version

Summary of OsREG470 (All List)

OrganismOryza sativa  
IDOsREG470  
SequenceAGCTGAGC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count798  

Entry Sequences (798 entries)

LocusGene modelSequenceDescription
Os01g0104600AK058683AGCTGAGCNONE 
AK100613AGCTGAGCSimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
Os01g0143900009-066-F12AGCTGAGCNONE 
015-049-A09AGCTGAGCNONE 
AK119686AGCTGAGCNONE 
AK120731AGCTGAGCConserved hypothetical protein. 
J023003C05AGCTGAGCNONE 
J100064E13AGCTGAGCNONE 
Os01g0158400009-069-D01GCTCAGCTNONE 
AK063812GCTCAGCTNONE 
AK102322GCTCAGCTGalactose-binding like domain containing protein. 
J033090J07GCTCAGCTNONE 
Os01g0164800AK064572AGCTGAGCHypothetical protein. 
Os01g0217500AK063270AGCTGAGCDJ-1 family protein. 
Os01g0219200AK108579GCTCAGCTConserved hypothetical protein. 
Os01g0281100AK109672GCTCAGCTGGGGCCConserved hypothetical protein. 
J065013K07GCTCAGCTGGGGCCNONE 
J065040E15GCTCAGCTGGGGCCNONE 
J065127F12GCTCAGCTGGGGCCNONE 
J075155K23GCTCAGCTGGGGCCNONE 
Os01g0305200009-022-C01GCTCAGCTGCCCACCCGNONE 
AK062385GCTCAGCTGCCCACCCGLg106-like family protein. 
J075005A20GCTCAGCTGCCCACCCGNONE 
J075028K05GCTCAGCTGCCCACCCGNONE 
J075060H07GCTCAGCTGCCCACCCGNONE 
J075090G07GCTCAGCTGCCCACCCGNONE 
J075117E20GCTCAGCTGCCCACCCGNONE 
J075153F17GCTCAGCTGCCCACCCGNONE 
J075179J10GCTCAGCTGCCCACCCGNONE 
J075183G15GCTCAGCTGCCCACCCGNONE 
Os01g0389200006-065-G12GCTCAGCTNONE 
006-091-F03GCTCAGCTNONE 
AK061076GCTCAGCTProtein of unknown function DUF679 family protein. 
J065034P08GCTCAGCTNONE 
J065132P04GCTCAGCTNONE 
J065214D12GCTCAGCTNONE 
Os01g0614900AK121767GCTCAGCTNONE 
Os01g0750000006-031-E04GCTCAGCTCAGCTNONE 
AK060095GCTCAGCTCAGCTSimilar to Ras-related protein RIC2. 
AK066450GCTCAGCTCAGCTNONE 
AY327044GCTCAGCTCAGCTNONE 
Os01g0755500AB071807AGCTGAGCSimilar to Transcription factor PCF7 (Fragment). 
AK058570AGCTGAGCNONE 
J065184I03AGCTGAGCNONE 
J065191I07AGCTGAGCNONE 
Os01g0781000006-077-C12AGCTGAGCNONE 
009-156-E02AGCTGAGCNONE 
AK059870AGCTGAGCVacuolar protein sorting-associated, VPS28 family protein. 
AK099116AGCTGAGCNONE 
AK104274AGCTGAGCNONE 
J023034E12AGCTGAGCNONE 
J075074G06AGCTGAGCNONE 
J090041H03AGCTGAGCNONE 
J100045K08AGCTGAGCNONE 
Os01g0818000AK069848CGGCTCGGCTCAGCTNONE 
AK070194CGGCTCGGCTCAGCTAuxin Efflux Carrier family protein. 
J023041H12CGGCTCGGCTCAGCTNONE 
Os01g0853400AK121543GCTCAGCTNONE 
AY168645GCTCAGCTNONE 
Os01g0924900AK067886GCTCAGCTGTP-binding signal recognition particle SRP54, G-domain containing protein. 
Os02g0106600AK107830AGCTGAGCZinc finger, RING-type domain containing protein. 
Os02g0110000AK106946AGCTGAGCLipolytic enzyme, G-D-S-L family protein. 
J075063H20AGCTGAGCNONE 
J075063K06AGCTGAGCNONE 
J075087L19AGCTGAGCNONE 
J075091E05AGCTGAGCNONE 
J075108L18AGCTGAGCNONE 
J075110E23AGCTGAGCNONE 
J075118J18AGCTGAGCNONE 
J075122B03AGCTGAGCNONE 
J075152J02AGCTGAGCNONE 
J080005L20AGCTGAGCNONE 
J080009L12AGCTGAGCNONE 
J080011L08AGCTGAGCNONE 
J080021H09AGCTGAGCNONE 
J080025P14AGCTGAGCNONE 
J080026O09AGCTGAGCNONE 
J080028K09AGCTGAGCNONE 
J080049L23AGCTGAGCNONE 
J080052A06AGCTGAGCNONE 
J080053B12AGCTGAGCNONE 
J080054B16AGCTGAGCNONE 
J080054G04AGCTGAGCNONE 
J080064L11AGCTGAGCNONE 
J080065A12AGCTGAGCNONE 
J080069H17AGCTGAGCNONE 
J080072I08AGCTGAGCNONE 
J080078H21AGCTGAGCNONE 
J080082E06AGCTGAGCNONE 
J080083H02AGCTGAGCNONE 
J080092H07AGCTGAGCNONE 
J080092L10AGCTGAGCNONE 
J080097L13AGCTGAGCNONE 
Os02g0256100006-038-B12AGCTGAGCNONE 
006-085-A11AGCTGAGCNONE 
009-129-E03AGCTGAGCNONE 
016-016-E06AGCTGAGCNONE 
AK059595AGCTGAGCVirulence factor, pectin lyase fold family protein. 
