AK107149AGCCGTCCGSimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44). 
Os01g0347100AK100716CGGATCGGACGGCTProtein of unknown function DUF1399 family protein. 
Os01g0348700009-125-H02AGCCGTCCNONE 
009-156-F08AGCCGTCCNONE 
009-177-A11AGCCGTCCNONE 
009-195-D02AGCCGTCCNONE 
013-040-B06AGCCGTCCNONE 
013-051-B09AGCCGTCCNONE 
AK120842AGCCGTCCSimilar to 60S ribosomal protein L23a (L25). 
J013071O22AGCCGTCCNONE 
J023022J07AGCCGTCCNONE 
J033028J08AGCCGTCCNONE 
J033109M11AGCCGTCCNONE 
J043022K15AGCCGTCCNONE 
J043031N11AGCCGTCCNONE 
J053023I10AGCCGTCCNONE 
J053045F16AGCCGTCCNONE 
J053054F22AGCCGTCCNONE 
J053094P15AGCCGTCCNONE 
J065048F01AGCCGTCCNONE 
J075012F16AGCCGTCCNONE 
J075089C09AGCCGTCCNONE 
J075179J20AGCCGTCCNONE 
J080305E19AGCCGTCCNONE 
J080309B21AGCCGTCCNONE 
J090017L05AGCCGTCCNONE 
J090058B11AGCCGTCCNONE 
Os01g0364900AK121145TCGGACGGCTConserved hypothetical protein. 
J023078A10TCGGACGGCTNONE 
Os01g0506100AK102377ATCGGACGGCTGlobin-like family protein. 
AK109825ATCGGACGGCTNONE 
Os01g0513800012-032-E11AGCCGTCCGATNONE 
AK100776AGCCGTCCGATSimilar to Brix domain containing protein 1 homolog. 
J023120C10AGCCGTCCGATNONE 
J033044A22AGCCGTCCGATNONE 
J033048H13AGCCGTCCGATNONE 
J033118F03AGCCGTCCGATNONE 
J065176B05AGCCGTCCGATNONE 
J075026B19AGCCGTCCGATNONE 
J075048I23AGCCGTCCGATNONE 
J075141A19AGCCGTCCGATNONE 
J075148E05AGCCGTCCGATNONE 
J090031M12AGCCGTCCGATNONE 
Os01g0525000015-038-B04GGACGGCTNONE 
AK064104GGACGGCTConserved hypothetical protein. 
Os01g0594300011-073-B12AGCCGTCCNONE 
012-007-E02AGCCGTCCNONE 
015-011-F11AGCCGTCCNONE 
AK105266AGCCGTCCPistil-specific extensin-like protein family protein. 
AK105670AGCCGTCCNONE 
Os01g0693900AK066034AGCCGTCCGATCNONE 
AK099894AGCCGTCCGATCPeptidyl-tRNA hydrolase family protein. 
J065165G19AGCCGTCCGATCNONE 
J100042C04AGCCGTCCGATCNONE 
Os01g0731800AK121474TCGGACGGCTRINGv domain containing protein. 
J023148N13TCGGACGGCTNONE 
J065136G08TCGGACGGCTNONE 
Os01g0732200015-078-D03GATCGGACGGCTNONE 
AK067563GATCGGACGGCTGTP-binding protein, HSR1-related domain containing protein. 
J013111I12GATCGGACGGCTNONE 
J033113N16GATCGGACGGCTNONE 
J033124C05GATCGGACGGCTNONE 
Os01g0766200AK069471AGCCGTCCGZinc finger, RING-type domain containing protein. 
AK070278AGCCGTCCGNONE 
J013074F08AGCCGTCCGNONE 
J023023M16AGCCGTCCGNONE 
J023049F08AGCCGTCCGNONE 
J065061D21AGCCGTCCGNONE 
J100083B13AGCCGTCCGNONE 
Os01g0784600AK067527GGACGGCTConserved hypothetical protein. 
Os01g0816700AK100654AGCCGTCCSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase). 
Os01g0835500AK100241AGCCGTCCGSimilar to Respiratory burst oxidase protein. 
Os01g0843700J065093C02AGCCGTCCConserved hypothetical protein. 
J065207M23AGCCGTCCNONE 
Os01g0846300AK065949GGACGGCTSimilar to Protein phosphatase 2C. 
Os01g0866200009-039-E12AGCCGTCCNONE 
J065059P16AGCCGTCCNONE 
J065063E21AGCCGTCCNONE 
J065078B21AGCCGTCCNONE 
J065079A11AGCCGTCCNONE 
J065087H15AGCCGTCCNONE 
J065137M10AGCCGTCCNONE 
J065138K24AGCCGTCCNONE 
J065142E08AGCCGTCCNONE 
J065171G11AGCCGTCCNONE 
J065183K15AGCCGTCCNONE 
J065192J05AGCCGTCCNONE 
J075151P09AGCCGTCCNONE 
J090020B17AGCCGTCCNONE 
J090067F15AGCCGTCCNONE 
J090070K06AGCCGTCCNONE 
J090094G13AGCCGTCCNONE 
J100081M20AGCCGTCCHistone H3. 
J100089D06AGCCGTCCNONE 
Os01g0866300006-087-C06AGCCGTCCNONE 
006-114-E01AGCCGTCCNONE 
J065202L13AGCCGTCCNONE 
Os01g0896800AK065268AGCCGTCCGATCNONE 
AK104693AGCCGTCCGATCEukaryotic ribosomal protein L5 family protein. 
J013126P09AGCCGTCCGATCNONE 
J033046N15AGCCGTCCGATCNONE 
J090008K02AGCCGTCCGATCNONE 
J090024F15AGCCGTCCGATCNONE 
J090074I23AGCCGTCCGATCNONE 
J090093F03AGCCGTCCGATCNONE 
J090096N02AGCCGTCCGATCNONE 
Os01g0904200AK068432GGACGGCTCGGProtein kinase-like domain containing protein. 
J100027C22GGACGGCTCGGNONE 
J100064A19GGACGGCTCGGNONE 
Os01g0908100AK072293AGCCGTCCRabGAP/TBC domain containing protein. 
J065010B13AGCCGTCCNONE 
J065010M12AGCCGTCCNONE 
J065047C19AGCCGTCCNONE 
J065069B18AGCCGTCCNONE 
J065071K24AGCCGTCCNONE 
J065142P04AGCCGTCCNONE 
J065170E11AGCCGTCCNONE 
Os01g0927000AK106700AGCCGTCCGATCSimilar to SET domain-containing protein SET118. 
