version

Summary of OsREG471 (All List)

OrganismOryza sativa  
IDOsREG471  
SequenceAGGCCCAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2731  

Entry Sequences (2731 entries)

LocusGene modelSequenceDescription
Os01g0166800AK073783GGACGGCCCATTAGGCCCAATAConserved hypothetical protein. 
AK099378GGACGGCCCATTAGGCCCAATANONE 
J033026H10GGACGGCCCATTAGGCCCAATANONE 
J033067O18GGACGGCCCATTAGGCCCAATANONE 
J033108A17GGACGGCCCATTAGGCCCAATANONE 
J065015J11GGACGGCCCATTAGGCCCAATANONE 
J065204P09GGACGGCCCATTAGGCCCAATANONE 
Os01g0184800AK073377GAGGCCCAAAAPhosducin family protein. 
AK102544GAGGCCCAAAANONE 
J023047L21GAGGCCCAAAANONE 
J023135I09GAGGCCCAAAANONE 
J033028G17GAGGCCCAAAANONE 
J065164L07GAGGCCCAAAANONE 
J065193F22GAGGCCCAAAANONE 
J075035I10GAGGCCCAAAANONE 
J075168H15GAGGCCCAAAANONE 
Os01g0221300011-021-E12AAGGCCCAATTNONE 
AK073330AAGGCCCAATTConserved hypothetical protein. 
J013130J18AAGGCCCAATTNONE 
J033024A12AAGGCCCAATTNONE 
J065063H09AAGGCCCAATTNONE 
J065093G05AAGGCCCAATTNONE 
J090007K12AAGGCCCAATTNONE 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
AK069972CAAGGCCCAACASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075090M12CAAGGCCCAACANONE 
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075146A12CAAGGCCCAACANONE 
Os01g0233500AB024986TAGGCCCAAAANONE 
AK063476TAGGCCCAAAACyclin. 
Os01g0250600J075046P13AAGGCCCAAAANONE 
J075046P13CAGGCCCAATANONE 
Os01g0269100011-080-F08AAGGCCCAAACNONE 
AK067610AAGGCCCAAACSimilar to Rab proteins geranylgeranyltransferase component A 2 (Rab escort protein 2) (REP-2) (Choroideraemia-like protein). 
J013059P18AAGGCCCAAACNONE 
J013112F12AAGGCCCAAACNONE 
J023002M17AAGGCCCAAACNONE 
J023022J24AAGGCCCAAACNONE 
J033050A10AAGGCCCAAACNONE 
J033091A17AAGGCCCAAACNONE 
J033123E17AAGGCCCAAACNONE 
J033143H04AAGGCCCAAACNONE 
J043005H18AAGGCCCAAACNONE 
J075038A05AAGGCCCAAACNONE 
J075091K23AAGGCCCAAACNONE 
J075118O05AAGGCCCAAACNONE 
J075195P17AAGGCCCAAACNONE 
J090027J21AAGGCCCAAACNONE 
J100024I09AAGGCCCAAACNONE 
J100032D15AAGGCCCAAACNONE 
J100071I02AAGGCCCAAACNONE 
J100080E01AAGGCCCAAACNONE 
J100086A08AAGGCCCAAACNONE 
Os01g0277500AK066984AGTTGGGCTCTTGGGCCTCSimilar to Dof3 gene (Fragment). 
J013074F19AGTTGGGCTCTTGGGCCTCNONE 
J013091E10AGTTGGGCTCTTGGGCCTCNONE 
J023077C19AGTTGGGCTCTTGGGCCTCNONE 
J033068A02AGTTGGGCTCTTGGGCCTCNONE 
J065137O05AGTTGGGCTCTTGGGCCTCNONE 
Os01g0295900J065076G19AAGGCCCAATNONE 
Os01g0303100009-049-H10TTTTGGGCCTANONE 
AK062603TTTTGGGCCTASimilar to Chitinase precursor (EC 3.2.1.17). 
Os01g0327600AK120216ATTTGGGCCTGANONE 
AK121799ATTTGGGCCTGAConserved hypothetical protein. 
J065081I07ATTTGGGCCTGANONE 
J065082D04ATTTGGGCCTGANONE 
J065082G10ATTTGGGCCTGANONE 
J065085G24ATTTGGGCCTGANONE 
J065105J24ATTTGGGCCTGANONE 
J065128D18ATTTGGGCCTGANONE 
J065155D13ATTTGGGCCTGANONE 
J065200C11ATTTGGGCCTGANONE 
Os01g0348700009-125-H02CAAGGCCCAATCGGCCCACAANONE 
009-156-F08CAAGGCCCAATCGGCCCACAANONE 
009-177-A11CAAGGCCCAATCGGCCCACAANONE 
009-195-D02CAAGGCCCAATCGGCCCACAANONE 
013-040-B06CAAGGCCCAATCGGCCCACAANONE 
013-051-B09CAAGGCCCAATCGGCCCACAANONE 
AK120842CAAGGCCCAATCGGCCCACAASimilar to 60S ribosomal protein L23a (L25). 
J013071O22CAAGGCCCAATCGGCCCACAANONE 
J023022J07CAAGGCCCAATCGGCCCACAANONE 
J033028J08CAAGGCCCAATCGGCCCACAANONE 
J033109M11CAAGGCCCAATCGGCCCACAANONE 
J043022K15CAAGGCCCAATCGGCCCACAANONE 
J043031N11CAAGGCCCAATCGGCCCACAANONE 
J053023I10CAAGGCCCAATCGGCCCACAANONE 
J053045F16CAAGGCCCAATCGGCCCACAANONE 
J053054F22CAAGGCCCAATCGGCCCACAANONE 
J053094P15CAAGGCCCAATCGGCCCACAANONE 
J065048F01CAAGGCCCAATCGGCCCACAANONE 
J075012F16CAAGGCCCAATCGGCCCACAANONE 
J075089C09CAAGGCCCAATCGGCCCACAANONE 
J075179J20CAAGGCCCAATCGGCCCACAANONE 
J080305E19CAAGGCCCAATCGGCCCACAANONE 
J080309B21CAAGGCCCAATCGGCCCACAANONE 
J090017L05CAAGGCCCAATCGGCCCACAANONE 
J090058B11CAAGGCCCAATCGGCCCACAANONE 
Os01g0530300AK111105AAGGCCCAATTGGGCCGAHypothetical protein. 
J090023M11AAGGCCCAATTGGGCCGANONE 
J090053G13AAGGCCCAATTGGGCCGANONE 
Os01g0530400016-019-E07AAGGCCCAACNONE 
AK103724AAGGCCCAACNONE 
AK106476AAGGCCCAACGlutaredoxin-related protein family protein. 
J023108F14AAGGCCCAACNONE 
J033138C10AAGGCCCAACNONE 
Os01g0533900AK101194GAGGCCCAAACSimilar to Multidrug resistance protein 1 homolog. 
AK101194TAGGCCCAAAASimilar to Multidrug resistance protein 1 homolog. 
Os01g0546900AK073801GAGGCCCAACCTranscription factor jumonji/aspartyl beta-hydroxylase domain containing protein. 
Os01g0560200AK102003AAATGGGCAAGGCCCAATTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
J033079N06AAATGGGCAAGGCCCAATTNONE 
J065092F14AAATGGGCAAGGCCCAATTNONE 
J065106D04AAATGGGCAAGGCCCAATTNONE 
J065194K23AAATGGGCAAGGCCCAATTNONE 
Os01g0571200014-074-A10ATTTGGGCCTANONE 
AK121299ATTTGGGCCTASimilar to Ribosomal protein L34. 
J023110L12ATTTGGGCCTANONE 
Os01g0588200006-052-E10CCAGGCCCAACCAAGCCCACGGNONE 
AJ251563CCAGGCCCAACCAAGCCCACGGNONE 
AK070745CCAGGCCCAACCAAGCCCACGGVoltage-dependent anion channel. 
AK104055CCAGGCCCAACCAAGCCCACGGNONE 
AK104419CCAGGCCCAACCAAGCCCACGGNONE 
J023057A07CCAGGCCCAACCAAGCCCACGGNONE 
J023068C08CCAGGCCCAACCAAGCCCACGGNONE 
J023148E24CCAGGCCCAACCAAGCCCACGGNONE 
J090045O22CCAGGCCCAACCAAGCCCACGGNONE 
J090045P03CCAGGCCCAACCAAGCCCACGGNONE 
J090050C18CCAGGCCCAACCAAGCCCACGGNONE 
J100023F01CCAGGCCCAACCAAGCCCACGGNONE 
J100051I18CCAGGCCCAACCAAGCCCACGGNONE 
J100060P17CCAGGCCCAACCAAGCCCACGGNONE 
Os01g0621700AK108938AAGGCCCAAAMyosin tail 2 domain containing protein. 
J100033P13AAGGCCCAAANONE 
Os01g0642900009-109-F01GAGGCCCAAAANONE 
AK063836GAGGCCCAAAASingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560GAGGCCCAAAANONE 
J033043K18GAGGCCCAAAANONE 
J100023C05GAGGCCCAAAANONE 
J100038C15GAGGCCCAAAANONE 
J100039C23GAGGCCCAAAANONE 
Os01g0679600009-061-F03AAAGCCCAATAGGCCCAATANONE 
014-055-H04AAAGCCCAATAGGCCCAATANONE 
AK062530AAAGCCCAATAGGCCCAATAConserved hypothetical protein. 
J065015E10AAAGCCCAATAGGCCCAATANONE 
J065061F21AAAGCCCAATAGGCCCAATANONE 
J065128F13AAAGCCCAATAGGCCCAATANONE 
J065189E14AAAGCCCAATAGGCCCAATANONE 
J075006F04AAAGCCCAATAGGCCCAATANONE 
J075017A20AAAGCCCAATAGGCCCAATANONE 
J075075H02AAAGCCCAATAGGCCCAATANONE 
J075104C06AAAGCCCAATAGGCCCAATANONE 
J075154F23AAAGCCCAATAGGCCCAATANONE 
J075168N01AAAGCCCAATAGGCCCAATANONE 
J075189L15AAAGCCCAATAGGCCCAATANONE 
J075192J18AAAGCCCAATAGGCCCAATANONE 
J100062M10AAAGCCCAATAGGCCCAATANONE 
J100064C23AAAGCCCAATAGGCCCAATANONE 
J100080M16AAAGCCCAATAGGCCCAATANONE 
Os01g0681100016-048-E04TTTTGGGCCTTGNONE 
AK072230TTTTGGGCCTTGSimilar to Dynamin-related protein 1B (Dynamin-like protein B). 
J023002D21TTTTGGGCCTTGNONE 
J033136O22TTTTGGGCCTTGNONE 
Os01g0695200015-090-F01GAGGCCCAAAANONE 
AK064145GAGGCCCAAAAProtein of unknown function DUF266, plant family protein. 
J065163N10GAGGCCCAAAANONE 
J100051F21GAGGCCCAAAANONE 
Os01g0700200AK100961TAGGCCCAAGCCCATCCASimilar to Chromosome condensation regulator protein (Fragment). 
J023141C11TAGGCCCAAGCCCATCCANONE 
Os01g0707300AK059962TGTTGGGCCTTNONE 
AK104463TGTTGGGCCTTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0710800013-097-E05TTTTGGGCCTTAGGCCCATATNONE 
AK069973TTTTGGGCCTTAGGCCCATATNONE 
AK071099TTTTGGGCCTTAGGCCCATATConserved hypothetical protein. 
J023081K01TTTTGGGCCTTAGGCCCATATNONE 
J023123E16TTTTGGGCCTTAGGCCCATATNONE 
J033066B11TTTTGGGCCTTAGGCCCATATNONE 
J065144G11TTTTGGGCCTTAGGCCCATATNONE 
Os01g0715800011-061-G06TGTTGGGCCTTNONE 
AK063369TGTTGGGCCTTConserved hypothetical protein. 
J065194O22TGTTGGGCCTTNONE 
Os01g0737900012-087-D12AAGGCCCATTGGGCCTTNONE 
012-087-D12ATTTGGGCCTANONE 
AK072600AAGGCCCATTGGGCCTTProtein prenyltransferase domain containing protein. 
AK072600ATTTGGGCCTAProtein prenyltransferase domain containing protein. 
J023006E12AAGGCCCATTGGGCCTTNONE 
J023006E12ATTTGGGCCTANONE 
J023130A18AAGGCCCATTGGGCCTTNONE 
J023130A18ATTTGGGCCTANONE 
J023134O05AAGGCCCATTGGGCCTTNONE 
J023134O05ATTTGGGCCTANONE 
Os01g0738600AK073479GAGGCCCAAACENTH/VHS domain containing protein. 
AK120616GAGGCCCAAACNONE 
J013046M12GAGGCCCAAACNONE 
J013152B11GAGGCCCAAACNONE 
J023007A09GAGGCCCAAACNONE 
J023007N03GAGGCCCAAACNONE 
J023042A01GAGGCCCAAACNONE 
J023059P06GAGGCCCAAACNONE 
J023113A05GAGGCCCAAACNONE 
J033044K11GAGGCCCAAACNONE 
J033082E04GAGGCCCAAACNONE 
J090033B13GAGGCCCAAACNONE 
J090062H08GAGGCCCAAACNONE 
J100086G23GAGGCCCAAACNONE 
Os01g0742400AK109885AGTTGGGCCTTNONE 
AK119360AGTTGGGCCTTNONE 
AK120741AGTTGGGCCTTProtein kinase-like domain containing protein. 
J023003P18AGTTGGGCCTTNONE 
Os01g0773200015-072-C12CCAGGCCCAAATAGGCCCAGTNONE 
Os01g0785700AK100774AGCCGTTGGGCCTGNONE 
AK102081AGCCGTTGGGCCTGProtein prenyltransferase domain containing protein. 
AY129829AGCCGTTGGGCCTGNONE 
J023120B17AGCCGTTGGGCCTGNONE 
J033082K10AGCCGTTGGGCCTGNONE 
Os01g0805800006-057-H04CAAGGCCCAATNONE 
006-106-H01CAAGGCCCAATNONE 
AK059963CAAGGCCCAATNONE 
AK103408CAAGGCCCAATRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0810000AK102143ATATGGGCCGTCAGGCCCAATTNONE 
AK120752ATATGGGCCGTCAGGCCCAATTUtp11 family protein. 
J023006E09ATATGGGCCGTCAGGCCCAATTNONE 
J033086A13ATATGGGCCGTCAGGCCCAATTNONE 
J033133K07ATATGGGCCGTCAGGCCCAATTNONE 
J065066L16ATATGGGCCGTCAGGCCCAATTNONE 
J065161C01ATATGGGCCGTCAGGCCCAATTNONE 
J100027D18ATATGGGCCGTCAGGCCCAATTNONE 
J100063J12ATATGGGCCGTCAGGCCCAATTNONE 
Os01g0817700006-112-C04TGTTGGGCCTGNONE 
Os01g0836400AK073540GTTGGGCCTGSAC3/GANP family protein. 
J023019D11GTTGGGCCTGNONE 
J023139O22GTTGGGCCTGNONE 
J033042J20GTTGGGCCTGNONE 
J033046M18GTTGGGCCTGNONE 
J033124J09GTTGGGCCTGNONE 
J090015E05GTTGGGCCTGNONE 
J090076J09GTTGGGCCTGNONE 
Os01g0851000AK065338TGTTGGGCCTAPfkB domain containing protein. 
Os01g0852200AK063954CCAGGCCCAAGCCCNONE 
Os01g0853700AK111988CAAGGCCCAATSimilar to MCB1 protein. 
J075050N16CAAGGCCCAATNONE 
J075117H23CAAGGCCCAATNONE 
Os01g0853800006-033-H02TCAGGCCCAATTNONE 
006-037-A10TCAGGCCCAATTNONE 
006-038-F10TCAGGCCCAATTNONE 
006-054-E01TCAGGCCCAATTNONE 
006-067-E10TCAGGCCCAATTNONE 
012-015-G05TCAGGCCCAATTNONE 
AK069147TCAGGCCCAATTC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK105929TCAGGCCCAATTNONE 
AK106144TCAGGCCCAATTNONE 
AK106186TCAGGCCCAATTNONE 
J023007P09TCAGGCCCAATTNONE 
J023007P10TCAGGCCCAATTNONE 
J065084L10TCAGGCCCAATTNONE 
J065179B10TCAGGCCCAATTNONE 
J065186D16TCAGGCCCAATTNONE 
J075040I08TCAGGCCCAATTNONE 
J075043K21TCAGGCCCAATTNONE 
J075051J08TCAGGCCCAATTNONE 
J075061D24TCAGGCCCAATTNONE 
J075095H04TCAGGCCCAATTNONE 
J075145J12TCAGGCCCAATTNONE 
J075148O18TCAGGCCCAATTNONE 
J075187J05TCAGGCCCAATTNONE 
J090042A20TCAGGCCCAATTNONE 
J100025K01TCAGGCCCAATTNONE 
Os01g0872700AK066633TTGGGCCTANONE 
AK100381TTGGGCCTAPutative 5-3 exonuclease domain containing protein. 
J013028K13TTGGGCCTANONE 
J013038C19TTGGGCCTANONE 
J023024P16TTGGGCCTANONE 
J023074N21TTGGGCCTANONE 
J023085E21TTGGGCCTANONE 
J033034K14TTGGGCCTANONE 
J033044N04TTGGGCCTANONE 
J033052O10TTGGGCCTANONE 
J033087J09TTGGGCCTANONE 
J033129L17TTGGGCCTANONE 
J033143O07TTGGGCCTANONE 
J065014M22TTGGGCCTANONE 
J065025H10TTGGGCCTANONE 
J065051H21TTGGGCCTANONE 
J065123E05TTGGGCCTANONE 
J065181P03TTGGGCCTANONE 
J100064B21TTGGGCCTANONE 
Os01g0887700AF045571TCTGGGCCTTGGGCCTTNONE 
AF047428TCTGGGCCTTGGGCCTTNONE 
AK071139TCTGGGCCTTGGGCCTTZinc finger, FYVE/PHD-type domain containing protein. 
J023082D05TCTGGGCCTTGGGCCTTNONE 
J065062L19TCTGGGCCTTGGGCCTTNONE 
J065116H15TCTGGGCCTTGGGCCTTNONE 
J065194N09TCTGGGCCTTGGGCCTTNONE 
J100074C19TCTGGGCCTTGGGCCTTNONE 
Os01g0889000AK103621ATGGCCCACGAGGCCCAAATTetratricopeptide-like helical domain containing protein. 
Os01g0907300015-031-F03TGTTGGGCCTANONE 
AK103626TGTTGGGCCTAConserved hypothetical protein. 
AK108617TGTTGGGCCTANONE 
J013094D23TGTTGGGCCTANONE 
J013106G24TGTTGGGCCTANONE 
J013120M13TGTTGGGCCTANONE 
J023056M16TGTTGGGCCTANONE 
J023092M24TGTTGGGCCTANONE 
J033133N22TGTTGGGCCTANONE 
J043010O12TGTTGGGCCTANONE 
Os01g0917400AK111958GTTTGGGCCTANONE 
Os01g0920400016-005-B10AATTGGGCCTANONE 
AK073965AATTGGGCCTASimilar to Dynamin-related protein 3A (Dynamin-like protein 2) (Dynamin-like protein 2a). Splice isoform 2. 