AK061146AGCTGAGCNONE 
AK106194AGCTGAGCNONE 
J065028G09AGCTGAGCNONE 
J065156E13AGCTGAGCNONE 
J065184P14AGCTGAGCNONE 
Os02g0266800AK070674GCTCAGCTNONE 
L34551GCTCAGCTTranscriptional activator protein. 
Os02g0287000006-107-B10GCTCAGCTNONE 
006-120-E07GCTCAGCTNONE 
AF052503GCTCAGCTNONE 
AK059647GCTCAGCTSimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK099131GCTCAGCTNONE 
J023048M05GCTCAGCTNONE 
J033107L10GCTCAGCTNONE 
J065019A12GCTCAGCTNONE 
J065064J21GCTCAGCTNONE 
J065071D15GCTCAGCTNONE 
J065094L12GCTCAGCTNONE 
J065095L06GCTCAGCTNONE 
J065097J11GCTCAGCTNONE 
J065099M08GCTCAGCTNONE 
J065104D01GCTCAGCTNONE 
J065107L02GCTCAGCTNONE 
J065110D14GCTCAGCTNONE 
J065135J07GCTCAGCTNONE 
J065137C16GCTCAGCTNONE 
J065150C07GCTCAGCTNONE 
J065165I10GCTCAGCTNONE 
J065189F07GCTCAGCTNONE 
J065205L22GCTCAGCTNONE 
J065214C09GCTCAGCTNONE 
J065217G17GCTCAGCTNONE 
J075029E17GCTCAGCTNONE 
J075054O16GCTCAGCTNONE 
J075068N23GCTCAGCTNONE 
J075135N18GCTCAGCTNONE 
J075152G09GCTCAGCTNONE 
J075162D10GCTCAGCTNONE 
J075164F11GCTCAGCTNONE 
J080036L12GCTCAGCTNONE 
J080049K18GCTCAGCTNONE 
J080060P03GCTCAGCTNONE 
J080062G16GCTCAGCTNONE 
J080062G21GCTCAGCTNONE 
J080064N07GCTCAGCTNONE 
J080075I22GCTCAGCTNONE 
J080086F20GCTCAGCTNONE 
J080087G07GCTCAGCTNONE 
J080088I06GCTCAGCTNONE 
J080302B20GCTCAGCTNONE 
J080303L14GCTCAGCTNONE 
J080309O12GCTCAGCTNONE 
J080317F12GCTCAGCTNONE 
J080317P18GCTCAGCTNONE 
J090013L15GCTCAGCTNONE 
J090043N04GCTCAGCTNONE 
J090085G01GCTCAGCTNONE 
J090085G19GCTCAGCTNONE 
Os02g0288100AK107019AGCTGAGCSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
Os02g0314600AK068924AGCTGAGCTCAGCTGAGCPeptidase A1, pepsin family protein. 
J065021N06AGCTGAGCTCAGCTGAGCNONE 
J065120N03AGCTGAGCTCAGCTGAGCNONE 
J100058F22AGCTGAGCTCAGCTGAGCNONE 
Os02g0324200AK070063AGCTGAGCConserved hypothetical protein. 
Os02g0457600AK106836GCTCAGCTConserved hypothetical protein. 
Os02g0517531AK062177AGCTGAGCNONE 
Os02g0598300AK105842GCTCAGCTConserved hypothetical protein. 
AY224550GCTCAGCTNONE 
Os02g0614600AK058581AGCTGAGCNONE 
Os02g0625000AB103094AGCTGAGCNONE 
AJ298877AGCTGAGCNONE 
AK065669AGCTGAGCNONE 
AK099334AGCTGAGCNONE 
Os02g0625500011-025-C06AGCTGAGCGTCGCGNONE 
AB050624AGCTGAGCGTCGCGNONE 
AK059188AGCTGAGCGTCGCGNONE 
AK059771AGCTGAGCGTCGCGNONE 
AK101791AGCTGAGCGTCGCGSimilar to Adenosine kinase-like protein (Fragment). 
AY224510AGCTGAGCGTCGCGNONE 
J013152H02AGCTGAGCGTCGCGNONE 
J023012P09AGCTGAGCGTCGCGNONE 
J023127D16AGCTGAGCGTCGCGNONE 
J033024G01AGCTGAGCGTCGCGNONE 
J033025L19AGCTGAGCGTCGCGNONE 
J033080M04AGCTGAGCGTCGCGNONE 
J033101A08AGCTGAGCGTCGCGNONE 
J033121L12AGCTGAGCGTCGCGNONE 
J043017N15AGCTGAGCGTCGCGNONE 
J065207J01AGCTGAGCGTCGCGNONE 
J090049G12AGCTGAGCGTCGCGNONE 
J100036A07AGCTGAGCGTCGCGNONE 
J100076C04AGCTGAGCGTCGCGNONE 
J100080N22AGCTGAGCGTCGCGNONE 
Os02g0654100AK101814AGCTGAGCSimilar to Enoyl-CoA hydratase. 