Os01g0963600006-037-F11AGCCGTCCNONE 
006-049-E01AGCCGTCCNONE 
006-115-A02AGCCGTCCNONE 
AK060804AGCCGTCCABA/WDS induced protein family protein. 
AK065858AGCCGTCCNONE 
AK104613AGCCGTCCNONE 
J013041E22AGCCGTCCNONE 
Os02g0100800009-070-H03GGACGGCTNONE 
AK062555GGACGGCTHypothetical protein. 
Os02g0193900AK069578AGCCGTCCConserved hypothetical protein. 
AK104014AGCCGTCCNONE 
J080308C08AGCCGTCCNONE 
J090043C09AGCCGTCCNONE 
Os02g0216200AK108648AGCCGTCCGATCHypothetical protein. 
Os02g0287000006-107-B10AGCCGTCCGATCNONE 
006-120-E07AGCCGTCCGATCNONE 
AF052503AGCCGTCCGATCNONE 
AK059647AGCCGTCCGATCSimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK099131AGCCGTCCGATCNONE 
J023048M05AGCCGTCCGATCNONE 
J033107L10AGCCGTCCGATCNONE 
J065019A12AGCCGTCCGATCNONE 
J065064J21AGCCGTCCGATCNONE 
J065071D15AGCCGTCCGATCNONE 
J065094L12AGCCGTCCGATCNONE 
J065095L06AGCCGTCCGATCNONE 
J065097J11AGCCGTCCGATCNONE 
J065099M08AGCCGTCCGATCNONE 
J065104D01AGCCGTCCGATCNONE 
J065107L02AGCCGTCCGATCNONE 
J065110D14AGCCGTCCGATCNONE 
J065135J07AGCCGTCCGATCNONE 
J065137C16AGCCGTCCGATCNONE 
J065150C07AGCCGTCCGATCNONE 
J065165I10AGCCGTCCGATCNONE 
J065189F07AGCCGTCCGATCNONE 
J065205L22AGCCGTCCGATCNONE 
J065214C09AGCCGTCCGATCNONE 
J065217G17AGCCGTCCGATCNONE 
J075029E17AGCCGTCCGATCNONE 
J075054O16AGCCGTCCGATCNONE 
J075068N23AGCCGTCCGATCNONE 
J075135N18AGCCGTCCGATCNONE 
J075152G09AGCCGTCCGATCNONE 
J075162D10AGCCGTCCGATCNONE 
J075164F11AGCCGTCCGATCNONE 
J080036L12AGCCGTCCGATCNONE 
J080049K18AGCCGTCCGATCNONE 
J080060P03AGCCGTCCGATCNONE 
J080062G16AGCCGTCCGATCNONE 
J080062G21AGCCGTCCGATCNONE 
J080064N07AGCCGTCCGATCNONE 
J080075I22AGCCGTCCGATCNONE 
J080086F20AGCCGTCCGATCNONE 
J080087G07AGCCGTCCGATCNONE 
J080088I06AGCCGTCCGATCNONE 
J080302B20AGCCGTCCGATCNONE 
J080303L14AGCCGTCCGATCNONE 
J080309O12AGCCGTCCGATCNONE 
J080317F12AGCCGTCCGATCNONE 
J080317P18AGCCGTCCGATCNONE 
J090013L15AGCCGTCCGATCNONE 
J090043N04AGCCGTCCGATCNONE 
J090085G01AGCCGTCCGATCNONE 
J090085G19AGCCGTCCGATCNONE 
Os02g0324700006-086-H07AGCCGTCCNONE 
006-106-G09AGCCGTCCNONE 
AK060405AGCCGTCCConserved hypothetical protein. 
AK104437AGCCGTCCNONE 
Os02g0435000AK060832AGCCGTCCNONE 
AK102414AGCCGTCCTranslocation protein Sec62 family protein. 
Os02g0593700AK060817AGCCGTCCNONE 
Os02g0622400005-010-C04AGCCGTCCGATCNONE 
AK061679AGCCGTCCGATCConserved hypothetical protein. 
J013058H01AGCCGTCCGATCNONE 
J013095D07AGCCGTCCGATCNONE 
J023054G05AGCCGTCCGATCNONE 
J023093A17AGCCGTCCGATCNONE 
J023146P16AGCCGTCCGATCNONE 
J033089D16AGCCGTCCGATCNONE 
J033099G12AGCCGTCCGATCNONE 
J033131N10AGCCGTCCGATCNONE 
J053073J04AGCCGTCCGATCNONE 
J053074P03AGCCGTCCGATCNONE 
J053075M06AGCCGTCCGATCNONE 
J053088K13AGCCGTCCGATCNONE 
J090039F18AGCCGTCCGATCNONE 
J090045M03AGCCGTCCGATCNONE 
Os02g0717600J090003H19CCCCCGCGACGCGGATCGGACGGCTNONE 
J100090A12CCCCCGCGACGCGGATCGGACGGCTConserved hypothetical protein. 
Os02g0754300009-048-D05AGCCGTCCGATNONE 
AK059012AGCCGTCCGATNONE 
AK068621AGCCGTCCGATNONE 
AK099805AGCCGTCCGATRibosomal protein L29 family protein. 
J065102P04AGCCGTCCGATNONE 
J065161I03AGCCGTCCGATNONE 
Os02g0764700AK107146AGCCGTCCSimilar to Ethylene-responsive transcription factor 4 (Ethylene-responsive element binding factor 4) (Related to APETALA-2 protein 5) (EREBP-4) (AtERF4). 
J075062H22AGCCGTCCNONE 
J090073I18AGCCGTCCNONE 
Os02g0777800AK066978AGCCGTCCGSimilar to Avr9/Cf-9 induced kinase 1. 
Os03g0111600AK101020AGCCGTCCGATCCCCACGTProtein of unknown function DUF1618 domain containing protein. 
J023149K08AGCCGTCCGATCCCCACGTNONE 
J033042K17AGCCGTCCGATCCCCACGTNONE 
J033073E05AGCCGTCCGATCCCCACGTNONE 
J043032K02AGCCGTCCGATCCCCACGTNONE 
J090009D04AGCCGTCCGATCCCCACGTNONE 
J090037M16AGCCGTCCGATCCCCACGTNONE 
Os03g0136200004-011-E10AGCCGTCCGATCNONE 
006-067-A08AGCCGTCCGATCNONE 
011-007-E02AGCCGTCCGATCNONE 
011-099-H10AGCCGTCCGATCNONE 
012-044-D08AGCCGTCCGATCNONE 
013-045-G12AGCCGTCCGATCNONE 
013-062-C09AGCCGTCCGATCNONE 
013-072-F09AGCCGTCCGATCNONE 
013-085-B12AGCCGTCCGATCNONE 
013-097-E09AGCCGTCCGATCNONE 
013-097-F09AGCCGTCCGATCNONE 
014-013-C09AGCCGTCCGATCNONE 
014-082-D08AGCCGTCCGATCNONE 
015-071-A09AGCCGTCCGATCNONE 
AF042333AGCCGTCCGATCNONE 
AK060887AGCCGTCCGATCNONE 
AK121681AGCCGTCCGATC24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2). 
