version

Summary of OsREG472 (All List)

OrganismOryza sativa  
IDOsREG472  
SequenceAGGCCCAC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2354  

Entry Sequences (2354 entries)

LocusGene modelSequenceDescription
Os01g0104000AK072087TAGGCCCACAGAAGCCCATAANONE 
AK103808TAGGCCCACAGAAGCCCATAAC-type lectin domain containing protein. 
Os01g0104100AK072797TTATGGGCTTCTGTGGGCCTAZinc finger, RING-type domain containing protein. 
AK104280TTATGGGCTTCTGTGGGCCTANONE 
Os01g0132700J065063N10AGTGGGCCTCSurfeit locus 5 family protein. 
J065164N24AGTGGGCCTCNONE 
J065167H04AGTGGGCCTCNONE 
J065187N12AGTGGGCCTCNONE 
Os01g0132800AK068422AGTGGGCCTAPeptidyl-tRNA hydrolase family protein. 
Os01g0171200AK107515ACGTGGGCCTTGNONE 
AK109475ACGTGGGCCTTGConserved hypothetical protein. 
Os01g0191100009-011-A02CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-011-A02TAGGCCCACACGNONE 
009-028-D05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-028-D05TAGGCCCACACGNONE 
009-058-B11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-058-B11TAGGCCCACACGNONE 
009-151-D09CCACCTGTGGGCCTTCTGGGCTTTTNONE 
009-151-D09TAGGCCCACACGNONE 
013-026-G03CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-026-G03TAGGCCCACACGNONE 
013-063-F04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-063-F04TAGGCCCACACGNONE 
013-069-B05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
013-069-B05TAGGCCCACACGNONE 
014-029-E04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-029-E04TAGGCCCACACGNONE 
014-072-H04CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-072-H04TAGGCCCACACGNONE 
014-089-E09CCACCTGTGGGCCTTCTGGGCTTTTNONE 
014-089-E09TAGGCCCACACGNONE 
015-047-G05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
015-047-G05TAGGCCCACACGNONE 
016-033-G06CCACCTGTGGGCCTTCTGGGCTTTTNONE 
016-033-G06TAGGCCCACACGNONE 
AK058815CCACCTGTGGGCCTTCTGGGCTTTTSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
AK058815TAGGCCCACACGSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023069C08TAGGCCCACACGNONE 
J023077K21CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023077K21TAGGCCCACACGNONE 
J023081F19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J023081F19TAGGCCCACACGNONE 
J033052N11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033052N11TAGGCCCACACGNONE 
J033058N11CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033058N11TAGGCCCACACGNONE 
J033114G05CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033114G05TAGGCCCACACGNONE 
J033114O17CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033114O17TAGGCCCACACGNONE 
J033129L14CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J033129L14TAGGCCCACACGNONE 
J053029I12CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J053029I12TAGGCCCACACGNONE 
J065067N19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065067N19TAGGCCCACACGNONE 
J065084I19CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065084I19TAGGCCCACACGNONE 
J065099O03CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065099O03TAGGCCCACACGNONE 
J065201I08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J065201I08TAGGCCCACACGNONE 
J075035B08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075035B08TAGGCCCACACGNONE 
J075037B22CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075037B22TAGGCCCACACGNONE 
J075054L16CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075054L16TAGGCCCACACGNONE 
J075059D15CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075059D15TAGGCCCACACGNONE 
J075164I08CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075164I08TAGGCCCACACGNONE 
J075185J01CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J075185J01TAGGCCCACACGNONE 
J090042O06CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090042O06TAGGCCCACACGNONE 
J090044F12CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090044F12TAGGCCCACACGNONE 
J090063L02CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090063L02TAGGCCCACACGNONE 
J090073I10CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090073I10TAGGCCCACACGNONE 
J090078E18CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J090078E18TAGGCCCACACGNONE 
J100072K16CCACCTGTGGGCCTTCTGGGCTTTTNONE 
J100072K16TAGGCCCACACGNONE 
Os01g0191800AK061360AGCCCATAAAGGCCCACCTNONE 
Os01g0209000AK103701CAAGTGGGCCTAAlg9-like mannosyltransferase family protein. 
J065104C04CAAGTGGGCCTANONE 
J090083C01CAAGTGGGCCTANONE 
Os01g0219200AK108579CCAGGCCCACTTGTCAGTGConserved hypothetical protein. 
Os01g0222700012-011-E01GAGGCCCACGTNONE 
AK068883GAGGCCCACGTNONE 
AK101946GAGGCCCACGTZinc finger, BED-type predicted domain containing protein. 
J033075C16GAGGCCCACGTNONE 
J043013D08GAGGCCCACGTNONE 
J065089G19GAGGCCCACGTNONE 
J065197K19GAGGCCCACGTNONE 
J075161L21GAGGCCCACGTNONE 
Os01g0229100006-113-G08ACGTGGGCCTCNONE 
011-075-E08ACGTGGGCCTCNONE 
AK061285ACGTGGGCCTCNONE 
AK070838ACGTGGGCCTCTetratricopeptide-like helical domain containing protein. 
J013059F08ACGTGGGCCTCNONE 
J013059G08ACGTGGGCCTCNONE 
J013059G09ACGTGGGCCTCNONE 
J013069M12ACGTGGGCCTCNONE 
J013105A19ACGTGGGCCTCNONE 
J013149F07ACGTGGGCCTCNONE 
J023073J07ACGTGGGCCTCNONE 
J023130F24ACGTGGGCCTCNONE 
J023147J08ACGTGGGCCTCNONE 
J033028F13ACGTGGGCCTCNONE 
J033115A16ACGTGGGCCTCNONE 
J033135F02ACGTGGGCCTCNONE 
J065031G16ACGTGGGCCTCNONE 
J065058A09ACGTGGGCCTCNONE 
J065089N15ACGTGGGCCTCNONE 
J065130I09ACGTGGGCCTCNONE 
J065191P09ACGTGGGCCTCNONE 
J065197P14ACGTGGGCCTCNONE 
J080306D15ACGTGGGCCTCNONE 
J080308M06ACGTGGGCCTCNONE 
J080315A03ACGTGGGCCTCNONE 
J080315N11ACGTGGGCCTCNONE 
J090046E14ACGTGGGCCTCNONE 
J090058G09ACGTGGGCCTCNONE 
J090077H05ACGTGGGCCTCNONE 
J090087O20ACGTGGGCCTCNONE 
Os01g0229200AK066024GAGGCCCACGTVHS domain containing protein. 
Os01g0258600J075028F17GACGGCCCAGGCCCACGGCCCACANONE 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
J075071B09GACGGCCCAGGCCCACGGCCCACANONE 
J075093E04GACGGCCCAGGCCCACGGCCCACANONE 
J100033B11GACGGCCCAGGCCCACGGCCCACANONE 
Os01g0283000AK073165GAGGCCCACTConserved hypothetical protein. 
J033023G08GAGGCCCACTNONE 
Os01g0283100004-018-B01AGTGGGCCTCNONE 
AK060908AGTGGGCCTCNONE 
AK071713AGTGGGCCTCSimilar to Ferripyochelin-binding protein-like. 
AK104205AGTGGGCCTCNONE 
AK122051AGTGGGCCTCNONE 
J023109L19AGTGGGCCTCNONE 
Os01g0299400AK107814GAGGCCCACAASterile alpha motif homology domain containing protein. 
J065112H10GAGGCCCACAANONE 
Os01g0324400AK102854ACAGCCCAGCCCACCAGGCCCACANONE 
AK111299ACAGCCCAGCCCACCAGGCCCACANONE 
J033032A11ACAGCCCAGCCCACCAGGCCCACANONE 
J033110L02ACAGCCCAGCCCACCAGGCCCACANONE 
Os01g0618500011-019-D03GAGGCCCACTACGGCCCACCTNONE 
AK067476GAGGCCCACTACGGCCCACCTSimilar to RNA helicase (Fragment). 
J013020E19GAGGCCCACTACGGCCCACCTNONE 
J033046J12GAGGCCCACTACGGCCCACCTNONE 
J033055D06GAGGCCCACTACGGCCCACCTNONE 
Os01g0626300016-070-G04GAGGCCCACNONE 
AK122071GAGGCCCACSimilar to Mitochondrial import receptor subunit TOM7-1 (Translocase of outer membrane 7 kDa subunit 1). 
J023108I04GAGGCCCACNONE 
J033117J08GAGGCCCACNONE 
J065007O12GAGGCCCACNONE 
J065020K12GAGGCCCACNONE 
J065142D24GAGGCCCACNONE 
J065157K19GAGGCCCACNONE 
J080307H19GAGGCCCACNONE 
J080311D16GAGGCCCACNONE 
J080316C12GAGGCCCACNONE 
J080316E03GAGGCCCACNONE 
J100033K16GAGGCCCACNONE 
J100042J21GAGGCCCACNONE 
J100051E06GAGGCCCACNONE 
J100071E22GAGGCCCACNONE 
Os01g0680400AK067914AAGGCCCACGCGTAFII28-like protein family protein. 
J065039K13AAGGCCCACGCGNONE 
J065042K22AAGGCCCACGCGNONE 
J080016E23AAGGCCCACGCGNONE 
J080064E22AAGGCCCACGCGNONE 
Os01g0743400AK059177TCGTGGGCCTTSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114TCGTGGGCCTTNONE 
J065070E07TCGTGGGCCTTNONE 
J065152G11TCGTGGGCCTTNONE 
Os01g0750900AK111087ACGTGGGCCTAConserved hypothetical protein. 
J100042H18ACGTGGGCCTANONE 
J100044L13ACGTGGGCCTANONE 
Os01g0757200AB092485GAGGCCCACCCNONE 
AK060666GAGGCCCACCCNONE 
AK060714GAGGCCCACCCNONE 
AK099350GAGGCCCACCCNONE 
AK101713GAGGCCCACCCSimilar to GA 2-oxidase 4. 
Os01g0757700AK102734CCACTGACAGTGGGCCTCConserved hypothetical protein. 
J033106B06CCACTGACAGTGGGCCTCNONE 
J065025B07CCACTGACAGTGGGCCTCNONE 
J065025B08CCACTGACAGTGGGCCTCNONE 
J065033E12CCACTGACAGTGGGCCTCNONE 
J065197B01CCACTGACAGTGGGCCTCNONE 
Os01g0764300J090053G03TCAGGCCCACCProtein of unknown function DUF155 family protein. 
Os01g0794100009-027-B12TGTGGGCCTGNONE 
AK062404TGTGGGCCTGConserved hypothetical protein. 
Os01g0805000009-045-H11AGTGGGCCTANONE 
009-196-H08AGTGGGCCTANONE 
J013094D22AGTGGGCCTARibosomal protein L34 family protein. 
J013119F23AGTGGGCCTANONE 
J065128B11AGTGGGCCTANONE 
Os01g0839300AK064685GAGGCCCACTGGGCCGAAASimilar to 50S ribosomal protein L17. 
J065060I21GAGGCCCACTGGGCCGAAANONE 
Os01g0850400AJ575220GGGCCGAGAGGCCCACGCGNONE 
AK108582GGGCCGAGAGGCCCACGCGSimilar to MYBY1 protein (Fragment). 
Os01g0861000AK058707TAGGCCCACTConserved hypothetical protein. 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
J065013G01CAGCCCAGCCCAAGGCCCACCANONE 
J065063D03CAGCCCAGCCCAAGGCCCACCANONE 
J065143H01CAGCCCAGCCCAAGGCCCACCANONE 
J065146F08CAGCCCAGCCCAAGGCCCACCANONE 
J065153D14CAGCCCAGCCCAAGGCCCACCANONE 
J065170E02CAGCCCAGCCCAAGGCCCACCANONE 
J065175M22CAGCCCAGCCCAAGGCCCACCANONE 
J065186E13CAGCCCAGCCCAAGGCCCACCANONE 
J075023J16CAGCCCAGCCCAAGGCCCACCANONE 
J075176J06CAGCCCAGCCCAAGGCCCACCANONE 
Os01g0896800AK065268CCAGGCCCACANONE 
AK104693CCAGGCCCACAEukaryotic ribosomal protein L5 family protein. 
J013126P09CCAGGCCCACANONE 
J033046N15CCAGGCCCACANONE 
J090008K02CCAGGCCCACANONE 
J090024F15CCAGGCCCACANONE 
J090074I23CCAGGCCCACANONE 
J090093F03CCAGGCCCACANONE 
J090096N02CCAGGCCCACANONE 
Os01g0915800AK103859TAGGCCCACGCGSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TAGGCCCACGCGNONE 
J090056H03TAGGCCCACGCGNONE 
J090058L14TAGGCCCACGCGNONE 
J090058P16TAGGCCCACGCGNONE 
J090076C19TAGGCCCACGCGNONE 
J100086P14TAGGCCCACGCGNONE 
Os01g0920000AK069967GAGGCCCACTCBS domain containing protein. 
Os01g0934500AK073211GAGGCCCACGAAConserved hypothetical protein. 
Os01g0958100AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
Os01g0969100AK070623GAGGCCCATGCAGGCCCACCAACNAD-dependent epimerase/dehydratase family protein. 
Os01g0976300AK111354TGGTGGGCCTAHeavy metal transport/detoxification protein domain containing protein. 
Os02g0120000AK067383GTGGTGGGCCTATTTGGGCTGAProtein prenyltransferase domain containing protein. 
AK101590GTGGTGGGCCTATTTGGGCTGANONE 
J013100B15GTGGTGGGCCTATTTGGGCTGANONE 
Os02g0121100012-035-F06CAAGGCCCACTCCCCCACGNONE 
013-031-H05CAAGGCCCACTCCCCCACGNONE 
013-058-E11CAAGGCCCACTCCCCCACGNONE 
014-010-D01CAAGGCCCACTCCCCCACGNONE 
AK070711CAAGGCCCACTCCCCCACGConserved hypothetical protein. 
AK119758CAAGGCCCACTCCCCCACGNONE 
J013033G12CAAGGCCCACTCCCCCACGNONE 
J023007M16CAAGGCCCACTCCCCCACGNONE 
J023020K20CAAGGCCCACTCCCCCACGNONE 
J023061H10CAAGGCCCACTCCCCCACGNONE 
J033027H20CAAGGCCCACTCCCCCACGNONE 
J033051E18CAAGGCCCACTCCCCCACGNONE 
J090005F12CAAGGCCCACTCCCCCACGNONE 
J090017A20CAAGGCCCACTCCCCCACGNONE 
J090018G11CAAGGCCCACTCCCCCACGNONE 
J090062C18CAAGGCCCACTCCCCCACGNONE 
J100027N10CAAGGCCCACTCCCCCACGNONE 
J100032L14CAAGGCCCACTCCCCCACGNONE 
J100045C14CAAGGCCCACTCCCCCACGNONE 
J100061M09CAAGGCCCACTCCCCCACGNONE 
J100062K11CAAGGCCCACTCCCCCACGNONE 
J100064H11CAAGGCCCACTCCCCCACGNONE 
J100074H16CAAGGCCCACTCCCCCACGNONE 
J100082N01CAAGGCCCACTCCCCCACGNONE 
Os02g0135600AK069843GCCGGCCCAGTTAGGCCCACAConserved hypothetical protein. 
J023034H09GCCGGCCCAGTTAGGCCCACANONE 
J033090D08GCCGGCCCAGTTAGGCCCACANONE 
J100025N07GCCGGCCCAGTTAGGCCCACANONE 
J100075G18GCCGGCCCAGTTAGGCCCACANONE 
Os02g0135700AK100570TGTGGGCCTAACTGGGCCGGCDNA polymerase V family protein. 
Os02g0146700AK105609CAAGGCCCACASimilar to PSMD2 subunit (Fragment). 
AK119490CAAGGCCCACANONE 
AK121963CAAGGCCCACANONE 
Os02g0178400009-151-B08TAGGCCCACANONE 
AK063815TAGGCCCACAProtein transport protein SEC61 gamma subunit. 