Os02g0662200AK063236AGCTGAGCYbaK/prolyl-tRNA synthetase associated region domain containing protein. 
Os02g0726300006-025-H11AGCTGAGCNONE 
009-066-B03AGCTGAGCNONE 
AB028132AGCTGAGCNONE 
AK061000AGCTGAGCNONE 
AK100892AGCTGAGCNONE 
AK101321AGCTGAGCSimilar to AOBP (Ascorbate oxidase promoter-binding protein). 
J065152L01AGCTGAGCNONE 
J075041D14AGCTGAGCNONE 
J075192K22AGCTGAGCNONE 
J100029I23AGCTGAGCNONE 
J100029K14AGCTGAGCNONE 
J100045M03AGCTGAGCNONE 
Os02g0734300006-027-C05AGCTGAGCNONE 
006-027-C11AGCTGAGCNONE 
006-039-E12AGCTGAGCNONE 
006-095-H04AGCTGAGCNONE 
009-112-G07AGCTGAGCNONE 
AK059780AGCTGAGCSimilar to Nudix hydrolase 18, mitochondrial precursor (EC 3.6.1.-) (AtNUDT18). 
AK104571AGCTGAGCNONE 
J065079N09AGCTGAGCNONE 
J065188A17AGCTGAGCNONE 
J065209B17AGCTGAGCNONE 
Os02g0738200J100040B06AGCTGAGCNONE 
J100050N02AGCTGAGCU box domain containing protein. 
J100056J12AGCTGAGCNONE 
Os03g0108300006-070-F02AGCTGAGCNONE 
006-083-A04AGCTGAGCNONE 
AK061126AGCTGAGCSimilar to Cellulase (EC 3.2.1.4). 
AK104060AGCTGAGCNONE 
AK119538AGCTGAGCNONE 
Os03g0148800003-107-B01GCTCAGCTNONE 
AK068803GCTCAGCTZinc finger, C2H2-type domain containing protein. 
Os03g0151700AK111951AGCTGAGCNONE 
Os03g0176900AK073509GCTCAGCTHypothetical protein. 
Os03g0194600009-115-B11AGCTGAGCNONE 
AK062839AGCTGAGCDOMON related domain containing protein. 
Os03g0244600011-068-A01GCTCAGCTNONE 
012-073-B08GCTCAGCTNONE 
AK103524GCTCAGCTSimilar to AUX1-like protein. 
J033028C21GCTCAGCTNONE 
J033060A06GCTCAGCTNONE 
J033131K12GCTCAGCTNONE 
J033138J09GCTCAGCTNONE 
Os03g0248300009-063-H02GCTCAGCTNONE 
AK062535GCTCAGCTSimilar to Cytochrome P450 76C4 (EC 1.14.-.-). 
Os03g0255100AK061989AGCTGAGCNONE 
Os03g0262700006-072-A10AGCTGAGCNONE 
006-075-F12AGCTGAGCNONE 
006-088-D03AGCTGAGCNONE 
AK061109AGCTGAGCHarpin-induced 1 domain containing protein. 
AK099159AGCTGAGCNONE 
AK099322AGCTGAGCNONE 
AK104530AGCTGAGCNONE 
J053024C09AGCTGAGCNONE 
J075142N24AGCTGAGCNONE 
J100064C18AGCTGAGCNONE 
Os03g0272400009-134-B08AGCTGAGCNONE 
AK070454AGCTGAGCHypothetical protein. 
J023050K07AGCTGAGCNONE 
J075075P06AGCTGAGCNONE 
J090098L07AGCTGAGCNONE 
Os03g0315800J013045O08GCTCAGCTNONE 
J053024C23GCTCAGCTNONE 
J065197C01GCTCAGCTNONE 
Os03g0339300006-027-G01AGCTGAGCNONE 
006-040-H10AGCTGAGCNONE 
006-045-F04AGCTGAGCNONE 
006-053-F06AGCTGAGCNONE 
006-054-G04AGCTGAGCNONE 
006-055-G10AGCTGAGCNONE 
006-057-B03AGCTGAGCNONE 
006-059-A11AGCTGAGCNONE 
006-063-G09AGCTGAGCNONE 
006-067-G05AGCTGAGCNONE 
006-069-B05AGCTGAGCNONE 
006-069-F04AGCTGAGCNONE 
006-073-G02AGCTGAGCNONE 
006-083-B01AGCTGAGCNONE 
006-083-C10AGCTGAGCNONE 
006-084-F11AGCTGAGCNONE 
006-085-B11AGCTGAGCNONE 
006-085-G09AGCTGAGCNONE 
006-088-C02AGCTGAGCNONE 
006-091-F07AGCTGAGCNONE 
006-097-A10AGCTGAGCNONE 
006-100-B01AGCTGAGCNONE 
006-101-F04AGCTGAGCNONE 
006-119-A01AGCTGAGCNONE 
006-119-B12AGCTGAGCNONE 
AK061545AGCTGAGCNONE 
AK067107AGCTGAGCNONE 
AK104156AGCTGAGCNONE 
AK104395AGCTGAGCSimilar to Peroxidase (EC 1.11.1.7). 
AK104470AGCTGAGCNONE 
AK104487AGCTGAGCNONE 
AK104494AGCTGAGCNONE 
AK104508AGCTGAGCNONE 
AK104573AGCTGAGCNONE 
AK104644AGCTGAGCNONE 
AK106109AGCTGAGCNONE 
J065024E15AGCTGAGCNONE 
J065025L04AGCTGAGCNONE 
Os03g0383800AK061915AGCTGAGCNucleotide-binding, alpha-beta plait domain containing protein. 