J013073N14AGCCGTCCGATCNONE 
J013123F01AGCCGTCCGATCNONE 
J023050A02AGCCGTCCGATCNONE 
J033046H22AGCCGTCCGATCNONE 
J033070A11AGCCGTCCGATCNONE 
J065059G11AGCCGTCCGATCNONE 
J065068F10AGCCGTCCGATCNONE 
J065164A10AGCCGTCCGATCNONE 
J075031F07AGCCGTCCGATCNONE 
J075054J01AGCCGTCCGATCNONE 
J075086M04AGCCGTCCGATCNONE 
J075118K23AGCCGTCCGATCNONE 
J075122A09AGCCGTCCGATCNONE 
J075123D06AGCCGTCCGATCNONE 
J075129A22AGCCGTCCGATCNONE 
J075161E07AGCCGTCCGATCNONE 
J075179H04AGCCGTCCGATCNONE 
J075181C06AGCCGTCCGATCNONE 
J075186A12AGCCGTCCGATCNONE 
J090014H16AGCCGTCCGATCNONE 
J090045G17AGCCGTCCGATCNONE 
J090048B09AGCCGTCCGATCNONE 
J090052J23AGCCGTCCGATCNONE 
J090052K22AGCCGTCCGATCNONE 
J090059F10AGCCGTCCGATCNONE 
J090080F19AGCCGTCCGATCNONE 
J100039J08AGCCGTCCGATCNONE 
J100044K02AGCCGTCCGATCNONE 
J100051E16AGCCGTCCGATCNONE 
J100053F08AGCCGTCCGATCNONE 
J100056F07AGCCGTCCGATCNONE 
J100058A10AGCCGTCCGATCNONE 
Os03g0160900J065071D24ATCGGACGGCTNONE 
J065132L03ATCGGACGGCTHypothetical protein. 
J075189L19ATCGGACGGCTNONE 
Os03g0161000AK121425CACTGACAGGTGGGCCGGGGACGGCTNONE 
J023135K12CACTGACAGGTGGGCCGGGGACGGCTNONE 
Os03g0177100AK068092AGCCGTCCGATCConserved hypothetical protein. 
J100036F01AGCCGTCCGATCNONE 
J100040N06AGCCGTCCGATCNONE 
J100043E08AGCCGTCCGATCNONE 
Os03g0178400AK108257CGGACGGCTEpoxide hydrolase family protein. 
Os03g0200400AK107086AGCCGTCCGConserved hypothetical protein. 
Os03g0200500005-016-A06AGCCGTCCNONE 
AK069251AGCCGTCC40S ribosomal protein S3a (CYC07 protein). 
AK104243AGCCGTCCNONE 
AK104699AGCCGTCCNONE 
D26060AGCCGTCCNONE 
J013024H20AGCCGTCCNONE 
J013029C14AGCCGTCCNONE 
J013035O17AGCCGTCCNONE 
J013066B11AGCCGTCCNONE 
J013066B12AGCCGTCCNONE 
J013066B13AGCCGTCCNONE 
J013152M04AGCCGTCCNONE 
J023001A03AGCCGTCCNONE 
J023013H23AGCCGTCCNONE 
J023042L07AGCCGTCCNONE 
J023081L11AGCCGTCCNONE 
J023088I23AGCCGTCCNONE 
J023092N22AGCCGTCCNONE 
J023126A20AGCCGTCCNONE 
J023139A17AGCCGTCCNONE 
J023150G12AGCCGTCCNONE 
J033026M10AGCCGTCCNONE 
J033031H24AGCCGTCCNONE 
J033036C22AGCCGTCCNONE 
J033037P08AGCCGTCCNONE 
J033045G14AGCCGTCCNONE 
J033048A13AGCCGTCCNONE 
J033048B13AGCCGTCCNONE 
J033048K11AGCCGTCCNONE 
J033066A06AGCCGTCCNONE 
J033072H01AGCCGTCCNONE 
J033082K07AGCCGTCCNONE 
J033091G20AGCCGTCCNONE 
J033095C14AGCCGTCCNONE 
J033101N24AGCCGTCCNONE 
J033105L15AGCCGTCCNONE 
J033107J18AGCCGTCCNONE 
J033112L02AGCCGTCCNONE 
J033117I17AGCCGTCCNONE 
J043003K06AGCCGTCCNONE 
J043016I20AGCCGTCCNONE 
J043021A10AGCCGTCCNONE 
J043034F14AGCCGTCCNONE 
J065002O17AGCCGTCCNONE 
J065014B14AGCCGTCCNONE 
J065054N19AGCCGTCCNONE 
J065112P18AGCCGTCCNONE 
J065121B20AGCCGTCCNONE 
J065170M08AGCCGTCCNONE 
J065194B05AGCCGTCCNONE 
J090040F01AGCCGTCCNONE 
J090078O20AGCCGTCCNONE 
J090078P21AGCCGTCCNONE 
J090084E11AGCCGTCCNONE 
J100080B11AGCCGTCCNONE 
Os03g0217900AK119980AGCCGTCCGATConserved hypothetical protein. 
J053089K18AGCCGTCCGATNONE 
J090058B20AGCCGTCCGATNONE 
J090081L09AGCCGTCCGATNONE 
Os03g0231700015-021-C12GGACGGCTNONE 
AK068401GGACGGCTNONE 
AK073426GGACGGCTSimilar to Squalene monooxygenase 2 (EC 1.14.99.7). 
Os03g0245100AK059346ATCGGACGGCTNONE 
AK069529ATCGGACGGCTDihydrodipicolinate reductase family protein. 
AK102253ATCGGACGGCTNONE 
J023004J01ATCGGACGGCTNONE 
J033089J05ATCGGACGGCTNONE 
Os03g0269300011-021-H03AGCCGTCCGATCNONE 
011-029-B01AGCCGTCCGATCNONE 
AK111855AGCCGTCCGATCNONE 
AK111884AGCCGTCCGATCAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0279200009-097-C06CCGAGCCGTCCNONE 
013-007-B07CCGAGCCGTCCNONE 
AK121750CCGAGCCGTCCSimilar to Histone H2A. 