AK121516TAGGCCCACANONE 
J033026A17TAGGCCCACANONE 
J065011K14TAGGCCCACANONE 
J065056D01TAGGCCCACANONE 
J065061L22TAGGCCCACANONE 
J065076M01TAGGCCCACANONE 
J075092E14TAGGCCCACANONE 
Os02g0193600AK060499TAGGCCCACAMad3/BUB1 homology region 1 domain containing protein. 
Os02g0226900AK064279CAGGCCCACGAACGGCCCProtein prenyltransferase domain containing protein. 
Os02g0245000AK119770CCAGGCCCACGANONE 
AK119874CCAGGCCCACGASWAP/Surp domain containing protein. 
J065038L11CCAGGCCCACGANONE 
J100059I06CCAGGCCCACGANONE 
J100076C23CCAGGCCCACGANONE 
J100081P08CCAGGCCCACGANONE 
J100084C13CCAGGCCCACGANONE 
Os02g0266200AK099647TAGGCCCACGCGNONE 
AK103371TAGGCCCACGCGProtein prenyltransferase domain containing protein. 
Os02g0496900AK059542AAGGCCCACACGGCCCACCTConserved hypothetical protein. 
J053031E06AAGGCCCACACGGCCCACCTNONE 
J065195E11AAGGCCCACACGGCCCACCTNONE 
J090008P16AAGGCCCACACGGCCCACCTNONE 
Os02g0510300AK067961TGTGGGCCTAConserved hypothetical protein. 
AK104001TGTGGGCCTANONE 
J013123J20TGTGGGCCTANONE 
J065169H15TGTGGGCCTANONE 
Os02g0525400011-008-B01TAGGCCCACAGCCCAAACNONE 
AK065368TAGGCCCACAGCCCAAACSimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
J013021B13TAGGCCCACAGCCCAAACNONE 
J033046H10TAGGCCCACAGCCCAAACNONE 
Os02g0555000015-020-G02CCGTGGGCCTCNONE 
AK065270CCGTGGGCCTCNONE 
AK121253CCGTGGGCCTCProtein of unknown function, ATP binding family protein. 
J013002L01CCGTGGGCCTCNONE 
J023060A02CCGTGGGCCTCNONE 
J023101O11CCGTGGGCCTCNONE 
J023140A15CCGTGGGCCTCNONE 
J033042H19CCGTGGGCCTCNONE 
J033046C02CCGTGGGCCTCNONE 
J033080N19CCGTGGGCCTCNONE 
J065026I02CCGTGGGCCTCNONE 
J065040C18CCGTGGGCCTCNONE 
J090004I16CCGTGGGCCTCNONE 
Os02g0567000AK068282TGTGGGCCTAConserved hypothetical protein. 
J075034A17TGTGGGCCTANONE 
J075129I09TGTGGGCCTANONE 
Os02g0591800AK060611ACATGGGCTAGGCCCACTBrix domain containing protein. 
AK102534ACATGGGCTAGGCCCACTNONE 
J075057H08ACATGGGCTAGGCCCACTNONE 
J075179P18ACATGGGCTAGGCCCACTNONE 
J080011H01ACATGGGCTAGGCCCACTNONE 
J080018E14ACATGGGCTAGGCCCACTNONE 
J080026N17ACATGGGCTAGGCCCACTNONE 
J080047A13ACATGGGCTAGGCCCACTNONE 
J080049C17ACATGGGCTAGGCCCACTNONE 
J080050G07ACATGGGCTAGGCCCACTNONE 
J080064D10ACATGGGCTAGGCCCACTNONE 
J080080A03ACATGGGCTAGGCCCACTNONE 
J080080G20ACATGGGCTAGGCCCACTNONE 
J080080I03ACATGGGCTAGGCCCACTNONE 
J080081H12ACATGGGCTAGGCCCACTNONE 
J080090K07ACATGGGCTAGGCCCACTNONE 
J080092O06ACATGGGCTAGGCCCACTNONE 
J080096B07ACATGGGCTAGGCCCACTNONE 
J080097M08ACATGGGCTAGGCCCACTNONE 
Os02g0605600016-017-B02AAGGCCCACGANONE 
AK066104AAGGCCCACGALUC7 related family protein. 
J013052G16AAGGCCCACGANONE 
J043022E03AAGGCCCACGANONE 
J065105P10AAGGCCCACGANONE 
Os02g0606900J023065M01TAGGCCCACANONE 
J023065M01TGGTGGGCCTANONE 
J075046E14TAGGCCCACANONE 
J075046E14TGGTGGGCCTANONE 
Os02g0614600AK058581TCGTGGGCCTCNONE 
Os02g0651500AK066333GAGGCCCACTNONE 
AK121865GAGGCCCACTHypothetical protein. 
J090038J11GAGGCCCACTNONE 
Os02g0653800J023002B17CAAGTGGGCCTTNONE 
J033067E03CAAGTGGGCCTTSimilar to GTP-binding protein. 
J033105M04CAAGTGGGCCTTNONE 
J053039E15CAAGTGGGCCTTNONE 
J065026L07CAAGTGGGCCTTNONE 
J065038B03CAAGTGGGCCTTNONE 
J065087J15CAAGTGGGCCTTNONE 
J065121B22CAAGTGGGCCTTNONE 
J065128N12CAAGTGGGCCTTNONE 
J065189E19CAAGTGGGCCTTNONE 
J100058B03CAAGTGGGCCTTNONE 
Os02g0656500011-045-C08TCAGGCCCACTNONE 
011-045-E06TCAGGCCCACTNONE 
016-046-A01TCAGGCCCACTNONE 
016-046-B01TCAGGCCCACTNONE 
AK062239TCAGGCCCACTNONE 
AK066420TCAGGCCCACTDnaJ-like protein. 
J013067J21TCAGGCCCACTNONE 
J065047L09TCAGGCCCACTNONE 
J065104M20TCAGGCCCACTNONE 
J065134B04TCAGGCCCACTNONE 
J065152C10TCAGGCCCACTNONE 
J065161O03TCAGGCCCACTNONE 
J065169F18TCAGGCCCACTNONE 
J065210M21TCAGGCCCACTNONE 
J065217B03TCAGGCCCACTNONE 
J065218C10TCAGGCCCACTNONE 
J075041F09TCAGGCCCACTNONE 
J075048A02TCAGGCCCACTNONE 
J075083F21TCAGGCCCACTNONE 
J080005F10TCAGGCCCACTNONE 
J080013P21TCAGGCCCACTNONE 
J080027J09TCAGGCCCACTNONE 
J080037O17TCAGGCCCACTNONE 
J080039F02TCAGGCCCACTNONE 
J080039G01TCAGGCCCACTNONE 
J080041I09TCAGGCCCACTNONE 
J080043M01TCAGGCCCACTNONE 
J080060H17TCAGGCCCACTNONE 
J080062O07TCAGGCCCACTNONE 
J080079F05TCAGGCCCACTNONE 
J080093H04TCAGGCCCACTNONE 
J080096B15TCAGGCCCACTNONE 
J080097H24TCAGGCCCACTNONE 
J090032O11TCAGGCCCACTNONE 
J090044F01TCAGGCCCACTNONE 
J090045E04TCAGGCCCACTNONE 
J090048O03TCAGGCCCACTNONE 
J090049E04TCAGGCCCACTNONE 
J090070E19TCAGGCCCACTNONE 
J090079E13TCAGGCCCACTNONE 
J090089L14TCAGGCCCACTNONE 
J090095K13TCAGGCCCACTNONE 
J090096I19TCAGGCCCACTNONE 
J090098B04TCAGGCCCACTNONE 
J100027P13TCAGGCCCACTNONE 
J100048H06TCAGGCCCACTNONE 
J100060J15TCAGGCCCACTNONE 
J100070K16TCAGGCCCACTNONE 
J100074O22TCAGGCCCACTNONE 
Os02g0661300016-077-C09GAGGCCCACCTNONE 
AK106503GAGGCCCACCTConserved hypothetical protein. 
Os02g0666800AK101444TAGGCCCACAAProtein of unknown function DUF788 family protein. 
J033039F09TAGGCCCACAANONE 
J065041E15TAGGCCCACAANONE 
J075087I24TAGGCCCACAANONE 
J100079A10TAGGCCCACAANONE 
Os02g0682600AK108470TGTGGGCCTAZinc finger, Tim10/DDP-type family protein. 
J065019B06TGTGGGCCTANONE 
J065065L01TGTGGGCCTANONE 
Os02g0728600AK063054CTGACAGGTGGGCCTASimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065121P04CTGACAGGTGGGCCTANONE 
Os02g0741500AK068867CAGGCCCACCARibbon-helix-helix domain containing protein. 
Os02g0767900009-154-G01AGGTGGGCCTAGCCCATCGNONE 
009-154-G01AGGTGGGCCTGGCCCATCANONE 
009-172-H09AGGTGGGCCTAGCCCATCGNONE 
009-172-H09AGGTGGGCCTGGCCCATCANONE 
AK099885AGGTGGGCCTAGCCCATCGGlutaredoxin 2 family protein. 
AK099885AGGTGGGCCTGGCCCATCAGlutaredoxin 2 family protein. 
Os02g0770700AK106494TGTGGGCCTAPeptidase C50, separase family protein. 
Os02g0793000AK070242GAGGCCCACGANONE 
AK099173GAGGCCCACGANONE 
AK105863GAGGCCCACGAZinc finger, CCCH-type domain containing protein. 
Os02g0795900012-075-B04GAGGCCCACGAANONE 
AK105305GAGGCCCACGAASimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21GAGGCCCACGAANONE 
Os02g0802400J065054M13AGGTGGGCCTGGNONE 
J065061I04AGGTGGGCCTGGNONE 
J065112M15AGGTGGGCCTGGEF-Hand type domain containing protein. 
J100050L24AGGTGGGCCTGGNONE 
J100059D20AGGTGGGCCTGGNONE 
Os02g0819700AK067374CAAGGCCCACACGZinc finger, Zim17-type family protein. 
AK099160CAAGGCCCACACGNONE 
J100086K17CAAGGCCCACACGNONE 
Os02g0829900009-044-G07AGGTGGGCGTGGGCCTGNONE 
AK120917AGGTGGGCGTGGGCCTGSimilar to BRICK1. 
AY224582AGGTGGGCGTGGGCCTGNONE 
J023034L01AGGTGGGCGTGGGCCTGNONE 
J023034M01AGGTGGGCGTGGGCCTGNONE 
J090010G06AGGTGGGCGTGGGCCTGNONE 
J090020D07AGGTGGGCGTGGGCCTGNONE 
J100041L04AGGTGGGCGTGGGCCTGNONE 
J100061D05AGGTGGGCGTGGGCCTGNONE 
J100070L18AGGTGGGCGTGGGCCTGNONE 
Os03g0127000AK068479TGTGGGCCTCConserved hypothetical protein. 
J013152D10TGTGGGCCTCNONE 
J075167I20TGTGGGCCTCNONE 
J090067O04TGTGGGCCTCNONE 
Os03g0133400AK073032AAGGCCCACGPeptidoglycan-binding LysM domain containing protein. 
J013127B06AAGGCCCACGNONE 
J013151F14AAGGCCCACGNONE 
J023008L05AAGGCCCACGNONE 
J023009I03AAGGCCCACGNONE 
J023041F03AAGGCCCACGNONE 
J023146H06AAGGCCCACGNONE 
J033067A22AAGGCCCACGNONE 
J033109M12AAGGCCCACGNONE 
J065141H14AAGGCCCACGNONE 
J075003N15AAGGCCCACGNONE 
J075072J19AAGGCCCACGNONE 
J075114G10AAGGCCCACGNONE 
J075145H07AAGGCCCACGNONE 
J075160G14AAGGCCCACGNONE 
J075180J01AAGGCCCACGNONE 
J100075D05AAGGCCCACGNONE 
Os03g0143000AK073102TTGTGGGCCTCSAM (and some other nucleotide) binding motif domain containing protein. 
J033051I24TTGTGGGCCTCNONE 
Os03g0143400AK073999TAGGCCCACAACCCGGCCCATTSimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21TAGGCCCACAACCCGGCCCATTNONE 
J033073C08TAGGCCCACAACCCGGCCCATTNONE 
J033094C19TAGGCCCACAACCCGGCCCATTNONE 
J065017L10TAGGCCCACAACCCGGCCCATTNONE 
J065070H22TAGGCCCACAACCCGGCCCATTNONE 
J065079M09TAGGCCCACAACCCGGCCCATTNONE 
J065091N18TAGGCCCACAACCCGGCCCATTNONE 
J065109N03TAGGCCCACAACCCGGCCCATTNONE 
J065113F05TAGGCCCACAACCCGGCCCATTNONE 
J065135D23TAGGCCCACAACCCGGCCCATTNONE 
J065156L16TAGGCCCACAACCCGGCCCATTNONE 
J065207O04TAGGCCCACAACCCGGCCCATTNONE 
J065208F03TAGGCCCACAACCCGGCCCATTNONE 
J090010M15TAGGCCCACAACCCGGCCCATTNONE 
J090056J18TAGGCCCACAACCCGGCCCATTNONE 
Os03g0143600AB110188CAAGGCCCACANONE 
AK068424CAAGGCCCACASimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464CAAGGCCCACANONE 
AY224545CAAGGCCCACANONE 
J013154F02CAAGGCCCACANONE 
Os03g0146500006-036-F10AAGGCCCACCTNONE 
006-082-C03AAGGCCCACCTNONE 
006-098-E04AAGGCCCACCTNONE 
006-110-C03AAGGCCCACCTNONE 
009-057-C11AAGGCCCACCTNONE 
009-182-D02AAGGCCCACCTNONE 
AK059776AAGGCCCACCTGalactose-binding like domain containing protein. 
AK071628AAGGCCCACCTNONE 
AK104105AAGGCCCACCTNONE 
AK104220AAGGCCCACCTNONE 
J065168B02AAGGCCCACCTNONE 
Os03g0177000AK071368CCCACCCGGACCCACTCTCCAGGCCCACAGCN5-related N-acetyltransferase domain containing protein. 
Os03g0193225012-084-B12TCAGGCCCACGTNONE 
AK069459TCAGGCCCACGTFrigida-like family protein. 
J023019D20TCAGGCCCACGTNONE 
Os03g0219200011-045-E01TAGGCCCACAANONE 
AK073785TAGGCCCACAASimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19TAGGCCCACAANONE 
J043009H23TAGGCCCACAANONE 
Os03g0244200003-114-A11TAGGCCCACTCTNONE 
015-089-B03TAGGCCCACTCTNONE 
016-048-G01TAGGCCCACTCTNONE 
AK101837TAGGCCCACTCTSimilar to Thaumatin-like protein. 
AK105771TAGGCCCACTCTNONE 
AK107182TAGGCCCACTCTNONE 
J065054I12TAGGCCCACTCTNONE 
J065208F20TAGGCCCACTCTNONE 
J075088F18TAGGCCCACTCTNONE 
J075092G13TAGGCCCACTCTNONE 
J075120G01TAGGCCCACTCTNONE 
J075147M20TAGGCCCACTCTNONE 
J075151J03TAGGCCCACTCTNONE 
J100064H21TAGGCCCACTCTNONE 
Os03g0253100AK119618TAGGCCCACAGCCCACTTGPhosphomevalonate kinase Erg8 family protein. 
J033052A14TAGGCCCACAGCCCACTTGNONE 
Os03g0300600003-125-G06AAGGCCCACAANONE 
006-048-C04AAGGCCCACAANONE 
009-044-A09AAGGCCCACAANONE 
AK059801AAGGCCCACAANONE 
AK066250AAGGCCCACAASimilar to Chaperone protein dnaJ. 