Os03g0399600AK068188GCTCAGCTConserved hypothetical protein. 
J013135E21GCTCAGCTNONE 
Os03g0417800AK058813GCTCAGCTNONE 
Os03g0421800AK099491GCTCAGCTVirulence factor, pectin lyase fold family protein. 
J065198F08GCTCAGCTNONE 
Os03g0438400AK070383GCTCAGCTCGTGGGCTCGGCTCGGCTCGGConserved hypothetical protein. 
J023054E02GCTCAGCTCGTGGGCTCGGCTCGGCTCGGNONE 
Os03g0608000AK111073AGCTGAGCHypothetical protein. 
Os03g0667500AB070226GCTCAGCTNONE 
AK107681GCTCAGCTSimilar to Metal transport protein. 
AY327039GCTCAGCTNONE 
J100018I19GCTCAGCTNONE 
J100021A21GCTCAGCTNONE 
J100023I18GCTCAGCTNONE 
J100027L17GCTCAGCTNONE 
J100036M20GCTCAGCTNONE 
J100042H20GCTCAGCTNONE 
J100061E02GCTCAGCTNONE 
J100070D23GCTCAGCTNONE 
J100070E10GCTCAGCTNONE 
J100071M08GCTCAGCTNONE 
J100080O20GCTCAGCTNONE 
J100086D19GCTCAGCTNONE 
Os03g0679700J013000M05AGCTGAGCNONE 
J013000P20AGCTGAGCNONE 
J013002H20AGCTGAGCNONE 
J013020D05AGCTGAGCNONE 
J013026P07AGCTGAGCNONE 
J013028C12AGCTGAGCNONE 
J013042F19AGCTGAGCNONE 
J013044A21AGCTGAGCNONE 
J013046C21AGCTGAGCNONE 
J013050J21AGCTGAGCNONE 
J013059N07AGCTGAGCNONE 
J013062A09AGCTGAGCNONE 
J013070O21AGCTGAGCNONE 
J013089D07AGCTGAGCNONE 
J013089E06AGCTGAGCNONE 
J013095N24AGCTGAGCNONE 
J013096B18AGCTGAGCNONE 
J013099J02AGCTGAGCNONE 
J013109F19AGCTGAGCNONE 
J013111M08AGCTGAGCNONE 
J013149F14AGCTGAGCNONE 
J013154E24AGCTGAGCNONE 
J023024H03AGCTGAGCNONE 
J053029L11AGCTGAGCNONE 
J053032K10AGCTGAGCNONE 
J053033A21AGCTGAGCNONE 
J053035O13AGCTGAGCNONE 
J053039E03AGCTGAGCNONE 
J053039L20AGCTGAGCNONE 
J053048D02AGCTGAGCNONE 
J053050G23AGCTGAGCNONE 
J053052A12AGCTGAGCNONE 
J053056D16AGCTGAGCNONE 
J053056F13AGCTGAGCNONE 
J053059O10AGCTGAGCNONE 
J053060I01AGCTGAGCNONE 
J053069H13AGCTGAGCNONE 
J053069L02AGCTGAGCNONE 
J053073O13AGCTGAGCNONE 
J053077A07AGCTGAGCNONE 
J053096E04AGCTGAGCNONE 
J053099D06AGCTGAGCNONE 
J090005H08AGCTGAGCNONE 
J090014C12AGCTGAGCNONE 
J090034K02AGCTGAGCNONE 
Os03g0760700AK060701GCTCAGCTSimilar to Aspartate-semialdehyde dehydrogenase (EC 1.2.1.11) (Fragment). 
Os03g0770800015-057-H01AGCTGAGCNONE 
AF435641AGCTGAGCNONE 
AK121805AGCTGAGCCSLC9. 
J023034N23AGCTGAGCNONE 
J023037A20AGCTGAGCNONE 
J023080E22AGCTGAGCNONE 
J023090M05AGCTGAGCNONE 
J033085E01AGCTGAGCNONE 
J033097L05AGCTGAGCNONE 
J100059A04AGCTGAGCNONE 
J100073A18AGCTGAGCNONE 
Os03g0855600006-029-G09GCTCAGCTNONE 
006-033-E02GCTCAGCTNONE 
006-069-G07GCTCAGCTNONE 
006-083-A02GCTCAGCTNONE 
006-098-H04GCTCAGCTNONE 
009-054-C04GCTCAGCTNONE 
AK060030GCTCAGCTNONE 
AK061467GCTCAGCTConserved hypothetical protein. 