J033087I02CCGAGCCGTCCNONE 
J065002G20CCGAGCCGTCCNONE 
J065102M04CCGAGCCGTCCNONE 
J065139A02CCGAGCCGTCCNONE 
J075109D21CCGAGCCGTCCNONE 
J075191L12CCGAGCCGTCCNONE 
J090096C03CCGAGCCGTCCNONE 
J100036C23CCGAGCCGTCCNONE 
Os03g0300200AK102070ATCGGACGGCTSimilar to Ubiquitin-specific protease 16. 
Os03g0300300AK099693AGCCGTCCGAWD40-like domain containing protein. 
Os03g0305500011-012-F10GGACGGCTNONE 
011-050-D09GGACGGCTNONE 
015-027-E07GGACGGCTNONE 
015-085-G08GGACGGCTNONE 
J013105D04GGACGGCTNONE 
J023023O22GGACGGCTNONE 
J023056K03GGACGGCTNONE 
J033050D04GGACGGCTNONE 
J033086D03GGACGGCTNONE 
J033140P04GGACGGCTNONE 
J090050D07GGACGGCTNONE 
J100032O09GGACGGCTNONE 
J100085J04GGACGGCTNONE 
Os03g0336300AK068503CCGAGCCGTCCPeptidase M16, C-terminal domain containing protein. 
Os03g0699300AK120407CCGAGCCGTCCGATCSimilar to Adenylosuccinate synthetase, chloroplast precursor (EC 6.3.4.4) (IMP-- aspartate ligase) (AdSS) (AMPSase). 
Os03g0708800009-180-H07AGCCGTCCNONE 
014-021-A05AGCCGTCCNONE 
AK063141AGCCGTCCNONE 
AK063654AGCCGTCCHypothetical protein. 
AK121625AGCCGTCCNONE 
J065041G22AGCCGTCCNONE 
J065063P10AGCCGTCCNONE 
J065158O11AGCCGTCCNONE 
Os03g0720400AK067604GGACGGCTProtein of unknown function DUF295 family protein. 
J013112B07GGACGGCTNONE 
Os03g0746000AK073682AGCCGTCCConserved hypothetical protein. 
AK073682AGCCGTCCGATCConserved hypothetical protein. 
AK111472AGCCGTCCNONE 
AK111472AGCCGTCCGATCNONE 
J090083F05AGCCGTCCNONE 
J090083F05AGCCGTCCGATCNONE 
Os03g0791800013-037-A12AGCCGTCCNONE 
AB079798AGCCGTCCNONE 
AK067703AGCCGTCCRad6 (Ubiquitin carrier protein). 
AK120251AGCCGTCCNONE 
J013045G10AGCCGTCCNONE 
J023102B18AGCCGTCCNONE 
J065020J23AGCCGTCCNONE 
J065127I21AGCCGTCCNONE 
J065151E11AGCCGTCCNONE 
J075076B05AGCCGTCCNONE 
J075116C15AGCCGTCCNONE 
J075136A07AGCCGTCCNONE 
J100029G21AGCCGTCCNONE 
J100030K01AGCCGTCCNONE 
J100041J02AGCCGTCCNONE 
J100049C22AGCCGTCCNONE 
J100057G17AGCCGTCCNONE 
J100086L12AGCCGTCCNONE 
Os03g0811100AK072463ATCGGACGGCTSimilar to Magnesium-chelatase subunit chlD, chloroplast precursor (EC 6.6.1.1) (Mg-protoporphyrin IX chelatase) (Mg-chelatase subunit D). 
Os03g0815900013-097-G08AGCCGTCCGATCGGACNONE 
AK065258AGCCGTCCGATCGGACNONE 
AK119756AGCCGTCCGATCGGACSimilar to DNA-directed RNA polymerase. 
J013002J17AGCCGTCCGATCGGACNONE 
J013074A12AGCCGTCCGATCGGACNONE 
J023045C17AGCCGTCCGATCGGACNONE 
J033050E21AGCCGTCCGATCGGACNONE 
J053094P05AGCCGTCCGATCGGACNONE 
J090038F11AGCCGTCCGATCGGACNONE 
J090072J01AGCCGTCCGATCGGACNONE 
J100026H07AGCCGTCCGATCGGACNONE 
J100040O06AGCCGTCCGATCGGACNONE 
J100083D07AGCCGTCCGATCGGACNONE 
Os03g0820600013-030-F01AGCCGTCCNONE 
AK058941AGCCGTCCSimilar to Actin-depolymerizing factor 3 (ADF 3) (ZmABP3) (ZmADF3). 
J065038I10AGCCGTCCNONE 
J065043C23AGCCGTCCNONE 
J065060H20AGCCGTCCNONE 
J065065E06AGCCGTCCNONE 
J065078K18AGCCGTCCNONE 
J065116J24AGCCGTCCNONE 
J065118G22AGCCGTCCNONE 
J065129D16AGCCGTCCNONE 
J065153G20AGCCGTCCNONE 
J065159I03AGCCGTCCNONE 
J065176E14AGCCGTCCNONE 
J065187B11AGCCGTCCNONE 
J065203D14AGCCGTCCNONE 
J065217P15AGCCGTCCNONE 
J075105D14AGCCGTCCNONE 
J100036F11AGCCGTCCNONE 
J100044M07AGCCGTCCNONE 
Os03g0826800006-081-B04ATCGGACGGCTNONE 
015-050-A02ATCGGACGGCTNONE 
AK065702ATCGGACGGCTConserved hypothetical protein. 
AK119789ATCGGACGGCTNONE 
J013035P06ATCGGACGGCTNONE 
J023025I11ATCGGACGGCTNONE 
J065023J15ATCGGACGGCTNONE 
J065204K04ATCGGACGGCTNONE 
J075021L07ATCGGACGGCTNONE 
J075104F02ATCGGACGGCTNONE 
J075146J05ATCGGACGGCTNONE 
J100026H04ATCGGACGGCTNONE 
J100031M07ATCGGACGGCTNONE 
J100035A06ATCGGACGGCTNONE 
J100052J05ATCGGACGGCTNONE 
J100059F12ATCGGACGGCTNONE 
J100071F10ATCGGACGGCTNONE 
J100074G08ATCGGACGGCTNONE 
J100074G24ATCGGACGGCTNONE 
J100082L21ATCGGACGGCTNONE 
Os04g0269900J065139P11CGGACGGCTNONE 
J100034P12CGGACGGCTNONE 
J100045D21CGGACGGCTNONE 
Os04g0401800AB197127AGCCGTCCGATCCGDNA repair metallo-beta-lactamase domain containing protein. 