AK069897AAGGCCCACAANONE 
AK104186AAGGCCCACAANONE 
J065197D15AAGGCCCACAANONE 
J090031C11AAGGCCCACAANONE 
J100024C23AAGGCCCACAANONE 
J100030B16AAGGCCCACAANONE 
J100033K12AAGGCCCACAANONE 
J100043M19AAGGCCCACAANONE 
J100056N09AAGGCCCACAANONE 
J100058E12AAGGCCCACAANONE 
J100084J08AAGGCCCACAANONE 
Os03g0342900006-032-D01CACGTGGGCCTCNONE 
006-033-E10CACGTGGGCCTCNONE 
006-051-G06CACGTGGGCCTCNONE 
006-053-E05CACGTGGGCCTCNONE 
006-056-B05CACGTGGGCCTCNONE 
006-058-F04CACGTGGGCCTCNONE 
006-059-E05CACGTGGGCCTCNONE 
006-060-F10CACGTGGGCCTCNONE 
006-104-D12CACGTGGGCCTCNONE 
009-129-C12CACGTGGGCCTCNONE 
AK060136CACGTGGGCCTCNONE 
AK060980CACGTGGGCCTCNONE 
AK064815CACGTGGGCCTCDormancyauxin associated family protein. 
AK104244CACGTGGGCCTCNONE 
AK104391CACGTGGGCCTCNONE 
AK104590CACGTGGGCCTCNONE 
AK104744CACGTGGGCCTCNONE 
AK106100CACGTGGGCCTCNONE 
J013000E10CACGTGGGCCTCNONE 
J075027O22CACGTGGGCCTCNONE 
J075052J03CACGTGGGCCTCNONE 
J075066E15CACGTGGGCCTCNONE 
J075095C17CACGTGGGCCTCNONE 
J075118N05CACGTGGGCCTCNONE 
J075187K22CACGTGGGCCTCNONE 
J090026L04CACGTGGGCCTCNONE 
J090059G16CACGTGGGCCTCNONE 
J100055P20CACGTGGGCCTCNONE 
J100062A10CACGTGGGCCTCNONE 
J100068G20CACGTGGGCCTCNONE 
Os03g0344100009-166-F10ACGTGGGCCTTNONE 
AK061903ACGTGGGCCTTNONE 
AK065547ACGTGGGCCTTSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24ACGTGGGCCTTNONE 
J033087C06ACGTGGGCCTTNONE 
J053073I09ACGTGGGCCTTNONE 
J065189D11ACGTGGGCCTTNONE 
J090032B15ACGTGGGCCTTNONE 
Os03g0352800009-030-G08AAGGCCCACAAGGCCCNONE 
AK059673AAGGCCCACAAGGCCCSimilar to Acyl carrier protein 1 (EC 1.6.5.3) (EC 1.6.99.3). 
J023060F17AAGGCCCACAAGGCCCNONE 
J075050N19AAGGCCCACAAGGCCCNONE 
J075104J18AAGGCCCACAAGGCCCNONE 
J075142K05AAGGCCCACAAGGCCCNONE 
J100050I19AAGGCCCACAAGGCCCNONE 
J100057N04AAGGCCCACAAGGCCCNONE 
Os03g0379500AK064760TAGGCCCACCASimilar to 40S ribosomal protein S9. 
J080024D11TAGGCCCACCANONE 
J080044J02TAGGCCCACCANONE 
J080050F01TAGGCCCACCANONE 
J080063D21TAGGCCCACCANONE 
J080063G04TAGGCCCACCANONE 
J080078E02TAGGCCCACCANONE 
Os03g0395900AK120654AAGGCCCACANONE 
J075050E23AAGGCCCACANONE 
Os03g0586800003-114-H11TTCGTGGGCCTANONE 
AK063765TTCGTGGGCCTASimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302TTCGTGGGCCTANONE 
J090004H06TTCGTGGGCCTANONE 
J090022N15TTCGTGGGCCTANONE 
J100035E05TTCGTGGGCCTANONE 
J100041L05TTCGTGGGCCTANONE 
J100041M18TTCGTGGGCCTANONE 
J100057P04TTCGTGGGCCTANONE 
J100089H06TTCGTGGGCCTANONE 
J100090C23TTCGTGGGCCTANONE 
Os03g0606200009-030-E09CCAGGCCCACTNONE 
009-076-H10CCAGGCCCACTNONE 
009-122-H12CCAGGCCCACTNONE 
009-153-F09CCAGGCCCACTNONE 
AB055076CCAGGCCCACTMitochondrial ATP synthase 6 KD subunit. 
AK072384CCAGGCCCACTNONE 
AK107928CCAGGCCCACTNONE 
J023078E13CCAGGCCCACTNONE 
J053031N01CCAGGCCCACTNONE 
J053046K19CCAGGCCCACTNONE 
J053062P07CCAGGCCCACTNONE 
J053091C23CCAGGCCCACTNONE 
J053099N19CCAGGCCCACTNONE 
J065005E06CCAGGCCCACTNONE 
J065030N03CCAGGCCCACTNONE 
J065138O21CCAGGCCCACTNONE 
J065159K03CCAGGCCCACTNONE 
J075030M08CCAGGCCCACTNONE 
J080006E23CCAGGCCCACTNONE 
J080010D10CCAGGCCCACTNONE 
J080016N17CCAGGCCCACTNONE 
J080024N09CCAGGCCCACTNONE 
J080028E23CCAGGCCCACTNONE 
J080035I11CCAGGCCCACTNONE 
J080038D15CCAGGCCCACTNONE 
J080040H08CCAGGCCCACTNONE 
J080043L04CCAGGCCCACTNONE 
J080047C06CCAGGCCCACTNONE 
J080061G04CCAGGCCCACTNONE 
J080066E10CCAGGCCCACTNONE 
J080067P03CCAGGCCCACTNONE 
J080082D07CCAGGCCCACTNONE 
J080089M13CCAGGCCCACTNONE 
J080094O09CCAGGCCCACTNONE 
J080095C24CCAGGCCCACTNONE 
J080309E21CCAGGCCCACTNONE 
J090016G15CCAGGCCCACTNONE 
J090031C20CCAGGCCCACTNONE 
J090033A15CCAGGCCCACTNONE 
J090037L07CCAGGCCCACTNONE 
J090038I10CCAGGCCCACTNONE 
J090072P19CCAGGCCCACTNONE 
J100040J02CCAGGCCCACTNONE 
J100047N05CCAGGCCCACTNONE 
J100048M10CCAGGCCCACTNONE 
J100076C02CCAGGCCCACTNONE 
J100077G23CCAGGCCCACTNONE 
J100080O08CCAGGCCCACTNONE 
J100085C06CCAGGCCCACTNONE 
J100085F16CCAGGCCCACTNONE 
Os03g0626800015-067-B09GGGTGGGCTGTTCGTGGGCCTCNONE 
AK111916GGGTGGGCTGTTCGTGGGCCTCNONE 
AK112092GGGTGGGCTGTTCGTGGGCCTCCalcineurin B protein. 
J075016C21GGGTGGGCTGTTCGTGGGCCTCNONE 
Os03g0712600015-008-G03CGCGTGGGCCTGGCCCACTNONE 
AK103705CGCGTGGGCCTGGCCCACTHypothetical protein. 
J033136N14CGCGTGGGCCTGGCCCACTNONE 
Os03g0725300011-085-E09TAGGCCCACGAANONE 
AK063969TAGGCCCACGAASimilar to Dbr1-prov protein. 
AK073636TAGGCCCACGAANONE 
J033050L15TAGGCCCACGAANONE 
J053082G03TAGGCCCACGAANONE 
Os03g0761200011-038-H02GAGGCCCACGTNONE 
015-055-D12GAGGCCCACGTNONE 
016-032-B01GAGGCCCACGTNONE 
AK064205GAGGCCCACGTNONE 
AK101534GAGGCCCACGTAnkyrin repeat containing protein. 
J075033L23GAGGCCCACGTNONE 
J075046K09GAGGCCCACGTNONE 
J075134K18GAGGCCCACGTNONE 
J075157I10GAGGCCCACGTNONE 
Os03g0765000AK073918GAGGCCCACACSimilar to Serine/threonine-protein kinase 12 (EC 2.7.1.37) (Aurora-B) (Fragment). 
Os03g0774600AK066871CAGGCCCACGGHypothetical protein. 
J053033J17CAGGCCCACGGNONE 
Os03g0785200003-116-B06TTGTGGGCCTGANONE 
J013098I23TTGTGGGCCTGANONE 
J023002I24TTGTGGGCCTGAMitochodrial transcription termination factor-related family protein. 
J075150G04TTGTGGGCCTGANONE 
Os03g0798600AK121716GGCCGGGCCGGAACACGTGGGCCTASimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18GGCCGGGCCGGAACACGTGGGCCTANONE 
J033079G18GGCCGGGCCGGAACACGTGGGCCTANONE 
J043038B19GGCCGGGCCGGAACACGTGGGCCTANONE 
J065091E15GGCCGGGCCGGAACACGTGGGCCTANONE 
J065092P10GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189F18GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189L12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075021B11GGCCGGGCCGGAACACGTGGGCCTANONE 
J075022L15GGCCGGGCCGGAACACGTGGGCCTANONE 
J075046G12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075080H15GGCCGGGCCGGAACACGTGGGCCTANONE 
J090045H01GGCCGGGCCGGAACACGTGGGCCTANONE 
J090077H16GGCCGGGCCGGAACACGTGGGCCTANONE 
J090083D22GGCCGGGCCGGAACACGTGGGCCTANONE 
J100021D24GGCCGGGCCGGAACACGTGGGCCTANONE 
J100023G04GGCCGGGCCGGAACACGTGGGCCTANONE 
J100049J23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100075K23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100077G22GGCCGGGCCGGAACACGTGGGCCTANONE 
Os03g0802300AK120564AGTGGGCCTTGGGCCGAGAConserved hypothetical protein. 
AK120687AGTGGGCCTTGGGCCGAGANONE 
Os03g0821900AK070847AGTGGGCCTACCGGGCCAAAGCCCACASimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0833500AK119356GAGGCGTGGGCCTGSimilar to 98kDa HDM allergen. 
Os03g0833700011-060-A10GAGGCCCACGAANONE 
AK121918GAGGCCCACGAARNA 3'-terminal phosphate cyclase family protein. 
Os03g0835400AK061773TAGGCCCACTTGSimilar to Uvs101. 
AK098986TAGGCCCACTTGNONE 
AK105896TAGGCCCACTTGNONE 
Os03g0843700AK070364ACACGTGGGCCTAFAR1 domain containing protein. 
J013146A20ACACGTGGGCCTANONE 
J023050I08ACACGTGGGCCTANONE 
J033058E14ACACGTGGGCCTANONE 
J033111G20ACACGTGGGCCTANONE 
J033141H24ACACGTGGGCCTANONE 
J065021K13ACACGTGGGCCTANONE 
J065082M21ACACGTGGGCCTANONE 
J075106L22ACACGTGGGCCTANONE 
J075150L05ACACGTGGGCCTANONE 
J075172H24ACACGTGGGCCTANONE 
J075199F06ACACGTGGGCCTANONE 
Os03g0851100AF303468GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
AK102069GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTSimilar to Translational elongation factor EF-TuM. 
J033082G06GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J043036M21GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065158H05GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065192A04GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
Os03g0851200009-035-B01AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-134-F10AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-154-H05AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
AK059425AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCSimilar to CAXIP1 protein. 
J065065D24AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046O19AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075048O04AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075181I09AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J080303G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090086F12AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090088E07AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
Os03g0851900AK102145TAGGCCCACAAAFG1-like ATPase family protein. 
J033086B08TAGGCCCACAANONE 
Os03g0852600009-174-G04AAGGCCCACGANONE 
AK063101AAGGCCCACGAProtein of unknown function DUF565 family protein. 
J065131H12AAGGCCCACGANONE 
J090046K24AAGGCCCACGANONE 
Os04g0103200003-106-F06CAAGGCCCACANONE 
015-058-G03CAAGGCCCACANONE 
AK060850CAAGGCCCACANONE 
AK066032CAAGGCCCACAProteasome component region PCI domain containing protein. 
J013046D12CAAGGCCCACANONE 
J013088L18CAAGGCCCACANONE 
J013093J06CAAGGCCCACANONE 
J013111I01CAAGGCCCACANONE 
J013120B15CAAGGCCCACANONE 
J013149K17CAAGGCCCACANONE 
J023010J08CAAGGCCCACANONE 
J023034J10CAAGGCCCACANONE 
J023055D05CAAGGCCCACANONE 
J033023L03CAAGGCCCACANONE 
J033025N21CAAGGCCCACANONE 
J033026A19CAAGGCCCACANONE 
J033026M14CAAGGCCCACANONE 
J033046J22CAAGGCCCACANONE 
J033052H11CAAGGCCCACANONE 
J033058P05CAAGGCCCACANONE 
J033064A11CAAGGCCCACANONE 
J033067K11CAAGGCCCACANONE 
J033076H02CAAGGCCCACANONE 
J033094E04CAAGGCCCACANONE 
J033106A02CAAGGCCCACANONE 
J033108N14CAAGGCCCACANONE 
J033114I06CAAGGCCCACANONE 
J033118H18CAAGGCCCACANONE 
J033148C05CAAGGCCCACANONE 
J043010I24CAAGGCCCACANONE 
J043037C07CAAGGCCCACANONE 
J053025M02CAAGGCCCACANONE 
J053026N08CAAGGCCCACANONE 
J053027O14CAAGGCCCACANONE 
J065038N11CAAGGCCCACANONE 
J065219C03CAAGGCCCACANONE 
J090011F14CAAGGCCCACANONE 
J090027C03CAAGGCCCACANONE 
J090067M19CAAGGCCCACANONE 
J090069C17CAAGGCCCACANONE 
J090070P21CAAGGCCCACANONE 
J090075N11CAAGGCCCACANONE 
J090095C22CAAGGCCCACANONE 
J100027O14CAAGGCCCACANONE 
J100055E01CAAGGCCCACANONE 
Os04g0418000006-025-C05CAGGCCCACANONE 
006-025-D11CAGGCCCACANONE 
006-045-F02CAGGCCCACANONE 
006-060-B04CAGGCCCACANONE 
006-063-E03CAGGCCCACANONE 
006-070-G08CAGGCCCACANONE 
006-072-H05CAGGCCCACANONE 
AK061030CAGGCCCACANONE 
AK099124CAGGCCCACANONE 
AK106155CAGGCCCACAConserved hypothetical protein. 
AK119714CAGGCCCACANONE 
J023039I07CAGGCCCACANONE 
J065025N03CAGGCCCACANONE 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0436800015-053-A06ACGTGGGCCTGANONE 
AK101115ACGTGGGCCTGAProtein prenyltransferase domain containing protein. 
J033025G14ACGTGGGCCTGANONE 
J033073N23ACGTGGGCCTGANONE 
J033097L19ACGTGGGCCTGANONE 
Os04g0445200009-034-A06CAAGTGGGCCTCNONE 
AK062427CAAGTGGGCCTCProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720CAAGTGGGCCTCNONE 
J065022E20CAAGTGGGCCTCNONE 
J065062D16CAAGTGGGCCTCNONE 
J065081I02CAAGTGGGCCTCNONE 
J065087C10CAAGTGGGCCTCNONE 
J065116N16CAAGTGGGCCTCNONE 
J065132F10CAAGTGGGCCTCNONE 
J065140F18CAAGTGGGCCTCNONE 
J065143M22CAAGTGGGCCTCNONE 
J065158K17CAAGTGGGCCTCNONE 
J065162D07CAAGTGGGCCTCNONE 
J065207H19CAAGTGGGCCTCNONE 
J075155B20CAAGTGGGCCTCNONE 
J075167E24CAAGTGGGCCTCNONE 
J075178B19CAAGTGGGCCTCNONE 
J080301D22CAAGTGGGCCTCNONE 
J080301J15CAAGTGGGCCTCNONE 
J080308J02CAAGTGGGCCTCNONE 
Os04g0497600AK059415TCAGGCCCACALupus La protein family protein. 