AK067858GCTCAGCTNONE 
AK106030GCTCAGCTNONE 
J013123A10GCTCAGCTNONE 
J065001I24GCTCAGCTNONE 
J065015N21GCTCAGCTNONE 
J065016H07GCTCAGCTNONE 
J065040A05GCTCAGCTNONE 
J065040F01GCTCAGCTNONE 
J065066G17GCTCAGCTNONE 
J065077I09GCTCAGCTNONE 
J065099M22GCTCAGCTNONE 
J065135B13GCTCAGCTNONE 
J065144H19GCTCAGCTNONE 
J065146I03GCTCAGCTNONE 
J065169E02GCTCAGCTNONE 
J065177D21GCTCAGCTNONE 
J065189L20GCTCAGCTNONE 
J065207H13GCTCAGCTNONE 
J065210D24GCTCAGCTNONE 
J065212I03GCTCAGCTNONE 
J075007E21GCTCAGCTNONE 
J075013H07GCTCAGCTNONE 
J075023K06GCTCAGCTNONE 
J075031D23GCTCAGCTNONE 
J075038K09GCTCAGCTNONE 
J075084C08GCTCAGCTNONE 
J075098K20GCTCAGCTNONE 
J090028E04GCTCAGCTNONE 
J090031E20GCTCAGCTNONE 
J090042F06GCTCAGCTNONE 
J090049L05GCTCAGCTNONE 
J090086G03GCTCAGCTNONE 
J090096J04GCTCAGCTNONE 
J100035O03GCTCAGCTNONE 
J100053H24GCTCAGCTNONE 
J100056L17GCTCAGCTNONE 
J100058K06GCTCAGCTNONE 
J100059G09GCTCAGCTNONE 
J100081C15GCTCAGCTNONE 
Os03g0859100006-025-A05AGCTGAGCNONE 
006-028-B03AGCTGAGCNONE 
006-059-C09AGCTGAGCNONE 
009-076-G04AGCTGAGCNONE 
AK060992AGCTGAGCLipolytic enzyme, G-D-S-L family protein. 
AK109857AGCTGAGCNONE 
Os03g0859550J065092L21CGTGGGGGCTCAGCTGGGCCTCConserved hypothetical protein. 
Os04g0412300AK110902AGCTGAGCNONE 
AK121151AGCTGAGCGlycoside hydrolase, family 17 protein. 
J013126I01AGCTGAGCNONE 
J023078I08AGCTGAGCNONE 
J090006M17AGCTGAGCNONE 
J090060D03AGCTGAGCNONE 
J090063F12AGCTGAGCNONE 
J100040E06AGCTGAGCNONE 
J100057F18AGCTGAGCNONE 
J100058B19AGCTGAGCNONE 
J100058C20AGCTGAGCNONE 
J100067G08AGCTGAGCNONE 
J100082C09AGCTGAGCNONE 
J100086D14AGCTGAGCNONE 
Os04g0500700AK072528GCTCAGCTSimilar to Hydroxyanthranilate hydroxycinnamoyltransferase 3. 
AK104637GCTCAGCTNONE 
AK119237GCTCAGCTNONE 
Os04g0507100AK061905AGCTGAGCCGAGCCGNONE 
Os04g0512300AK071791GCTCAGCTArp2/3 complex, 34kDa subunit p34-Arc family protein. 
J023012N15GCTCAGCTNONE 
J023114E05GCTCAGCTNONE 
J075035B21GCTCAGCTNONE 
J075173E11GCTCAGCTNONE 
J075199P08GCTCAGCTNONE 
Os04g0528300AK058387AGCTGAGCNONE 
J013000P15AGCTGAGCNONE 
Os04g0539000009-165-H09GCTCAGCTNONE 
014-012-F10GCTCAGCTNONE 
AK105343GCTCAGCTLambda integrase-like, N-terminal domain containing protein. 
Os04g0583500009-191-G11AGCTGAGCNONE 
013-007-A10AGCTGAGCNONE 
014-046-F11AGCTGAGCNONE 
AF247165AGCTGAGCNONE 
AK062225AGCTGAGCSimilar to Expansin 4 (Fragment). 
AK066414AGCTGAGCNONE 
J013067I11AGCTGAGCNONE 
J033128H02AGCTGAGCNONE 
Os04g0590800009-126-H01GCTCAGCTNONE 
AK062895GCTCAGCTHypothetical protein. 
Os04g0614500AK100259GCTCAGCTAminotransferase class-III family protein. 
Os04g0631200013-003-B06AGCTGAGCNONE 
AK059277AGCTGAGCSimilar to Xyloglucan endotransglycosylase (Fragment). 
AK099331AGCTGAGCNONE 
J033024P08AGCTGAGCNONE 
J033041G02AGCTGAGCNONE 
J053075H12AGCTGAGCNONE 
J065016B13AGCTGAGCNONE 
J090075B22AGCTGAGCNONE 
J100084K17AGCTGAGCNONE 
Os04g0648900006-069-H01GCTCAGCTNONE 
012-095-D01GCTCAGCTNONE 
015-088-E07GCTCAGCTNONE 
AK061095GCTCAGCTSimilar to Dehydration responsive element binding protein 2F (DREB2F protein). 
AK099333GCTCAGCTNONE 
J100056E16GCTCAGCTNONE 
Os04g0650200AK072573AGCTGAGCNONE 
AK109786AGCTGAGCLipolytic enzyme, G-D-S-L family protein. 
Os04g0659400AK070174CCGAGCCGAGCCGAGCTGAGCENT domain containing protein. 
Os04g0692200006-047-H10AGCTGAGCTGAGCNONE 
006-107-D08AGCTGAGCTGAGCNONE 
009-122-B09AGCTGAGCTGAGCNONE 
AK059807AGCTGAGCTGAGCNONE 
AK060875AGCTGAGCTGAGCNONE 
AK071726AGCTGAGCTGAGCConserved hypothetical protein. 