AB197127GATCGGACGGCTDNA repair metallo-beta-lactamase domain containing protein. 
AK103868AGCCGTCCGATCCGNONE 
AK103868GATCGGACGGCTNONE 
J033149H08AGCCGTCCGATCCGNONE 
J033149H08GATCGGACGGCTNONE 
J065020C11AGCCGTCCGATCCGNONE 
J065020C11GATCGGACGGCTNONE 
J075179J09AGCCGTCCGATCCGNONE 
J075179J09GATCGGACGGCTNONE 
J090034B13AGCCGTCCGATCCGNONE 
J090034B13GATCGGACGGCTNONE 
Os04g0414500AK121479GGACGGCTConserved hypothetical protein. 
J023149I19GGACGGCTNONE 
J090084C07GGACGGCTNONE 
Os04g0416000J065041L09AGCCGTCCNONE 
J065050F15AGCCGTCCNONE 
J065053M14AGCCGTCCProtein of unknown function DUF1279 domain containing protein. 
J065057I09AGCCGTCCNONE 
J065132E14AGCCGTCCNONE 
J065144L23AGCCGTCCNONE 
J065154N13AGCCGTCCNONE 
J065158P16AGCCGTCCNONE 
J080302F01AGCCGTCCNONE 
J080308G20AGCCGTCCNONE 
Os04g0443500AK105357AGCCGTCCSimilar to Protein phosphatase methylesterase 1 (EC 3.1.1.-) (PME-1). Splice isoform 3. 
Os04g0527700AK072980GGACGGCTGGGAAAGCCHCH domain containing protein. 
J023117E20GGACGGCTGGGAAAGCNONE 
J023150D11GGACGGCTGGGAAAGCNONE 
Os04g0528100009-090-G06GATCGGACGGCTNONE 
009-168-C11GATCGGACGGCTNONE 
AK065957GATCGGACGGCTConserved hypothetical protein. 
J013039G20GATCGGACGGCTNONE 
J013044D08GATCGGACGGCTNONE 
J065013L14GATCGGACGGCTNONE 
J065143H08GATCGGACGGCTNONE 
J065146C14GATCGGACGGCTNONE 
J065149K22GATCGGACGGCTNONE 
J065156B18GATCGGACGGCTNONE 
J065201A04GATCGGACGGCTNONE 
J065209A04GATCGGACGGCTNONE 
Os04g0566900AK072344AGCCGTCCGATCConserved hypothetical protein. 
Os04g0569100AB101647GGACGGCTNONE 
AK111914GGACGGCTNONE 
AK112099GGACGGCTSimilar to OCL1 homeobox protein. 
Os04g0602800AK100925AGCCGTCCGSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0623100006-042-D10AGCCGTCCNONE 
AK067276AGCCGTCCBromodomain containing protein. 
J013097L22AGCCGTCCNONE 
J013099L18AGCCGTCCNONE 
J023009D13AGCCGTCCNONE 
J023041M21AGCCGTCCNONE 
J090088H12AGCCGTCCNONE 
Os04g0623700AK071587AGCCGTCCGNONE 
J023101P16AGCCGTCCGNONE 
J100044N20AGCCGTCCGNONE 
J100052H13AGCCGTCCGNONE 
J100075E05AGCCGTCCGNONE 
Y10118AGCCGTCCGSimilar to Signal recognition particle 14 kDa protein (SRP14). 
Os04g0642300Os04g0642300AGCCGTCCNONE 
Os05g0112101J065141G20AGCCGTCCGATCEpsin, N-terminal domain containing protein. 
Os05g0132500AK060754GGACGGCTNONE 
Os05g0135400013-051-E05AGCCGTCCNONE 
AK063587AGCCGTCCHaem peroxidase family protein. 
J065063H19AGCCGTCCNONE 
Os05g0176000J100055L06AGCCGTCCFibrillarin family protein. 
Os05g0187000AB026564AGCCGTCCNONE 
AK103126AGCCGTCCBeta 2 subunit of 20S proteasome (20S proteasome beta subunit). 
J023025O17AGCCGTCCNONE 
J033022B11AGCCGTCCNONE 
J033023J11AGCCGTCCNONE 
J043024J15AGCCGTCCNONE 
J075012M05AGCCGTCCNONE 
J075014K21AGCCGTCCNONE 
J075022G22AGCCGTCCNONE 
J075075H15AGCCGTCCNONE 
J075086E08AGCCGTCCNONE 
J075090O05AGCCGTCCNONE 
J075105A09AGCCGTCCNONE 
J075127C04AGCCGTCCNONE 
J075162K04AGCCGTCCNONE 
J075187K10AGCCGTCCNONE 
J075190G16AGCCGTCCNONE 
J075194E10AGCCGTCCNONE 
J090001G14AGCCGTCCNONE 
J090003I23AGCCGTCCNONE 
J090019B04AGCCGTCCNONE 
J090046P04AGCCGTCCNONE 
J100025M01AGCCGTCCNONE 
J100049G13AGCCGTCCNONE 
J100059G08AGCCGTCCNONE 
J100078M14AGCCGTCCNONE 
Os05g0230600AK070398AGCCGTCCProtein of unknown function DUF1620 domain containing protein. 
J023048G06AGCCGTCCNONE 
J023104B17AGCCGTCCNONE 
J023117E17AGCCGTCCNONE 
J033141M04AGCCGTCCNONE 
J043013P22AGCCGTCCNONE 
J075106H10AGCCGTCCNONE 
J090022K02AGCCGTCCNONE 
J090027E17AGCCGTCCNONE 
J090057K12AGCCGTCCNONE 
J090058C13AGCCGTCCNONE 
J090067E04AGCCGTCCNONE 
J090069N19AGCCGTCCNONE 
J090070J02AGCCGTCCNONE 
J090088H01AGCCGTCCNONE 
J090099A08AGCCGTCCNONE 
Os05g0297900AK071238AGCCGTCCGATCSimilar to Signal peptidase 18 subunit (Fragment). 