AK099054TCAGGCCCACANONE 
J013121K15TCAGGCCCACANONE 
J013149O10TCAGGCCCACANONE 
J023112H08TCAGGCCCACANONE 
J033050F07TCAGGCCCACANONE 
Os04g0502900AK059306GAGGCCCACCCGEF-Hand type domain containing protein. 
AK099122GAGGCCCACCCGNONE 
Os04g0504600J065162K24CCGTGGGCCTTNONE 
Os04g0564600009-038-A02CCCGGCCCATAAGGCCCACGTNONE 
AK105145CCCGGCCCATAAGGCCCACGTNONE 
AK120614CCCGGCCCATAAGGCCCACGTSimilar to HMG1 protein. 
J013102D16CCCGGCCCATAAGGCCCACGTNONE 
J013151P06CCCGGCCCATAAGGCCCACGTNONE 
J033082C11CCCGGCCCATAAGGCCCACGTNONE 
J065073N13CCCGGCCCATAAGGCCCACGTNONE 
J065142E11CCCGGCCCATAAGGCCCACGTNONE 
J065187I19CCCGGCCCATAAGGCCCACGTNONE 
J065204K02CCCGGCCCATAAGGCCCACGTNONE 
J090089P22CCCGGCCCATAAGGCCCACGTNONE 
J100060B16CCCGGCCCATAAGGCCCACGTNONE 
Os04g0565500006-022-C06CCAGGCCCACGTNONE 
AK058888CCAGGCCCACGTAmino acid/polyamine transporter II family protein. 
AK071118CCAGGCCCACGTNONE 
AK105902CCAGGCCCACGTNONE 
J023052I22CCAGGCCCACGTNONE 
J023082L01CCAGGCCCACGTNONE 
J023112P14CCAGGCCCACGTNONE 
J065043O12CCAGGCCCACGTNONE 
J065045B08CCAGGCCCACGTNONE 
J065059N01CCAGGCCCACGTNONE 
J065073A04CCAGGCCCACGTNONE 
J065078K06CCAGGCCCACGTNONE 
J065124J08CCAGGCCCACGTNONE 
J065140G16CCAGGCCCACGTNONE 
J065185E13CCAGGCCCACGTNONE 
J065197N09CCAGGCCCACGTNONE 
J100024A03CCAGGCCCACGTNONE 
J100042E11CCAGGCCCACGTNONE 
J100069L15CCAGGCCCACGTNONE 
J100078K13CCAGGCCCACGTNONE 
Os04g0584900AK058633AAGGCCCACTNONE 
Os04g0623600AK068129AAATGGGCCCCAGGCCCACTGTCAGTSimilar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC 1.1.3.15) (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase). 
J013126M17AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J013131A08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J023133N08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
Os04g0637500AK108202AAGGCCCACTMitochodrial transcription termination factor-related family protein. 
J065163A11AAGGCCCACTNONE 
Os04g0639100009-158-D03CGCGTGGGCCTCNONE 
AK063036CGCGTGGGCCTCConserved hypothetical protein. 
J075045D14CGCGTGGGCCTCNONE 
J075047L16CGCGTGGGCCTCNONE 
J075048D20CGCGTGGGCCTCNONE 
J075056E20CGCGTGGGCCTCNONE 
J075074E14CGCGTGGGCCTCNONE 
J075108F16CGCGTGGGCCTCNONE 
J075143L19CGCGTGGGCCTCNONE 
J075146L07CGCGTGGGCCTCNONE 
J075158I04CGCGTGGGCCTCNONE 
J075172B20CGCGTGGGCCTCNONE 
J090061M08CGCGTGGGCCTCNONE 
Os04g0670600AK064255TCAGGCCCACGAANONE 
Os04g0670800AK073170GAGGCCCACGGNONE 
Os04g0674100J080097J12AAGGCCCACCAThioredoxin-like fold domain containing protein. 
J080097J12TAGGCCCACTThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965AGTGGGCCTANONE 
AK101965TGGTGGGCCTTNONE 
AK103795AGTGGGCCTACoenzyme Q biosynthesis Coq4 family protein. 
AK103795TGGTGGGCCTTCoenzyme Q biosynthesis Coq4 family protein. 
J033076F14AGTGGGCCTANONE 
J033076F14TGGTGGGCCTTNONE 
J065020P20AGTGGGCCTANONE 
J065020P20TGGTGGGCCTTNONE 
J065057I21AGTGGGCCTANONE 
J065057I21TGGTGGGCCTTNONE 
J065059P11AGTGGGCCTANONE 
J065059P11TGGTGGGCCTTNONE 
J065083A22AGTGGGCCTANONE 
J065083A22TGGTGGGCCTTNONE 
J065093K10AGTGGGCCTANONE 
J065093K10TGGTGGGCCTTNONE 
J065097D03AGTGGGCCTANONE 
J065097D03TGGTGGGCCTTNONE 
J065103P05AGTGGGCCTANONE 
J065103P05TGGTGGGCCTTNONE 
J065113K09AGTGGGCCTANONE 
J065113K09TGGTGGGCCTTNONE 
J065118F23AGTGGGCCTANONE 
J065118F23TGGTGGGCCTTNONE 
J065119M06AGTGGGCCTANONE 
J065119M06TGGTGGGCCTTNONE 
J065146K17AGTGGGCCTANONE 
J065146K17TGGTGGGCCTTNONE 
J065161N12AGTGGGCCTANONE 
J065161N12TGGTGGGCCTTNONE 
J065169L02AGTGGGCCTANONE 
J065169L02TGGTGGGCCTTNONE 
J065189H12AGTGGGCCTANONE 
J065189H12TGGTGGGCCTTNONE 
J065192E24AGTGGGCCTANONE 
J065192E24TGGTGGGCCTTNONE 
J065193K17AGTGGGCCTANONE 
J065193K17TGGTGGGCCTTNONE 
J065197O21AGTGGGCCTANONE 
J065197O21TGGTGGGCCTTNONE 
J065214D09AGTGGGCCTANONE 
J065214D09TGGTGGGCCTTNONE 
J065217B11AGTGGGCCTANONE 
J065217B11TGGTGGGCCTTNONE 
J075132K07AGTGGGCCTANONE 
J075132K07TGGTGGGCCTTNONE 
J100059D14AGTGGGCCTANONE 
J100059D14TGGTGGGCCTTNONE 
Os04g0685800AK070891GTGTGGGCCTGGCCCAACTSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345GTGTGGGCCTGGCCCAACTNONE 
J023069G19GTGTGGGCCTGGCCCAACTNONE 
J023097E09GTGTGGGCCTGGCCCAACTNONE 
J065071A01GTGTGGGCCTGGCCCAACTNONE 
J065186F08GTGTGGGCCTGGCCCAACTNONE 
J075044B21GTGTGGGCCTGGCCCAACTNONE 
J075120N18GTGTGGGCCTGGCCCAACTNONE 
J075131B22GTGTGGGCCTGGCCCAACTNONE 
J100041H18GTGTGGGCCTGGCCCAACTNONE 
J100042P13GTGTGGGCCTGGCCCAACTNONE 
Os05g0110700AK102486AAGGCCCACACKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12AAGGCCCACACNONE 
Os05g0121000009-181-E02TTGTGGGCCTTNONE 
AK058867TTGTGGGCCTTNONE 
AK071341TTGTGGGCCTTProtein of unknown function DUF1218 family protein. 
J023024H24TTGTGGGCCTTNONE 
J023090B22TTGTGGGCCTTNONE 
J023111G15TTGTGGGCCTTNONE 
J023134K14TTGTGGGCCTTNONE 
J033057C05TTGTGGGCCTTNONE 
J033067J15TTGTGGGCCTTNONE 
J033084L15TTGTGGGCCTTNONE 
J033088B04TTGTGGGCCTTNONE 
J043027A08TTGTGGGCCTTNONE 
J043029L03TTGTGGGCCTTNONE 
J053031K22TTGTGGGCCTTNONE 
J053046I01TTGTGGGCCTTNONE 
J053070B05TTGTGGGCCTTNONE 
J053072C10TTGTGGGCCTTNONE 
J065097M22TTGTGGGCCTTNONE 
J065164I17TTGTGGGCCTTNONE 
J075058I08TTGTGGGCCTTNONE 
J075064C09TTGTGGGCCTTNONE 
J080304C16TTGTGGGCCTTNONE 
J080304H16TTGTGGGCCTTNONE 
J080306E17TTGTGGGCCTTNONE 
J080310L03TTGTGGGCCTTNONE 
J080316J07TTGTGGGCCTTNONE 
J080317L23TTGTGGGCCTTNONE 
J080319A10TTGTGGGCCTTNONE 
J090060F01TTGTGGGCCTTNONE 
J100042N16TTGTGGGCCTTNONE 
J100047F05TTGTGGGCCTTNONE 
J100075J19TTGTGGGCCTTNONE 
Os05g0129400AK102359GTTTGGGCCTAGGCCCACCCGAnkyrin repeat containing protein. 
J033091I05GTTTGGGCCTAGGCCCACCCGNONE 
Os05g0150300AK100732AAGGCCCACTSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
Os05g0155100006-075-B02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK061929CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK102810CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
J013023E03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013038C16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013120M14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013153B04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013159B07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023012A02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027F08CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027I12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023120F05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023138O03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023142H13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023143P06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033023P09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033035O14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033042N19CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033043B12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033065D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033081A12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033084N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033085M03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033112D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033114O07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033119D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033140E06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033141K23CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J043040I22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053050B21CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053065I18CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053074O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065072K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065211I09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090004K04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090016L06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090040F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090063F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090081J09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100032A10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100037G20CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100056O10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100071D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100075K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100079F16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100080O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100086N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
Os05g0214100AK100400TGTGGGCCTASimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y- 1140 of Kluyveromyces lactis. 
AK107105TGTGGGCCTANONE 
J013073B12TGTGGGCCTANONE 
J013093B07TGTGGGCCTANONE 
J023086N14TGTGGGCCTANONE 
J065143B06TGTGGGCCTANONE 
J090009B02TGTGGGCCTANONE 
J090075A13TGTGGGCCTANONE 
Os05g0243200009-073-F12TCAGGCCCACTCCNONE 
AK061317TCAGGCCCACTCCSimilar to Ribosomal protein L13. 
J065120F21TCAGGCCCACTCCNONE 
J065185K05TCAGGCCCACTCCNONE 
Os05g0300700014-079-G07TAGGCCCACTGACNONE 
AK063728TAGGCCCACTGACNONE 
AK067846TAGGCCCACTGACConserved hypothetical protein. 
Os05g0344200006-022-E04CCGTGGGCCTCNONE 
006-080-D01CCGTGGGCCTCNONE 
009-021-D03CCGTGGGCCTCNONE 
009-026-A10CCGTGGGCCTCNONE 
009-054-B12CCGTGGGCCTCNONE 
009-059-H03CCGTGGGCCTCNONE 
009-077-C02CCGTGGGCCTCNONE 
009-095-H12CCGTGGGCCTCNONE 
009-106-B08CCGTGGGCCTCNONE 
009-138-D10CCGTGGGCCTCNONE 
009-140-G06CCGTGGGCCTCNONE 
009-146-E09CCGTGGGCCTCNONE 
009-161-F04CCGTGGGCCTCNONE 
009-176-F05CCGTGGGCCTCNONE 
013-047-C03CCGTGGGCCTCNONE 
013-052-E07CCGTGGGCCTCNONE 
013-054-G04CCGTGGGCCTCNONE 
013-095-D10CCGTGGGCCTCNONE 
014-003-D06CCGTGGGCCTCNONE 
014-020-C09CCGTGGGCCTCNONE 
014-043-E01CCGTGGGCCTCNONE 
014-080-G09CCGTGGGCCTCNONE 
014-081-H05CCGTGGGCCTCNONE 
AK060058CCGTGGGCCTCConserved hypothetical protein. 
AK098850CCGTGGGCCTCNONE 
AK104716CCGTGGGCCTCNONE 
AK119727CCGTGGGCCTCNONE 
J013000G04CCGTGGGCCTCNONE 
J013155L11CCGTGGGCCTCNONE 
J033138J22CCGTGGGCCTCNONE 
J065112E22CCGTGGGCCTCNONE 
J065124M06CCGTGGGCCTCNONE 
J065130M01CCGTGGGCCTCNONE 
J065137I03CCGTGGGCCTCNONE 
J065157O12CCGTGGGCCTCNONE 
J065171B12CCGTGGGCCTCNONE 
J075003O16CCGTGGGCCTCNONE 
J075026G12CCGTGGGCCTCNONE 
J075032K07CCGTGGGCCTCNONE 
J075070I11CCGTGGGCCTCNONE 
J075093K06CCGTGGGCCTCNONE 
J075148C12CCGTGGGCCTCNONE 
J075148L08CCGTGGGCCTCNONE 
J075152G13CCGTGGGCCTCNONE 
J075177G07CCGTGGGCCTCNONE 
J100026I09CCGTGGGCCTCNONE 
J100083L11CCGTGGGCCTCNONE 
J100086F04CCGTGGGCCTCNONE 
Os05g0397700AK067298GAGGCCCACTGGGCCGTGSecY protein family protein. 
Os05g0435400AK109595CCAGGCCCACCAAGCCCConserved hypothetical protein. 
Os05g0440100015-006-F06GAGGCCCACCANONE 
015-076-D04GAGGCCCACCANONE 
AK073094GAGGCCCACCANONE 
AK102786GAGGCCCACCAHistone deacetylase superfamily protein. 
J033107M16GAGGCCCACCANONE 
Os05g0441500AK120434ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F13ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F15ACAGCCCAGGCCCACCTGTCAGNONE 
J065152G07ACAGCCCAGGCCCACCTGTCAGNONE 
Os05g0445500009-021-C05TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-129-D11TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-147-E04TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-169-C11TCCGGCCCATGGGCCGTGGGCCTCNONE 
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B. 
D21114TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023001K23TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023107J19TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023143J09TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065049D04TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065092I06TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065188H04TCCGGCCCATGGGCCGTGGGCCTCNONE 
Os05g0470800011-027-A06TTGTGGGCCTCNONE 
AK069780TTGTGGGCCTCBacterial surface antigen (D15) family protein. 
J023007A20TTGTGGGCCTCNONE 
J023028F19TTGTGGGCCTCNONE 
J023081E20TTGTGGGCCTCNONE 
J023089D13TTGTGGGCCTCNONE 
J023115D18TTGTGGGCCTCNONE 
J033087E22TTGTGGGCCTCNONE 
J033143O14TTGTGGGCCTCNONE 
Os05g0512500009-036-D05GTGGTGGGCCTCNONE 
AK062441GTGGTGGGCCTCCT20 family protein. 
J080003C10GTGGTGGGCCTCNONE 
J080046G11GTGGTGGGCCTCNONE 
Os05g0513400AK069309TGTGGGCCTAProtein of unknown function DUF803 family protein. 
AK121638TGTGGGCCTANONE 
Os05g0524500AK073571TAGGCCCACCCGProtein kinase-like domain containing protein. 
Os05g0528200009-146-C01AAGGCCCACTNONE 
AK062985AAGGCCCACTSimilar to 50S ribosomal protein L20. 
Os05g0563600009-152-H06CCAGGCCCACGTNONE 
AK058836CCAGGCCCACGTNONE 
AK099313CCAGGCCCACGTBeta-Ig-H3/fasciclin domain containing protein. 
Os05g0577900016-028-C02CAGGCCCACANONE 
016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201CAGGCCCACAConserved hypothetical protein. 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
AK065040TGTGGGCCTGSimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013001H17TGTGGGCCTGNONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06TGTGGGCCTGNONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08TGTGGGCCTGNONE 
Os05g0592400AB037144CAAGGCCCACACNONE 
AK065508CAAGGCCCACACUV-damaged DNA binding protein. 