J023110I24AGCTGAGCTGAGCNONE 
J033091O06AGCTGAGCTGAGCNONE 
J053027N16AGCTGAGCTGAGCNONE 
J053089E19AGCTGAGCTGAGCNONE 
J053098H12AGCTGAGCTGAGCNONE 
J053099N13AGCTGAGCTGAGCNONE 
J075031B15AGCTGAGCTGAGCNONE 
J080013D12AGCTGAGCTGAGCNONE 
J080013H05AGCTGAGCTGAGCNONE 
J080013H07AGCTGAGCTGAGCNONE 
J080088I03AGCTGAGCTGAGCNONE 
Os05g0150600011-043-D06AGCTGAGCNONE 
AK072977AGCTGAGCATP-dependent DNA helicase RecQ family protein. 
AY180331AGCTGAGCNONE 
J090053A16AGCTGAGCNONE 
Os05g0178300009-043-A05AGCTGAGCTGAGCNONE 
009-113-C11AGCTGAGCTGAGCNONE 
009-195-C07AGCTGAGCTGAGCNONE 
AK059243AGCTGAGCTGAGCNONE 
AK099514AGCTGAGCTGAGCConserved hypothetical protein. 
J065058J12AGCTGAGCTGAGCNONE 
J075038B08AGCTGAGCTGAGCNONE 
J090083D18AGCTGAGCTGAGCNONE 
J090088G02AGCTGAGCTGAGCNONE 
Os05g0208100AK107068GCTCAGCTSimilar to CBL-interacting serine/threonine-protein kinase 15 (EC 2.7.1.37) (Serine/threonine-protein kinase ATPK10) (SOS2-like protein kinase PKS3) (SOS-interacting protein 2) (SNF1-related kinase 3.1). 
Os05g0230700006-028-C09GCTCAGCTCAGCTNONE 
006-058-E02GCTCAGCTCAGCTNONE 
006-075-E04GCTCAGCTCAGCTNONE 
006-084-H09GCTCAGCTCAGCTNONE 
006-107-B09GCTCAGCTCAGCTNONE 
009-006-E03GCTCAGCTCAGCTNONE 
AK102762GCTCAGCTCAGCTNONE 
AK105936GCTCAGCTCAGCTNONE 
J033107D08GCTCAGCTCAGCTNONE 
J080302G01GCTCAGCTCAGCTNONE 
J090095M14GCTCAGCTCAGCTNONE 
J100047F06GCTCAGCTCAGCTNONE 
J100074H04GCTCAGCTCAGCTNONE 
J100086E04GCTCAGCTCAGCTNONE 
Os05g0298700AK108917GCTCAGCTSimilar to Xylan endohydrolase isoenzyme X-I (EC 3.2.1.8). 
Os05g0349000AK070681GCTCAGCTConserved hypothetical protein. 
AK120753GCTCAGCTNONE 
J023006K02GCTCAGCTNONE 
J023063E02GCTCAGCTNONE 
J043003J19GCTCAGCTNONE 
Os05g0358500AK060575GCTCAGCTCAGGTGGGNONE 
AK100777GCTCAGCTCAGGTGGGProtein phosphatase 2C-like domain containing protein. 
Os05g0420200AK067880AGCTGAGCProtein of unknown function DUF179 family protein. 
Os05g0437200014-036-D04GCTCAGCTNONE 
AK059283GCTCAGCTNONE 
AK121867GCTCAGCTProtein of unknown function DUF502 family protein. 
Os05g0505900AK105820AGCTGAGCNONE 
AK105820GCTCAGCTNONE 
AK106936AGCTGAGCConserved hypothetical protein. 
AK106936GCTCAGCTConserved hypothetical protein. 
Os05g0540800AK060731GCTCAGCTNONE 
AK071090GCTCAGCTHomeodomain-like containing protein. 
J013095F03GCTCAGCTNONE 
J023079C11GCTCAGCTNONE 
J033080E08GCTCAGCTNONE 
Os05g0582800006-023-G02AGCTGAGCNONE 
013-002-E03AGCTGAGCNONE 
AK069785AGCTGAGCPeptidase S10, serine carboxypeptidase family protein. 
AK105906AGCTGAGCNONE 
J023031H02AGCTGAGCNONE 
J023058O12AGCTGAGCNONE 
Os06g0111600AK065637GCTCAGCTAcyl carrier protein-like family protein. 
J013031C15GCTCAGCTNONE 
Os06g0140700009-041-G05GCTCAGCTNONE 
AF145726GCTCAGCTNONE 
AK105150GCTCAGCTNONE 
AY206864GCTCAGCTSimilar to Homeodomain leucine zipper protein (Fragment). 
Os06g0141200006-103-E07GCTCAGCTNONE 
009-044-D11GCTCAGCTNONE 
AF171223GCTCAGCTNONE 
AK061234GCTCAGCTSimilar to RNA-binding protein EWS. 
AK099058GCTCAGCTNONE 
J013154B21GCTCAGCTNONE 
J075067O16GCTCAGCTNONE 
Os06g0202600J065108E12GCTCAGCTNONE 
Os06g0233400AK061460AGCTGAGCProtein of unknown function DUF298 family protein. 
AK098976AGCTGAGCNONE 
AK099013AGCTGAGCNONE 
AK104717AGCTGAGCNONE 
J013105K08AGCTGAGCNONE 
J053101O09AGCTGAGCNONE 
J065068N19AGCTGAGCNONE 
J065131H03AGCTGAGCNONE 
J065161P05AGCTGAGCNONE 
J065162G07AGCTGAGCNONE 
J065210C14AGCTGAGCNONE 
J090070I23AGCTGAGCNONE 
J100032J12AGCTGAGCNONE 
J100045H07AGCTGAGCNONE 
J100059G22AGCTGAGCNONE 
J100076O20AGCTGAGCNONE 
J100085G05AGCTGAGCNONE 
J100087F22AGCTGAGCNONE 
J100089L23AGCTGAGCNONE 
Os06g0348800AF318581AGCTGAGCNONE 
AK061946AGCTGAGCNONE 
AK065184AGCTGAGCNONE 
AK098909AGCTGAGCNONE 
AK098915AGCTGAGCHomeodomain-like containing protein. 