J013023K02AATTGGGCCTANONE 
J023008G04AATTGGGCCTANONE 
J033072A13AATTGGGCCTANONE 
J033106F08AATTGGGCCTANONE 
J043009F23AATTGGGCCTANONE 
J043027F03AATTGGGCCTANONE 
J065009O17AATTGGGCCTANONE 
J065046M03AATTGGGCCTANONE 
J065051H14AATTGGGCCTANONE 
J065077G12AATTGGGCCTANONE 
J065082M20AATTGGGCCTANONE 
J065087O20AATTGGGCCTANONE 
J065123N10AATTGGGCCTANONE 
J065124O16AATTGGGCCTANONE 
J065163P15AATTGGGCCTANONE 
J065166D19AATTGGGCCTANONE 
J065212C15AATTGGGCCTANONE 
J065219F23AATTGGGCCTANONE 
J075068F08AATTGGGCCTANONE 
J075139J12AATTGGGCCTANONE 
J075196K05AATTGGGCCTANONE 
J090050D18AATTGGGCCTANONE 
J090099H08AATTGGGCCTANONE 
J100029L12AATTGGGCCTANONE 
J100044C19AATTGGGCCTANONE 
J100056L03AATTGGGCCTANONE 
J100078E23AATTGGGCCTANONE 
J100087E19AATTGGGCCTANONE 
Os01g0929500AK111399AGTTGGGCCTTACTGGGCCGGTSimilar to Carbonyl reductase-like protein. 
AK120263AGTTGGGCCTTACTGGGCCGGTNONE 
Os01g0937300AK062872TTTTGGGCCTANONE 
J033136K12TTTTGGGCCTANONE 
J053048E20TTTTGGGCCTANONE 
J053088K08TTTTGGGCCTANONE 
J065011G23TTTTGGGCCTANONE 
J065202J09TTTTGGGCCTANONE 
Os01g0945300003-104-D07TATTGGGCCTANONE 
AK065371TATTGGGCCTAAmino acid/polyamine transporter I family protein. 
AK072189TATTGGGCCTANONE 
J013023D09TATTGGGCCTANONE 
J013055J18TATTGGGCCTANONE 
J013146P21TATTGGGCCTANONE 
J075109G14TATTGGGCCTANONE 
J075158O19TATTGGGCCTANONE 
Os01g0970900011-018-A07AAGGCCCAAGNONE 
011-018-A07ATTGGGCCTANONE 
011-022-E12AAGGCCCAAGNONE 
011-022-E12ATTGGGCCTANONE 
AK063285AAGGCCCAAGNONE 
AK063285ATTGGGCCTANONE 
AK101688AAGGCCCAAGProtein prenyltransferase domain containing protein. 
AK101688ATTGGGCCTAProtein prenyltransferase domain containing protein. 
J100042L01AAGGCCCAAGNONE 
J100042L01ATTGGGCCTANONE 
J100053B11AAGGCCCAAGNONE 
J100053B11ATTGGGCCTANONE 
Os01g0971600AK070366GTTTGGGCCTTGSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
Os02g0102700006-096-A07GTTTGGGCCTTNONE 
006-096-A07TAGGCCCAAATNONE 
AK061193GTTTGGGCCTTSimilar to AGL157Cp. 
AK061193TAGGCCCAAATSimilar to AGL157Cp. 
AK061558GTTTGGGCCTTNONE 
AK061558TAGGCCCAAATNONE 
AK103689GTTTGGGCCTTNONE 
AK103689TAGGCCCAAATNONE 
J023128B06GTTTGGGCCTTNONE 
J023128B06TAGGCCCAAATNONE 
J033136G21GTTTGGGCCTTNONE 
J033136G21TAGGCCCAAATNONE 
J053084F10GTTTGGGCCTTNONE 
J053084F10TAGGCCCAAATNONE 
J053089D12GTTTGGGCCTTNONE 
J053089D12TAGGCCCAAATNONE 
J075149B12GTTTGGGCCTTNONE 
J075149B12TAGGCCCAAATNONE 
J075165L17GTTTGGGCCTTNONE 
J075165L17TAGGCCCAAATNONE 
Os02g0103700009-031-C12TAGGCCCAATANONE 
AK062502TAGGCCCAATANONE 
AK102186TAGGCCCAATASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17TAGGCCCAATANONE 
J065161I07TAGGCCCAATANONE 
J065184G15TAGGCCCAATANONE 
J075123E02TAGGCCCAATANONE 
Os02g0135600AK069843GAGGCCCAAGConserved hypothetical protein. 
J023034H09GAGGCCCAAGNONE 
J033090D08GAGGCCCAAGNONE 
J100025N07GAGGCCCAAGNONE 
J100075G18GAGGCCCAAGNONE 
Os02g0135700AK100570CTTGGGCCTCDNA polymerase V family protein. 
Os02g0169000AK101628CAAGGCCCAAGConserved hypothetical protein. 
Os02g0176300AK066588TGTTGGGCTTGGGCCTCGGCCCAGGConserved hypothetical protein. 
J013072N24TGTTGGGCTTGGGCCTCGGCCCAGGNONE 
Os02g0180100005-013-B11GAGGCCCAACCNONE 
AK067359GAGGCCCAACCPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein. 
AK104700GAGGCCCAACCNONE 
J013090O22GAGGCCCAACCNONE 
J013099P19GAGGCCCAACCNONE 
J090041M21GAGGCCCAACCNONE 
J090049C14GAGGCCCAACCNONE 
Os02g0186700AK064492GAGGCCCAAATConserved hypothetical protein. 
J065210K09GAGGCCCAAATNONE 
J075006A17GAGGCCCAAATNONE 
J075108C18GAGGCCCAAATNONE 
J075153E08GAGGCCCAAATNONE 
Os02g0192700004-020-H12TAGGCCCAACCNONE 
006-024-H06TAGGCCCAACCNONE 
006-042-F06TAGGCCCAACCNONE 
006-050-D04TAGGCCCAACCNONE 
006-059-E10TAGGCCCAACCNONE 
006-070-B02TAGGCCCAACCNONE 
006-084-A09TAGGCCCAACCNONE 
006-114-E11TAGGCCCAACCNONE 
006-117-E05TAGGCCCAACCNONE 
009-126-D11TAGGCCCAACCNONE 
AK061629TAGGCCCAACCSimilar to Thioredoxin peroxidase. 
AK065909TAGGCCCAACCNONE 
J013043E11TAGGCCCAACCNONE 
J065038I09TAGGCCCAACCNONE 
J065078C12TAGGCCCAACCNONE 
J065122O14TAGGCCCAACCNONE 
J065198H04TAGGCCCAACCNONE 
Os02g0220600AK103901AAGGCCCAACANONE 
J013058O03AAGGCCCAACANONE 
J013124E21AAGGCCCAACANONE 
J023023L03AAGGCCCAACANONE 
J023023L21AAGGCCCAACANONE 
J023061N01AAGGCCCAACANONE 
J023065O09AAGGCCCAACANONE 
J023106J17AAGGCCCAACANONE 
J023119N08AAGGCCCAACANONE 
J033058A19AAGGCCCAACANONE 
J033098O13AAGGCCCAACANONE 
J033100M18AAGGCCCAACANONE 
J033125A21AAGGCCCAACANONE 
J033148C12AAGGCCCAACANONE 
J043017F03AAGGCCCAACANONE 
J043032J02AAGGCCCAACANONE 
J053047N10AAGGCCCAACANONE 
J053089P04AAGGCCCAACANONE 
J065051K09AAGGCCCAACANONE 
J065064H24AAGGCCCAACANONE 
J090001L06AAGGCCCAACANONE 
J090017C24AAGGCCCAACANONE 
J090058G15AAGGCCCAACANONE 
J090058H23AAGGCCCAACANONE 
J090061G20AAGGCCCAACANONE 
J090069N23AAGGCCCAACANONE 
J090071A08AAGGCCCAACANONE 
J090074A08AAGGCCCAACANONE 
J090077B15AAGGCCCAACANONE 
J090081K06AAGGCCCAACANONE 
J090083I05AAGGCCCAACANONE 
J090091O22AAGGCCCAACANONE 
J090097L10AAGGCCCAACANONE 
J100026B11AAGGCCCAACANONE 
J100044M01AAGGCCCAACANONE 
J100046F10AAGGCCCAACANONE 
J100051K14AAGGCCCAACANONE 
J100060D22AAGGCCCAACANONE 
J100060H18AAGGCCCAACANONE 
J100070I06AAGGCCCAACANONE 
J100071C04AAGGCCCAACANONE 
J100078M13AAGGCCCAACANONE 
J100080E17AAGGCCCAACANONE 
J100083I09AAGGCCCAACANONE 
Os02g0236100AK120541AAGGCCCAATTSimilar to SERK1 (Fragment). 
Os02g0252100AF139211TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AF139211TATTGGGCCTGANONE 
AK062577TACGGCCCATTAAAGCCCAGGCCCAAAASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK062577TATTGGGCCTGASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
AK099051TATTGGGCCTGANONE 
J013156E01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J013156E01TATTGGGCCTGANONE 
J065001D02TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065001D02TATTGGGCCTGANONE 
J065042A05TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065042A05TATTGGGCCTGANONE 
J065116H01TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065116H01TATTGGGCCTGANONE 
J065167P13TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065167P13TATTGGGCCTGANONE 
J065168N07TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J065168N07TATTGGGCCTGANONE 
J075093G21TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075093G21TATTGGGCCTGANONE 
J075109H15TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075109H15TATTGGGCCTGANONE 
J075194P17TACGGCCCATTAAAGCCCAGGCCCAAAANONE 
J075194P17TATTGGGCCTGANONE 
Os02g0255200AK121591AAGGCCCAAGGCCCATTASimilar to Ribosomal protein S15a homolog. 
J033023N03AAGGCCCAAGGCCCATTANONE 
J033031C22AAGGCCCAAGGCCCATTANONE 
J033037P22AAGGCCCAAGGCCCATTANONE 
J090013J10AAGGCCCAAGGCCCATTANONE 
J090030I04AAGGCCCAAGGCCCATTANONE 
Os02g0256000AK108573GGTTGGGCCTGGConserved hypothetical protein. 
Os02g0266500AK100307GGTTGGGCCTCSimilar to RASPBERRY3. 
Os02g0304800Os02g0304800GAGGCCCAAProtein prenyltransferase domain containing protein. 
Os02g0497700011-094-A10AAGGCCCAAAANONE 
012-073-H02AAGGCCCAAAANONE 
016-056-G05AAGGCCCAAAANONE 
AK070143AAGGCCCAAAANONE 
J023041O14AAGGCCCAAAANONE 
J023092H01AAGGCCCAAAANONE 
J033048A17AAGGCCCAAAANONE 
J033051K21AAGGCCCAAAANONE 
J033122D01AAGGCCCAAAANONE 
J090032E23AAGGCCCAAAANONE 
J090055K13AAGGCCCAAAANONE 
Os02g0522000AK101294ATTTGGGCCTTGGGCTGTRetrotransposon gag protein family protein. 
Os02g0525400011-008-B01CAAGGCCCAAGNONE 
011-008-B01CAGGCCCAAANONE 
AK065368CAAGGCCCAAGSimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
AK065368CAGGCCCAAASimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
J013021B13CAAGGCCCAAGNONE 
J013021B13CAGGCCCAAANONE 
J033046H10CAAGGCCCAAGNONE 
J033046H10CAGGCCCAAANONE 
Os02g0533800009-149-F12GAGGCCCAAACNONE 
013-058-H02GAGGCCCAAACNONE 
014-017-G07GAGGCCCAAACNONE 
014-028-F04GAGGCCCAAACNONE 
014-050-G04GAGGCCCAAACNONE 
014-095-F04GAGGCCCAAACNONE 
014-099-C08GAGGCCCAAACNONE 
016-046-F05GAGGCCCAAACNONE 
AK121139GAGGCCCAAACConserved hypothetical protein. 
J013104A14GAGGCCCAAACNONE 
J023077F13GAGGCCCAAACNONE 
J023145I11GAGGCCCAAACNONE 
J065033D14GAGGCCCAAACNONE 
J065079I15GAGGCCCAAACNONE 
J065104E21GAGGCCCAAACNONE 
J065128E06GAGGCCCAAACNONE 
J065174F07GAGGCCCAAACNONE 
J065195B12GAGGCCCAAACNONE 
J065207B12GAGGCCCAAACNONE 
J080304M24GAGGCCCAAACNONE 
J090040A13GAGGCCCAAACNONE 
J090054B18GAGGCCCAAACNONE 
J100037A06GAGGCCCAAACNONE 
J100042F24GAGGCCCAAACNONE 
J100043N23GAGGCCCAAACNONE 
J100044H14GAGGCCCAAACNONE 
J100056K24GAGGCCCAAACNONE 
J100063O22GAGGCCCAAACNONE 
J100071G05GAGGCCCAAACNONE 
J100078G15GAGGCCCAAACNONE 
Os02g0533900AB062681GTTTGGGCCTCNONE 
AK061722GTTTGGGCCTCNONE 
AK106147GTTTGGGCCTCNONE 
AK121892GTTTGGGCCTCSimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0543000009-061-H02GAGGCCCAAACNONE 
009-123-H02GAGGCCCAAACNONE 
009-192-D09GAGGCCCAAACNONE 
009-197-F06GAGGCCCAAACNONE 
AK060261GAGGCCCAAACNONE 
AK062319GAGGCCCAAACABA/WDS induced protein family protein. 
AK062880GAGGCCCAAACNONE 
AK063217GAGGCCCAAACNONE 
AK066415GAGGCCCAAACNONE 
J065084L15GAGGCCCAAACNONE 
J065207N17GAGGCCCAAACNONE 
J075088J03GAGGCCCAAACNONE 
J100024G08GAGGCCCAAACNONE 
J100027P19GAGGCCCAAACNONE 
J100052E02GAGGCCCAAACNONE 
J100055B02GAGGCCCAAACNONE 
Os02g0567000AK068282TAGGCCCAAATConserved hypothetical protein. 
J075034A17TAGGCCCAAATNONE 
J075129I09TAGGCCCAAATNONE 
Os02g0578400Os02g0578400GAGGCCCAAATPhotosystem II oxygen evolving complex protein PsbQ family protein. 
Os02g0606900J023065M01TAGGCCCAATANONE 
J075046E14TAGGCCCAATANONE 
Os02g0610700014-008-A03TAAGCCCACGTAGGCCCAAACNONE 
AK059205TAAGCCCACGTAGGCCCAAACConserved hypothetical protein. 
AK100281TAAGCCCACGTAGGCCCAAACNONE 
J023074H03TAAGCCCACGTAGGCCCAAACNONE 
J065002J16TAAGCCCACGTAGGCCCAAACNONE 
J065032I20TAAGCCCACGTAGGCCCAAACNONE 
J065076A07TAAGCCCACGTAGGCCCAAACNONE 
J065142O21TAAGCCCACGTAGGCCCAAACNONE 
J065203A03TAAGCCCACGTAGGCCCAAACNONE 
J075017F24TAAGCCCACGTAGGCCCAAACNONE 
J075017G24TAAGCCCACGTAGGCCCAAACNONE 
Os02g0621600AK071074AAGGCCCAAATNONE 
AK108575AAGGCCCAAATConserved hypothetical protein. 
J023078O20AAGGCCCAAATNONE 
J075025M01AAGGCCCAAATNONE 
J090047L11AAGGCCCAAATNONE 
Os02g0665400AK073914CTTGGGCCTANONE 
AK109787CTTGGGCCTANONE 
AK120141CTTGGGCCTASimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19CTTGGGCCTANONE 
J075165B08CTTGGGCCTANONE 
J075177B03CTTGGGCCTANONE 
J075191K02CTTGGGCCTANONE 
J090051I12CTTGGGCCTANONE 
J090057E21CTTGGGCCTANONE 
J090058E01CTTGGGCCTANONE 
J090087C06CTTGGGCCTANONE 
J100025K07CTTGGGCCTANONE 
J100026I21CTTGGGCCTANONE 
J100041E12CTTGGGCCTANONE 
J100083B01CTTGGGCCTANONE 
Os02g0670400009-189-H11AAGGCCCAATANONE 
AB079636AAGGCCCAATASimilar to HMGc1 protein. 
J090001B08AAGGCCCAATANONE 
Os02g0672700AK059611AAGGCCCAACAAGCCCAACTDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179AAGGCCCAACAAGCCCAACTNONE 
J023098L23AAGGCCCAACAAGCCCAACTNONE 
J065042J21AAGGCCCAACAAGCCCAACTNONE 
J065187L09AAGGCCCAACAAGCCCAACTNONE 
J065190O10AAGGCCCAACAAGCCCAACTNONE 
J080041G14AAGGCCCAACAAGCCCAACTNONE 
J080078K08AAGGCCCAACAAGCCCAACTNONE 
J080089D20AAGGCCCAACAAGCCCAACTNONE 
J080094D04AAGGCCCAACAAGCCCAACTNONE 
Os02g0688900AK066093AAGGCCCAATGPI transamidase subunit PIG-U family protein. 
J065007D18AAGGCCCAATNONE 
J065040G21AAGGCCCAATNONE 
J065103G03AAGGCCCAATNONE 
J065175F18AAGGCCCAATNONE 
J065202A07AAGGCCCAATNONE 
J075006C01AAGGCCCAATNONE 
J075178F24AAGGCCCAATNONE 
Os02g0689200011-024-D04TAGGCCCAAANONE 
AK071254TAGGCCCAAANONE 
AK072660TAGGCCCAAAProtein of unknown function DUF250 domain containing protein. 
J023087G23TAGGCCCAAANONE 
J023134O11TAGGCCCAAANONE 
J033095E21TAGGCCCAAANONE 
J033113F12TAGGCCCAAANONE 
J033124F02TAGGCCCAAANONE 
J065070A01TAGGCCCAAANONE 
J065129C05TAGGCCCAAANONE 
J065165M19TAGGCCCAAANONE 
J090015K07TAGGCCCAAANONE 
J090066D21TAGGCCCAAANONE 
J090075M20TAGGCCCAAANONE 
Os02g0689700AK063776GAGGCCCAACCRibosomal protein L18P/L5E family protein. 
Os02g0725200005-020-F05AAGGCCCAATANONE 
AK058309AAGGCCCAATANONE 
AK103602AAGGCCCAATARubisco methyltransferase family protein. 
J013109C13AAGGCCCAATANONE 
J033133G01AAGGCCCAATANONE 
J075087L23AAGGCCCAATANONE 
J090073J10AAGGCCCAATANONE 
Os02g0727400AK068514TATTGGGCCTTConserved hypothetical protein. 
Os02g0740300AK067833TAAGCCCATTTTGGGCCTGAAA ATPase domain containing protein. 
Os02g0767900009-154-G01GTTGGGCCTGGNONE 
009-172-H09GTTGGGCCTGGNONE 
AK099885GTTGGGCCTGGGlutaredoxin 2 family protein. 
Os02g0772500AK100349GAGGCCCAATAProtein prenyltransferase domain containing protein. 
J023082M21GAGGCCCAATANONE 
J065047H11GAGGCCCAATANONE 
J065055F20GAGGCCCAATANONE 
J065082I22GAGGCCCAATANONE 
J100074B04GAGGCCCAATANONE 
Os02g0780500AK072784CCATGGGCCGGACCGTTGGGCCTCNONE 
AK121143CCATGGGCCGGACCGTTGGGCCTCConserved hypothetical protein. 
J023075M13CCATGGGCCGGACCGTTGGGCCTCNONE 
J023077P14CCATGGGCCGGACCGTTGGGCCTCNONE 
J023123C16CCATGGGCCGGACCGTTGGGCCTCNONE 
J023142P06CCATGGGCCGGACCGTTGGGCCTCNONE 
Os02g0788400AK060351TAGGCCCAATANONE 
AK103497TAGGCCCAATASimilar to Eukaryotic translation initiation factor 3 subunit-like protein. 
Os02g0794400AK065845ATTGGGCCTTInitiation factor 3 family protein. 