J013069J24CAAGGCCCACACNONE 
J013075H15CAAGGCCCACACNONE 
J013095H04CAAGGCCCACACNONE 
J013105L19CAAGGCCCACACNONE 
J013152P13CAAGGCCCACACNONE 
J023072O05CAAGGCCCACACNONE 
J033024J22CAAGGCCCACACNONE 
J033030D07CAAGGCCCACACNONE 
J033041D09CAAGGCCCACACNONE 
J033051M16CAAGGCCCACACNONE 
J033126M01CAAGGCCCACACNONE 
J033145H24CAAGGCCCACACNONE 
Os06g0101600AF093636AAGGCCCACGTNONE 
AK070447AAGGCCCACGTPlastocyanin, chloroplast precursor. 
J065001A20AAGGCCCACGTNONE 
J065019M17AAGGCCCACGTNONE 
J065021H18AAGGCCCACGTNONE 
J065061A17AAGGCCCACGTNONE 
J065073L02AAGGCCCACGTNONE 
J065099F17AAGGCCCACGTNONE 
J065101C23AAGGCCCACGTNONE 
J065121E23AAGGCCCACGTNONE 
J065122N04AAGGCCCACGTNONE 
J065141N05AAGGCCCACGTNONE 
J065143N21AAGGCCCACGTNONE 
J065161H09AAGGCCCACGTNONE 
J065161J04AAGGCCCACGTNONE 
J065162P20AAGGCCCACGTNONE 
J065182K10AAGGCCCACGTNONE 
J065184M05AAGGCCCACGTNONE 
J065186H24AAGGCCCACGTNONE 
J065189G21AAGGCCCACGTNONE 
J065190N14AAGGCCCACGTNONE 
J065191H08AAGGCCCACGTNONE 
J065205H17AAGGCCCACGTNONE 
J075001E03AAGGCCCACGTNONE 
J075001H21AAGGCCCACGTNONE 
J075003J23AAGGCCCACGTNONE 
J075003K01AAGGCCCACGTNONE 
J075005I11AAGGCCCACGTNONE 
J075007F16AAGGCCCACGTNONE 
J075017I11AAGGCCCACGTNONE 
J075018O05AAGGCCCACGTNONE 
J075019G24AAGGCCCACGTNONE 
J075032D04AAGGCCCACGTNONE 
J075032N13AAGGCCCACGTNONE 
J075033C09AAGGCCCACGTNONE 
J075033D11AAGGCCCACGTNONE 
J075039A20AAGGCCCACGTNONE 
J075058P12AAGGCCCACGTNONE 
J075062E10AAGGCCCACGTNONE 
J075062P16AAGGCCCACGTNONE 
J075063C17AAGGCCCACGTNONE 
J075066E07AAGGCCCACGTNONE 
J075066I20AAGGCCCACGTNONE 
J075075K21AAGGCCCACGTNONE 
J075078F03AAGGCCCACGTNONE 
J075082F10AAGGCCCACGTNONE 
J075086G16AAGGCCCACGTNONE 
J075087E07AAGGCCCACGTNONE 
J075087K06AAGGCCCACGTNONE 
J075087L04AAGGCCCACGTNONE 
J075088B16AAGGCCCACGTNONE 
J075088D02AAGGCCCACGTNONE 
J075094H21AAGGCCCACGTNONE 
J075094I24AAGGCCCACGTNONE 
J075094K10AAGGCCCACGTNONE 
J075095C18AAGGCCCACGTNONE 
J075097B05AAGGCCCACGTNONE 
J075099C13AAGGCCCACGTNONE 
J075099H22AAGGCCCACGTNONE 
J075099L16AAGGCCCACGTNONE 
J075104K08AAGGCCCACGTNONE 
J075118O06AAGGCCCACGTNONE 
J075119E15AAGGCCCACGTNONE 
J075124N06AAGGCCCACGTNONE 
J075126G02AAGGCCCACGTNONE 
J075127L24AAGGCCCACGTNONE 
J075131E23AAGGCCCACGTNONE 
J075140H06AAGGCCCACGTNONE 
J075146I20AAGGCCCACGTNONE 
J075146N24AAGGCCCACGTNONE 
J075147I19AAGGCCCACGTNONE 
J075155K07AAGGCCCACGTNONE 
J075156C05AAGGCCCACGTNONE 
J075161G07AAGGCCCACGTNONE 
J075164G01AAGGCCCACGTNONE 
J075170J18AAGGCCCACGTNONE 
J075172G17AAGGCCCACGTNONE 
J075176G10AAGGCCCACGTNONE 
J075178C05AAGGCCCACGTNONE 
J075179G01AAGGCCCACGTNONE 
J075181E24AAGGCCCACGTNONE 
J080029D19AAGGCCCACGTNONE 
J080034L11AAGGCCCACGTNONE 
J080039G07AAGGCCCACGTNONE 
J080062M23AAGGCCCACGTNONE 
J080302A01AAGGCCCACGTNONE 
J100042I15AAGGCCCACGTNONE 
J100043G22AAGGCCCACGTNONE 
J100056L12AAGGCCCACGTNONE 
J100061A12AAGGCCCACGTNONE 
J100073O20AAGGCCCACGTNONE 
J100082I08AAGGCCCACGTNONE 
Os06g0103400009-138-H04AAGGCCCAGGCCCACCANONE 
AK067021AAGGCCCAGGCCCACCANucleic acid-binding, OB-fold domain containing protein. 
AK071627AAGGCCCAGGCCCACCANONE 
J080307A01AAGGCCCAGGCCCACCANONE 
Os06g0111700011-090-A02CAAGGCCCACCAAAGCCCACACNONE 
AK063401CAAGGCCCACCAAAGCCCACACTetratricopeptide-like helical domain containing protein. 
Os06g0129000Os06g0129000TGTGGGCCTAConserved hypothetical protein. 
Os06g0134900AK103205TCGTGGGCCTTConserved hypothetical protein. 
J033122E01TCGTGGGCCTTNONE 
Os06g0135000J075008J15AAGGCCCACGANONE 
J075166F23AAGGCCCACGANONE 
J075185F03AAGGCCCACGANONE 
Os06g0174350J043034B05AGTGGGCCTAGTTGGGCCGGAConserved hypothetical protein. 
Os06g0199300J065045H01ACGTGGGCCTCNONE 
J075177C22ACGTGGGCCTCNONE 
J080068H06ACGTGGGCCTCNONE 
J090048F01ACGTGGGCCTCNONE 
J100066F17ACGTGGGCCTCNONE 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0216800AK068112GAGGCCCACASimilar to Cyclophilin-40 (Expressed protein). 
J013134M21GAGGCCCACANONE 
J033127L12GAGGCCCACANONE 
J090060B08GAGGCCCACANONE 
Os06g0225300AK065224AAGGCCCAAATAGGCCCACTNONE 
AK100258AAGGCCCAAATAGGCCCACTSimilar to SERK1 (Fragment). 
J013002G23AAGGCCCAAATAGGCCCACTNONE 
Os06g0298500AK108252TAGGCCCACGGConserved hypothetical protein. 
J065144C04TAGGCCCACGGNONE 
J075054P09TAGGCCCACGGNONE 
J075165A13TAGGCCCACGGNONE 
J075172E10TAGGCCCACGGNONE 
Os06g0304500AK119441GAAGCCCATTAAGGCCCACTCRS1/YhbY domain containing protein. 
J075143M24GAAGCCCATTAAGGCCCACTNONE 
J075194D03GAAGCCCATTAAGGCCCACTNONE 
Os06g0515400AK071571TTGTGGGCCTGAConserved hypothetical protein. 
Os06g0531600AK120456TGGTGGGCCTGANONE 
J013105I19TGGTGGGCCTGANONE 
J090006G02TGGTGGGCCTGANONE 
Os06g0555500016-056-B08GAGGCCCACCANONE 
AK102375GAGGCCCACCANONE 
AK106546GAGGCCCACCAInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08GAGGCCCACCANONE 
J033091P04GAGGCCCACCANONE 
J090082P16GAGGCCCACCANONE 
Os06g0622700AK107021TCTGGCCCAAAAGGCCCACAEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTGGCCCAAAAGGCCCACANONE 
J065100L18TCTGGCCCAAAAGGCCCACANONE 
J065129N15TCTGGCCCAAAAGGCCCACANONE 
J065152M08TCTGGCCCAAAAGGCCCACANONE 
J065198M12TCTGGCCCAAAAGGCCCACANONE 
J090077J22TCTGGCCCAAAAGGCCCACANONE 
J100024G23TCTGGCCCAAAAGGCCCACANONE 
J100027L01TCTGGCCCAAAAGGCCCACANONE 
J100047C06TCTGGCCCAAAAGGCCCACANONE 
J100055D01TCTGGCCCAAAAGGCCCACANONE 
J100067M05TCTGGCCCAAAAGGCCCACANONE 
J100077M16TCTGGCCCAAAAGGCCCACANONE 
J100078M22TCTGGCCCAAAAGGCCCACANONE 
Os06g0688100AK063450CAGGCCCACTNONE 
AK101144CAGGCCCACTRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0702800009-039-E05ATGGCCCAGAAGGCCCACCANONE 
AK073948ATGGCCCAGAAGGCCCACCAHypothetical protein. 
J023108K23ATGGCCCAGAAGGCCCACCANONE 
J033072H04ATGGCCCAGAAGGCCCACCANONE 
J065008G05ATGGCCCAGAAGGCCCACCANONE 
J065128J12ATGGCCCAGAAGGCCCACCANONE 
J065131A01ATGGCCCAGAAGGCCCACCANONE 
J065173B12ATGGCCCAGAAGGCCCACCANONE 
Os06g0710300AK121344AAGGCCCACCTUncharacterized protein UPF0114 family protein. 
J043016B12AAGGCCCACCTNONE 
J065104H21AAGGCCCACCTNONE 
Os06g0725400J065086O07AGTGGGCCTTGSimilar to BLE1 protein. 
J065114J19AGTGGGCCTTGNONE 
Os07g0112600AK109561CACGTGGGCCTCConserved hypothetical protein. 
Os07g0121000AK072975GGGCCGAAGAGGCCCACTTGProtein of unknown function DUF1719, Oryza sativa family protein. 
J023148M03GGGCCGAAGAGGCCCACTTGNONE 
Os07g0123000AK070836GCCCATTAGGCCCACAACyclin-like F-box domain containing protein. 
Os07g0179000AK100008TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
AK119398TTCGGCCCATTAAAGCCCATATAGGCCCACGAProtein prenyltransferase domain containing protein. 
AK119505TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0187300AK103069AAGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12AAGGCCCACGAANONE 
J033117P16AAGGCCCACGAANONE 
Os07g0202400009-155-C12TAGGCCCACANONE 
AK063024TAGGCCCACAConserved hypothetical protein. 
Os07g0223100006-044-G07GAGGCCCACGGNONE 
006-071-E10GAGGCCCACGGNONE 
006-077-A04GAGGCCCACGGNONE 
009-162-H05GAGGCCCACGGNONE 
J023050M10GAGGCCCACGGNONE 
J023055F05GAGGCCCACGGNONE 
J023060I11GAGGCCCACGGNONE 
J023101M01GAGGCCCACGGNONE 
J065059J21GAGGCCCACGGNONE 
J065087I18GAGGCCCACGGNONE 
J065113L17GAGGCCCACGGNONE 
J065123E19GAGGCCCACGGNONE 
J065137O04GAGGCCCACGGNONE 
J065217M03GAGGCCCACGGNONE 
J090012O14GAGGCCCACGGNONE 
J090014C13GAGGCCCACGGNONE 
J090060C24GAGGCCCACGGNONE 
J100037H14GAGGCCCACGGNONE 
J100060E10GAGGCCCACGGNONE 
J100067L04GAGGCCCACGGNONE 
J100075G09GAGGCCCACGGNONE 
J100077C15GAGGCCCACGGNONE 
Os07g0242000AK107347CAAGGCCCACCConserved hypothetical protein. 
Os07g0300900AK061941GCGTGGGCCTCSimilar to Lysine-sensitive aspartate kinase. 
AK102162GCGTGGGCCTCNONE 
Os07g0418000AK060294GAGGCCCACANONE 
AK065942GAGGCCCACAConserved hypothetical protein. 
AK105006GAGGCCCACANONE 
J013047M02GAGGCCCACANONE 
J023074D13GAGGCCCACANONE 
J053045I08GAGGCCCACANONE 
J075048C07GAGGCCCACANONE 
Os07g0435100AB037153ACGTGGGCCTCNONE 
AK061383ACGTGGGCCTCSimilar to 26S proteasome subunit RPN12. 
AK061408ACGTGGGCCTCNONE 
AK101316ACGTGGGCCTCNONE 
J023133D07ACGTGGGCCTCNONE 
J023136B17ACGTGGGCCTCNONE 
J033065M08ACGTGGGCCTCNONE 
J033070F05ACGTGGGCCTCNONE 
J033070L20ACGTGGGCCTCNONE 
J033108J15ACGTGGGCCTCNONE 
J053080M19ACGTGGGCCTCNONE 
J053091B15ACGTGGGCCTCNONE 
J065067J03ACGTGGGCCTCNONE 
J065102C02ACGTGGGCCTCNONE 
J065135H09ACGTGGGCCTCNONE 
J080302K03ACGTGGGCCTCNONE 
J090059J11ACGTGGGCCTCNONE 
J090074G14ACGTGGGCCTCNONE 
J100025F20ACGTGGGCCTCNONE 
J100028L08ACGTGGGCCTCNONE 
J100049L14ACGTGGGCCTCNONE 
J100054O07ACGTGGGCCTCNONE 
Os07g0479200005-017-H08GAGGCCCACGCNONE 
AK058326GAGGCCCACGCSimilar to SL15-like (Fragment). 
J013092A08GAGGCCCACGCNONE 
J033139E04GAGGCCCACGCNONE 
J043016M16GAGGCCCACGCNONE 
J053050O18GAGGCCCACGCNONE 
J053098B03GAGGCCCACGCNONE 
J065068G10GAGGCCCACGCNONE 
J065091I17GAGGCCCACGCNONE 
J065109A03GAGGCCCACGCNONE 
J065168B17GAGGCCCACGCNONE 
J065177A05GAGGCCCACGCNONE 
J065180J01GAGGCCCACGCNONE 
J075006F13GAGGCCCACGCNONE 
J075022J03GAGGCCCACGCNONE 
J075024N09GAGGCCCACGCNONE 
J075114B12GAGGCCCACGCNONE 
J080023M06GAGGCCCACGCNONE 
J080081N24GAGGCCCACGCNONE 
J090060N07GAGGCCCACGCNONE 
Os07g0516000AK106685CAGGCCCACSialidase domain containing protein. 
Os07g0522600AK067405AAGGCCCACTSimilar to Glutamate receptor 3.4 precursor (Ligand-gated ion channel 3.4) (AtGLR4). Splice isoform 2. 
AK103813AAGGCCCACTNONE 
J013106I10AAGGCCCACTNONE 
J023019F16AAGGCCCACTNONE 
J023111D09AAGGCCCACTNONE 
J033147C01AAGGCCCACTNONE 
J090014A07AAGGCCCACTNONE 
J090040K16AAGGCCCACTNONE 
J090087I22AAGGCCCACTNONE 
Os07g0606900011-039-F09GAGGCCCACCTNONE 
011-058-E11GAGGCCCACCTNONE 
012-014-C08GAGGCCCACCTNONE 
012-062-H02GAGGCCCACCTNONE 
012-067-G01GAGGCCCACCTNONE 
015-029-A08GAGGCCCACCTNONE 
015-039-H09GAGGCCCACCTNONE 
015-044-A09GAGGCCCACCTNONE 
015-047-G10GAGGCCCACCTNONE 
015-065-C04GAGGCCCACCTNONE 
015-067-C10GAGGCCCACCTNONE 
015-078-H10GAGGCCCACCTNONE 
015-084-A06GAGGCCCACCTNONE 
016-050-F01GAGGCCCACCTNONE 
016-059-E11GAGGCCCACCTNONE 
016-059-F04GAGGCCCACCTHeavy metal transport/detoxification protein domain containing protein. 