AK122161AGCTGAGCNONE 
J013002D22AGCTGAGCNONE 
J013002F22AGCTGAGCNONE 
J013002I19AGCTGAGCNONE 
J013022A07AGCTGAGCNONE 
J013135J08AGCTGAGCNONE 
J033147G01AGCTGAGCNONE 
J075012G19AGCTGAGCNONE 
J075049L03AGCTGAGCNONE 
J075068G02AGCTGAGCNONE 
J075145E15AGCTGAGCNONE 
J075145J09AGCTGAGCNONE 
J075155B11AGCTGAGCNONE 
J075173E22AGCTGAGCNONE 
J075180B11AGCTGAGCNONE 
J075195D12AGCTGAGCNONE 
Os06g0672400AK068794AGCTGAGCTGAGCTTTCCCProtein of unknown function DUF640 domain containing protein. 
Os06g0680700AK064920AGCTGAGCCytochrome P450 family protein. 
Os06g0717600AK061850GCTCAGCTTTCCCNONE 
AK067113GCTCAGCTTTCCCZinc finger, RING-type domain containing protein. 
Os07g0158900003-012-H09GCTCAGCTNONE 
J013000A12GCTCAGCTNONE 
J013001C06GCTCAGCTNONE 
J013027C13GCTCAGCTNONE 
J013027E12GCTCAGCTNONE 
J013039K11GCTCAGCTNONE 
J013039P07GCTCAGCTNONE 
J013059O14GCTCAGCTNONE 
J013059O16GCTCAGCTNONE 
J013063I07GCTCAGCTNONE 
J013067I16GCTCAGCTNONE 
J013074D13GCTCAGCTNONE 
J013092G14GCTCAGCTNONE 
J013100P17GCTCAGCTNONE 
J013111A21GCTCAGCTNONE 
J013123D12GCTCAGCTNONE 
J013127A02GCTCAGCTNONE 
J013132G22GCTCAGCTNONE 
J013146N10GCTCAGCTNONE 
J013158E20GCTCAGCTNONE 
J013158I24GCTCAGCTNONE 
J013162G20GCTCAGCTNONE 
J023073F21GCTCAGCTNONE 
J023083J08GCTCAGCTNONE 
J023085D22GCTCAGCTNONE 
J023087P06GCTCAGCTNONE 
J023112P16GCTCAGCTNONE 
J023114D16GCTCAGCTNONE 
J023119N24GCTCAGCTNONE 
J033050F10GCTCAGCTNONE 
J033051D06GCTCAGCTNONE 
J033109P09GCTCAGCTNONE 
J033121B17GCTCAGCTNONE 
J033129L24GCTCAGCTNONE 
J043030A10GCTCAGCTNONE 
J065014M11GCTCAGCTNONE 
J065064L11GCTCAGCTNONE 
J065065K22GCTCAGCTNONE 
J065069C17GCTCAGCTNONE 
J065079H10GCTCAGCTNONE 
J065098E08GCTCAGCTNONE 
J065098G19GCTCAGCTNONE 
J065113I10GCTCAGCTNONE 
J065169H21GCTCAGCTNONE 
J065180B04GCTCAGCTNONE 
J065203E06GCTCAGCTNONE 
J075002A14GCTCAGCTNONE 
J075006C07GCTCAGCTNONE 
J075007C01GCTCAGCTNONE 
J075025B21GCTCAGCTNONE 
J075030E10GCTCAGCTNONE 
J075036L12GCTCAGCTNONE 
J075043M07GCTCAGCTNONE 
J075054A21GCTCAGCTNONE 
J075070I04GCTCAGCTNONE 
J075076G01GCTCAGCTNONE 
J075081C01GCTCAGCTNONE 
J075090H13GCTCAGCTNONE 
J075090J22GCTCAGCTNONE 
J075091D19GCTCAGCTNONE 
J075091P10GCTCAGCTNONE 
J075092B13GCTCAGCTNONE 
J075093L15GCTCAGCTNONE 
J075095C14GCTCAGCTNONE 
J075095E09GCTCAGCTNONE 
J075100I06GCTCAGCTNONE 
J075118N15GCTCAGCTNONE 
J075119F22GCTCAGCTNONE 
J075129G22GCTCAGCTNONE 
J075139E10GCTCAGCTNONE 
J075142A03GCTCAGCTNONE 
J075148L07GCTCAGCTNONE 
J075154L23GCTCAGCTNONE 
J075159M11GCTCAGCTNONE 
J075163G01GCTCAGCTNONE 
J075173N04GCTCAGCTNONE 
J075186J21GCTCAGCTNONE 
J090022E15GCTCAGCTNONE 
J090048L16GCTCAGCTNONE 
J090087B09GCTCAGCTNONE 
J090096E04GCTCAGCTNONE 
J100055E22GCTCAGCTNONE 
Os07g0250900AK107935AGCTGAGCHarpin-induced 1 domain containing protein. 