J013042M03ATTGGGCCTTNONE 
Os02g0800000J100043O08GCTGGGCCTTGGGCCTTGGGCTNONE 
J100043O08TATTGGGCCTGNONE 
J100064O18GCTGGGCCTTGGGCCTTGGGCTNONE 
J100064O18TATTGGGCCTGNONE 
Os02g0804300006-046-D12TTTTGGGCCTTNONE 
AK060165TTTTGGGCCTTNONE 
AK067584TTTTGGGCCTTSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12TTTTGGGCCTTNONE 
J023098C22TTTTGGGCCTTNONE 
J033123P06TTTTGGGCCTTNONE 
J065060N24TTTTGGGCCTTNONE 
J065069H22TTTTGGGCCTTNONE 
J065155N20TTTTGGGCCTTNONE 
J065170K07TTTTGGGCCTTNONE 
J090033D12TTTTGGGCCTTNONE 
Os02g0805600006-054-D07CCAGGCCCAAGGCCCATCTNONE 
AK059822CCAGGCCCAAGGCCCATCTNONE 
AK099516CCAGGCCCAAGGCCCATCTSimilar to Alcohol dehydrogenase, zinc-containing. 
AK104587CCAGGCCCAAGGCCCATCTNONE 
J065037H22CCAGGCCCAAGGCCCATCTNONE 
J090015P17CCAGGCCCAAGGCCCATCTNONE 
Os02g0814300AK111376GAGGCCCAAATCytochrome c, monohaem domain containing protein. 
J065063I24GAGGCCCAAATNONE 
Os02g0814800AK109850TATTGGGCCTGGGlutathione S-transferase, C-terminal-like domain containing protein. 
Os02g0816700009-132-E07GAGGCCCAATTNONE 
AK059572GAGGCCCAATTConserved hypothetical protein. 
Os02g0816800013-089-A09AATTGGGCCTCNONE 
AK102271AATTGGGCCTCNAD-dependent epimerase/dehydratase family protein. 
J013105O04AATTGGGCCTCNONE 
J013124I08AATTGGGCCTCNONE 
J023002E08AATTGGGCCTCNONE 
J023025C01AATTGGGCCTCNONE 
J023037O12AATTGGGCCTCNONE 
J023049N06AATTGGGCCTCNONE 
J023069G18AATTGGGCCTCNONE 
J033029M02AATTGGGCCTCNONE 
J033037L22AATTGGGCCTCNONE 
J033089A08AATTGGGCCTCNONE 
J033103L07AATTGGGCCTCNONE 
J033125L19AATTGGGCCTCNONE 
J090008N20AATTGGGCCTCNONE 
J090041F23AATTGGGCCTCNONE 
J090092H16AATTGGGCCTCNONE 
Os02g0819100AK100156TAGGCCCAATAZinc finger, DHHC-type domain containing protein. 
J013088C21TAGGCCCAATANONE 
Os02g0819700AK067374TAGGCCCAATTZinc finger, Zim17-type family protein. 
AK067374TGGATGGGCTGTATTGGGCCTCZinc finger, Zim17-type family protein. 
AK099160TAGGCCCAATTNONE 
AK099160TGGATGGGCTGTATTGGGCCTCNONE 
J100086K17TAGGCCCAATTNONE 
J100086K17TGGATGGGCTGTATTGGGCCTCNONE 
Os02g0824400AK121390GAGGCCCAATTConserved hypothetical protein. 
AK121390GTTTGGGCCTTGConserved hypothetical protein. 
J023128P21GAGGCCCAATTNONE 
J023128P21GTTTGGGCCTTGNONE 
J053097O16GAGGCCCAATTNONE 
J053097O16GTTTGGGCCTTGNONE 
J065012I02GAGGCCCAATTNONE 
J065012I02GTTTGGGCCTTGNONE 
J065049C06GAGGCCCAATTNONE 
J065049C06GTTTGGGCCTTGNONE 
J065051H02GAGGCCCAATTNONE 
J065051H02GTTTGGGCCTTGNONE 
J065069A13GAGGCCCAATTNONE 
J065069A13GTTTGGGCCTTGNONE 
J065082E04GAGGCCCAATTNONE 
J065082E04GTTTGGGCCTTGNONE 
J065102N09GAGGCCCAATTNONE 
J065102N09GTTTGGGCCTTGNONE 
J065157O10GAGGCCCAATTNONE 
J065157O10GTTTGGGCCTTGNONE 
J065188N23GAGGCCCAATTNONE 
J065188N23GTTTGGGCCTTGNONE 
J065190J11GAGGCCCAATTNONE 
J065190J11GTTTGGGCCTTGNONE 
J065202M09GAGGCCCAATTNONE 
J065202M09GTTTGGGCCTTGNONE 
Os02g0824700009-023-E06ATTTGGGCCTCSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18ATTTGGGCCTCNONE 
J065017H21ATTTGGGCCTCNONE 
J065052N02ATTTGGGCCTCNONE 
J065053M01ATTTGGGCCTCNONE 
J065064B14ATTTGGGCCTCNONE 
J065146K22ATTTGGGCCTCNONE 
Os02g0827600AK068455TATTGGGCCTTGConserved hypothetical protein. 
Os02g0830700AK101172AGGGCCCAGGCCCAACTLeucine rich repeat, N-terminal domain containing protein. 
Os02g0832700AK099439TGTTGGGCCTTTGGGCTTCSimilar to Metal tolerance protein C2 (AtMTPc2). 
Os03g0117100005-014-F09GAGGCCCAATANONE 
006-027-C07GAGGCCCAATANONE 
006-036-G11GAGGCCCAATANONE 
006-038-H10GAGGCCCAATANONE 
006-044-D08GAGGCCCAATANONE 
006-105-H12GAGGCCCAATANONE 
009-190-G08GAGGCCCAATANONE 
AK070213GAGGCCCAATAPeroxisomal biogenesis factor 11 family protein. 
AK104570GAGGCCCAATANONE 
AK104706GAGGCCCAATANONE 
J013055H24GAGGCCCAATANONE 
J023044I05GAGGCCCAATANONE 
J075111G05GAGGCCCAATANONE 
J080002K23GAGGCCCAATANONE 
J080002N12GAGGCCCAATANONE 
J080004B01GAGGCCCAATANONE 
J080007H19GAGGCCCAATANONE 
J080008M18GAGGCCCAATANONE 
J080011D18GAGGCCCAATANONE 
J080012J01GAGGCCCAATANONE 
J080018C19GAGGCCCAATANONE 
J080022C20GAGGCCCAATANONE 
J080022I05GAGGCCCAATANONE 
J080022M12GAGGCCCAATANONE 
J080023P03GAGGCCCAATANONE 
J080025A05GAGGCCCAATANONE 
J080029C02GAGGCCCAATANONE 
J080036H08GAGGCCCAATANONE 
J080039P12GAGGCCCAATANONE 
J080040H05GAGGCCCAATANONE 
J080045I23GAGGCCCAATANONE 
J080057O04GAGGCCCAATANONE 
J080059K18GAGGCCCAATANONE 
J080061E04GAGGCCCAATANONE 
J080062C20GAGGCCCAATANONE 
J080062F10GAGGCCCAATANONE 
J080062L05GAGGCCCAATANONE 
J080068L06GAGGCCCAATANONE 
J080069N09GAGGCCCAATANONE 
J080071M14GAGGCCCAATANONE 
J080072K17GAGGCCCAATANONE 
J080080A09GAGGCCCAATANONE 
J080086A18GAGGCCCAATANONE 
J080088O14GAGGCCCAATANONE 
J080089O04GAGGCCCAATANONE 
J080092G21GAGGCCCAATANONE 
J080094K09GAGGCCCAATANONE 
Os03g0125000006-032-D09TGATGGGCCTAAGGCCCAAATNONE 
006-033-B05TGATGGGCCTAAGGCCCAAATNONE 
006-048-G06TGATGGGCCTAAGGCCCAAATNONE 
006-048-G09TGATGGGCCTAAGGCCCAAATNONE 
006-052-D09TGATGGGCCTAAGGCCCAAATNONE 
006-072-A04TGATGGGCCTAAGGCCCAAATNONE 
006-076-F12TGATGGGCCTAAGGCCCAAATNONE 
006-080-B03TGATGGGCCTAAGGCCCAAATNONE 
006-092-H03TGATGGGCCTAAGGCCCAAATNONE 
006-103-G04TGATGGGCCTAAGGCCCAAATNONE 
009-079-E01TGATGGGCCTAAGGCCCAAATNONE 
009-150-F03TGATGGGCCTAAGGCCCAAATNONE 
AF095708TGATGGGCCTAAGGCCCAAATNONE 
AK059557TGATGGGCCTAAGGCCCAAATNONE 
AK070779TGATGGGCCTAAGGCCCAAATSimilar to 50S ribosomal protein L5, chloroplast. 
AK098999TGATGGGCCTAAGGCCCAAATNONE 
AK104137TGATGGGCCTAAGGCCCAAATNONE 
J065002D07TGATGGGCCTAAGGCCCAAATNONE 
J065167E24TGATGGGCCTAAGGCCCAAATNONE 
J075199O14TGATGGGCCTAAGGCCCAAATNONE 
J100083L01TGATGGGCCTAAGGCCCAAATNONE 
Os03g0125700009-132-G03AAGGCCCAAAANONE 
AK062913AAGGCCCAAAAConserved hypothetical protein. 
J075046C16AAGGCCCAAAANONE 
J075115L05AAGGCCCAAAANONE 
J075143I05AAGGCCCAAAANONE 
J075197O07AAGGCCCAAAANONE 
Os03g0126300AK061256TCAGGCCCAATTATGGCCCATAANONE 
AK061961TCAGGCCCAATTATGGCCCATAANONE 
AY346336TCAGGCCCAATTATGGCCCATAASAM (and some other nucleotide) binding motif domain containing protein. 
J065023J17TCAGGCCCAATTATGGCCCATAANONE 
J090023H12TCAGGCCCAATTATGGCCCATAANONE 
Os03g0149400AK111396AAGGCCCAACCAGCCCAAGProtein prenyltransferase domain containing protein. 
AK111396CTTGGGCTTTCAAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os03g0197400AK071413AAGGCCCAACCSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905AAGGCCCAACCNONE 
J053023D18AAGGCCCAACCNONE 
Os03g0198400AK059522ATTGGGCCTCNONE 
AK103101ATTGGGCCTCSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19ATTGGGCCTCNONE 
J075036K08ATTGGGCCTCNONE 
J075040J23ATTGGGCCTCNONE 
J075041H18ATTGGGCCTCNONE 
J075053H18ATTGGGCCTCNONE 
J075055K15ATTGGGCCTCNONE 
J075111K03ATTGGGCCTCNONE 
J075125B22ATTGGGCCTCNONE 
J075195L10ATTGGGCCTCNONE 
Os03g0232500AK110980TATTGGGCCTAGTP-binding protein, HSR1-related domain containing protein. 
J100036C06TATTGGGCCTANONE 
Os03g0249200009-103-B08AAAGCCCACATAGGCCCAAATNONE 
AK069944AAAGCCCACATAGGCCCAAATClass I peptide chain release factor domain containing protein. 
J065166E13AAAGCCCACATAGGCCCAAATNONE 
Os03g0253100AK119618AAGGCCCAATAPhosphomevalonate kinase Erg8 family protein. 
J033052A14AAGGCCCAATANONE 
Os03g0255500AK102392ATTTGGGCCTCSimilar to Phosphoenolpyruvate carboxykinase 4 (EC 4.1.1.49) (Fragment). 
Os03g0256400AK073854TGTGGGCTGAATTGGGCCTTSimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0257900009-150-G06AATTGGGCCTTTTTGGGCCGANONE 
009-181-H05AATTGGGCCTTTTTGGGCCGANONE 
AK063892AATTGGGCCTTTTTGGGCCGANONE 
AK100114AATTGGGCCTTTTTGGGCCGASimilar to Lectin-like receptor kinase 7;2. 
AK103486AATTGGGCCTTTTTGGGCCGANONE 
J023006K11AATTGGGCCTTTTTGGGCCGANONE 
J075005E15AATTGGGCCTTTTTGGGCCGANONE 
J075007K24AATTGGGCCTTTTTGGGCCGANONE 
J075034G06AATTGGGCCTTTTTGGGCCGANONE 
J075051I19AATTGGGCCTTTTTGGGCCGANONE 
J075076A08AATTGGGCCTTTTTGGGCCGANONE 
J075096H04AATTGGGCCTTTTTGGGCCGANONE 
J075115I09AATTGGGCCTTTTTGGGCCGANONE 
J075132K23AATTGGGCCTTTTTGGGCCGANONE 
J075147C17AATTGGGCCTTTTTGGGCCGANONE 
J090059O20AATTGGGCCTTTTTGGGCCGANONE 
Os03g0261500AK061995ATTTGGGCCTCNONE 
J013044K20ATTTGGGCCTCNONE 
J033113A11ATTTGGGCCTCNONE 
J100032O18ATTTGGGCCTCNONE 
J100037K21ATTTGGGCCTCNONE 
Os03g0265900009-004-C01TGTTGGGCCTTNONE 
009-045-B03TGTTGGGCCTTNONE 
AK099963TGTTGGGCCTTNONE 
AK120374TGTTGGGCCTTConserved hypothetical protein. 
J013036A19TGTTGGGCCTTNONE 
J013070J20TGTTGGGCCTTNONE 
J013071C06TGTTGGGCCTTNONE 
J013088C01TGTTGGGCCTTNONE 
J013112H21TGTTGGGCCTTNONE 
J065114K10TGTTGGGCCTTNONE 
J100028M20TGTTGGGCCTTNONE 
Os03g0266000AK068775AAGGCCCAACAOvarian tumour, otubain domain containing protein. 
AK104949AAGGCCCAACANONE 
J075149K24AAGGCCCAACANONE 
J075184C19AAGGCCCAACANONE 
Os03g0268300AK102684TAGGCCCAAGCCCAACCSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22TAGGCCCAAGCCCAACCNONE 
J013057J23TAGGCCCAAGCCCAACCNONE 
J013149I10TAGGCCCAAGCCCAACCNONE 
J013149M20TAGGCCCAAGCCCAACCNONE 
J013151D14TAGGCCCAAGCCCAACCNONE 
J013162O11TAGGCCCAAGCCCAACCNONE 
J023001F12TAGGCCCAAGCCCAACCNONE 
J023031B21TAGGCCCAAGCCCAACCNONE 
J023080A07TAGGCCCAAGCCCAACCNONE 
J023081N04TAGGCCCAAGCCCAACCNONE 
J023090C08TAGGCCCAAGCCCAACCNONE 
J023134G05TAGGCCCAAGCCCAACCNONE 
J023139G17TAGGCCCAAGCCCAACCNONE 
J023143I10TAGGCCCAAGCCCAACCNONE 
J023147D04TAGGCCCAAGCCCAACCNONE 
J023147O15TAGGCCCAAGCCCAACCNONE 
J033102K23TAGGCCCAAGCCCAACCNONE 
J033106C17TAGGCCCAAGCCCAACCNONE 
J075033G19TAGGCCCAAGCCCAACCNONE 
J075039J18TAGGCCCAAGCCCAACCNONE 
J075050K20TAGGCCCAAGCCCAACCNONE 
J075075J03TAGGCCCAAGCCCAACCNONE 
J075080E16TAGGCCCAAGCCCAACCNONE 
J075086L08TAGGCCCAAGCCCAACCNONE 
J075091K19TAGGCCCAAGCCCAACCNONE 
J075099O20TAGGCCCAAGCCCAACCNONE 
J075104I06TAGGCCCAAGCCCAACCNONE 
J075137C16TAGGCCCAAGCCCAACCNONE 
J075152G03TAGGCCCAAGCCCAACCNONE 
J075176N12TAGGCCCAAGCCCAACCNONE 
J100086K11TAGGCCCAAGCCCAACCNONE 
Os03g0284600AK110712GAGGCCCAAGThioredoxin fold domain containing protein. 
Os03g0295500009-083-F02TTGGCCCATATAAGGCCCAACTNONE 
J053029J05TTGGCCCATATAAGGCCCAACTNONE 
J053054B07TTGGCCCATATAAGGCCCAACTCHCH domain containing protein. 
J065024G23TTGGCCCATATAAGGCCCAACTNONE 
J065036F08TTGGCCCATATAAGGCCCAACTNONE 
J065066M11TTGGCCCATATAAGGCCCAACTNONE 
J065143G19TTGGCCCATATAAGGCCCAACTNONE 
Os03g0305500AK070638GGTTGGGCCTTArgininosuccinate lyase domain containing protein. 
Os03g0308000016-023-H09TAGGCCCAACANONE 
AK100355TAGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05TAGGCCCAACANONE 
J023043K04TAGGCCCAACANONE 
J023083I20TAGGCCCAACANONE 
J033068F22TAGGCCCAACANONE 
J033125P21TAGGCCCAACANONE 
J065207A22TAGGCCCAACANONE 
J100018D20TAGGCCCAACANONE 
J100026L17TAGGCCCAACANONE 
J100055D14TAGGCCCAACANONE 
J100060P03TAGGCCCAACANONE 
J100078A20TAGGCCCAACANONE 
Os03g0308900AK064183GAGGCCCAAAConserved hypothetical protein. 
Os03g0321000AK103653CCAGGCCCAATASimilar to Steroid membrane binding protein-like. 
Os03g0322600009-180-H12GAGGCCCAAAANONE 
AK067222GAGGCCCAAAAHypothetical protein. 
J065017H05GAGGCCCAAAANONE 
J065118G12GAGGCCCAAAANONE 
J065175F07GAGGCCCAAAANONE 
J065175N14GAGGCCCAAAANONE 
Os03g0324800AK059868GAGGCCCAAATNONE 
AK071431GAGGCCCAAATHypothetical protein. 
Os03g0339100AK111641AAGGCCCAACTSimilar to PRL1 protein. 
Os03g0340700011-070-H05CGGGCCGAGTTGGGCCTANONE 
AK100470CGGGCCGAGTTGGGCCTATetratricopeptide-like helical domain containing protein. 
J013158I08CGGGCCGAGTTGGGCCTANONE 
J023009H24CGGGCCGAGTTGGGCCTANONE 
J023031L20CGGGCCGAGTTGGGCCTANONE 
J023093E24CGGGCCGAGTTGGGCCTANONE 
J023105J11CGGGCCGAGTTGGGCCTANONE 
J100059O05CGGGCCGAGTTGGGCCTANONE 
J100075G03CGGGCCGAGTTGGGCCTANONE 
J100086J06CGGGCCGAGTTGGGCCTANONE 
Os03g0343500009-042-G06GAGGCCCAATANONE 
009-063-D01GAGGCCCAATANONE 
009-156-H09GAGGCCCAATANONE 
AB117995GAGGCCCAATANONE 
AK058737GAGGCCCAATANONE 
AK059599GAGGCCCAATASimilar to 60S ribosomal protein L22-2. 