J013159C03AGCCGTCCGATCNONE 
J023041J06AGCCGTCCGATCNONE 
J023085B09AGCCGTCCGATCNONE 
J033031J11AGCCGTCCGATCNONE 
J065010C22AGCCGTCCGATCNONE 
J065032E10AGCCGTCCGATCNONE 
J065141O18AGCCGTCCGATCNONE 
J065155K04AGCCGTCCGATCNONE 
Os05g0339000016-094-B12AGCCGTCCGNONE 
J075038J09AGCCGTCCGNONE 
J075124F11AGCCGTCCGNONE 
J075143E13AGCCGTCCGVHS domain containing protein. 
J075165E01AGCCGTCCGNONE 
J075185F12AGCCGTCCGNONE 
J100060N16AGCCGTCCGNONE 
J100066M21AGCCGTCCGNONE 
J100089K17AGCCGTCCGNONE 
Os05g0349800011-076-D06CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
014-037-D12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
AK063677CCGAGCCGTCCGCGTCGCCGCGCGACACGTEmbryonic abundant protein 1. 
AK119674CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053027D20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053039D11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053047P16CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053048F05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053058E11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053060C03CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053082N12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065017B15CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065117G02CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065212K21CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075001H18CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075003F20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075026F11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075035F13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075055C12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075067L20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075067O13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075070A12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075089E05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075128J17CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075134M19CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075192L11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075199D14CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
Os05g0372300AK120018GGACGGCTCytochrome P450 family protein. 
Os05g0404400004-002-D12GGACGGCTNONE 
006-041-E06GGACGGCTNONE 
009-059-D02GGACGGCTNONE 
AK065418GGACGGCTConserved hypothetical protein. 
AK104172GGACGGCTNONE 
AK104635GGACGGCTNONE 
J013023J24GGACGGCTNONE 
Os05g0497625Os05g0497625AGCCGTCCConserved hypothetical protein. 
Os05g0506900AK106697AGCCGTCCBrix domain containing protein. 
Os05g0510700AK070308GATCGGACGGCTCGGBSD domain containing protein. 
Os05g0519800AK069435CCGAGCCGTCCProtein of unknown function DUF28 family protein. 
J023024L22CCGAGCCGTCCNONE 
Os05g0548100AK060333AGCCGTCCGATCCGConserved hypothetical protein. 
AK100682AGCCGTCCGATCCGNONE 
J013151E01AGCCGTCCGATCCGNONE 
J023113L22AGCCGTCCGATCCGNONE 
J043027A19AGCCGTCCGATCCGNONE 
J075093E06AGCCGTCCGATCCGNONE 
J090060D15AGCCGTCCGATCCGNONE 
J090082J03AGCCGTCCGATCCGNONE 
J100050E01AGCCGTCCGATCCGNONE 
Os05g0558000015-029-G05AGCCGTCCNONE 
AK073857AGCCGTCCRibosomal protein L1 family protein. 
J033074P11AGCCGTCCNONE 
J090060I16AGCCGTCCNONE 
Os06g0115200J100029D05AGCCGTCCNONE 
J100048P05AGCCGTCCQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os06g0129000Os06g0129000AGCCGTCCConserved hypothetical protein. 
Os06g0134800014-049-H04AGCCGTCCGNONE 
AK063692AGCCGTCCGGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0147600AK107817AGCCGTCCGConserved hypothetical protein. 
Os06g0168600AK068858CGGACGGCTSimilar to Ribonucleotide reductase. 
Os06g0171700AK103771GGACGGCTCdk-activating kinase assembly factor (MAT1) family protein. 
J033143J20GGACGGCTNONE 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0226950J065070E21GGACGGCTSterol desaturase family protein. 
J065218I08GGACGGCTNONE 
Os06g0332400AK058294AGCCGTCCNONE 
AK101738AGCCGTCCVHS domain containing protein. 
J013119B12AGCCGTCCNONE 
J013132G17AGCCGTCCNONE 
J023034E06AGCCGTCCNONE 
J023039I05AGCCGTCCNONE 
J033024E14AGCCGTCCNONE 
J033039N04AGCCGTCCNONE 
J033048P16AGCCGTCCNONE 
J033069F24AGCCGTCCNONE 
J033071D15AGCCGTCCNONE 
J033106D01AGCCGTCCNONE 
J033106D09AGCCGTCCNONE 
J033106F09AGCCGTCCNONE 
J033107K03AGCCGTCCNONE 
J033129G10AGCCGTCCNONE 
J065016B15AGCCGTCCNONE 
J065022H07AGCCGTCCNONE 
J065048E07AGCCGTCCNONE 
J065068B11AGCCGTCCNONE 
J065157C13AGCCGTCCNONE 
J100042J02AGCCGTCCNONE 
Os06g0505400AK068107ATCGGACGGCTAbortive infection protein family protein. 
J013074E10ATCGGACGGCTNONE 
J013130C21ATCGGACGGCTNONE 
J033070J05ATCGGACGGCTNONE 
J033139B07ATCGGACGGCTNONE 
J043040G03ATCGGACGGCTNONE 
J065169G13ATCGGACGGCTNONE 
J075005M22ATCGGACGGCTNONE 
J075021E02ATCGGACGGCTNONE 
J075038D02ATCGGACGGCTNONE 
J075076G19ATCGGACGGCTNONE 
Os06g0506100AK107403GATCGGACGGCTProtein prenyltransferase domain containing protein. 
Os06g0562700AK109753GGACGGCTConserved hypothetical protein. 
Os06g0666400AK108002GATCGGACGGCTVQ domain containing protein. 
J065043C22GATCGGACGGCTNONE 
J065120O19GATCGGACGGCTNONE 
J075197D23GATCGGACGGCTNONE 
J100030E22GATCGGACGGCTNONE 
J100031I22GATCGGACGGCTNONE 
J100072I12GATCGGACGGCTNONE 
Os06g0669200009-018-A06GGACGGCTNONE 
AK062363GGACGGCTConserved hypothetical protein. 
Os06g0716700AB037681CCGAGCCGTCCGATCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385CCGAGCCGTCCGATCNONE 
AK102478CCGAGCCGTCCGATCNONE 
J013030D18CCGAGCCGTCCGATCNONE 
J090091L06CCGAGCCGTCCGATCNONE 
Os07g0124600AK073437CCGAGCCGTCCATCCCCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24CCGAGCCGTCCATCCCCCNONE 
J033136G07CCGAGCCGTCCATCCCCCNONE 
J065092I12CCGAGCCGTCCATCCCCCNONE 
J065132F04CCGAGCCGTCCATCCCCCNONE 
J065143I11CCGAGCCGTCCATCCCCCNONE 
Os07g0145250J075010B04ATCGGACGGCTNONE 
J075030M07ATCGGACGGCTNONE 
J075039C20ATCGGACGGCTNONE 
J075047G02ATCGGACGGCTNONE 
J075059C09ATCGGACGGCTNONE 
J075093A20ATCGGACGGCTNONE 
J075122B05ATCGGACGGCTNONE 
J075130K10ATCGGACGGCTConserved hypothetical protein. 