016-062-C02GAGGCCCACCTNONE 
J065170E01GAGGCCCACCTNONE 
J075122G11GAGGCCCACCTNONE 
Os07g0633200AK061338TAGGCCCACGASimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451TAGGCCCACGANONE 
J033096E22TAGGCCCACGANONE 
J033125D06TAGGCCCACGANONE 
J075048C23TAGGCCCACGANONE 
J075050G02TAGGCCCACGANONE 
J075104J04TAGGCCCACGANONE 
J075144N04TAGGCCCACGANONE 
Os07g0639800AK074012GAGGCCCACGASimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592GAGGCCCACGANONE 
AK104739GAGGCCCACGANONE 
Os07g0644300AK066726AAGGCCCACCASimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483AAGGCCCACCANONE 
Os07g0659500AK073537CAGGCCCACCANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0667400AK073297AGTGGGCCTCSAM (and some other nucleotide) binding motif domain containing protein. 
J033027J22AGTGGGCCTCNONE 
J033122B17AGTGGGCCTCNONE 
J065017H12AGTGGGCCTCNONE 
J065106D19AGTGGGCCTCNONE 
J065196J16AGTGGGCCTCNONE 
J090084F01AGTGGGCCTCNONE 
Os07g0693100AB111050TAGGCCCACCNONE 
AK100433TAGGCCCACCSimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC). 
J023054O07TAGGCCCACCNONE 
J023088C24TAGGCCCACCNONE 
J023088I11TAGGCCCACCNONE 
Os08g0107900014-055-C03TGTGGGCCTANONE 
J065062G20TGTGGGCCTANONE 
Os08g0116500009-007-E05GAGGCCCACGATCCGGCCCAAGNONE 
009-074-C07GAGGCCCACGATCCGGCCCAAGNONE 
009-098-A07GAGGCCCACGATCCGGCCCAAGNONE 
009-100-C03GAGGCCCACGATCCGGCCCAAGNONE 
009-136-E04GAGGCCCACGATCCGGCCCAAGNONE 
009-138-B08GAGGCCCACGATCCGGCCCAAGNONE 
009-144-B06GAGGCCCACGATCCGGCCCAAGNONE 
009-184-E04GAGGCCCACGATCCGGCCCAAGNONE 
009-189-F01GAGGCCCACGATCCGGCCCAAGNONE 
013-006-E05GAGGCCCACGATCCGGCCCAAGNONE 
013-015-C10GAGGCCCACGATCCGGCCCAAGNONE 
013-019-F09GAGGCCCACGATCCGGCCCAAGNONE 
013-020-C01GAGGCCCACGATCCGGCCCAAGNONE 
013-021-F05GAGGCCCACGATCCGGCCCAAGNONE 
013-035-D08GAGGCCCACGATCCGGCCCAAGNONE 
013-038-C09GAGGCCCACGATCCGGCCCAAGNONE 
013-054-B07GAGGCCCACGATCCGGCCCAAGNONE 
013-061-G10GAGGCCCACGATCCGGCCCAAGNONE 
013-074-B01GAGGCCCACGATCCGGCCCAAGNONE 
013-079-B06GAGGCCCACGATCCGGCCCAAGNONE 
013-099-B09GAGGCCCACGATCCGGCCCAAGNONE 
013-099-G11GAGGCCCACGATCCGGCCCAAGNONE 
014-023-F04GAGGCCCACGATCCGGCCCAAGNONE 
014-032-C07GAGGCCCACGATCCGGCCCAAGNONE 
014-045-E02GAGGCCCACGATCCGGCCCAAGNONE 
014-085-C02GAGGCCCACGATCCGGCCCAAGNONE 
014-087-F04GAGGCCCACGATCCGGCCCAAGNONE 
014-089-C04GAGGCCCACGATCCGGCCCAAGNONE 
014-090-E01GAGGCCCACGATCCGGCCCAAGNONE 
014-094-G11GAGGCCCACGATCCGGCCCAAGNONE 
014-097-B07GAGGCCCACGATCCGGCCCAAGNONE 
015-024-A12GAGGCCCACGATCCGGCCCAAGNONE 
015-032-C06GAGGCCCACGATCCGGCCCAAGNONE 
016-053-E09GAGGCCCACGATCCGGCCCAAGNONE 
016-081-F10GAGGCCCACGATCCGGCCCAAGNONE 
AK058240GAGGCCCACGATCCGGCCCAAGSimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09GAGGCCCACGATCCGGCCCAAGNONE 
J023107O19GAGGCCCACGATCCGGCCCAAGNONE 
J053029K21GAGGCCCACGATCCGGCCCAAGNONE 
J053073P11GAGGCCCACGATCCGGCCCAAGNONE 
J053074B04GAGGCCCACGATCCGGCCCAAGNONE 
J053078M14GAGGCCCACGATCCGGCCCAAGNONE 
J065001E12GAGGCCCACGATCCGGCCCAAGNONE 
J065006J12GAGGCCCACGATCCGGCCCAAGNONE 
J065015C06GAGGCCCACGATCCGGCCCAAGNONE 
J065025D13GAGGCCCACGATCCGGCCCAAGNONE 
J065029A04GAGGCCCACGATCCGGCCCAAGNONE 
J065031D23GAGGCCCACGATCCGGCCCAAGNONE 
J065032E24GAGGCCCACGATCCGGCCCAAGNONE 
J065034P16GAGGCCCACGATCCGGCCCAAGNONE 
J065043B04GAGGCCCACGATCCGGCCCAAGNONE 
J065044A15GAGGCCCACGATCCGGCCCAAGNONE 
J065062D18GAGGCCCACGATCCGGCCCAAGNONE 
J065079G13GAGGCCCACGATCCGGCCCAAGNONE 
J065080A19GAGGCCCACGATCCGGCCCAAGNONE 
J065080A20GAGGCCCACGATCCGGCCCAAGNONE 
J065089N19GAGGCCCACGATCCGGCCCAAGNONE 
J065111O07GAGGCCCACGATCCGGCCCAAGNONE 
J065115N15GAGGCCCACGATCCGGCCCAAGNONE 
J065131A04GAGGCCCACGATCCGGCCCAAGNONE 
J065138H02GAGGCCCACGATCCGGCCCAAGNONE 
J065139K10GAGGCCCACGATCCGGCCCAAGNONE 
J065144A02GAGGCCCACGATCCGGCCCAAGNONE 
J065155J17GAGGCCCACGATCCGGCCCAAGNONE 
J065159D18GAGGCCCACGATCCGGCCCAAGNONE 
J065159I18GAGGCCCACGATCCGGCCCAAGNONE 
J065167H12GAGGCCCACGATCCGGCCCAAGNONE 
J065174C22GAGGCCCACGATCCGGCCCAAGNONE 
J065184A05GAGGCCCACGATCCGGCCCAAGNONE 
J065188M15GAGGCCCACGATCCGGCCCAAGNONE 
J065191D23GAGGCCCACGATCCGGCCCAAGNONE 
J065203C07GAGGCCCACGATCCGGCCCAAGNONE 
J065207C23GAGGCCCACGATCCGGCCCAAGNONE 
J065207L16GAGGCCCACGATCCGGCCCAAGNONE 
J065212F01GAGGCCCACGATCCGGCCCAAGNONE 
J065212F05GAGGCCCACGATCCGGCCCAAGNONE 
J075037B07GAGGCCCACGATCCGGCCCAAGNONE 
J075042F15GAGGCCCACGATCCGGCCCAAGNONE 
J075059J03GAGGCCCACGATCCGGCCCAAGNONE 
J075068M18GAGGCCCACGATCCGGCCCAAGNONE 
J075079E13GAGGCCCACGATCCGGCCCAAGNONE 
J075081F12GAGGCCCACGATCCGGCCCAAGNONE 
J075083I05GAGGCCCACGATCCGGCCCAAGNONE 
J075123K23GAGGCCCACGATCCGGCCCAAGNONE 
J075142F16GAGGCCCACGATCCGGCCCAAGNONE 
J075156N03GAGGCCCACGATCCGGCCCAAGNONE 
J075162K05GAGGCCCACGATCCGGCCCAAGNONE 
J075171E08GAGGCCCACGATCCGGCCCAAGNONE 
J075177N03GAGGCCCACGATCCGGCCCAAGNONE 
J075182K17GAGGCCCACGATCCGGCCCAAGNONE 
J075186K02GAGGCCCACGATCCGGCCCAAGNONE 
J075191K05GAGGCCCACGATCCGGCCCAAGNONE 
J080011E10GAGGCCCACGATCCGGCCCAAGNONE 
J080016M21GAGGCCCACGATCCGGCCCAAGNONE 
J080017A17GAGGCCCACGATCCGGCCCAAGNONE 
J080031O09GAGGCCCACGATCCGGCCCAAGNONE 
J080039G21GAGGCCCACGATCCGGCCCAAGNONE 
J080041B01GAGGCCCACGATCCGGCCCAAGNONE 
J080050G20GAGGCCCACGATCCGGCCCAAGNONE 
J080054A12GAGGCCCACGATCCGGCCCAAGNONE 
J080058O08GAGGCCCACGATCCGGCCCAAGNONE 
J080061N04GAGGCCCACGATCCGGCCCAAGNONE 
J080064L23GAGGCCCACGATCCGGCCCAAGNONE 
J080064P05GAGGCCCACGATCCGGCCCAAGNONE 
J080069I17GAGGCCCACGATCCGGCCCAAGNONE 
J080070E07GAGGCCCACGATCCGGCCCAAGNONE 
J080071B20GAGGCCCACGATCCGGCCCAAGNONE 
J080074L08GAGGCCCACGATCCGGCCCAAGNONE 
J080076N08GAGGCCCACGATCCGGCCCAAGNONE 
J080081A14GAGGCCCACGATCCGGCCCAAGNONE 
J080081J17GAGGCCCACGATCCGGCCCAAGNONE 
J080085N14GAGGCCCACGATCCGGCCCAAGNONE 
J080090B09GAGGCCCACGATCCGGCCCAAGNONE 
J080097L11GAGGCCCACGATCCGGCCCAAGNONE 
J080306H13GAGGCCCACGATCCGGCCCAAGNONE 
J080307H13GAGGCCCACGATCCGGCCCAAGNONE 
J080311F12GAGGCCCACGATCCGGCCCAAGNONE 
J080316L23GAGGCCCACGATCCGGCCCAAGNONE 
J080318H02GAGGCCCACGATCCGGCCCAAGNONE 
J090016L15GAGGCCCACGATCCGGCCCAAGNONE 
J090019I02GAGGCCCACGATCCGGCCCAAGNONE 
J090031G21GAGGCCCACGATCCGGCCCAAGNONE 
J090066C15GAGGCCCACGATCCGGCCCAAGNONE 
J100032I02GAGGCCCACGATCCGGCCCAAGNONE 
J100032N07GAGGCCCACGATCCGGCCCAAGNONE 
J100032N16GAGGCCCACGATCCGGCCCAAGNONE 
J100041P21GAGGCCCACGATCCGGCCCAAGNONE 
J100048M04GAGGCCCACGATCCGGCCCAAGNONE 
J100048M14GAGGCCCACGATCCGGCCCAAGNONE 
J100063B08GAGGCCCACGATCCGGCCCAAGNONE 
J100088E20GAGGCCCACGATCCGGCCCAAGNONE 
J100090I08GAGGCCCACGATCCGGCCCAAGNONE 
Os08g0118900AK109749AAGGCCCACAAAdenylate kinase family protein. 
Os08g0130500006-024-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-032-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-047-B12CCAAGCCCATCAGGCCCACCAACNONE 
006-058-H06CCAAGCCCATCAGGCCCACCAACNONE 
006-062-D07CCAAGCCCATCAGGCCCACCAACNONE 
006-083-F11CCAAGCCCATCAGGCCCACCAACNONE 
006-084-A11CCAAGCCCATCAGGCCCACCAACNONE 
006-096-F12CCAAGCCCATCAGGCCCACCAACNONE 
006-105-A04CCAAGCCCATCAGGCCCACCAACNONE 
006-110-D11CCAAGCCCATCAGGCCCACCAACNONE 
011-022-D11CCAAGCCCATCAGGCCCACCAACNONE 
AK064857CCAAGCCCATCAGGCCCACCAAC60S acidic ribosomal protein P0. 