AK121502GAGGCCCAATANONE 
J023082D10GAGGCCCAATANONE 
J033022G11GAGGCCCAATANONE 
J075048M16GAGGCCCAATANONE 
J075049O20GAGGCCCAATANONE 
J075082I02GAGGCCCAATANONE 
J075105G01GAGGCCCAATANONE 
J075131K05GAGGCCCAATANONE 
J080002H01GAGGCCCAATANONE 
J080003H01GAGGCCCAATANONE 
J080005G08GAGGCCCAATANONE 
J080011M13GAGGCCCAATANONE 
J080020M02GAGGCCCAATANONE 
J080026N24GAGGCCCAATANONE 
J080028L09GAGGCCCAATANONE 
J080032O14GAGGCCCAATANONE 
J080033J12GAGGCCCAATANONE 
J080035D05GAGGCCCAATANONE 
J080039H01GAGGCCCAATANONE 
J080044B07GAGGCCCAATANONE 
J080044E23GAGGCCCAATANONE 
J080049N11GAGGCCCAATANONE 
J080050A21GAGGCCCAATANONE 
J080055L24GAGGCCCAATANONE 
J080059N20GAGGCCCAATANONE 
J080061F04GAGGCCCAATANONE 
J080078I16GAGGCCCAATANONE 
J080079G24GAGGCCCAATANONE 
J080080K13GAGGCCCAATANONE 
J080083G20GAGGCCCAATANONE 
J080087B08GAGGCCCAATANONE 
J080091L19GAGGCCCAATANONE 
J080094D06GAGGCCCAATANONE 
J090038L06GAGGCCCAATANONE 
J090075H06GAGGCCCAATANONE 
J090081D12GAGGCCCAATANONE 
Os03g0343900009-077-C03ACAGCCCAAGGCCCAAGNONE 
AK105813ACAGCCCAAGGCCCAAGPhotosystem II protein PsbX family protein. 
J100059N03ACAGCCCAAGGCCCAAGNONE 
J100079C20ACAGCCCAAGGCCCAAGNONE 
Os03g0363350Os03g0363350GTATGGGCCATGAGGCCCAACAProtein of unknown function DUF455 family protein. 
Os03g0438400AK070383AAGGCCCAAGCCCAATAConserved hypothetical protein. 
J023054E02AAGGCCCAAGCCCAATANONE 
Os03g0576900AK071314AAGGCCCAACCAmino acid/polyamine transporter I family protein. 
J023074L08AAGGCCCAACCNONE 
J023084D13AAGGCCCAACCNONE 
J080011C14AAGGCCCAACCNONE 
J080012F24AAGGCCCAACCNONE 
J080018M05AAGGCCCAACCNONE 
J080021G05AAGGCCCAACCNONE 
J080021N18AAGGCCCAACCNONE 
J080023E19AAGGCCCAACCNONE 
J080024H14AAGGCCCAACCNONE 
J080025E15AAGGCCCAACCNONE 
J080038F19AAGGCCCAACCNONE 
J080044N09AAGGCCCAACCNONE 
J080054D05AAGGCCCAACCNONE 
J080057J16AAGGCCCAACCNONE 
J080060A05AAGGCCCAACCNONE 
J080061M12AAGGCCCAACCNONE 
J080063H13AAGGCCCAACCNONE 
J080065O04AAGGCCCAACCNONE 
J080066I17AAGGCCCAACCNONE 
J080066J06AAGGCCCAACCNONE 
J080089J22AAGGCCCAACCNONE 
J080090I03AAGGCCCAACCNONE 
J080091J23AAGGCCCAACCNONE 
J080091K20AAGGCCCAACCNONE 
J080093G24AAGGCCCAACCNONE 
J080094I08AAGGCCCAACCNONE 
J080096A17AAGGCCCAACCNONE 
J090051G12AAGGCCCAACCNONE 
Os03g0577000012-055-F04CTTGGGCCTANONE 
AK061051CTTGGGCCTASimilar to Ribosomal protein S3 (Fragment). 
AK099146CTTGGGCCTANONE 
J065060A01CTTGGGCCTANONE 
J075079B17CTTGGGCCTANONE 
J075134K12CTTGGGCCTANONE 
J090048F23CTTGGGCCTANONE 
J090072I19CTTGGGCCTANONE 
J100087C19CTTGGGCCTANONE 
J100090C21CTTGGGCCTANONE 
Os03g0598200AK068322TTTTGGGCCTCNop14-like protein family protein. 
Os03g0598900J053098D07AATTGGGCCTGGGCCATNONE 
J065063O13AATTGGGCCTGGGCCATDSBA oxidoreductase family protein. 
Os03g0647400AK073665TGTTGGGCCTAGCK domain containing protein. 
J033051B07TGTTGGGCCTANONE 
Os03g0651700006-061-B11GAGGCCCAAGNONE 
AK059828GAGGCCCAAGConserved hypothetical protein. 
Os03g0669000AK067769CAGGCCCAATASimilar to RNA helicase (Fragment). 
AK099820CAGGCCCAATANONE 
Os03g0683700AK065067TAGGCCCAAAGGCCCAGGProtein of unknown function DUF810 family protein. 
Os03g0685700AK066043TAGGCCCAATProtein prenyltransferase domain containing protein. 
J013048F08TAGGCCCAATNONE 
Os03g0687800AK106820GAGGCCCAATAConserved hypothetical protein. 
AK106820TAGGCCCAATAConserved hypothetical protein. 
Os03g0704400AK101297AAGGCCCAAGProtein kinase domain containing protein. 
J033033I19AAGGCCCAAGNONE 
J090009M06AAGGCCCAAGNONE 
Os03g0727100AK068587GAGGCCCAACTConserved hypothetical protein. 
AK068587GTTTGGGCCGTAAGGCCCAACAConserved hypothetical protein. 
J013153F04GAGGCCCAACTNONE 
J013153F04GTTTGGGCCGTAAGGCCCAACANONE 
J065165J09GAGGCCCAACTNONE 
J065165J09GTTTGGGCCGTAAGGCCCAACANONE 
Os03g0740800AK071772CAGGCCCAAAAXRCC4, N-terminal domain containing protein. 
J023110F02CAGGCCCAAAANONE 
J075054I11CAGGCCCAAAANONE 
Os03g0743200J065049G14TGTTGGGCCTCNONE 
J065158O18TGTTGGGCCTCNONE 
Os03g0744700AK071178GTATGGGCCAGGCCCAACTConserved hypothetical protein. 
J075006D24GTATGGGCCAGGCCCAACTNONE 
J075165F21GTATGGGCCAGGCCCAACTNONE 
Os03g0746600AK069559GAGGCCCAATWD40-like domain containing protein. 
J023141K22GAGGCCCAATNONE 
Os03g0746800AK101718AAGGCCCAAGWD-40 repeat containing protein. 
Os03g0801800AK067130CAGGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J090079D17CAGGCCCAAACNONE 
J090087F23CAGGCCCAAACNONE 
Os03g0807800AK064984CAGGCCCAATSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14CAGGCCCAATNONE 
J065015J20CAGGCCCAATNONE 
J065122L11CAGGCCCAATNONE 
J065217E10CAGGCCCAATNONE 
J075023C02CAGGCCCAATNONE 
J075102O04CAGGCCCAATNONE 
J080024G24CAGGCCCAATNONE 
J080033F02CAGGCCCAATNONE 
J080047M13CAGGCCCAATNONE 
J080048A22CAGGCCCAATNONE 
J080056E06CAGGCCCAATNONE 
J080064O11CAGGCCCAATNONE 
Os03g0820100011-030-A10TCGGCCCAATAGGCCCAAGNONE 
011-031-C01TCGGCCCAATAGGCCCAAGNONE 
AK111534TCGGCCCAATAGGCCCAAGSimilar to Auxin-resistance protein AXR1. 
J013033L14TCGGCCCAATAGGCCCAAGNONE 
J013034D14TCGGCCCAATAGGCCCAAGNONE 
J013065N20TCGGCCCAATAGGCCCAAGNONE 
J013127A04TCGGCCCAATAGGCCCAAGNONE 
J013146A11TCGGCCCAATAGGCCCAAGNONE 
J023025D19TCGGCCCAATAGGCCCAAGNONE 
J023083K15TCGGCCCAATAGGCCCAAGNONE 
J033037N01TCGGCCCAATAGGCCCAAGNONE 
J033041H02TCGGCCCAATAGGCCCAAGNONE 
J043009M22TCGGCCCAATAGGCCCAAGNONE 
J090039L03TCGGCCCAATAGGCCCAAGNONE 
J090050L08TCGGCCCAATAGGCCCAAGNONE 
J090053J21TCGGCCCAATAGGCCCAAGNONE 
J090088G07TCGGCCCAATAGGCCCAAGNONE 
Os03g0828100009-088-D04TAGGCCCAACCNONE 
009-125-F01TAGGCCCAACCNONE 
009-169-C06TAGGCCCAACCNONE 
AK059132TAGGCCCAACCNONE 
AK062799TAGGCCCAACCNONE 
AK099043TAGGCCCAACCSimilar to 50S ribosomal protein L18. 
J013146D01TAGGCCCAACCNONE 
J065057J16TAGGCCCAACCNONE 
Os03g0833700011-060-A10ATTTGGGCCTANONE 
AK121918ATTTGGGCCTARNA 3'-terminal phosphate cyclase family protein. 
Os03g0845700009-075-D05AATTGGGCCTTGNONE 
AK062622AATTGGGCCTTGSimilar to RPB17 (Fragment). 
J065068H03AATTGGGCCTTGNONE 
J065075A18AATTGGGCCTTGNONE 
J065118C19AATTGGGCCTTGNONE 
J075001B15AATTGGGCCTTGNONE 
J075048D11AATTGGGCCTTGNONE 
J075056D01AATTGGGCCTTGNONE 
J075092P03AATTGGGCCTTGNONE 
J075111I04AATTGGGCCTTGNONE 
Os03g0848100J013028M09GAGGCCCAAACNONE 
J065080L17GAGGCCCAAACNONE 
J065083C11GAGGCCCAAACNONE 
Os03g0850100AK101126ATTGGGCCTTAATGGGCCAANLI interacting factor domain containing protein. 
Os03g0851900AK102145TTTTGGGCCTCAFG1-like ATPase family protein. 
J033086B08TTTTGGGCCTCNONE 
Os03g0858700006-024-D11TTTTGGGCCTTGNONE 
AK061723TTTTGGGCCTTGProtein of unknown function DUF1499 family protein. 
AK064976TTTTGGGCCTTGNONE 
J013001B23TTTTGGGCCTTGNONE 
Os04g0117800Os04g0117800AATTGGGCCTCAmidase family protein. 
Os04g0194000AK102654AATTGGGCCTTGCyclin-like F-box domain containing protein. 
J033101G08AATTGGGCCTTGNONE 
J090084B18AATTGGGCCTTGNONE 
Os04g0218600009-123-A05AAGGCCCAAGGCCCATCCNONE 
AK062873AAGGCCCAAGGCCCATCCNONE 
AK103472AAGGCCCAAGGCCCATCCConserved hypothetical protein. 
J090077A20AAGGCCCAAGGCCCATCCNONE 
Os04g0305700009-180-E11TTTTGGGCCTANONE 
AK068128TTTTGGGCCTAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK105689TTTTGGGCCTANONE 
J065026K17TTTTGGGCCTANONE 
J065122C23TTTTGGGCCTANONE 
Os04g0388900AK063224GAGGCCCAAASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19GAGGCCCAAANONE 
J065148P22GAGGCCCAAANONE 
J075040G12GAGGCCCAAANONE 
Os04g0436800015-053-A06CAAGGCCCAAAANONE 
AK101115CAAGGCCCAAAAProtein prenyltransferase domain containing protein. 
J033025G14CAAGGCCCAAAANONE 
J033073N23CAAGGCCCAAAANONE 
J033097L19CAAGGCCCAAAANONE 
Os04g0440000AK073064TATTGGGCCTCNONE 
AK101691TATTGGGCCTCConserved hypothetical protein. 
AK102407TATTGGGCCTCNONE 
Os04g0440100AK101324AAGGCCCAATTNONE 
AK105415AAGGCCCAATTNonsense-mediated decay UPF3 domain containing protein. 
Os04g0445200009-034-A06GAGGCCCAAATNONE 
AK062427GAGGCCCAAATProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720GAGGCCCAAATNONE 
J065022E20GAGGCCCAAATNONE 
J065062D16GAGGCCCAAATNONE 
J065081I02GAGGCCCAAATNONE 
J065087C10GAGGCCCAAATNONE 
J065116N16GAGGCCCAAATNONE 
J065132F10GAGGCCCAAATNONE 
J065140F18GAGGCCCAAATNONE 
J065143M22GAGGCCCAAATNONE 
J065158K17GAGGCCCAAATNONE 
J065162D07GAGGCCCAAATNONE 
J065207H19GAGGCCCAAATNONE 
J075155B20GAGGCCCAAATNONE 
J075167E24GAGGCCCAAATNONE 
J075178B19GAGGCCCAAATNONE 
J080301D22GAGGCCCAAATNONE 
J080301J15GAGGCCCAAATNONE 
J080308J02GAGGCCCAAATNONE 
Os04g0446500015-073-B06CCAGGCCCAATTNONE 
AB118009CCAGGCCCAATTNONE 
AK073743CCAGGCCCAATTNONE 
AK103814CCAGGCCCAATTSimilar to FK506-binding protein 2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (FKBP-13) (FKBP-15). 
J033055H15CCAGGCCCAATTNONE 
J033067L09CCAGGCCCAATTNONE 
J033147C19CCAGGCCCAATTNONE 
J033147C20CCAGGCCCAATTNONE 
Os04g0457700J075145N15TTTGGGCCTCGCGCGCConserved hypothetical protein. 
Os04g0462900006-094-A02CTTGGGCCTTNONE 
006-097-F05CTTGGGCCTTNONE 
009-129-A10CTTGGGCCTTNONE 
015-042-F07CTTGGGCCTTNONE 
AK058481CTTGGGCCTTNONE 
AK059483CTTGGGCCTTNONE 
AK061324CTTGGGCCTTNONE 
AK099100CTTGGGCCTTNONE 
AK102579CTTGGGCCTTNONE 
AK106322CTTGGGCCTTSimilar to Prohibitin. 
J065059J20CTTGGGCCTTNONE 
J065085I02CTTGGGCCTTNONE 
J065118N23CTTGGGCCTTNONE 
J065208K24CTTGGGCCTTNONE 
J075053B14CTTGGGCCTTNONE 
J075097M22CTTGGGCCTTNONE 
J075184B07CTTGGGCCTTNONE 
J075194A15CTTGGGCCTTNONE 
J080315G03CTTGGGCCTTNONE 
J090088H19CTTGGGCCTTNONE 
Os04g0465000AK060688TAGGCCCAAAANONE 
AK102302TAGGCCCAAAASterile alpha motif homology domain containing protein. 
J023084D14TAGGCCCAAAANONE 
J023086J22TAGGCCCAAAANONE 
Os04g0466100AK064543TGTTGGGCCTCSimilar to Cell division protein FtsH-like protein. 
Os04g0476600014-086-A01TTTGGGCCTGANONE 
015-073-B12TTTGGGCCTGANONE 
AK105466TTTGGGCCTGAC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os04g0490000AK108365AGTTGGGCCTTGSimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0520900AK068793TAGGCCCAAATProtein prenyltransferase domain containing protein. 
AK105606TAGGCCCAAATNONE 
Os04g0542900AK068610AAGGCCCAAACConserved hypothetical protein. 
Os04g0547600AK109141TTTGGGCCTTPathogenesis-related transcriptional factor and ERF domain containing protein. 
AY339379TTTGGGCCTTNONE 
J065112J12TTTGGGCCTTNONE 
Os04g0573200AK065277AAGGCCCAAACNONE 
AK120348AAGGCCCAAACHeavy metal transport/detoxification protein domain containing protein. 
Os04g0581300009-171-H01ATGGCCCATAAGGCCCAACANONE 
009-171-H01ATTTGGGCCTTTTTGGGCCTANONE 
AK063093ATGGCCCATAAGGCCCAACASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
AK063093ATTTGGGCCTTTTTGGGCCTASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0589200AK068571GAGGCCCAATCGTGGGCConserved hypothetical protein. 
AK102463GAGGCCCAATCGTGGGCNONE 
J075083K10GAGGCCCAATCGTGGGCNONE 
Os04g0589600011-100-F04GAGGCCCAATNONE 
AK061833GAGGCCCAATGlycosyl transferase, group 1 domain containing protein. 
AK098964GAGGCCCAATNONE 
AK100053GAGGCCCAATNONE 
Os04g0612600AB042115AAGGCCCAAACAATGGGCCCACCTNONE 
AK060707AAGGCCCAAACAATGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK099008AAGGCCCAAACAATGGGCCCACCTNONE 
AK104427AAGGCCCAAACAATGGGCCCACCTNONE 
J023043H02AAGGCCCAAACAATGGGCCCACCTNONE 
J033033I23AAGGCCCAAACAATGGGCCCACCTNONE 
J033067P21AAGGCCCAAACAATGGGCCCACCTNONE 
J033088M21AAGGCCCAAACAATGGGCCCACCTNONE 
J033133M08AAGGCCCAAACAATGGGCCCACCTNONE 
J043030I16AAGGCCCAAACAATGGGCCCACCTNONE 
J075049H08AAGGCCCAAACAATGGGCCCACCTNONE 
Os04g0631200013-003-B06GAGGCCCAAGNONE 
AK059277GAGGCCCAAGSimilar to Xyloglucan endotransglycosylase (Fragment). 
AK099331GAGGCCCAAGNONE 
J033024P08GAGGCCCAAGNONE 
J033041G02GAGGCCCAAGNONE 
J053075H12GAGGCCCAAGNONE 
J065016B13GAGGCCCAAGNONE 
J090075B22GAGGCCCAAGNONE 
J100084K17GAGGCCCAAGNONE 
Os04g0661700AK066532CTTGGGCCTTConserved hypothetical protein. 
J065083O18CTTGGGCCTTNONE 
Os04g0665700013-084-D06GAGGCCCAAAGCCCAACTNONE 
AK121951GAGGCCCAAAGCCCAACTZinc finger, CCCH-type domain containing protein. 
J013020L20GAGGCCCAAAGCCCAACTNONE 
J033034K12GAGGCCCAAAGCCCAACTNONE 
J033107K04GAGGCCCAAAGCCCAACTNONE 
J065044C03GAGGCCCAAAGCCCAACTNONE 
J065103I10GAGGCCCAAAGCCCAACTNONE 
J065106P15GAGGCCCAAAGCCCAACTNONE 
J075061O20GAGGCCCAAAGCCCAACTNONE 
J075091P11GAGGCCCAAAGCCCAACTNONE 
J075095A18GAGGCCCAAAGCCCAACTNONE 
J075117C22GAGGCCCAAAGCCCAACTNONE 
J075166B22GAGGCCCAAAGCCCAACTNONE 
J075198L04GAGGCCCAAAGCCCAACTNONE 
J090032K13GAGGCCCAAAGCCCAACTNONE 
J090045E22GAGGCCCAAAGCCCAACTNONE 
Os04g0669600AK110767GGGGCCCAGGCCCAAAAPhospholipase/Carboxylesterase family protein. 
J065195K10GGGGCCCAGGCCCAAAANONE 
Os04g0674100J080097J12TATTGGGCCTAThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965TAGGCCCAATNONE 
AK103795TAGGCCCAATCoenzyme Q biosynthesis Coq4 family protein. 
J033076F14TAGGCCCAATNONE 
J065020P20TAGGCCCAATNONE 
J065057I21TAGGCCCAATNONE 
J065059P11TAGGCCCAATNONE 
J065083A22TAGGCCCAATNONE 
J065093K10TAGGCCCAATNONE 
J065097D03TAGGCCCAATNONE 
J065103P05TAGGCCCAATNONE 
J065113K09TAGGCCCAATNONE 
J065118F23TAGGCCCAATNONE 
J065119M06TAGGCCCAATNONE 
J065146K17TAGGCCCAATNONE 
J065161N12TAGGCCCAATNONE 
J065169L02TAGGCCCAATNONE 
J065189H12TAGGCCCAATNONE 
J065192E24TAGGCCCAATNONE 
J065193K17TAGGCCCAATNONE 
J065197O21TAGGCCCAATNONE 
J065214D09TAGGCCCAATNONE 
J065217B11TAGGCCCAATNONE 
J075132K07TAGGCCCAATNONE 
J100059D14TAGGCCCAATNONE 
Os04g0681500AK105582AAATGGGCCAGGCCCAACEF-Hand type domain containing protein. 