J075138D05ATCGGACGGCTNONE 
J075161C12ATCGGACGGCTNONE 
Os07g0224000009-060-E01ATCGGACGGCTNONE 
J065042D20ATCGGACGGCTNONE 
J065127D14ATCGGACGGCTNONE 
J065176C24ATCGGACGGCTNONE 
J065188M12ATCGGACGGCTNONE 
J065194L14ATCGGACGGCTNONE 
J075060P09ATCGGACGGCTNONE 
J075134C14ATCGGACGGCTRibosomal protein L24E family protein. 
J075192M12ATCGGACGGCTNONE 
J100032N01ATCGGACGGCTNONE 
Os07g0262200AK071615AGCCGTCCATCCACCATCCAACGSimilar to Prohibitin. 
AK104133AGCCGTCCATCCACCATCCAACGNONE 
Os07g0432800012-025-C05AGCCGTCCGNONE 
AK063456AGCCGTCCGMyb, DNA-binding domain containing protein. 
J053025J09AGCCGTCCGNONE 
J053052K16AGCCGTCCGNONE 
J053060G01AGCCGTCCGNONE 
J053096H11AGCCGTCCGNONE 
J075033O13AGCCGTCCGNONE 
Os07g0555200AK058724GGACGGCTNONE 
Os07g0589400AK072501AGCCGTCCQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617AGCCGTCCNONE 
AK104756AGCCGTCCNONE 
Os08g0270900AK108117GGACGGCTConserved hypothetical protein. 
Os08g0343000AK068357AGCCGTCCProtein kinase-like domain containing protein. 
AK099236AGCCGTCCNONE 
Os08g0414300AK072217AGCCGTCCGConserved hypothetical protein. 
J065039C07AGCCGTCCGNONE 
J065098N11AGCCGTCCGNONE 
J065120J15AGCCGTCCGNONE 
J075076H12AGCCGTCCGNONE 
J075101N16AGCCGTCCGNONE 
J080010A07AGCCGTCCGNONE 
J080023C16AGCCGTCCGNONE 
J080027G22AGCCGTCCGNONE 
J080053D02AGCCGTCCGNONE 
J080065E17AGCCGTCCGNONE 
J080068C15AGCCGTCCGNONE 
J090061J10AGCCGTCCGNONE 
Os08g0503800AK101954AGCCGTCCSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
AK101954AGCCGTCCGATCTGGTGGGCCCACACSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
Os08g0547100006-088-E09AGCCGTCCNONE 
AK073704AGCCGTCCNONE 
AK109374AGCCGTCC6-phosphogluconolactonase domain containing protein. 
J023055A08AGCCGTCCNONE 
J023150G19AGCCGTCCNONE 
J033060E10AGCCGTCCNONE 
J033112J12AGCCGTCCNONE 
Os09g0274100009-112-B02AGCCGTCCNONE 
AK062823AGCCGTCCConserved hypothetical protein. 
Os09g0281900AK121112CGGATCGGACGGCTThyroid hormone receptor-associated protein complex component TRAP170- like protein. 
J023073I01CGGATCGGACGGCTNONE 
Os09g0325300011-005-H08CCGAGCCGTCCGATNONE 
011-005-H08GGACGGCTNONE 
AK068435CCGAGCCGTCCGATConserved hypothetical protein. 
AK068435GGACGGCTConserved hypothetical protein. 
AK073998CCGAGCCGTCCGATNONE 
AK073998GGACGGCTNONE 
J033071H21CCGAGCCGTCCGATNONE 
J033071H21GGACGGCTNONE 
J065214H05CCGAGCCGTCCGATNONE 
J065214H05GGACGGCTNONE 
Os09g0382400009-125-E12GATCGGACGGCTCGGNONE 
AK062891GATCGGACGGCTCGGConserved hypothetical protein. 
J065069H20GATCGGACGGCTCGGNONE 
J065137I22GATCGGACGGCTCGGNONE 
J065218O10GATCGGACGGCTCGGNONE 
Os09g0406900012-044-F05GGACGGCTNONE 
AK063485GGACGGCTNONE 
AK067460GGACGGCTConserved hypothetical protein. 
Os09g0462700AK060597ATCGGACGGCTNONE 
AK067260ATCGGACGGCTSimilar to RNA Binding Protein 47. 
Os09g0516600AK070780GGACGGCTNONE 
AK103563GGACGGCTNONE 
AY054407GGACGGCTGlyoxalase II. 
J013058P06GGACGGCTNONE 
J013093G04GGACGGCTNONE 
J023007G05GGACGGCTNONE 
J023091A08GGACGGCTNONE 
J023136K23GGACGGCTNONE 
J023138D20GGACGGCTNONE 
J033022N20GGACGGCTNONE 
J033065N15GGACGGCTNONE 
J033109L23GGACGGCTNONE 
J053073C08GGACGGCTNONE 
J075094J24GGACGGCTNONE 
J075106P21GGACGGCTNONE 
Os09g0533300AK073741AGCCGTCCPhosphoesterase At2g46880 family protein. 
J043004F12AGCCGTCCNONE 
J043013K12AGCCGTCCNONE 
J075006D19AGCCGTCCNONE 
J075064C01AGCCGTCCNONE 
J090003A07AGCCGTCCNONE 
J090085H04AGCCGTCCNONE 
J100051J16AGCCGTCCNONE 
Os09g0570400AK065287GATCGGACGGCTMajor facilitator superfamily protein. 
J013002M15GATCGGACGGCTNONE 
J013030F15GATCGGACGGCTNONE 
J013055E11GATCGGACGGCTNONE 
J013071P13GATCGGACGGCTNONE 
J013072E15GATCGGACGGCTNONE 
J013072G14GATCGGACGGCTNONE 
J013075F17GATCGGACGGCTNONE 
J013089I20GATCGGACGGCTNONE 
J013092E05GATCGGACGGCTNONE 
J013121F02GATCGGACGGCTNONE 
J013122D22GATCGGACGGCTNONE 
J013156E24GATCGGACGGCTNONE 
J023042O15GATCGGACGGCTNONE 
J023104D22GATCGGACGGCTNONE 
J033065I08GATCGGACGGCTNONE 
J033131C03GATCGGACGGCTNONE 
J090064E11GATCGGACGGCTNONE 
J100063G18GATCGGACGGCTNONE 
Os11g0157400AK066482AGCCGTCCExo70 exocyst complex subunit family protein. 