D21130CCAAGCCCATCAGGCCCACCAACNONE 
J013000H12CCAAGCCCATCAGGCCCACCAACNONE 
J013024M17CCAAGCCCATCAGGCCCACCAACNONE 
J013028H09CCAAGCCCATCAGGCCCACCAACNONE 
J013045N22CCAAGCCCATCAGGCCCACCAACNONE 
J013092K19CCAAGCCCATCAGGCCCACCAACNONE 
J013106L12CCAAGCCCATCAGGCCCACCAACNONE 
J013107A03CCAAGCCCATCAGGCCCACCAACNONE 
J013109E12CCAAGCCCATCAGGCCCACCAACNONE 
J013114N08CCAAGCCCATCAGGCCCACCAACNONE 
J013120J12CCAAGCCCATCAGGCCCACCAACNONE 
J013121E21CCAAGCCCATCAGGCCCACCAACNONE 
J013135P20CCAAGCCCATCAGGCCCACCAACNONE 
J023006J08CCAAGCCCATCAGGCCCACCAACNONE 
J023014L16CCAAGCCCATCAGGCCCACCAACNONE 
J023020N03CCAAGCCCATCAGGCCCACCAACNONE 
J023027M24CCAAGCCCATCAGGCCCACCAACNONE 
J023029D18CCAAGCCCATCAGGCCCACCAACNONE 
J023030A14CCAAGCCCATCAGGCCCACCAACNONE 
J023041G23CCAAGCCCATCAGGCCCACCAACNONE 
J023049H05CCAAGCCCATCAGGCCCACCAACNONE 
J023060I23CCAAGCCCATCAGGCCCACCAACNONE 
J023099D07CCAAGCCCATCAGGCCCACCAACNONE 
J023104A20CCAAGCCCATCAGGCCCACCAACNONE 
J023105F18CCAAGCCCATCAGGCCCACCAACNONE 
J023112D21CCAAGCCCATCAGGCCCACCAACNONE 
J023122M18CCAAGCCCATCAGGCCCACCAACNONE 
J023139J20CCAAGCCCATCAGGCCCACCAACNONE 
J023149L20CCAAGCCCATCAGGCCCACCAACNONE 
J023150G04CCAAGCCCATCAGGCCCACCAACNONE 
J033036G02CCAAGCCCATCAGGCCCACCAACNONE 
J033045P13CCAAGCCCATCAGGCCCACCAACNONE 
J033046A22CCAAGCCCATCAGGCCCACCAACNONE 
J033086H16CCAAGCCCATCAGGCCCACCAACNONE 
J033087D07CCAAGCCCATCAGGCCCACCAACNONE 
J033089M14CCAAGCCCATCAGGCCCACCAACNONE 
J033095F14CCAAGCCCATCAGGCCCACCAACNONE 
J033108M01CCAAGCCCATCAGGCCCACCAACNONE 
J033117A17CCAAGCCCATCAGGCCCACCAACNONE 
J033122F03CCAAGCCCATCAGGCCCACCAACNONE 
J033126A04CCAAGCCCATCAGGCCCACCAACNONE 
J033144D13CCAAGCCCATCAGGCCCACCAACNONE 
J033145D13CCAAGCCCATCAGGCCCACCAACNONE 
J043022M09CCAAGCCCATCAGGCCCACCAACNONE 
J053025I11CCAAGCCCATCAGGCCCACCAACNONE 
J053027K06CCAAGCCCATCAGGCCCACCAACNONE 
J053029D15CCAAGCCCATCAGGCCCACCAACNONE 
J053048I22CCAAGCCCATCAGGCCCACCAACNONE 
J053055I01CCAAGCCCATCAGGCCCACCAACNONE 
J053079P07CCAAGCCCATCAGGCCCACCAACNONE 
J053090J23CCAAGCCCATCAGGCCCACCAACNONE 
J053094C24CCAAGCCCATCAGGCCCACCAACNONE 
J065023F18CCAAGCCCATCAGGCCCACCAACNONE 
J065029I12CCAAGCCCATCAGGCCCACCAACNONE 
J065044B18CCAAGCCCATCAGGCCCACCAACNONE 
J065045C07CCAAGCCCATCAGGCCCACCAACNONE 
J065063K22CCAAGCCCATCAGGCCCACCAACNONE 
J065093D11CCAAGCCCATCAGGCCCACCAACNONE 
J065096P09CCAAGCCCATCAGGCCCACCAACNONE 
J065099N04CCAAGCCCATCAGGCCCACCAACNONE 
J065103K24CCAAGCCCATCAGGCCCACCAACNONE 
J065110H12CCAAGCCCATCAGGCCCACCAACNONE 
J065132F24CCAAGCCCATCAGGCCCACCAACNONE 
J065157K16CCAAGCCCATCAGGCCCACCAACNONE 
J065185D11CCAAGCCCATCAGGCCCACCAACNONE 
J065202E16CCAAGCCCATCAGGCCCACCAACNONE 
J065217D07CCAAGCCCATCAGGCCCACCAACNONE 
J075053I19CCAAGCCCATCAGGCCCACCAACNONE 
J075055L24CCAAGCCCATCAGGCCCACCAACNONE 
J075056H24CCAAGCCCATCAGGCCCACCAACNONE 
J075070D02CCAAGCCCATCAGGCCCACCAACNONE 
J075084O15CCAAGCCCATCAGGCCCACCAACNONE 
J075090F24CCAAGCCCATCAGGCCCACCAACNONE 
J075135E03CCAAGCCCATCAGGCCCACCAACNONE 
J075174A01CCAAGCCCATCAGGCCCACCAACNONE 
J075188F05CCAAGCCCATCAGGCCCACCAACNONE 
J075192C17CCAAGCCCATCAGGCCCACCAACNONE 
J080001B02CCAAGCCCATCAGGCCCACCAACNONE 
J080001C08CCAAGCCCATCAGGCCCACCAACNONE 
J080002D15CCAAGCCCATCAGGCCCACCAACNONE 
J080002I03CCAAGCCCATCAGGCCCACCAACNONE 
J080003E24CCAAGCCCATCAGGCCCACCAACNONE 
J080004M10CCAAGCCCATCAGGCCCACCAACNONE 
J080005C18CCAAGCCCATCAGGCCCACCAACNONE 
J080006A12CCAAGCCCATCAGGCCCACCAACNONE 
J080006F04CCAAGCCCATCAGGCCCACCAACNONE 
J080006M11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J11CCAAGCCCATCAGGCCCACCAACNONE 
J080008J22CCAAGCCCATCAGGCCCACCAACNONE 
J080009F14CCAAGCCCATCAGGCCCACCAACNONE 
J080010B12CCAAGCCCATCAGGCCCACCAACNONE 
J080010G14CCAAGCCCATCAGGCCCACCAACNONE 
J080010N07CCAAGCCCATCAGGCCCACCAACNONE 
J080011D04CCAAGCCCATCAGGCCCACCAACNONE 
J080011G10CCAAGCCCATCAGGCCCACCAACNONE 
J080011O19CCAAGCCCATCAGGCCCACCAACNONE 
J080013K23CCAAGCCCATCAGGCCCACCAACNONE 
J080013M09CCAAGCCCATCAGGCCCACCAACNONE 
J080013N12CCAAGCCCATCAGGCCCACCAACNONE 
J080013O15CCAAGCCCATCAGGCCCACCAACNONE 
J080014C13CCAAGCCCATCAGGCCCACCAACNONE 
J080014D21CCAAGCCCATCAGGCCCACCAACNONE 
J080014F08CCAAGCCCATCAGGCCCACCAACNONE 
J080014N08CCAAGCCCATCAGGCCCACCAACNONE 
J080014P19CCAAGCCCATCAGGCCCACCAACNONE 
J080015L09CCAAGCCCATCAGGCCCACCAACNONE 
J080015P15CCAAGCCCATCAGGCCCACCAACNONE 
J080018P10CCAAGCCCATCAGGCCCACCAACNONE 
J080020C06CCAAGCCCATCAGGCCCACCAACNONE 
J080022C14CCAAGCCCATCAGGCCCACCAACNONE 
J080022E01CCAAGCCCATCAGGCCCACCAACNONE 
J080022P04CCAAGCCCATCAGGCCCACCAACNONE 
J080022P10CCAAGCCCATCAGGCCCACCAACNONE 
J080023B20CCAAGCCCATCAGGCCCACCAACNONE 
J080023G19CCAAGCCCATCAGGCCCACCAACNONE 
J080024N15CCAAGCCCATCAGGCCCACCAACNONE 
J080025E11CCAAGCCCATCAGGCCCACCAACNONE 
J080025G24CCAAGCCCATCAGGCCCACCAACNONE 
J080026B01CCAAGCCCATCAGGCCCACCAACNONE 
J080026B05CCAAGCCCATCAGGCCCACCAACNONE 
J080027L17CCAAGCCCATCAGGCCCACCAACNONE 
J080028K02CCAAGCCCATCAGGCCCACCAACNONE 
J080029L23CCAAGCCCATCAGGCCCACCAACNONE 
J080030D08CCAAGCCCATCAGGCCCACCAACNONE 
J080031C03CCAAGCCCATCAGGCCCACCAACNONE 
J080031K02CCAAGCCCATCAGGCCCACCAACNONE 
J080032C16CCAAGCCCATCAGGCCCACCAACNONE 
J080033F10CCAAGCCCATCAGGCCCACCAACNONE 
J080033G12CCAAGCCCATCAGGCCCACCAACNONE 
J080033K03CCAAGCCCATCAGGCCCACCAACNONE 
J080034B03CCAAGCCCATCAGGCCCACCAACNONE 
J080034N21CCAAGCCCATCAGGCCCACCAACNONE 
J080034O03CCAAGCCCATCAGGCCCACCAACNONE 
J080035G10CCAAGCCCATCAGGCCCACCAACNONE 
J080038E14CCAAGCCCATCAGGCCCACCAACNONE 
J080039A19CCAAGCCCATCAGGCCCACCAACNONE 
J080039G10CCAAGCCCATCAGGCCCACCAACNONE 
J080039J01CCAAGCCCATCAGGCCCACCAACNONE 
J080039J09CCAAGCCCATCAGGCCCACCAACNONE 
J080040F07CCAAGCCCATCAGGCCCACCAACNONE 
J080040H18CCAAGCCCATCAGGCCCACCAACNONE 
J080041E08CCAAGCCCATCAGGCCCACCAACNONE 
J080041E16CCAAGCCCATCAGGCCCACCAACNONE 
J080041L08CCAAGCCCATCAGGCCCACCAACNONE 
J080042A07CCAAGCCCATCAGGCCCACCAACNONE 
J080044E02CCAAGCCCATCAGGCCCACCAACNONE 
J080045K03CCAAGCCCATCAGGCCCACCAACNONE 
J080046O03CCAAGCCCATCAGGCCCACCAACNONE 
J080047F08CCAAGCCCATCAGGCCCACCAACNONE 
J080048H01CCAAGCCCATCAGGCCCACCAACNONE 
J080048I05CCAAGCCCATCAGGCCCACCAACNONE 
J080048N06CCAAGCCCATCAGGCCCACCAACNONE 
J080050A07CCAAGCCCATCAGGCCCACCAACNONE 
J080050B04CCAAGCCCATCAGGCCCACCAACNONE 
J080050E21CCAAGCCCATCAGGCCCACCAACNONE 
J080051J01CCAAGCCCATCAGGCCCACCAACNONE 
J080051K02CCAAGCCCATCAGGCCCACCAACNONE 
J080051L02CCAAGCCCATCAGGCCCACCAACNONE 
J080052C20CCAAGCCCATCAGGCCCACCAACNONE 
J080052I22CCAAGCCCATCAGGCCCACCAACNONE 
J080052J21CCAAGCCCATCAGGCCCACCAACNONE 
J080052K22CCAAGCCCATCAGGCCCACCAACNONE 
J080055A05CCAAGCCCATCAGGCCCACCAACNONE 
J080055I12CCAAGCCCATCAGGCCCACCAACNONE 
J080056A21CCAAGCCCATCAGGCCCACCAACNONE 
J080056N11CCAAGCCCATCAGGCCCACCAACNONE 
J080057D02CCAAGCCCATCAGGCCCACCAACNONE 
J080058H21CCAAGCCCATCAGGCCCACCAACNONE 
J080058P16CCAAGCCCATCAGGCCCACCAACNONE 
J080059M03CCAAGCCCATCAGGCCCACCAACNONE 
J080059N17CCAAGCCCATCAGGCCCACCAACNONE 
J080060F13CCAAGCCCATCAGGCCCACCAACNONE 
J080060H06CCAAGCCCATCAGGCCCACCAACNONE 
J080060J03CCAAGCCCATCAGGCCCACCAACNONE 
J080060O09CCAAGCCCATCAGGCCCACCAACNONE 
J080060P22CCAAGCCCATCAGGCCCACCAACNONE 
J080061F06CCAAGCCCATCAGGCCCACCAACNONE 
J080061H21CCAAGCCCATCAGGCCCACCAACNONE 
J080061O13CCAAGCCCATCAGGCCCACCAACNONE 
J080062J07CCAAGCCCATCAGGCCCACCAACNONE 
J080063A08CCAAGCCCATCAGGCCCACCAACNONE 
J080063F19CCAAGCCCATCAGGCCCACCAACNONE 
J080063O18CCAAGCCCATCAGGCCCACCAACNONE 
J080065D15CCAAGCCCATCAGGCCCACCAACNONE 
J080066E13CCAAGCCCATCAGGCCCACCAACNONE 
J080068L01CCAAGCCCATCAGGCCCACCAACNONE 
J080068P07CCAAGCCCATCAGGCCCACCAACNONE 
J080069I21CCAAGCCCATCAGGCCCACCAACNONE 
J080070M04CCAAGCCCATCAGGCCCACCAACNONE 
J080071E01CCAAGCCCATCAGGCCCACCAACNONE 
J080071J08CCAAGCCCATCAGGCCCACCAACNONE 
J080071M23CCAAGCCCATCAGGCCCACCAACNONE 
J080072A03CCAAGCCCATCAGGCCCACCAACNONE 
J080072G18CCAAGCCCATCAGGCCCACCAACNONE 
J080075A04CCAAGCCCATCAGGCCCACCAACNONE 
J080075E19CCAAGCCCATCAGGCCCACCAACNONE 
J080075P18CCAAGCCCATCAGGCCCACCAACNONE 
J080076N11CCAAGCCCATCAGGCCCACCAACNONE 
J080077A11CCAAGCCCATCAGGCCCACCAACNONE 
J080077D22CCAAGCCCATCAGGCCCACCAACNONE 
J080077H18CCAAGCCCATCAGGCCCACCAACNONE 
J080077L03CCAAGCCCATCAGGCCCACCAACNONE 
J080078D02CCAAGCCCATCAGGCCCACCAACNONE 
J080078L05CCAAGCCCATCAGGCCCACCAACNONE 
J080078N20CCAAGCCCATCAGGCCCACCAACNONE 
J080079I20CCAAGCCCATCAGGCCCACCAACNONE 
J080081D04CCAAGCCCATCAGGCCCACCAACNONE 
J080082A07CCAAGCCCATCAGGCCCACCAACNONE 
J080082E24CCAAGCCCATCAGGCCCACCAACNONE 
J080084A22CCAAGCCCATCAGGCCCACCAACNONE 
J080084E15CCAAGCCCATCAGGCCCACCAACNONE 
J080084G06CCAAGCCCATCAGGCCCACCAACNONE 
J080086A05CCAAGCCCATCAGGCCCACCAACNONE 
J080086F09CCAAGCCCATCAGGCCCACCAACNONE 
J080087B11CCAAGCCCATCAGGCCCACCAACNONE 
J080087H12CCAAGCCCATCAGGCCCACCAACNONE 
J080088I05CCAAGCCCATCAGGCCCACCAACNONE 
J080088N08CCAAGCCCATCAGGCCCACCAACNONE 
J080088P07CCAAGCCCATCAGGCCCACCAACNONE 
J080089A09CCAAGCCCATCAGGCCCACCAACNONE 
J080089D21CCAAGCCCATCAGGCCCACCAACNONE 
J080089F24CCAAGCCCATCAGGCCCACCAACNONE 
J080089H22CCAAGCCCATCAGGCCCACCAACNONE 
J080089I04CCAAGCCCATCAGGCCCACCAACNONE 
J080090D01CCAAGCCCATCAGGCCCACCAACNONE 
J080091F09CCAAGCCCATCAGGCCCACCAACNONE 
J080091G18CCAAGCCCATCAGGCCCACCAACNONE 
J080091L24CCAAGCCCATCAGGCCCACCAACNONE 
J080091M12CCAAGCCCATCAGGCCCACCAACNONE 
J080091N12CCAAGCCCATCAGGCCCACCAACNONE 
J080093A15CCAAGCCCATCAGGCCCACCAACNONE 
J080093C08CCAAGCCCATCAGGCCCACCAACNONE 
J080093I08CCAAGCCCATCAGGCCCACCAACNONE 
J080093P21CCAAGCCCATCAGGCCCACCAACNONE 
J080094E18CCAAGCCCATCAGGCCCACCAACNONE 
J080094F15CCAAGCCCATCAGGCCCACCAACNONE 
J080094J21CCAAGCCCATCAGGCCCACCAACNONE 
J080095A09CCAAGCCCATCAGGCCCACCAACNONE 
J080096G05CCAAGCCCATCAGGCCCACCAACNONE 
J080096K07CCAAGCCCATCAGGCCCACCAACNONE 
J080097M17CCAAGCCCATCAGGCCCACCAACNONE 
J080097P21CCAAGCCCATCAGGCCCACCAACNONE 
J080302B15CCAAGCCCATCAGGCCCACCAACNONE 
J080306J15CCAAGCCCATCAGGCCCACCAACNONE 
J080306O13CCAAGCCCATCAGGCCCACCAACNONE 
J080307C15CCAAGCCCATCAGGCCCACCAACNONE 
J080307I04CCAAGCCCATCAGGCCCACCAACNONE 
J080307L05CCAAGCCCATCAGGCCCACCAACNONE 
J080308F11CCAAGCCCATCAGGCCCACCAACNONE 
J080311C04CCAAGCCCATCAGGCCCACCAACNONE 
J080311I07CCAAGCCCATCAGGCCCACCAACNONE 
J080312C01CCAAGCCCATCAGGCCCACCAACNONE 
J080312O08CCAAGCCCATCAGGCCCACCAACNONE 
J080315F14CCAAGCCCATCAGGCCCACCAACNONE 
J080318K13CCAAGCCCATCAGGCCCACCAACNONE 
J080319A17CCAAGCCCATCAGGCCCACCAACNONE 
J090001I01CCAAGCCCATCAGGCCCACCAACNONE 
J090002O18CCAAGCCCATCAGGCCCACCAACNONE 
J090007A08CCAAGCCCATCAGGCCCACCAACNONE 
J090007F22CCAAGCCCATCAGGCCCACCAACNONE 
J090008D09CCAAGCCCATCAGGCCCACCAACNONE 
J090008L07CCAAGCCCATCAGGCCCACCAACNONE 
J090008O08CCAAGCCCATCAGGCCCACCAACNONE 
J090012N11CCAAGCCCATCAGGCCCACCAACNONE 
J090013M05CCAAGCCCATCAGGCCCACCAACNONE 
J090020E08CCAAGCCCATCAGGCCCACCAACNONE 
J090020O20CCAAGCCCATCAGGCCCACCAACNONE 
J090021I10CCAAGCCCATCAGGCCCACCAACNONE 
J090023D07CCAAGCCCATCAGGCCCACCAACNONE 