Os04g0691700015-036-C06ATTGGGCCTCNONE 
AK106305ATTGGGCCTCSimilar to Autoimmune regulator (Autoimmune polyendocrinopathy candidiasis ectodermal dystrophy protein) (APECED protein). 
Os04g0692200006-047-H10ATGGCCCAGGCCCAACANONE 
006-047-H10CCAGGCCCAATANONE 
006-107-D08ATGGCCCAGGCCCAACANONE 
006-107-D08CCAGGCCCAATANONE 
009-122-B09ATGGCCCAGGCCCAACANONE 
009-122-B09CCAGGCCCAATANONE 
AK059807ATGGCCCAGGCCCAACANONE 
AK059807CCAGGCCCAATANONE 
AK060875ATGGCCCAGGCCCAACANONE 
AK060875CCAGGCCCAATANONE 
AK071726ATGGCCCAGGCCCAACAConserved hypothetical protein. 
AK071726CCAGGCCCAATAConserved hypothetical protein. 
J023110I24ATGGCCCAGGCCCAACANONE 
J023110I24CCAGGCCCAATANONE 
J033091O06ATGGCCCAGGCCCAACANONE 
J033091O06CCAGGCCCAATANONE 
J053027N16ATGGCCCAGGCCCAACANONE 
J053027N16CCAGGCCCAATANONE 
J053089E19ATGGCCCAGGCCCAACANONE 
J053089E19CCAGGCCCAATANONE 
J053098H12ATGGCCCAGGCCCAACANONE 
J053098H12CCAGGCCCAATANONE 
J053099N13ATGGCCCAGGCCCAACANONE 
J053099N13CCAGGCCCAATANONE 
J075031B15ATGGCCCAGGCCCAACANONE 
J075031B15CCAGGCCCAATANONE 
J080013D12ATGGCCCAGGCCCAACANONE 
J080013D12CCAGGCCCAATANONE 
J080013H05ATGGCCCAGGCCCAACANONE 
J080013H05CCAGGCCCAATANONE 
J080013H07ATGGCCCAGGCCCAACANONE 
J080013H07CCAGGCCCAATANONE 
J080088I03ATGGCCCAGGCCCAACANONE 
J080088I03CCAGGCCCAATANONE 
Os05g0106100009-186-E05CAGGCCCAAAANONE 
013-067-H01CAGGCCCAAAANONE 
AK063178CAGGCCCAAAASimilar to Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14) (V- ATPase 16 kDa proteolipid subunit) (Fragment). 
J065010J15CAGGCCCAAAANONE 
J065073M24CAGGCCCAAAANONE 
J065077A22CAGGCCCAAAANONE 
J065167I04CAGGCCCAAAANONE 
J075084F11CAGGCCCAAAANONE 
J075086M18CAGGCCCAAAANONE 
Os05g0110700AK102486GAGGCCCAATAKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12GAGGCCCAATANONE 
Os05g0121000009-181-E02GTTTGGGCCCACTAGGCCCAACCNONE 
AK058867GTTTGGGCCCACTAGGCCCAACCNONE 
AK071341GTTTGGGCCCACTAGGCCCAACCProtein of unknown function DUF1218 family protein. 
J023024H24GTTTGGGCCCACTAGGCCCAACCNONE 
J023090B22GTTTGGGCCCACTAGGCCCAACCNONE 
J023111G15GTTTGGGCCCACTAGGCCCAACCNONE 
J023134K14GTTTGGGCCCACTAGGCCCAACCNONE 
J033057C05GTTTGGGCCCACTAGGCCCAACCNONE 
J033067J15GTTTGGGCCCACTAGGCCCAACCNONE 
J033084L15GTTTGGGCCCACTAGGCCCAACCNONE 
J033088B04GTTTGGGCCCACTAGGCCCAACCNONE 
J043027A08GTTTGGGCCCACTAGGCCCAACCNONE 
J043029L03GTTTGGGCCCACTAGGCCCAACCNONE 
J053031K22GTTTGGGCCCACTAGGCCCAACCNONE 
J053046I01GTTTGGGCCCACTAGGCCCAACCNONE 
J053070B05GTTTGGGCCCACTAGGCCCAACCNONE 
J053072C10GTTTGGGCCCACTAGGCCCAACCNONE 
J065097M22GTTTGGGCCCACTAGGCCCAACCNONE 
J065164I17GTTTGGGCCCACTAGGCCCAACCNONE 
J075058I08GTTTGGGCCCACTAGGCCCAACCNONE 
J075064C09GTTTGGGCCCACTAGGCCCAACCNONE 
J080304C16GTTTGGGCCCACTAGGCCCAACCNONE 
J080304H16GTTTGGGCCCACTAGGCCCAACCNONE 
J080306E17GTTTGGGCCCACTAGGCCCAACCNONE 
J080310L03GTTTGGGCCCACTAGGCCCAACCNONE 
J080316J07GTTTGGGCCCACTAGGCCCAACCNONE 
J080317L23GTTTGGGCCCACTAGGCCCAACCNONE 
J080319A10GTTTGGGCCCACTAGGCCCAACCNONE 
J090060F01GTTTGGGCCCACTAGGCCCAACCNONE 
J100042N16GTTTGGGCCCACTAGGCCCAACCNONE 
J100047F05GTTTGGGCCCACTAGGCCCAACCNONE 
J100075J19GTTTGGGCCCACTAGGCCCAACCNONE 
Os05g0121800AK101222AAGGCCCAACAConserved hypothetical protein. 
J033031D02AAGGCCCAACANONE 
J065078F10AAGGCCCAACANONE 
J065151J16AAGGCCCAACANONE 
J065151K04AAGGCCCAACANONE 
J090057E18AAGGCCCAACANONE 
Os05g0125600AK102952AAGGCCCAAAProtein of unknown function DUF1677, Oryza sativa family protein. 
J033115D18AAGGCCCAAANONE 
Os05g0129400AK102359GTTTGGGCCTAGGCCCACCCGAnkyrin repeat containing protein. 
J033091I05GTTTGGGCCTAGGCCCACCCGNONE 
Os05g0153400AK108071TAGGCCCAACACGGCCCATGTProtein prenyltransferase domain containing protein. 
Os05g0155100006-075-B02AAGGCCCAAACCAGCCCACAANONE 
AK061929AAGGCCCAAACCAGCCCACAANONE 
AK102810AAGGCCCAAACCAGCCCACAANONE 
AK120877AAGGCCCAAACCAGCCCACAASimilar to 60S ribosomal protein L18. 
J013023E03AAGGCCCAAACCAGCCCACAANONE 
J013038C16AAGGCCCAAACCAGCCCACAANONE 
J013120M14AAGGCCCAAACCAGCCCACAANONE 
J013153B04AAGGCCCAAACCAGCCCACAANONE 
J013159B07AAGGCCCAAACCAGCCCACAANONE 
J023012A02AAGGCCCAAACCAGCCCACAANONE 
J023027F08AAGGCCCAAACCAGCCCACAANONE 
J023027I12AAGGCCCAAACCAGCCCACAANONE 
J023120F05AAGGCCCAAACCAGCCCACAANONE 
J023138O03AAGGCCCAAACCAGCCCACAANONE 
J023142H13AAGGCCCAAACCAGCCCACAANONE 
J023143P06AAGGCCCAAACCAGCCCACAANONE 
J033023P09AAGGCCCAAACCAGCCCACAANONE 
J033035O14AAGGCCCAAACCAGCCCACAANONE 
J033042N19AAGGCCCAAACCAGCCCACAANONE 
J033043B12AAGGCCCAAACCAGCCCACAANONE 
J033065D10AAGGCCCAAACCAGCCCACAANONE 
J033081A12AAGGCCCAAACCAGCCCACAANONE 
J033084N05AAGGCCCAAACCAGCCCACAANONE 
J033085M03AAGGCCCAAACCAGCCCACAANONE 
J033112D15AAGGCCCAAACCAGCCCACAANONE 
J033114O07AAGGCCCAAACCAGCCCACAANONE 
J033119D15AAGGCCCAAACCAGCCCACAANONE 
J033140E06AAGGCCCAAACCAGCCCACAANONE 
J033141K23AAGGCCCAAACCAGCCCACAANONE 
J043040I22AAGGCCCAAACCAGCCCACAANONE 
J053050B21AAGGCCCAAACCAGCCCACAANONE 
J053065I18AAGGCCCAAACCAGCCCACAANONE 
J053074O16AAGGCCCAAACCAGCCCACAANONE 
J065072K13AAGGCCCAAACCAGCCCACAANONE 
J065211I09AAGGCCCAAACCAGCCCACAANONE 
J090004K04AAGGCCCAAACCAGCCCACAANONE 
J090016L06AAGGCCCAAACCAGCCCACAANONE 
J090040F22AAGGCCCAAACCAGCCCACAANONE 
J090063F22AAGGCCCAAACCAGCCCACAANONE 
J090081J09AAGGCCCAAACCAGCCCACAANONE 
J100032A10AAGGCCCAAACCAGCCCACAANONE 
J100037G20AAGGCCCAAACCAGCCCACAANONE 
J100056O10AAGGCCCAAACCAGCCCACAANONE 
J100071D10AAGGCCCAAACCAGCCCACAANONE 
J100075K13AAGGCCCAAACCAGCCCACAANONE 
J100079F16AAGGCCCAAACCAGCCCACAANONE 
J100080O16AAGGCCCAAACCAGCCCACAANONE 
J100086N05AAGGCCCAAACCAGCCCACAANONE 
Os05g0177100AK064652CAAGGCCCAAATConserved hypothetical protein. 
Os05g0186000006-103-D10TAGGCCCAAGNONE 
009-047-D06TAGGCCCAAGNONE 
009-073-G05TAGGCCCAAGNONE 
009-084-G09TAGGCCCAAGNONE 
009-097-G04TAGGCCCAAGNONE 
009-111-D11TAGGCCCAAGNONE 
009-115-G01TAGGCCCAAGNONE 
009-131-B04TAGGCCCAAGNONE 
009-144-F05TAGGCCCAAGNONE 
009-154-D08TAGGCCCAAGNONE 
014-004-H02TAGGCCCAAGNONE 
AK058675TAGGCCCAAGNONE 
AK060420TAGGCCCAAGSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231TAGGCCCAAGNONE 
J065155C08TAGGCCCAAGNONE 
J075143K12TAGGCCCAAGNONE 
Os05g0226300AK067770ATTTGGGCCTTConserved hypothetical protein. 
J013120H22ATTTGGGCCTTNONE 
J013146E15ATTTGGGCCTTNONE 
Os05g0339200AK111022CAGGCCCAAAAConserved hypothetical protein. 
Os05g0349000AK070681CCATGGGCGTTGGGCCTCConserved hypothetical protein. 
AK120753CCATGGGCGTTGGGCCTCNONE 
J023006K02CCATGGGCGTTGGGCCTCNONE 
J023063E02CCATGGGCGTTGGGCCTCNONE 
J043003J19CCATGGGCGTTGGGCCTCNONE 
Os05g0357100AK102042AAGGCCCAAAA3'-5' exonuclease domain containing protein. 
J033081J05AAGGCCCAAAANONE 
J100022A18AAGGCCCAAAANONE 
Os05g0386800009-185-E02GAGGCCCAACTNONE 
AK062748GAGGCCCAACTNONE 
Os05g0386900009-015-C03TTTGGGCCTTGNONE 
AK059319TTTGGGCCTTGNONE 
Os05g0400700009-099-F02GAGGCCCAAGNONE 
AK072739GAGGCCCAAGSimilar to DNA-directed RNA polymerase II 19 kDa polypeptide (EC 2.7.7.6) (RNA polymerase II subunit 5). 
AK103913GAGGCCCAAGNONE 
J023138C10GAGGCCCAAGNONE 
Os05g0446900AK101748CTTGGGCCTCTGGGCCTAGlycoside hydrolase, starch-binding domain containing protein. 
Os05g0477300009-016-A12ATTGGGCCTCCAGCCCACGANONE 
009-029-B06ATTGGGCCTCCAGCCCACGANONE 
009-166-G04ATTGGGCCTCCAGCCCACGANONE 
013-016-C08ATTGGGCCTCCAGCCCACGANONE 
016-091-E10ATTGGGCCTCCAGCCCACGANONE 
AK061933ATTGGGCCTCCAGCCCACGANONE 
AK098982ATTGGGCCTCCAGCCCACGANONE 
AK119683ATTGGGCCTCCAGCCCACGANONE 
AK119693ATTGGGCCTCCAGCCCACGANONE 
AK119797ATTGGGCCTCCAGCCCACGANONE 
AK121584ATTGGGCCTCCAGCCCACGARibosomal protein S26E family protein. 
J013063C18ATTGGGCCTCCAGCCCACGANONE 
J013129B12ATTGGGCCTCCAGCCCACGANONE 
J013152K23ATTGGGCCTCCAGCCCACGANONE 
J023013K21ATTGGGCCTCCAGCCCACGANONE 
J023077O13ATTGGGCCTCCAGCCCACGANONE 
J023085D23ATTGGGCCTCCAGCCCACGANONE 
J033029G14ATTGGGCCTCCAGCCCACGANONE 
J033037F24ATTGGGCCTCCAGCCCACGANONE 
J033040H08ATTGGGCCTCCAGCCCACGANONE 
J033064J24ATTGGGCCTCCAGCCCACGANONE 
J033085C06ATTGGGCCTCCAGCCCACGANONE 
J033123P10ATTGGGCCTCCAGCCCACGANONE 
J033127K23ATTGGGCCTCCAGCCCACGANONE 
J033147D24ATTGGGCCTCCAGCCCACGANONE 
J075064E05ATTGGGCCTCCAGCCCACGANONE 
J090026B03ATTGGGCCTCCAGCCCACGANONE 
J100050M11ATTGGGCCTCCAGCCCACGANONE 
Os05g0484000AK106829TAGGCCCAAGProtein of unknown function DUF295 family protein. 
AK106829TCAGGCCCAAGProtein of unknown function DUF295 family protein. 
Os05g0487600AK100817CAAGGCCCAAACNONE 
AK103104CAAGGCCCAAACNONE 
J043027P10CAAGGCCCAAACNONE 
J065183N17CAAGGCCCAAACNONE 
Os05g0488900AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase. 
AK073699TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
AK105459TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080009C06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080021N09TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080041K24TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080058H15TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080064P06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080077B16TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
Os05g0498400009-129-A03GAGGCCCAAGNONE 
009-192-D10GAGGCCCAAGNONE 
009-194-D06GAGGCCCAAGNONE 
AK058219GAGGCCCAAGSimilar to Protein translation factor SUI1. 
AK070301GAGGCCCAAGNONE 
J043038N18GAGGCCCAAGNONE 
J065027A13GAGGCCCAAGNONE 
J075040J15GAGGCCCAAGNONE 
J075165B14GAGGCCCAAGNONE 
Os05g0501300006-075-B11CTTGGGCCTTGNONE 
006-083-H08CTTGGGCCTTGNONE 
AK059889CTTGGGCCTTGSimilar to Flavoprotein wrbA (Trp repressor binding protein). 
J043030K02CTTGGGCCTTGNONE 
Os05g0520200006-031-F07AAGGCCCAAACNONE 
AK061451AAGGCCCAAACThioredoxin-related domain containing protein. 
AK099433AAGGCCCAAACNONE 
Os05g0528200009-146-C01GAGGCCCAAACNONE 
AK062985GAGGCCCAAACSimilar to 50S ribosomal protein L20. 
Os05g0540100AB021666GAGGCCCAACTNONE 
AK060623GAGGCCCAACTNONE 
AK103819GAGGCCCAACTFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0552900AK102095AAGGCCCAAGMAP65/ASE1 family protein. 
Os05g0558000015-029-G05GAGGCCCAATANONE 
AK073857GAGGCCCAATARibosomal protein L1 family protein. 
J033074P11GAGGCCCAATANONE 
J090060I16GAGGCCCAATANONE 
Os05g0559900AK067197GAAGCCCAAGGCCCAAACtRNA-binding arm domain containing protein. 
J013074C15GAAGCCCAAGGCCCAAACNONE 
J013098O16GAAGCCCAAGGCCCAAACNONE 
J033030M01GAAGCCCAAGGCCCAAACNONE 
J090058H12GAAGCCCAAGGCCCAAACNONE 
J090075M06GAAGCCCAAGGCCCAAACNONE 
Os05g0561500006-066-D12GGTTGGGCCTGGNONE 
AK061788GGTTGGGCCTGGSimilar to CMP-KDO synthetase (EC 2.7.7.38) (Fragment). 
AK098862GGTTGGGCCTGGNONE 
J013000O09GGTTGGGCCTGGNONE 
J033145C24GGTTGGGCCTGGNONE 
Os05g0565200004-015-E06AAGGCCCAACCNONE 
004-015-E06AAGGCCCAACCNONE 
004-015-E06GAGGCCCAACCNONE 
004-015-E06TATTGGGCCTCNONE 
AK067090AAGGCCCAACCSimilar to Urease accessory protein G. 
AK067090AAGGCCCAACCSimilar to Urease accessory protein G. 
AK067090GAGGCCCAACCSimilar to Urease accessory protein G. 
AK067090TATTGGGCCTCSimilar to Urease accessory protein G. 
AK104200AAGGCCCAACCNONE 
AK104200AAGGCCCAACCNONE 
AK104200GAGGCCCAACCNONE 
AK104200TATTGGGCCTCNONE 
AK104368AAGGCCCAACCNONE 
AK104368AAGGCCCAACCNONE 
AK104368GAGGCCCAACCNONE 
AK104368TATTGGGCCTCNONE 
Os05g0571300AK072262CCAGGCCCAACAConserved hypothetical protein. 
AK109853CCAGGCCCAACANONE 
AK111014CCAGGCCCAACANONE 
Os05g0587400AK102121TATTGGGCCTAPrefoldin domain containing protein. 
J033084N12TATTGGGCCTANONE 
Os05g0591400AK120015GAGGCCCAAATHeat shock protein Hsp70 family protein. 
Os05g0595400006-103-B08AAGGCCCAAGNONE 
009-117-H06AAGGCCCAAGNONE 
AK061858AAGGCCCAAGNONE 
AK066391AAGGCCCAAGSimilar to Nucleoside diphosphate kinase III (EC 2.7.4.6) (NDK III) (NDP kinase III) (NDPK III). 
J013109B15AAGGCCCAAGNONE 
J023003J16AAGGCCCAAGNONE 
J023027P15AAGGCCCAAGNONE 
J023106M08AAGGCCCAAGNONE 
J023122O03AAGGCCCAAGNONE 
J033081D04AAGGCCCAAGNONE 
J033086G23AAGGCCCAAGNONE 
J033115F13AAGGCCCAAGNONE 
Os06g0101300013-080-G09AGTTGGGCCTAATTGGGCCTGGNONE 
015-006-A01AGTTGGGCCTAATTGGGCCTGGNONE 
015-044-F09AGTTGGGCCTAATTGGGCCTGGNONE 
AK109515AGTTGGGCCTAATTGGGCCTGGZinc finger, RING-type domain containing protein. 