Os11g0181700006-062-E12AGCCGTCCACGTGTCNONE 
006-072-B05AGCCGTCCACGTGTCNONE 
006-118-G08AGCCGTCCACGTGTCNONE 
009-068-A10AGCCGTCCACGTGTCNONE 
AK062546AGCCGTCCACGTGTCSimilar to Short-chain dehydrogenase Tic32. 
AK065928AGCCGTCCACGTGTCNONE 
Os11g0221000AK102073AGCCGTCCAux/IAA_ARF_dimerisation domain containing protein. 
Os11g0267400AK069552AGCCGTCCGATCSimilar to ClpC. 
AK100126AGCCGTCCGATCNONE 
Os11g0537400003-126-A11AGCCGTCCGATCNONE 
Os11g0660500009-031-D10AGCCGTCCGNONE 
009-100-G09AGCCGTCCGNONE 
009-162-G10AGCCGTCCGNONE 
009-183-H11AGCCGTCCGNONE 
013-010-B11AGCCGTCCGNONE 
013-050-A05AGCCGTCCGNONE 
013-070-E10AGCCGTCCGNONE 
AK105453AGCCGTCCGSimilar to Translationally controlled tumor protein (Fragment). 
D12626AGCCGTCCGNONE 
J013128M15AGCCGTCCGNONE 
J023004I19AGCCGTCCGNONE 
J033114F08AGCCGTCCGNONE 
J033147I20AGCCGTCCGNONE 
J065031M04AGCCGTCCGNONE 
J065033J03AGCCGTCCGNONE 
J065038E01AGCCGTCCGNONE 
J065048O06AGCCGTCCGNONE 
J065054E01AGCCGTCCGNONE 
J065075N08AGCCGTCCGNONE 
J065080C07AGCCGTCCGNONE 
J065096A12AGCCGTCCGNONE 
J065115P22AGCCGTCCGNONE 
J065122I21AGCCGTCCGNONE 
J065127A13AGCCGTCCGNONE 
J065158B06AGCCGTCCGNONE 
J065162E04AGCCGTCCGNONE 
J065162E05AGCCGTCCGNONE 
J065163L06AGCCGTCCGNONE 
J065177B16AGCCGTCCGNONE 
J065181M15AGCCGTCCGNONE 
J065201G15AGCCGTCCGNONE 
J065202J06AGCCGTCCGNONE 
J075002B19AGCCGTCCGNONE 
J075008G19AGCCGTCCGNONE 
J075010P05AGCCGTCCGNONE 
J075018H23AGCCGTCCGNONE 
J075051E18AGCCGTCCGNONE 
J075053C24AGCCGTCCGNONE 
J075077B06AGCCGTCCGNONE 
J075080B11AGCCGTCCGNONE 
J075083M04AGCCGTCCGNONE 
J075085H01AGCCGTCCGNONE 
J075109E11AGCCGTCCGNONE 
J075111O09AGCCGTCCGNONE 
J075130D13AGCCGTCCGNONE 
J075132H13AGCCGTCCGNONE 
J075147H19AGCCGTCCGNONE 
J075148J01AGCCGTCCGNONE 
J075159A18AGCCGTCCGNONE 
J075166F03AGCCGTCCGNONE 
J075191F09AGCCGTCCGNONE 
J075192K09AGCCGTCCGNONE 
J080006P15AGCCGTCCGNONE 
J080013J18AGCCGTCCGNONE 
J080023O06AGCCGTCCGNONE 
J080024I17AGCCGTCCGNONE 
J080029P03AGCCGTCCGNONE 
J080030C14AGCCGTCCGNONE 
J080038K15AGCCGTCCGNONE 
J080042I15AGCCGTCCGNONE 
J080053L07AGCCGTCCGNONE 
J080061H12AGCCGTCCGNONE 
J080064H24AGCCGTCCGNONE 
J080066J20AGCCGTCCGNONE 
J080074N07AGCCGTCCGNONE 
J080079F16AGCCGTCCGNONE 
J080079O07AGCCGTCCGNONE 
J080092E15AGCCGTCCGNONE 
J080301F19AGCCGTCCGNONE 
J080302O21AGCCGTCCGNONE 
J080306L02AGCCGTCCGNONE 
J080307F16AGCCGTCCGNONE 
J080307G01AGCCGTCCGNONE 
J080307K01AGCCGTCCGNONE 
J080309O22AGCCGTCCGNONE 
J080311E17AGCCGTCCGNONE 
J080311N08AGCCGTCCGNONE 
J080312O12AGCCGTCCGNONE 
J080315C08AGCCGTCCGNONE 
J080316D07AGCCGTCCGNONE 
J080318C17AGCCGTCCGNONE 
J090004B08AGCCGTCCGNONE 
J090009K02AGCCGTCCGNONE 
J090025O15AGCCGTCCGNONE 
J090026L03AGCCGTCCGNONE 
J090036P17AGCCGTCCGNONE 
J090047A21AGCCGTCCGNONE 
J090053O03AGCCGTCCGNONE 
J090059C04AGCCGTCCGNONE 
J090062O21AGCCGTCCGNONE 
J090064M11AGCCGTCCGNONE 
J090070C14AGCCGTCCGNONE 
J090075I03AGCCGTCCGNONE 
J090081G22AGCCGTCCGNONE 
J090083E18AGCCGTCCGNONE 
J090084A05AGCCGTCCGNONE 
J100019L11AGCCGTCCGNONE 
J100022D16AGCCGTCCGNONE 
J100042F09AGCCGTCCGNONE 
J100051J12AGCCGTCCGNONE 
J100065G21AGCCGTCCGNONE 
J100066D08AGCCGTCCGNONE 
J100069H04AGCCGTCCGNONE 
J100078I16AGCCGTCCGNONE 
J100090D15AGCCGTCCGNONE 
Os12g0165000AK111883GGACGGCTWD40-like domain containing protein. 
Os12g0502100Os12g0502100AGCCGTCCGATCConserved hypothetical protein. 
Os12g0580700AK072892AGCCGTCCSimilar to RING-H2 finger protein ATL2N. 
J075005E02AGCCGTCCNONE 
Os12g0613300AB118014GGACGGCTNONE 
AK100618GGACGGCTSimilar to Single myb histone 6. 
AK105660GGACGGCTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.