J075091G18AGCTGAGCNONE 
Os07g0566200011-016-A04AGCTGAGCNONE 
015-057-A04AGCTGAGCNONE 
AK069418AGCTGAGCProtein phosphatase 2C-like domain containing protein. 
AK070426AGCTGAGCNONE 
J023020C19AGCTGAGCNONE 
J023050K06AGCTGAGCNONE 
J090047F23AGCTGAGCNONE 
J090085B13AGCTGAGCNONE 
Os07g0586900AK120959GCTCAGCTCGGCTCGGCTCGGGRAS transcription factor domain containing protein. 
J090067N13GCTCAGCTCGGCTCGGCTCGGNONE 
J100035G19GCTCAGCTCGGCTCGGCTCGGNONE 
J100042K16GCTCAGCTCGGCTCGGCTCGGNONE 
J100075G15GCTCAGCTCGGCTCGGCTCGGNONE 
Os07g0600000006-021-B09AGCTGAGCNONE 
006-028-D09AGCTGAGCNONE 
013-065-H09AGCTGAGCNONE 
AK105907AGCTGAGCConserved hypothetical protein. 
Os07g0639000AK073381AGCTGAGCNONE 
AK102122AGCTGAGCSimilar to Peroxidase 1. 
J065163O11AGCTGAGCNONE 
J065191J08AGCTGAGCNONE 
J065191L24AGCTGAGCNONE 
J065212N08AGCTGAGCNONE 
J100018E10AGCTGAGCNONE 
J100087K02AGCTGAGCNONE 
Os07g0640900011-054-A08AGCTGAGCNONE 
AK063952AGCTGAGCSimilar to Heat shock transcription factor 33 (Fragment). 
AK099354AGCTGAGCNONE 
AK102159AGCTGAGCNONE 
AY344494AGCTGAGCNONE 
J033086G01AGCTGAGCNONE 
J075001L10AGCTGAGCNONE 
J090075I17AGCTGAGCNONE 
Os08g0167500006-063-D04AGCTGAGCNONE 
006-066-G09AGCTGAGCNONE 
AK061061AGCTGAGCConserved hypothetical protein. 
AK071197AGCTGAGCNONE 
J023082N10AGCTGAGCNONE 
Os08g0260600AK108529GTTTGGGCTCAGCTCD9/CD37/CD63 antigen family protein. 
Os08g0517300AK069175AGCTGAGCZinc finger, C2H2-type domain containing protein. 
Os08g0536300AF358777GCTCAGCTNONE 
AK099722GCTCAGCTSimilar to Hd1. 
J100054G13GCTCAGCTNONE 
Os09g0466300AK102696AGCTGAGCGRAM domain containing protein. 
J033103F22AGCTGAGCNONE 
Os11g0532600AK060253AGCTGAGCCCAAAALeucine-rich repeat 2 containing protein. 
J023065M14AGCTGAGCCCAAAANONE 
J023101A10AGCTGAGCCCAAAANONE 
Os11g0570000AK111751AGCTGAGCSimilar to Receptor kinase-like protein. 
J013060M13AGCTGAGCNONE 
J013104G05AGCTGAGCNONE 
J013124F03AGCTGAGCNONE 
J023002F04AGCTGAGCNONE 
J023010B08AGCTGAGCNONE 
J023024F23AGCTGAGCNONE 
J023026B16AGCTGAGCNONE 
J023034L02AGCTGAGCNONE 
J023050J11AGCTGAGCNONE 
J023098L16AGCTGAGCNONE 
J023109B14AGCTGAGCNONE 
J023130I24AGCTGAGCNONE 
J023132B14AGCTGAGCNONE 
J023141A01AGCTGAGCNONE 
J090021N24AGCTGAGCNONE 
J090061H08AGCTGAGCNONE 
Os11g0620300AJ704770GCTCAGCTNONE 
AK107901GCTCAGCTSimilar to Nonspecific lipid-transfer protein 2 (LTP 2). 
J075006M12GCTCAGCTNONE 
J075046J22GCTCAGCTNONE 
Os11g0703600006-119-F10GCTCAGCTNONE 
AK060197GCTCAGCTNONE 
AK060355GCTCAGCTConserved hypothetical protein. 
AK073953GCTCAGCTNONE 
J033076G17GCTCAGCTNONE 
J065044H14GCTCAGCTNONE 
J065090M21GCTCAGCTNONE 
J065176H11GCTCAGCTNONE 
J075011I11GCTCAGCTNONE 
J075013N03GCTCAGCTNONE 
J075019I23GCTCAGCTNONE 
J075074O07GCTCAGCTNONE 
J075095D12GCTCAGCTNONE 
J075096G19GCTCAGCTNONE 
J075118D01GCTCAGCTNONE 
J075132K12GCTCAGCTNONE 
J090061A17GCTCAGCTNONE 
J090061B08GCTCAGCTNONE 
Os12g0134600AK109609AGCTGAGCTransferase family protein. 
Os12g0138500006-054-B11AGCTGAGCNONE 
AK060933AGCTGAGCAnkyrin repeat containing protein. 
Os12g0477400J100045P07GCTCAGCTNo apical meristem (NAM) protein domain containing protein. 
J100046N20GCTCAGCTNONE 
Os12g0629700009-161-E05AGCTGAGCNONE 
009-165-H05AGCTGAGCNONE 
009-188-D03AGCTGAGCNONE 
AK099946AGCTGAGCSimilar to Thaumatin-like protein precursor. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.