AK121897AGTTGGGCCTAATTGGGCCTGGNONE 
J033084O06AGTTGGGCCTAATTGGGCCTGGNONE 
J033105E24AGTTGGGCCTAATTGGGCCTGGNONE 
J033126H24AGTTGGGCCTAATTGGGCCTGGNONE 
J065001F05AGTTGGGCCTAATTGGGCCTGGNONE 
J065002H03AGTTGGGCCTAATTGGGCCTGGNONE 
J065026B12AGTTGGGCCTAATTGGGCCTGGNONE 
J065093E11AGTTGGGCCTAATTGGGCCTGGNONE 
J065122E04AGTTGGGCCTAATTGGGCCTGGNONE 
J065164O07AGTTGGGCCTAATTGGGCCTGGNONE 
J065182M16AGTTGGGCCTAATTGGGCCTGGNONE 
J065217N11AGTTGGGCCTAATTGGGCCTGGNONE 
J090002P22AGTTGGGCCTAATTGGGCCTGGNONE 
Os06g0105900AK072638CAAGCCCAGGCCCAATAConserved hypothetical protein. 
Os06g0113600016-067-E03ATTTGGGCCTCCCATGGGCCATNONE 
AK062095ATTTGGGCCTCCCATGGGCCATNONE 
AK101235ATTTGGGCCTCCCATGGGCCATCyclin-like F-box domain containing protein. 
AK122025ATTTGGGCCTCCCATGGGCCATNONE 
J013022O19ATTTGGGCCTCCCATGGGCCATNONE 
J023045P05ATTTGGGCCTCCCATGGGCCATNONE 
J033031K01ATTTGGGCCTCCCATGGGCCATNONE 
J033034I09ATTTGGGCCTCCCATGGGCCATNONE 
J033041O04ATTTGGGCCTCCCATGGGCCATNONE 
J033071K03ATTTGGGCCTCCCATGGGCCATNONE 
J033075K16ATTTGGGCCTCCCATGGGCCATNONE 
J033097M01ATTTGGGCCTCCCATGGGCCATNONE 
J033099M22ATTTGGGCCTCCCATGGGCCATNONE 
J033108N15ATTTGGGCCTCCCATGGGCCATNONE 
J033121D18ATTTGGGCCTCCCATGGGCCATNONE 
J033125O06ATTTGGGCCTCCCATGGGCCATNONE 
J033139M16ATTTGGGCCTCCCATGGGCCATNONE 
J033145P18ATTTGGGCCTCCCATGGGCCATNONE 
J033149D05ATTTGGGCCTCCCATGGGCCATNONE 
Os06g0116400006-082-G06TAGGCCCAAACNONE 
AK058327TAGGCCCAAACNONE 
AK105979TAGGCCCAAACHigh-affinity nickel-transporter family protein. 
J065083I24TAGGCCCAAACNONE 
J100072O18TAGGCCCAAACNONE 
Os06g0124900009-128-B12CCAGGCCCAAGCCCAACCNONE 
009-186-H09CCAGGCCCAAGCCCAACCNONE 
AK062901CCAGGCCCAAGCCCAACCConserved hypothetical protein. 
J013056D13CCAGGCCCAAGCCCAACCNONE 
J013056D17CCAGGCCCAAGCCCAACCNONE 
J013066A13CCAGGCCCAAGCCCAACCNONE 
J013066C03CCAGGCCCAAGCCCAACCNONE 
J013066F01CCAGGCCCAAGCCCAACCNONE 
J023078D03CCAGGCCCAAGCCCAACCNONE 
J033113N02CCAGGCCCAAGCCCAACCNONE 
J065019F09CCAGGCCCAAGCCCAACCNONE 
J065048C21CCAGGCCCAAGCCCAACCNONE 
J065077L13CCAGGCCCAAGCCCAACCNONE 
J065082J09CCAGGCCCAAGCCCAACCNONE 
J065113H16CCAGGCCCAAGCCCAACCNONE 
J065147A20CCAGGCCCAAGCCCAACCNONE 
J065180A13CCAGGCCCAAGCCCAACCNONE 
J065198M18CCAGGCCCAAGCCCAACCNONE 
J065207K19CCAGGCCCAAGCCCAACCNONE 
J075109H13CCAGGCCCAAGCCCAACCNONE 
Os06g0128500AK058563ATTTGGGCCTGARibosomal protein L47, mitochondrial family protein. 
AK122132ATTTGGGCCTGANONE 
J033133F04ATTTGGGCCTGANONE 
J065094M24ATTTGGGCCTGANONE 
J065122J07ATTTGGGCCTGANONE 
J065137G10ATTTGGGCCTGANONE 
J065178L09ATTTGGGCCTGANONE 
J080011E11ATTTGGGCCTGANONE 
J080020G21ATTTGGGCCTGANONE 
J080039H03ATTTGGGCCTGANONE 
J080039J04ATTTGGGCCTGANONE 
Os06g0140100011-063-A02AAGGCCCAACANONE 
AK063371AAGGCCCAACALeucine carboxyl methyltransferase family protein. 
Os06g0146900AK071352CCAGGCCCAAAHypothetical protein. 
J065068D05CCAGGCCCAAANONE 
J075036G17CCAGGCCCAAANONE 
Os06g0187900009-171-C09CCAGGCCCAAACNONE 
AK063879CCAGGCCCAAACNONE 
AK071765CCAGGCCCAAACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023112N11CCAGGCCCAAACNONE 
J033098E13CCAGGCCCAAACNONE 
J100036J11CCAGGCCCAAACNONE 
J100047B19CCAGGCCCAAACNONE 
Os06g0199500AK060939TACTGGGCCCAAGGCCCAAATNONE 
AK064613TACTGGGCCCAAGGCCCAAATSimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138TACTGGGCCCAAGGCCCAAATNONE 
Os06g0210200012-084-E04GCTGGGCTGGTTGGGCCTCNONE 
012-084-E04TTTGGGCCTTNONE 
AK060502GCTGGGCTGGTTGGGCCTCNONE 
AK060502TTTGGGCCTTNONE 
AK069709GCTGGGCTGGTTGGGCCTCN-acyl-L-amino-acid amidohydrolase family protein. 
AK069709TTTGGGCCTTN-acyl-L-amino-acid amidohydrolase family protein. 
J023028L23GCTGGGCTGGTTGGGCCTCNONE 
J023028L23TTTGGGCCTTNONE 
J023056O05GCTGGGCTGGTTGGGCCTCNONE 
J023056O05TTTGGGCCTTNONE 
J033075N06GCTGGGCTGGTTGGGCCTCNONE 
J033075N06TTTGGGCCTTNONE 
J065099C14GCTGGGCTGGTTGGGCCTCNONE 
J065099C14TTTGGGCCTTNONE 
J065158C17GCTGGGCTGGTTGGGCCTCNONE 
J065158C17TTTGGGCCTTNONE 
J065214B02GCTGGGCTGGTTGGGCCTCNONE 
J065214B02TTTGGGCCTTNONE 
J075026E10GCTGGGCTGGTTGGGCCTCNONE 
J075026E10TTTGGGCCTTNONE 
J075066J06GCTGGGCTGGTTGGGCCTCNONE 
J075066J06TTTGGGCCTTNONE 
J075121I06GCTGGGCTGGTTGGGCCTCNONE 
J075121I06TTTGGGCCTTNONE 
J075124L08GCTGGGCTGGTTGGGCCTCNONE 
J075124L08TTTGGGCCTTNONE 
J100055D09GCTGGGCTGGTTGGGCCTCNONE 
J100055D09TTTGGGCCTTNONE 
J100055E04GCTGGGCTGGTTGGGCCTCNONE 
J100055E04TTTGGGCCTTNONE 
J100077L12GCTGGGCTGGTTGGGCCTCNONE 
J100077L12TTTGGGCCTTNONE 
Os06g0213900AK106922TAGGCCCAAGCCCConserved hypothetical protein. 
J090028K09TAGGCCCAAGCCCNONE 
J100078N13TAGGCCCAAGCCCNONE 
Os06g0225300AK065224AAGGCCCAAATAGGCCCACTNONE 
AK100258AAGGCCCAAATAGGCCCACTSimilar to SERK1 (Fragment). 
J013002G23AAGGCCCAAATAGGCCCACTNONE 
Os06g0226600006-083-D04AAGGCCCAACTNONE 
006-083-D04GTTGGGCCTTNONE 
AK061806AAGGCCCAACTNONE 
AK061806GTTGGGCCTTNONE 
AK102752AAGGCCCAACTTB2/DP1 and HVA22 related protein family protein. 
AK102752GTTGGGCCTTTB2/DP1 and HVA22 related protein family protein. 
J013089J11AAGGCCCAACTNONE 
J013089J11GTTGGGCCTTNONE 
J033106M05AAGGCCCAACTNONE 
J033106M05GTTGGGCCTTNONE 
J100044M21AAGGCCCAACTNONE 
J100044M21GTTGGGCCTTNONE 
J100056E06AAGGCCCAACTNONE 
J100056E06GTTGGGCCTTNONE 
J100059F06AAGGCCCAACTNONE 
J100059F06GTTGGGCCTTNONE 
Os06g0292400J065040E24TATTGGGCCTGAConserved hypothetical protein. 
Os06g0298400AK066952TAGGCCCAACWW/Rsp5/WWP domain containing protein. 
J013090J20TAGGCCCAACNONE 
J033024J05TAGGCCCAACNONE 
J033033H19TAGGCCCAACNONE 
J033057J15TAGGCCCAACNONE 
J065047L24TAGGCCCAACNONE 
J065198L23TAGGCCCAACNONE 
J065218N03TAGGCCCAACNONE 
J090001F10TAGGCCCAACNONE 
J090025N24TAGGCCCAACNONE 
J090073E16TAGGCCCAACNONE 
Os06g0320000009-030-C04CAAGGCCCAATTNONE 
009-135-F08CAAGGCCCAATTNONE 
J075103B05CAAGGCCCAATTProtein of unknown function DUF953, thioredoxin-like family protein. 
J075187J24CAAGGCCCAATTNONE 
Os06g0324000AK109614TAGGCCCAAACConserved hypothetical protein. 
Os06g0494400AK067594CCAGGCCCAATMulti antimicrobial extrusion protein MatE family protein. 
Os06g0567000009-166-G12CAAGGCCCAACANONE 
AK121337CAAGGCCCAACAProtein of unknown function UPF0197 family protein. 
J013122F01CAAGGCCCAACANONE 
J023080N12CAAGGCCCAACANONE 
J023120F03CAAGGCCCAACANONE 
J065013B18CAAGGCCCAACANONE 
J065039P21CAAGGCCCAACANONE 
J065089E06CAAGGCCCAACANONE 
J065095N19CAAGGCCCAACANONE 
J065119H03CAAGGCCCAACANONE 
J065121D18CAAGGCCCAACANONE 
J065149G04CAAGGCCCAACANONE 
J075012J04CAAGGCCCAACANONE 
J075021G13CAAGGCCCAACANONE 
J075106I23CAAGGCCCAACANONE 
J075107F19CAAGGCCCAACANONE 
J075152J22CAAGGCCCAACANONE 
J075186J20CAAGGCCCAACANONE 
J075188F16CAAGGCCCAACANONE 
J080001G06CAAGGCCCAACANONE 
J080002O09CAAGGCCCAACANONE 
J080006E10CAAGGCCCAACANONE 
J080006F24CAAGGCCCAACANONE 
J080012L07CAAGGCCCAACANONE 
J080016A10CAAGGCCCAACANONE 
J080017D11CAAGGCCCAACANONE 
J080017I04CAAGGCCCAACANONE 
J080017I10CAAGGCCCAACANONE 
J080020P06CAAGGCCCAACANONE 
J080024A20CAAGGCCCAACANONE 
J080027B10CAAGGCCCAACANONE 
J080027E03CAAGGCCCAACANONE 
J080027I01CAAGGCCCAACANONE 
J080027K20CAAGGCCCAACANONE 
J080041L12CAAGGCCCAACANONE 
J080043D21CAAGGCCCAACANONE 
J080044K11CAAGGCCCAACANONE 
J080048I08CAAGGCCCAACANONE 
J080049M12CAAGGCCCAACANONE 
J080050C14CAAGGCCCAACANONE 
J080050N21CAAGGCCCAACANONE 
J080053F04CAAGGCCCAACANONE 
J080054O16CAAGGCCCAACANONE 
J080058O21CAAGGCCCAACANONE 
J080059M11CAAGGCCCAACANONE 
J080061A11CAAGGCCCAACANONE 
J080063B15CAAGGCCCAACANONE 
J080063F22CAAGGCCCAACANONE 
J080066M18CAAGGCCCAACANONE 
J080068D12CAAGGCCCAACANONE 
J080070D22CAAGGCCCAACANONE 
J080071B06CAAGGCCCAACANONE 
J080072B17CAAGGCCCAACANONE 
J080081O04CAAGGCCCAACANONE 
J080089H05CAAGGCCCAACANONE 
J080093K13CAAGGCCCAACANONE 
J080095I05CAAGGCCCAACANONE 
J080097F19CAAGGCCCAACANONE 
J080304C03CAAGGCCCAACANONE 
J080304H11CAAGGCCCAACANONE 
J080308M21CAAGGCCCAACANONE 
J080313O15CAAGGCCCAACANONE 
J090020N23CAAGGCCCAACANONE 
J100023C12CAAGGCCCAACANONE 
Os06g0581300AK070987TTTGGGCCTTProtein of unknown function DUF1475 family protein. 
AK073185TTTGGGCCTTNONE 
J065209C10TTTGGGCCTTNONE 
J075060B03TTTGGGCCTTNONE 
J075117M08TTTGGGCCTTNONE 
J075126E04TTTGGGCCTTNONE 
J075189G04TTTGGGCCTTNONE 
J075189L16TTTGGGCCTTNONE 
J100061E16TTTGGGCCTTNONE 
Os06g0607800012-010-G03CAAGGCCCAAATNONE 
012-010-G03TAGGCCCAAATNONE 
AB070254CAAGGCCCAAATNONE 
AB070254TAGGCCCAAATNONE 
AK063158CAAGGCCCAAATSimilar to 26S proteasome regulatory complex subunit p42D. 
AK063158TAGGCCCAAATSimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695CAAGGCCCAAATNONE 
AK066695TAGGCCCAAATNONE 
J013074G13CAAGGCCCAAATNONE 
J013074G13TAGGCCCAAATNONE 
J090015C16CAAGGCCCAAATNONE 
J090015C16TAGGCCCAAATNONE 
J090069H10CAAGGCCCAAATNONE 
J090069H10TAGGCCCAAATNONE 
Os06g0625500006-034-A05CCAGGCCCAATACGCGTCCNONE 
AK058459CCAGGCCCAATACGCGTCCSimilar to Thioredoxin peroxidase. 
AK068955CCAGGCCCAATACGCGTCCNONE 
AK104130CCAGGCCCAATACGCGTCCNONE 
J023003C09CCAGGCCCAATACGCGTCCNONE 
J033043I02CCAGGCCCAATACGCGTCCNONE 
J065063E05CCAGGCCCAATACGCGTCCNONE 
J065190D24CCAGGCCCAATACGCGTCCNONE 
J065198I01CCAGGCCCAATACGCGTCCNONE 
J075107A02CCAGGCCCAATACGCGTCCNONE 
Os06g0649500AK072591AGTTGGGCCTGAWD40-like domain containing protein. 
Os06g0667400AK065424GAGGCCCAACAConserved hypothetical protein. 
AK065580GAGGCCCAACANONE 
Os06g0670100AK102577GAGGCCCAAACHypothetical protein. 
Os06g0670500AK059079AAGGCCCAAGNONE 
Os06g0674800J065007E09AAGGCCCAAGNONE 
J065037D21AAGGCCCAAGHypothetical protein. 
J065063P14AAGGCCCAAGNONE 
J065128K24AAGGCCCAAGNONE 
J065188F06AAGGCCCAAGNONE 
J065199I24AAGGCCCAAGNONE 
J065214N19AAGGCCCAAGNONE 
Os06g0696600006-060-B12AAGGCCCAAAANONE 
AK105934AAGGCCCAAAASimilar to Xyloglucan endo-transglycosylase homolog. 
Os06g0702800009-039-E05ACATGGGCCAGGCCCAAATNONE 
AK073948ACATGGGCCAGGCCCAAATHypothetical protein. 
J023108K23ACATGGGCCAGGCCCAAATNONE 
J033072H04ACATGGGCCAGGCCCAAATNONE 
J065008G05ACATGGGCCAGGCCCAAATNONE 
J065128J12ACATGGGCCAGGCCCAAATNONE 
J065131A01ACATGGGCCAGGCCCAAATNONE 
J065173B12ACATGGGCCAGGCCCAAATNONE 
Os06g0704600AK065784ATTGGGCCTANONE 
AK101836ATTGGGCCTASimilar to Delta-aminolevulinic acid dehydratase (Fragment). 
AK119551ATTGGGCCTANONE 
Os06g0704900AK103054TATTGGGCCTGASimilar to Cell division-like protein. 
J033117I21TATTGGGCCTGANONE 
Os06g0709100006-057-D06GTTGGGCCTANONE 
011-040-A08GTTGGGCCTANONE 
016-044-A01GTTGGGCCTANONE 
AK059732GTTGGGCCTANONE 
AK070881GTTGGGCCTACyclin-like F-box domain containing protein. 
AK103683GTTGGGCCTANONE 
J065026P10GTTGGGCCTANONE 
J090017L13GTTGGGCCTANONE 
Os06g0709300AK108588GAGGCCCAATFAR1 domain containing protein. 
Os06g0712500AK068531TAGGCCCAATGGCCCATGGSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os06g0715400012-007-C01GAGGCCCAAGGCCCATACNONE 
012-038-G03GAGGCCCAAGGCCCATACNONE 
AK071262GAGGCCCAAGGCCCATACt-snare domain containing protein. 
AK073963GAGGCCCAAGGCCCATACNONE 
J023085J06GAGGCCCAAGGCCCATACNONE 
J033073I09GAGGCCCAAGGCCCATACNONE 
J080316N15GAGGCCCAAGGCCCATACNONE 
J090062N15GAGGCCCAAGGCCCATACNONE 
Os06g0716800014-028-E06GAGGCCCAAGNONE 
016-046-F04GAGGCCCAAGNONE 
AK071639GAGGCCCAAGEukaryotic transcription factor, DNA-binding domain containing protein. 
AK103968GAGGCCCAAGNONE 
J023099K10GAGGCCCAAGNONE 
J065036H06GAGGCCCAAGNONE 
J065049K01GAGGCCCAAGNONE 
J065060N02GAGGCCCAAGNONE 
J065204C12GAGGCCCAAGNONE 
J065213P15GAGGCCCAAGNONE 
J080001K17GAGGCCCAAGNONE 
J080006L04GAGGCCCAAGNONE 
J080008A10GAGGCCCAAGNONE 
J080008E16GAGGCCCAAGNONE 
J080010L22GAGGCCCAAGNONE 
J080011N22GAGGCCCAAGNONE 
J080014K12GAGGCCCAAGNONE 
J080018F08GAGGCCCAAGNONE 
J080018N02GAGGCCCAAGNONE 
J080021N10GAGGCCCAAGNONE 
J080029B02GAGGCCCAAGNONE 
J080030D07GAGGCCCAAGNONE 
J080032A16GAGGCCCAAGNONE 
J080034M13GAGGCCCAAGNONE 
J080038F06GAGGCCCAAGNONE 
J080039K15GAGGCCCAAGNONE 
J080042M20GAGGCCCAAGNONE 
J080048N14GAGGCCCAAGNONE 
J080050F23GAGGCCCAAGNONE 
J080051C22GAGGCCCAAGNONE 
J080053B19GAGGCCCAAGNONE 
J080056J19GAGGCCCAAGNONE 
J080056K05GAGGCCCAAGNONE 
J080060C09GAGGCCCAAGNONE 
J080060K21GAGGCCCAAGNONE 
J080065J17GAGGCCCAAGNONE 
J080067A16GAGGCCCAAGNONE 
J080075I03GAGGCCCAAGNONE 
J080076D21GAGGCCCAAGNONE 
J080078G16GAGGCCCAAGNONE 
J080085K15GAGGCCCAAGNONE 
J080089C14GAGGCCCAAGNONE 
J080091N22GAGGCCCAAGNONE 
J080094N12GAGGCCCAAGNONE 
J090032N05GAGGCCCAAGNONE 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J033064G11TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065044F12TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065047I05TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065059P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065180P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J075131M22TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
Os07g0122300015-004-G08CTTGGGCCTCTGTGGGCTTGNONE 
AK103212CTTGGGCCTCTGTGGGCTTGNONE 
AK119295CTTGGGCCTCTGTGGGCTTGProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09CTTGGGCCTCTGTGGGCTTGNONE 
J090007P13CTTGGGCCTCTGTGGGCTTGNONE 
Os07g0124500012-092-F01GAGGCCCAACTNONE 
AK070529GAGGCCCAACTSimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000GAGGCCCAACTNONE 
J090007O11GAGGCCCAACTNONE 
J090010E02GAGGCCCAACTNONE 
J090078C04GAGGCCCAACTNONE 
Os07g0133700J065005A21AAATGGGCTAATTGGGCCTTHypothetical protein. 
J065096D02AAATGGGCTAATTGGGCCTTNONE 
J065097G13AAATGGGCTAATTGGGCCTTNONE 
Os07g0150200009-152-C07GAGGCCCAATTNONE 
AK058680GAGGCCCAATTNONE 
AK121635GAGGCCCAATTSimilar to 40S ribosomal protein S12-1. 
J033051C16GAGGCCCAATTNONE 
J033123H15GAGGCCCAATTNONE 
J065093I01GAGGCCCAATTNONE 
J065197C05GAGGCCCAATTNONE 
J075037B11GAGGCCCAATTNONE 
J075114B08GAGGCCCAATTNONE 
J075123N01GAGGCCCAATTNONE 
J075129O04GAGGCCCAATTNONE 
J075160H17GAGGCCCAATTNONE 
J075166H17GAGGCCCAATTNONE 
J080310F11GAGGCCCAATTNONE 
J080315P11GAGGCCCAATTNONE 
J090025A22GAGGCCCAATTNONE 
Os07g0155200006-036-E03TATTGGGCCTTNONE 
006-036-E04TATTGGGCCTTNONE 
AK061006TATTGGGCCTTProtein of unknown function DUF150 family protein. 
AK104606TATTGGGCCTTNONE 
Os07g0158300006-049-G04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
006-049-G04TAGGCCCAATTNONE 
AK099188CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK099188TAGGCCCAATTNONE 
AK104773CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK104773TAGGCCCAATTNONE 
J013106F16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013106F16TAGGCCCAATTNONE 
J013123H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013123H22TAGGCCCAATTNONE 
J023029J02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J02TAGGCCCAATTNONE 
J023029J03CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J03TAGGCCCAATTNONE 
J033138N08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J033138N08TAGGCCCAATTNONE 
J075011F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075011F05TAGGCCCAATTNONE 
J075022F10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075022F10TAGGCCCAATTNONE 
J075071L13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075071L13TAGGCCCAATTNONE 
J075094B08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075094B08TAGGCCCAATTNONE 
J075119B21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075119B21TAGGCCCAATTNONE 
J075140L02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075140L02TAGGCCCAATTNONE 
J075199O21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075199O21TAGGCCCAATTNONE 
J080001I17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080001I17TAGGCCCAATTNONE 
J080005M04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080005M04TAGGCCCAATTNONE 
J080011P17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080011P17TAGGCCCAATTNONE 
J080026B14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026B14TAGGCCCAATTNONE 
J080026C12CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026C12TAGGCCCAATTNONE 
J080030N16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080030N16TAGGCCCAATTNONE 
J080035K23CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080035K23TAGGCCCAATTNONE 
J080039J22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080039J22TAGGCCCAATTNONE 
J080045D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080045D04TAGGCCCAATTNONE 
J080050C06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050C06TAGGCCCAATTNONE 
J080050K14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050K14TAGGCCCAATTNONE 
J080051I09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080051I09TAGGCCCAATTNONE 
J080053F18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053F18TAGGCCCAATTNONE 
J080053G10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053G10TAGGCCCAATTNONE 
J080055F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080055F05TAGGCCCAATTNONE 
J080057E22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080057E22TAGGCCCAATTNONE 
J080058F17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080058F17TAGGCCCAATTNONE 
J080063C18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080063C18TAGGCCCAATTNONE 
J080065E02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080065E02TAGGCCCAATTNONE 
J080066E06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080066E06TAGGCCCAATTNONE 
J080067O05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080067O05TAGGCCCAATTNONE 
J080068N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080068N15TAGGCCCAATTNONE 
J080071O04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080071O04TAGGCCCAATTNONE 
J080074A20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074A20TAGGCCCAATTNONE 
J080074E14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074E14TAGGCCCAATTNONE 
J080074L05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074L05TAGGCCCAATTNONE 
J080075E08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075E08TAGGCCCAATTNONE 
J080075H07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075H07TAGGCCCAATTNONE 
J080077D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077D04TAGGCCCAATTNONE 
J080077N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077N15TAGGCCCAATTNONE 
J080078A07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080078A07TAGGCCCAATTNONE 
J080079H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080079H22TAGGCCCAATTNONE 
J080080F20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080F20TAGGCCCAATTNONE 
J080080M22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080M22TAGGCCCAATTNONE 
J080081K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081K09TAGGCCCAATTNONE 
J080081L04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081L04TAGGCCCAATTNONE 
J080090K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080090K09TAGGCCCAATTNONE 
J080093O13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080093O13TAGGCCCAATTNONE 
J080094A18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094A18TAGGCCCAATTNONE 
J080094E10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094E10TAGGCCCAATTNONE 
J080094H06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094H06TAGGCCCAATTNONE 
J080096I21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080096I21TAGGCCCAATTNONE 
J100081A19CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J100081A19TAGGCCCAATTNONE 
Os07g0190900012-063-F11AATTGGGCCTANONE 
AK073533AATTGGGCCTASMAD/FHA domain containing protein. 
J013110O09AATTGGGCCTANONE 
J033041I12AATTGGGCCTANONE 
J033046D05AATTGGGCCTANONE 
J033101K24AATTGGGCCTANONE 
J090009F10AATTGGGCCTANONE 
J090095B17AATTGGGCCTANONE 
Os07g0191000AK071379TAGGCCCAATTInositol monophosphatase family protein. 
AK103440TAGGCCCAATTNONE 
Os07g0191700AK066389TAGGCCCAAAGCCCAGTASimilar to AT.I.24-9 protein (Fragment). 
AK103768TAGGCCCAAAGCCCAGTANONE 
Os07g0231500AK109283TAGGCCCAAACyclin-like domain containing protein. 
J075001D10TAGGCCCAAANONE 
J075088P14TAGGCCCAAANONE 
J075115C22TAGGCCCAAANONE 
J075199L15TAGGCCCAAANONE 
Os07g0245100AK059133GTTTGGGCCTTNONE 
Os07g0256200AK072904AATTGGGCCTARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23AATTGGGCCTANONE 
Os07g0462700009-033-D05TTTTGGGCCTTGNONE 
AK073834TTTTGGGCCTTGNONE 
AK104968TTTTGGGCCTTGThioesterase superfamily domain containing protein. 
J065104G16TTTTGGGCCTTGNONE 
J065197C14TTTTGGGCCTTGNONE 
J065213E17TTTTGGGCCTTGNONE 
J065215D11TTTTGGGCCTTGNONE 
J075001J15TTTTGGGCCTTGNONE 
J075026M11TTTTGGGCCTTGNONE 
J075142G03TTTTGGGCCTTGNONE 
J075178H04TTTTGGGCCTTGNONE 
J100069P18TTTTGGGCCTTGNONE 
Os07g0479200005-017-H08GAGGCCCAAANONE 
AK058326GAGGCCCAAASimilar to SL15-like (Fragment). 
J013092A08GAGGCCCAAANONE 
J033139E04GAGGCCCAAANONE 
J043016M16GAGGCCCAAANONE 
J053050O18GAGGCCCAAANONE 
J053098B03GAGGCCCAAANONE 
J065068G10GAGGCCCAAANONE 
J065091I17GAGGCCCAAANONE 
J065109A03GAGGCCCAAANONE 
J065168B17GAGGCCCAAANONE 
J065177A05GAGGCCCAAANONE 
J065180J01GAGGCCCAAANONE 
J075006F13GAGGCCCAAANONE 
J075022J03GAGGCCCAAANONE 
J075024N09GAGGCCCAAANONE 
J075114B12GAGGCCCAAANONE 
J080023M06GAGGCCCAAANONE 
J080081N24GAGGCCCAAANONE 
J090060N07GAGGCCCAAANONE 
Os07g0516200AK061373CAAGGCCCAACASimilar to Endoribonuclease, L-PSP family. 
Os07g0535200011-024-E05TTTTGGGCCTANONE 
AK063926TTTTGGGCCTANONE 
AK101804TTTTGGGCCTACyclin-like F-box domain containing protein. 
J033066K01TTTTGGGCCTANONE 
J033133J23TTTTGGGCCTANONE 
Os07g0558200AK065243TCAGGCCCAAGInositol monophosphatase family protein. 
Os07g0564000AK069806AGTTGGGCCTCConserved hypothetical protein. 
Os07g0565000AK121056GTTTGGGCCTTCTTGGGCCGASimilar to 40S ribosomal protein S11. 
J023056G18GTTTGGGCCTTCTTGGGCCGANONE 
J065131K04GTTTGGGCCTTCTTGGGCCGANONE 
J065190L19GTTTGGGCCTTCTTGGGCCGANONE 
J065209B06GTTTGGGCCTTCTTGGGCCGANONE 
J065216P11GTTTGGGCCTTCTTGGGCCGANONE 
J090088F06GTTTGGGCCTTCTTGGGCCGANONE 
Os07g0573700AK070473CAAGGCCCAAGNucleotide-sugar transporter family protein. 
Os07g0591400Os07g0591400GGTTGGGCCTACGTGGGCCCCCACNONE 
Os07g0595700003-103-G05GAGGCCCAATTNONE 
AK108488GAGGCCCAATTConserved hypothetical protein. 
J065136O05GAGGCCCAATTNONE 
Os07g0595800011-069-G09AATTGGGCCTCNONE 
AK066349AATTGGGCCTCPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05AATTGGGCCTCNONE 
Os07g0611600AK059431TTTTGGGCCTTGNONE 
J033096O12TTTTGGGCCTTGNONE 
J075143O21TTTTGGGCCTTGNONE 
Os07g0620200AK099859TGTTGGGCCTTHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04TGTTGGGCCTTNONE 
Os07g0631300009-145-C11AATTGGGCATTGGGCCTCNONE 
AK063855AATTGGGCATTGGGCCTCConserved hypothetical protein. 
J043012K22AATTGGGCATTGGGCCTCNONE 
J043020D08AATTGGGCATTGGGCCTCNONE 
J065015L18AATTGGGCATTGGGCCTCNONE 
J065021G12AATTGGGCATTGGGCCTCNONE 
J065021H11AATTGGGCATTGGGCCTCNONE 
J065042D02AATTGGGCATTGGGCCTCNONE 
J065067O21AATTGGGCATTGGGCCTCNONE 
J065078J12AATTGGGCATTGGGCCTCNONE 
J065094B22AATTGGGCATTGGGCCTCNONE 
J065106N18AATTGGGCATTGGGCCTCNONE 
J065150G13AATTGGGCATTGGGCCTCNONE 
J065157K08AATTGGGCATTGGGCCTCNONE 
J065164B05AATTGGGCATTGGGCCTCNONE 
J065172G19AATTGGGCATTGGGCCTCNONE 
J065173F12AATTGGGCATTGGGCCTCNONE 
J065174D16AATTGGGCATTGGGCCTCNONE 
J065185B02AATTGGGCATTGGGCCTCNONE 
J065207B14AATTGGGCATTGGGCCTCNONE 
J065207J19AATTGGGCATTGGGCCTCNONE 
J065212L20AATTGGGCATTGGGCCTCNONE 
J100053C03AATTGGGCATTGGGCCTCNONE 
Os07g0632600AK058943AAGGCCCAAGNONE 
J065034J15AAGGCCCAAGNONE 
Os07g0633800AK103878TATTGGGCCTCConserved hypothetical protein. 
J033025K08TATTGGGCCTCNONE 
J033026N04TATTGGGCCTCNONE 
J090062M09TATTGGGCCTCNONE 
J090087F04TATTGGGCCTCNONE 
Os07g0673100AK060100GAGGCCCAAGNONE 
AK103678GAGGCCCAAGRibosomal protein S8E family protein. 
AK104794GAGGCCCAAGNONE 
Os08g0109300AK061825CTTGGGCCTCNONE 
AK066688CTTGGGCCTCSimilar to Adenylate kinase, chloroplast (EC 2.7.4.3) (ATP-AMP transphosphorylase). 
J023013L12CTTGGGCCTCNONE 
Os08g0112800009-113-D03GAGGCCCAAANONE 
AK121176GAGGCCCAAARickettsia 17 kDa surface antigen family protein. 
J023083C18GAGGCCCAAANONE 
J033074M10GAGGCCCAAANONE 
J033097G10GAGGCCCAAANONE 
J065090F05GAGGCCCAAANONE 
J090001J03GAGGCCCAAANONE 
J090044F23GAGGCCCAAANONE 
J090078H09GAGGCCCAAANONE 
J100088G23GAGGCCCAAANONE 
Os08g0127600AK058365TGTTGGGCCTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373TGTTGGGCCTANONE 
J013149L10TGTTGGGCCTANONE 
J075027H17TGTTGGGCCTANONE 
J075060F10TGTTGGGCCTANONE 
Os08g0127700012-086-F03TAGGCCCAACANONE 
AK059350TAGGCCCAACANONE 
AK099242TAGGCCCAACANONE 
AK121348TAGGCCCAACAConserved hypothetical protein. 
J033027J18TAGGCCCAACANONE 
J065012F22TAGGCCCAACANONE 
J065046N17TAGGCCCAACANONE 
J065197B02TAGGCCCAACANONE 
J100018P04TAGGCCCAACANONE 
J100052C14TAGGCCCAACANONE 
J100083A12TAGGCCCAACANONE 
Os08g0139100006-027-E12AATTGGGCCTCNONE 
006-089-E06AATTGGGCCTCNONE 
006-113-G02AATTGGGCCTCNONE 
AK061429AATTGGGCCTCNONE 
AK099590AATTGGGCCTCSimilar to DAG protein, chloroplast precursor. 
AK104727AATTGGGCCTCNONE 
J013043H11AATTGGGCCTCNONE 
J013049N13AATTGGGCCTCNONE 
J065079F01AATTGGGCCTCNONE 
J065122N24AATTGGGCCTCNONE 
J065142J24AATTGGGCCTCNONE 
J065193N03AATTGGGCCTCNONE 
J075041I21AATTGGGCCTCNONE 
J075145E04AATTGGGCCTCNONE 
Os08g0143500006-072-G06TATTGGGCCTANONE 
016-053-H02TATTGGGCCTANONE 
AK061094TATTGGGCCTANONE 
AK071122TATTGGGCCTAGlycosyl transferase, family 14 protein. 
J023081E17TATTGGGCCTANONE 
J023106O18TATTGGGCCTANONE 
J043001N22TATTGGGCCTANONE 
J065062D05TATTGGGCCTANONE 
J065099M15TATTGGGCCTANONE 
J065180K12TATTGGGCCTANONE 
J090045L23TATTGGGCCTANONE 
J100088K05TATTGGGCCTANONE 
Os08g0158900AK067062TAGGCCCAAGGTP1/OBG domain containing protein. 
J013089F04TAGGCCCAAGNONE 
J013092D16TAGGCCCAAGNONE 
J033120K14TAGGCCCAAGNONE 
J033133F24TAGGCCCAAGNONE 
J033145A10TAGGCCCAAGNONE 
J033145A11TAGGCCCAAGNONE 
J053048H24TAGGCCCAAGNONE 
J053075H10TAGGCCCAAGNONE 
Os08g0159000AK073617CTTGGGCCTANONE 
AK103973CTTGGGCCTASimilar to DnaJ homolog subfamily C member 1. 
J023130H14CTTGGGCCTANONE 
J033051J11CTTGGGCCTANONE 
J065101C10CTTGGGCCTANONE 
J065168B04CTTGGGCCTANONE 
J065184E22CTTGGGCCTANONE 
J080021D11CTTGGGCCTANONE 
J080025H10CTTGGGCCTANONE 
J080026N19CTTGGGCCTANONE 
J080034A12CTTGGGCCTANONE 
J080040L02CTTGGGCCTANONE 
J080042H19CTTGGGCCTANONE 
J080047B05CTTGGGCCTANONE 
J080047E09CTTGGGCCTANONE 
J080047I01CTTGGGCCTANONE 
J080052H19CTTGGGCCTANONE 
J080062K13CTTGGGCCTANONE 
J080063A22CTTGGGCCTANONE 
J080068G18CTTGGGCCTANONE 
J080068N19CTTGGGCCTANONE 
J080076G08CTTGGGCCTANONE 
J080077H13CTTGGGCCTANONE 
J080077K06CTTGGGCCTANONE 
J080093D15CTTGGGCCTANONE 
J080094D21CTTGGGCCTANONE 
J080097A20CTTGGGCCTANONE 
J080097E21CTTGGGCCTANONE 
J080097N17CTTGGGCCTANONE 
J100071K18CTTGGGCCTANONE 
J100072F09CTTGGGCCTANONE 
Os08g0162500AK121633ATTTGGGCCTAConserved hypothetical protein. 
J033105E19ATTTGGGCCTANONE 
J080012K11ATTTGGGCCTANONE 
J080041I12ATTTGGGCCTANONE 
J080049G05ATTTGGGCCTANONE 
J080050P09ATTTGGGCCTANONE 
J080051A10ATTTGGGCCTANONE 
J080054G05ATTTGGGCCTANONE 
J080058M08ATTTGGGCCTANONE 
J080064N23ATTTGGGCCTANONE 
J080072L15ATTTGGGCCTANONE 
J080096H09ATTTGGGCCTANONE 
J100079I08ATTTGGGCCTANONE 
Os08g0224700AK121754ATTGGGCCTTSimilar to 26S proteasome subunit RPN2a. 
Os08g0227100AK071657TAGGCCCAAAATRAF-like domain containing protein. 
AK103481TAGGCCCAAAANONE 
J065183O06TAGGCCCAAAANONE 
J090013C07TAGGCCCAAAANONE 
J090081F11TAGGCCCAAAANONE 
Os08g0230000014-096-F01GAGGCCCAACANONE 
AK067127GAGGCCCAACAConserved hypothetical protein. 
J013096C05GAGGCCCAACANONE 
J100032D12GAGGCCCAACANONE 
Os08g0282000016-023-A09TAGGCCCAAACNONE 
AK101411TAGGCCCAAACCD9/CD37/CD63 antigen family protein. 
J033037J09TAGGCCCAAACNONE 
J090047I07TAGGCCCAAACNONE 
J100021H13TAGGCCCAAACNONE 
Os08g0327400AK070992AAGGCCCAAAASimilar to Enoyl-ACP reductase (Fragment). 
J023077K10AAGGCCCAAAANONE 
J065075F06AAGGCCCAAAANONE 
J065112N14AAGGCCCAAAANONE 
J090028K07AAGGCCCAAAANONE 
J090039C15AAGGCCCAAAANONE 
J090048I11AAGGCCCAAAANONE 
J090083M10AAGGCCCAAAANONE 
Os08g0412200006-028-H07AAGGCCCAAATNONE 
AJ575234AAGGCCCAAATNONE 
AK059631AAGGCCCAAATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099367AAGGCCCAAATNONE 
AK104578AAGGCCCAAATNONE 
J033071L08AAGGCCCAAATNONE 
J065197K18AAGGCCCAAATNONE 
Os08g0433200013-023-E07AAGGCCCAAACNONE 
AK099471AAGGCCCAAACConserved hypothetical protein. 
J013024A05AAGGCCCAAACNONE 
J013065N03AAGGCCCAAACNONE 
J023111A21AAGGCCCAAACNONE 
J065035F10AAGGCCCAAACNONE 
J065083H01AAGGCCCAAACNONE 
J065159E03AAGGCCCAAACNONE 
J065186A03AAGGCCCAAACNONE 
J075032B02AAGGCCCAAACNONE 
J075038L14AAGGCCCAAACNONE 
J075047N21AAGGCCCAAACNONE 
J075076H05AAGGCCCAAACNONE 
J075110C08AAGGCCCAAACNONE 
J090096K17AAGGCCCAAACNONE 
Os08g0463500AK058457TAGGCCCAAGZinc finger, C2H2-type domain containing protein. 
Os08g0469500AK109599TAGGCCCAAGConserved hypothetical protein. 
Os08g0499200AK120828TAGGCCCAAGSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2. 
Os08g0500900AK102314TATTGGGCCTTSimilar to Phosphoribosylglycinamide formyltransferase, chloroplast precursor (EC 2.1.2.2) (GART) (GAR transformylase) (5'-phosphoribosylglycinamide transformylase). 
Os08g0511000AK107578TATTGGGCCTGGProtein prenyltransferase domain containing protein. 
Os08g0526500016-063-D04CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
AK073431CCAGCCCAGTTAGGCCCAAGCCCATTASimilar to SOX-1 protein. 
J033042D10CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
J065019E02CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
Os08g0535600AK121683GTTGGGCCTAZinc finger, Tim10/DDP-type family protein. 
J065077E05GTTGGGCCTANONE 
J075088M24GTTGGGCCTANONE 
J075140B03GTTGGGCCTANONE 
J090014B14GTTGGGCCTANONE 
Os08g0540500AK106511TAGGCCCAAATSAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0557100AK070743AAGGCCCAAAANONE 
AK101214AAGGCCCAAAASimilar to Nucleic acid-binding protein precursor. 
AK105901AAGGCCCAAAANONE 
J033031B04AAGGCCCAAAANONE 
J080004F08AAGGCCCAAAANONE 
J080004H12AAGGCCCAAAANONE 
J080005H08AAGGCCCAAAANONE 
J080005I02AAGGCCCAAAANONE 
J080008N16AAGGCCCAAAANONE 
J080009H23AAGGCCCAAAANONE 
J080012H17AAGGCCCAAAANONE 
J080012J21AAGGCCCAAAANONE 
J080013I20AAGGCCCAAAANONE 
J080016E07AAGGCCCAAAANONE 
J080018O04AAGGCCCAAAANONE 
J080020B18AAGGCCCAAAANONE 
J080021I16AAGGCCCAAAANONE 
J080022N01AAGGCCCAAAANONE 
J080023G08AAGGCCCAAAANONE 
J080023N09AAGGCCCAAAANONE 
J080024J24AAGGCCCAAAANONE 
J080025M12AAGGCCCAAAANONE 
J080028A22AAGGCCCAAAANONE 
J080028I01AAGGCCCAAAANONE 
J080029D22AAGGCCCAAAANONE 
J080030M02AAGGCCCAAAANONE 
J080031B06AAGGCCCAAAANONE 
J080035G08AAGGCCCAAAANONE 
J080036F19AAGGCCCAAAANONE 
J080038P14AAGGCCCAAAANONE 
J080039C17AAGGCCCAAAANONE 
J080043A10AAGGCCCAAAANONE 
J080044H02AAGGCCCAAAANONE 
J080044P12AAGGCCCAAAANONE 
J080047L06AAGGCCCAAAANONE 
J080050L06AAGGCCCAAAANONE 
J080052J11AAGGCCCAAAANONE 
J080052M10AAGGCCCAAAANONE 
J080053E20AAGGCCCAAAANONE 
J080054J01AAGGCCCAAAANONE 
J080059N09AAGGCCCAAAANONE 
J080064F19AAGGCCCAAAANONE 
J080064N22AAGGCCCAAAANONE 
J080065K14AAGGCCCAAAANONE 
J080065M12AAGGCCCAAAANONE 
J080068O07AAGGCCCAAAANONE 
J080076P20AAGGCCCAAAANONE 
J080087D08AAGGCCCAAAANONE 
J080087H16AAGGCCCAAAANONE 
J080090N23AAGGCCCAAAANONE 
J080091H04AAGGCCCAAAANONE 
J080091P13AAGGCCCAAAANONE 
J080094O15AAGGCCCAAAANONE 
J080094P14AAGGCCCAAAANONE 
J080095I07AAGGCCCAAAANONE 
J080097E22AAGGCCCAAAANONE 
Os08g0557400006-024-C02TAGGCCCAACCNONE 
AK060067TAGGCCCAACCProtein tyrosine phosphatase-like protein. 
AY224424TAGGCCCAACCNONE 
Os09g0120033AK069069CTTGGGCCTCConserved hypothetical protein. 
Os09g0329800AK069775TTTTGGGCCTAACAGCCCATATConserved hypothetical protein. 
Os09g0329900Os09g0329900TTTTGGGCCTAACAGCCCATATNONE 
Os09g0385300AK073247AATTGGGCCTGGGCCATHypothetical protein. 
AK120455AATTGGGCCTGGGCCATNONE 
J013104G23AATTGGGCCTGGGCCATNONE 
J023110A14AATTGGGCCTGGGCCATNONE 
J033143F07AATTGGGCCTGGGCCATNONE 
J065036P14AATTGGGCCTGGGCCATNONE 
J065041I11AATTGGGCCTGGGCCATNONE 
J065103K11AATTGGGCCTGGGCCATNONE 
J065138M15AATTGGGCCTGGGCCATNONE 
J065138P09AATTGGGCCTGGGCCATNONE 
J065141J20AATTGGGCCTGGGCCATNONE 
J075063J16AATTGGGCCTGGGCCATNONE 
J075063K19AATTGGGCCTGGGCCATNONE 
J075085H08AATTGGGCCTGGGCCATNONE 
J075093C12AATTGGGCCTGGGCCATNONE 
J075127N08AATTGGGCCTGGGCCATNONE 
J075134E09AATTGGGCCTGGGCCATNONE 
J075166D06AATTGGGCCTGGGCCATNONE 
J075168K24AATTGGGCCTGGGCCATNONE 
J075197G05AATTGGGCCTGGGCCATNONE 
J080034J24AATTGGGCCTGGGCCATNONE 
Os09g0397100J075141L14CAAGGCCCAACANONE 
J100063H17CAAGGCCCAACAConserved hypothetical protein. 
Os09g0401200AK063980CTGGCCCAAATAGGCCCAAGGCCCATTTSimilar to HSP associated protein like. 
Os09g0412900014-003-F10GGGCCGGGCCCGTTAGGCCCAACANONE 
AK102254GGGCCGGGCCCGTTAGGCCCAACAProtein prenyltransferase domain containing protein. 
AK102867GGGCCGGGCCCGTTAGGCCCAACANONE 
J033088H22GGGCCGGGCCCGTTAGGCCCAACANONE 
Os09g0471900AK073815CAAGGCCCAACABacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0495200AK102989ATTGGGCCTCConserved hypothetical protein. 
J075062H18ATTGGGCCTCNONE 
J075098G06ATTGGGCCTCNONE 
Os09g0510000AK121614GCAGCCCACTTGTTGGGCCTCConserved hypothetical protein. 
J033043O11GCAGCCCACTTGTTGGGCCTCNONE 
J065113F04GCAGCCCACTTGTTGGGCCTCNONE 
J080044D13GCAGCCCACTTGTTGGGCCTCNONE 
Os09g0511700AK101420ATTGGGCCTGSimilar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118). 
J013022L19ATTGGGCCTGNONE 
J013036D23ATTGGGCCTGNONE 
J013037F22ATTGGGCCTGNONE 
J013111M23ATTGGGCCTGNONE 
J023109F14ATTGGGCCTGNONE 
J023119H17ATTGGGCCTGNONE 
J023133H23ATTGGGCCTGNONE 
J033032G17ATTGGGCCTGNONE 
J033038B10ATTGGGCCTGNONE 
J033071M16ATTGGGCCTGNONE 
J033096G04ATTGGGCCTGNONE 
J033109D06ATTGGGCCTGNONE 
J043016E22ATTGGGCCTGNONE 
J043022O09ATTGGGCCTGNONE 
J100023N11ATTGGGCCTGNONE 
J100046I21ATTGGGCCTGNONE 
Os09g0522800015-033-B12GAGGCCCAACCNONE 
015-083-G12GAGGCCCAACCNONE 
AK070906GAGGCCCAACCProtein of unknown function DUF1618 domain containing protein. 
J023065L17GAGGCCCAACCNONE 
J090090P20GAGGCCCAACCNONE 
Os09g0531900AK073015CAGGCCCAAATAGCCCAGCSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os09g0534000AK100026TATTGGGCCAGGCCCAAAAConserved hypothetical protein. 
Os09g0559800AK071542GTTGGGCCTGGACGGCCCATGGSimilar to Transporter-like protein. 
J013063N24GTTGGGCCTGGACGGCCCATGGNONE 
Os09g0566100J013035O15ATTGGGCCTTNONE 
J013132B07ATTGGGCCTTNONE 
J023049I24ATTGGGCCTTNONE 
J033033A21ATTGGGCCTTNONE 
J033057C14ATTGGGCCTTNONE 
Os09g0568000AK068829CAGGCCCAAAANONE 
Os11g0107500005-005-H05GAGGCCCAANONE 
009-118-E10GAGGCCCAANONE 
009-180-A04GAGGCCCAANONE 
AK121033GAGGCCCAAMacrophage migration inhibitory factor family protein. 
J013070C02GAGGCCCAANONE 
J013132P08GAGGCCCAANONE 
J023050K24GAGGCCCAANONE 
J053064N21GAGGCCCAANONE 
J053070L15GAGGCCCAANONE 
J053099E18GAGGCCCAANONE 
J065032A09GAGGCCCAANONE 
J065035L22GAGGCCCAANONE 
J065134D23GAGGCCCAANONE 
J065161L19GAGGCCCAANONE 
J065210K04GAGGCCCAANONE 
J075150A22GAGGCCCAANONE 
J090019C11GAGGCCCAANONE 
J090057N06GAGGCCCAANONE 
J090084D03GAGGCCCAANONE 
J090098L16GAGGCCCAANONE 
J100021H05GAGGCCCAANONE 
J100021N11GAGGCCCAANONE 
J100052B12GAGGCCCAANONE 
J100083N17GAGGCCCAANONE 
J100089D22GAGGCCCAANONE 
Os11g0130200AK059458CTTGGGCCTGProtein of unknown function DUF309 family protein. 
J075195F21CTTGGGCCTGNONE 
Os11g0139500AK121845GAGGCCCATCCAGGCCCAACANONE 
Os11g0153600AK065028TTTTGGGCCTGAGTP-binding signal recognition particle SRP54, G-domain containing protein. 
J013001G13TTTTGGGCCTGANONE 
Os11g0156200AK100124GAGGCCCAAATPeptidase S28 family protein. 
Os11g0163500AK101154GAGGCCCAATAHomeodomain-like containing protein. 
Os11g0244200AK107883TGTTGGGCCTASimilar to Pisum sativum 17.9 kDa heat shock protein (hsp17.9) (Fragment). 
Os11g0286800AK072702AATTGGGCCTATerpene synthase family protein. 
AK100763AATTGGGCCTANONE 
AK107355AATTGGGCCTANONE 
J013026O22AATTGGGCCTANONE 
J013065A14AATTGGGCCTANONE 
J013129G22AATTGGGCCTANONE 
J023119J04AATTGGGCCTANONE 
Os11g0423200AK111297AAGGCCCAAGHypothetical protein. 
Os11g0473000AK060156AAGGCCCAAGGCCCATCANONE 
AK065994AAGGCCCAAGGCCCATCASimilar to ER lumen protein retaining receptor (HDEL receptor) (PGP169-12). 
AK104759AAGGCCCAAGGCCCATCANONE 
Os11g0484300AK121422AAATGGGCCGGGCCGAGGCCCAAASimilar to Mcm2-prov protein. 
Os11g0497000AK111924CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATSimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065097A08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065123J10CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J075096F04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J080065C15CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090033J04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090072N23CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100021E08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100063H21CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
Os11g0586300AK072257CCAGGCCCAAGConserved hypothetical protein. 
Os11g0615700AB026561ATTTGGGCCTTNONE 
AK059521ATTTGGGCCTTNONE 
AK103487ATTTGGGCCTTProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14ATTTGGGCCTTNONE 
J065044A11ATTTGGGCCTTNONE 
J065090I02ATTTGGGCCTTNONE 
J065104I09ATTTGGGCCTTNONE 
J065187J10ATTTGGGCCTTNONE 
J075024E07ATTTGGGCCTTNONE 
J075025O13ATTTGGGCCTTNONE 
J090062N12ATTTGGGCCTTNONE 
J090087G06ATTTGGGCCTTNONE 
J090098K11ATTTGGGCCTTNONE 
Os11g0644750009-018-E07CTTGGGCCTCNONE 
009-075-B11CTTGGGCCTCNONE 
009-098-C10CTTGGGCCTCNONE 
AK062734CTTGGGCCTCPlant disease resistance response protein family protein. 
Os11g0657200AK059959GTTTGGGCCTC2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07GAGGCCCAAACNONE 
AK062752GAGGCCCAAACSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os12g0136600AK064762ATTGGGCCTTGConserved hypothetical protein. 
J075198J21ATTGGGCCTTGNONE 
J080024B04ATTGGGCCTTGNONE 
J080042H13ATTGGGCCTTGNONE 
J080042J18ATTGGGCCTTGNONE 
J080068A13ATTGGGCCTTGNONE 
J080076G10ATTGGGCCTTGNONE 
J080076H12ATTGGGCCTTGNONE 
J080097E20ATTGGGCCTTGNONE 
J080097L07ATTGGGCCTTGNONE 
J090049I08ATTGGGCCTTGNONE 
Os12g0156400012-065-D02AATTGGGCCTCNONE 
AK072086AATTGGGCCTCNONE 
AK099278AATTGGGCCTCDcp1-like decapping family protein. 
J013063H09AATTGGGCCTCNONE 
J023125D09AATTGGGCCTCNONE 
J023149G21AATTGGGCCTCNONE 
J033064E07AATTGGGCCTCNONE 
J033093C07AATTGGGCCTCNONE 
J033107E06AATTGGGCCTCNONE 
J075172A11AATTGGGCCTCNONE 
J090009E07AATTGGGCCTCNONE 
J090023F13AATTGGGCCTCNONE 
J090071N18AATTGGGCCTCNONE 
Os12g0168700AK065708CCAGGCCCAACAAMP-dependent synthetase and ligase domain containing protein. 
AK065718CCAGGCCCAACANONE 
Os12g0223300006-037-D03GAGGCCCAAGNONE 
006-037-D03GAGGCCCAAGNONE 
AJ429043GAGGCCCAAGNONE 
AJ429043GAGGCCCAAGNONE 
AK060133GAGGCCCAAGSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK060133GAGGCCCAAGSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK073017GAGGCCCAAGNONE 
AK073017GAGGCCCAAGNONE 
J065085K05GAGGCCCAAGNONE 
J065085K05GAGGCCCAAGNONE 
J075053C01GAGGCCCAAGNONE 
J075053C01GAGGCCCAAGNONE 
J075055O06GAGGCCCAAGNONE 
J075055O06GAGGCCCAAGNONE 
J075073B01GAGGCCCAAGNONE 
J075073B01GAGGCCCAAGNONE 
J075089M07GAGGCCCAAGNONE 
J075089M07GAGGCCCAAGNONE 
J075095E16GAGGCCCAAGNONE 
J075095E16GAGGCCCAAGNONE 
J075112O19GAGGCCCAAGNONE 
J075112O19GAGGCCCAAGNONE 
J075143A11GAGGCCCAAGNONE 
J075143A11GAGGCCCAAGNONE 
J075173D24GAGGCCCAAGNONE 
J075173D24GAGGCCCAAGNONE 
J075199G18GAGGCCCAAGNONE 
J075199G18GAGGCCCAAGNONE 
J090030N06GAGGCCCAAGNONE 
J090030N06GAGGCCCAAGNONE 
J100052H12GAGGCCCAAGNONE 
J100052H12GAGGCCCAAGNONE 
J100079F09GAGGCCCAAGNONE 
J100079F09GAGGCCCAAGNONE 
Os12g0477600009-115-E02ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-125-D04ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-152-E11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
013-003-H06ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
AK099534ACCGGGCCCACTGGGCCGGAGGCCCAAAAConserved hypothetical protein. 
J065109J18ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J065115L23ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075002K19ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075034D13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075038B07ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075051A21ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075052J11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075072A08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075080E10ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075101E13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075112F22ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075139O17ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075141K08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075146N01ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075171J24ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
Os12g0503200014-087-C11TAGGCCCAATTNONE 
AK105377TAGGCCCAATTNONE 
Os12g0508300009-006-G07GAGGCCCAACTNONE 
009-133-E05GAGGCCCAACTNONE 
009-137-F10GAGGCCCAACTNONE 
014-024-A06GAGGCCCAACTNONE 
AK059123GAGGCCCAACTRibosomal protein S14 family protein. 
J100088E22GAGGCCCAACTNONE 
Os12g0564400009-069-F12GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
AK059949GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
Os12g0574800AK073004ATTTGGGCCTAATTGGGCCGTGNONE 
AK102465ATTTGGGCCTAATTGGGCCGTGBromodomain transcription factor containing protein. 
AK121687ATTTGGGCCTAATTGGGCCGTGNONE 
J033070O18ATTTGGGCCTAATTGGGCCGTGNONE 
J075097O17ATTTGGGCCTAATTGGGCCGTGNONE 
J080069F02ATTTGGGCCTAATTGGGCCGTGNONE 
Os12g0577900015-034-E07TCAGGCCCAACCNONE 
AK106299TCAGGCCCAACCProtein prenyltransferase domain containing protein. 
Os12g0588900AK069966AAAGCCCATTGGGCCTGGConserved hypothetical protein. 
AK069966GACGGCCCAGCTAGGCCCAATTConserved hypothetical protein. 
J023038A10AAAGCCCATTGGGCCTGGNONE 
J023038A10GACGGCCCAGCTAGGCCCAATTNONE 
J065061J23AAAGCCCATTGGGCCTGGNONE 
J065061J23GACGGCCCAGCTAGGCCCAATTNONE 
J065176O08AAAGCCCATTGGGCCTGGNONE 
J065176O08GACGGCCCAGCTAGGCCCAATTNONE 
J075143K13AAAGCCCATTGGGCCTGGNONE 
J075143K13GACGGCCCAGCTAGGCCCAATTNONE 
Os12g0610100Os12g0610100CAGGCCCAATTConserved hypothetical protein. 
Os12g0616900AK063753AATTGGGCCTTSimilar to Pyruvate dehydrogenase E1 beta subunit (Fragment). 
AK101464AATTGGGCCTTNONE 
J033126J16AATTGGGCCTTNONE 
J065140B05AATTGGGCCTTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.