J090023K22CCAAGCCCATCAGGCCCACCAACNONE 
J090023O08CCAAGCCCATCAGGCCCACCAACNONE 
J090028D21CCAAGCCCATCAGGCCCACCAACNONE 
J090029H14CCAAGCCCATCAGGCCCACCAACNONE 
J090029L12CCAAGCCCATCAGGCCCACCAACNONE 
J090030C05CCAAGCCCATCAGGCCCACCAACNONE 
J090031D18CCAAGCCCATCAGGCCCACCAACNONE 
J090032G10CCAAGCCCATCAGGCCCACCAACNONE 
J090034J22CCAAGCCCATCAGGCCCACCAACNONE 
J090034K16CCAAGCCCATCAGGCCCACCAACNONE 
J090036D10CCAAGCCCATCAGGCCCACCAACNONE 
J090037N17CCAAGCCCATCAGGCCCACCAACNONE 
J090043P17CCAAGCCCATCAGGCCCACCAACNONE 
J090044L20CCAAGCCCATCAGGCCCACCAACNONE 
J090045N16CCAAGCCCATCAGGCCCACCAACNONE 
J090048K03CCAAGCCCATCAGGCCCACCAACNONE 
J090048K10CCAAGCCCATCAGGCCCACCAACNONE 
J090049O07CCAAGCCCATCAGGCCCACCAACNONE 
J090055H23CCAAGCCCATCAGGCCCACCAACNONE 
J090056G12CCAAGCCCATCAGGCCCACCAACNONE 
J090056G16CCAAGCCCATCAGGCCCACCAACNONE 
J090059B16CCAAGCCCATCAGGCCCACCAACNONE 
J090066H21CCAAGCCCATCAGGCCCACCAACNONE 
J090067D22CCAAGCCCATCAGGCCCACCAACNONE 
J090072M07CCAAGCCCATCAGGCCCACCAACNONE 
J090073J21CCAAGCCCATCAGGCCCACCAACNONE 
J090075A15CCAAGCCCATCAGGCCCACCAACNONE 
J090079J09CCAAGCCCATCAGGCCCACCAACNONE 
J090080L07CCAAGCCCATCAGGCCCACCAACNONE 
J090084A03CCAAGCCCATCAGGCCCACCAACNONE 
J090085B07CCAAGCCCATCAGGCCCACCAACNONE 
J090088H11CCAAGCCCATCAGGCCCACCAACNONE 
J090090J12CCAAGCCCATCAGGCCCACCAACNONE 
J090091I21CCAAGCCCATCAGGCCCACCAACNONE 
J090091L02CCAAGCCCATCAGGCCCACCAACNONE 
J090093G18CCAAGCCCATCAGGCCCACCAACNONE 
J090094D23CCAAGCCCATCAGGCCCACCAACNONE 
J090098L19CCAAGCCCATCAGGCCCACCAACNONE 
J100017I22CCAAGCCCATCAGGCCCACCAACNONE 
J100018F08CCAAGCCCATCAGGCCCACCAACNONE 
J100018G19CCAAGCCCATCAGGCCCACCAACNONE 
J100019B05CCAAGCCCATCAGGCCCACCAACNONE 
J100019J18CCAAGCCCATCAGGCCCACCAACNONE 
J100019L04CCAAGCCCATCAGGCCCACCAACNONE 
J100023M06CCAAGCCCATCAGGCCCACCAACNONE 
J100024J23CCAAGCCCATCAGGCCCACCAACNONE 
J100024P09CCAAGCCCATCAGGCCCACCAACNONE 
J100027I05CCAAGCCCATCAGGCCCACCAACNONE 
J100029G03CCAAGCCCATCAGGCCCACCAACNONE 
J100029K08CCAAGCCCATCAGGCCCACCAACNONE 
J100031J17CCAAGCCCATCAGGCCCACCAACNONE 
J100037L16CCAAGCCCATCAGGCCCACCAACNONE 
J100038C05CCAAGCCCATCAGGCCCACCAACNONE 
J100039D19CCAAGCCCATCAGGCCCACCAACNONE 
J100041L02CCAAGCCCATCAGGCCCACCAACNONE 
J100045B08CCAAGCCCATCAGGCCCACCAACNONE 
J100045B15CCAAGCCCATCAGGCCCACCAACNONE 
J100047G07CCAAGCCCATCAGGCCCACCAACNONE 
J100047P19CCAAGCCCATCAGGCCCACCAACNONE 
J100048I15CCAAGCCCATCAGGCCCACCAACNONE 
J100049M16CCAAGCCCATCAGGCCCACCAACNONE 
J100049P18CCAAGCCCATCAGGCCCACCAACNONE 
J100050E21CCAAGCCCATCAGGCCCACCAACNONE 
J100051N02CCAAGCCCATCAGGCCCACCAACNONE 
J100052M02CCAAGCCCATCAGGCCCACCAACNONE 
J100055M24CCAAGCCCATCAGGCCCACCAACNONE 
J100056K11CCAAGCCCATCAGGCCCACCAACNONE 
J100059F20CCAAGCCCATCAGGCCCACCAACNONE 
J100059J15CCAAGCCCATCAGGCCCACCAACNONE 
J100068C19CCAAGCCCATCAGGCCCACCAACNONE 
J100068G06CCAAGCCCATCAGGCCCACCAACNONE 
J100069N02CCAAGCCCATCAGGCCCACCAACNONE 
J100073N04CCAAGCCCATCAGGCCCACCAACNONE 
J100074B05CCAAGCCCATCAGGCCCACCAACNONE 
J100080P13CCAAGCCCATCAGGCCCACCAACNONE 
J100083P09CCAAGCCCATCAGGCCCACCAACNONE 
J100084B11CCAAGCCCATCAGGCCCACCAACNONE 
J100085B07CCAAGCCCATCAGGCCCACCAACNONE 
J100086O20CCAAGCCCATCAGGCCCACCAACNONE 
J100087B02CCAAGCCCATCAGGCCCACCAACNONE 
J100089B14CCAAGCCCATCAGGCCCACCAACNONE 
Os08g0155000004-001-C12TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
014-030-C11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK060859TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
AK099613TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACBrix domain containing protein. 
J013154C17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033039F14TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J033126I18TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J043005A17TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053027C13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053033I07TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053054P04TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053060F22TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053061P10TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053065L13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053099H19TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J053101D09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075062C16TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075129P09TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075135C02TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J075147P13TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090007K03TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090050M06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090057M20TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090070B06TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J090080D11TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
J100021D15TGATGGGCCTAATGGGCCAAGCCCATCAAGGCCCACACNONE 
Os08g0158900AK067062AAGGCCCACGAGTP1/OBG domain containing protein. 
J013089F04AAGGCCCACGANONE 
J013092D16AAGGCCCACGANONE 
J033120K14AAGGCCCACGANONE 
J033133F24AAGGCCCACGANONE 
J033145A10AAGGCCCACGANONE 
J033145A11AAGGCCCACGANONE 
J053048H24AAGGCCCACGANONE 
J053075H10AAGGCCCACGANONE 
Os08g0159000AK073617TCGTGGGCCTTNONE 
AK103973TCGTGGGCCTTSimilar to DnaJ homolog subfamily C member 1. 
J023130H14TCGTGGGCCTTNONE 
J033051J11TCGTGGGCCTTNONE 
J065101C10TCGTGGGCCTTNONE 
J065168B04TCGTGGGCCTTNONE 
J065184E22TCGTGGGCCTTNONE 
J080021D11TCGTGGGCCTTNONE 
J080025H10TCGTGGGCCTTNONE 
J080026N19TCGTGGGCCTTNONE 
J080034A12TCGTGGGCCTTNONE 
J080040L02TCGTGGGCCTTNONE 
J080042H19TCGTGGGCCTTNONE 
J080047B05TCGTGGGCCTTNONE 
J080047E09TCGTGGGCCTTNONE 
J080047I01TCGTGGGCCTTNONE 
J080052H19TCGTGGGCCTTNONE 
J080062K13TCGTGGGCCTTNONE 
J080063A22TCGTGGGCCTTNONE 
J080068G18TCGTGGGCCTTNONE 
J080068N19TCGTGGGCCTTNONE 
J080076G08TCGTGGGCCTTNONE 
J080077H13TCGTGGGCCTTNONE 
J080077K06TCGTGGGCCTTNONE 
J080093D15TCGTGGGCCTTNONE 
J080094D21TCGTGGGCCTTNONE 
J080097A20TCGTGGGCCTTNONE 
J080097E21TCGTGGGCCTTNONE 
J080097N17TCGTGGGCCTTNONE 
J100071K18TCGTGGGCCTTNONE 
J100072F09TCGTGGGCCTTNONE 
Os08g0299600AK107112CAGGCCCACCACyclin-like F-box domain containing protein. 
Os08g0359500003-107-F09CAAGGCCCACGANONE 
006-091-E08CAAGGCCCACGANONE 
006-096-E12CAAGGCCCACGANONE 
006-111-F11CAAGGCCCACGANONE 
009-090-H10CAAGGCCCACGANONE 
014-013-B02CAAGGCCCACGANONE 
014-083-E03CAAGGCCCACGANONE 
014-100-F05CAAGGCCCACGANONE 
AK104798CAAGGCCCACGANONE 
AK112034CAAGGCCCACGAHSP20-like chaperone domain containing protein. 
J013060J18CAAGGCCCACGANONE 
J033042C22CAAGGCCCACGANONE 
J065168I06CAAGGCCCACGANONE 
J075077E12CAAGGCCCACGANONE 
J075094M21CAAGGCCCACGANONE 
J090068D17CAAGGCCCACGANONE 
J100027E21CAAGGCCCACGANONE 
J100058D21CAAGGCCCACGANONE 
J100067B02CAAGGCCCACGANONE 
Os08g0474600J075102L06GAGGCCCACGGNONE 
J075103J21GAGGCCCACGGNONE 
Os08g0492100AK060178AGTGGGCCTANONE 
AK071053AGTGGGCCTAParaneoplastic encephalomyelitis antigen family protein. 
AK100101AGTGGGCCTANONE 
J023004I20AGTGGGCCTANONE 
J023067D13AGTGGGCCTANONE 
J033028G05AGTGGGCCTANONE 
J033060L15AGTGGGCCTANONE 
J033103N12AGTGGGCCTANONE 
J033125B19AGTGGGCCTANONE 
J065132A12AGTGGGCCTANONE 
J065161F02AGTGGGCCTANONE 
J065162L05AGTGGGCCTANONE 
J090093I18AGTGGGCCTANONE 
J100061I05AGTGGGCCTANONE 
J100081G13AGTGGGCCTANONE 
Os08g0500900AK102314AAGGCCCACASimilar to Phosphoribosylglycinamide formyltransferase, chloroplast precursor (EC 2.1.2.2) (GART) (GAR transformylase) (5'-phosphoribosylglycinamide transformylase). 
Os08g0511800011-007-H01AAGGCCCACTGGGCTGANONE 
AK063264AAGGCCCACTGGGCTGAConserved hypothetical protein. 
Os08g0517900015-019-D06GAGGCCCACCTNONE 
AK064304GAGGCCCACCTSimilar to 30S ribosomal protein S16. 
Os08g0527400AK119389AGTGGGCCTTPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0535600AK121683GAGGCCCACAZinc finger, Tim10/DDP-type family protein. 
J065077E05GAGGCCCACANONE 
J075088M24GAGGCCCACANONE 
J075140B03GAGGCCCACANONE 
J090014B14GAGGCCCACANONE 
Os08g0542100AK058490AAAAGCCCAACAGGCCCACTRibosomal protein L7, eukaryotic form family protein. 
AK101416AAAAGCCCAACAGGCCCACTNONE 
J033037N08AAAAGCCCAACAGGCCCACTNONE 
J033086B16AAAAGCCCAACAGGCCCACTNONE 
J043036J02AAAAGCCCAACAGGCCCACTNONE 
J065137E02AAAAGCCCAACAGGCCCACTNONE 
J090015L07AAAAGCCCAACAGGCCCACTNONE 
J100036D02AAAAGCCCAACAGGCCCACTNONE 
Os09g0103600015-027-H02AGGTGGGCCTNONE 
AK064099AGGTGGGCCTPRP38 family protein. 
J065127H08AGGTGGGCCTNONE 
J065195O10AGGTGGGCCTNONE 
J100057E16AGGTGGGCCTNONE 
J100064I23AGGTGGGCCTNONE 
Os09g0309500J100027L22GAGGCCCACCACConserved hypothetical protein. 
Os09g0360400009-192-H06AAGGCCCACCCGGCCCGGGNONE 
AK071395AAGGCCCACCCGGCCCGGGConserved hypothetical protein. 
J013045J21AAGGCCCACCCGGCCCGGGNONE 
J023095O09AAGGCCCACCCGGCCCGGGNONE 
J065207K01AAGGCCCACCCGGCCCGGGNONE 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
Os09g0411700005-017-C05CCAGGCCCACAANONE 
009-163-B01CCAGGCCCACAANONE 
AK058290CCAGGCCCACAAPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919CCAGGCCCACAANONE 
AK121091CCAGGCCCACAANONE 
J013039D20CCAGGCCCACAANONE 
J023066F16CCAGGCCCACAANONE 
J023082H09CCAGGCCCACAANONE 
J023088H05CCAGGCCCACAANONE 
J065013G09CCAGGCCCACAANONE 
J065065C12CCAGGCCCACAANONE 
J065111I04CCAGGCCCACAANONE 
J065179H22CCAGGCCCACAANONE 
J075023N14CCAGGCCCACAANONE 
J090041J17CCAGGCCCACAANONE 
J100031J21CCAGGCCCACAANONE 
J100057A18CCAGGCCCACAANONE 
J100068P22CCAGGCCCACAANONE 
Os09g0434200AK062015AAGGCCCACACNONE 
AK103447AAGGCCCACACZinc finger, RING-type domain containing protein. 
Os09g0436700AK070597CAAGGCCCACCAPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os09g0468900AK120990TCGGCCCATCAGGCCCACGTConserved hypothetical protein. 
J013123P13TCGGCCCATCAGGCCCACGTNONE 
J023013I09TCGGCCCATCAGGCCCACGTNONE 
J023023G08TCGGCCCATCAGGCCCACGTNONE 
J023043E08TCGGCCCATCAGGCCCACGTNONE 
J033124D24TCGGCCCATCAGGCCCACGTNONE 
J065047I07TCGGCCCATCAGGCCCACGTNONE 
J065093C16TCGGCCCATCAGGCCCACGTNONE 
J090088O03TCGGCCCATCAGGCCCACGTNONE 
J100032M21TCGGCCCATCAGGCCCACGTNONE 
Os09g0474501J065129D17GAGGCCCACCAConserved hypothetical protein. 
Os09g0493700015-091-G11TAGGCCCACGCNONE 
AK068501TAGGCCCACGCSimilar to CUC2. 
AK099237TAGGCCCACGCNONE 
J013155B08TAGGCCCACGCNONE 
J023006E01TAGGCCCACGCNONE 
J023060K23TAGGCCCACGCNONE 
J023100B11TAGGCCCACGCNONE 
J033026L19TAGGCCCACGCNONE 
J033129J12TAGGCCCACGCNONE 
J033149K09TAGGCCCACGCNONE 
J065045I06TAGGCCCACGCNONE 
J065061A10TAGGCCCACGCNONE 
J065101H05TAGGCCCACGCNONE 
J065135A03TAGGCCCACGCNONE 
J065169C16TAGGCCCACGCNONE 
J100047C11TAGGCCCACGCNONE 
J100047K07TAGGCCCACGCNONE 
Os09g0511700AK101420TAGGCCCACGGCCCACCCSimilar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118). 
J013022L19TAGGCCCACGGCCCACCCNONE 
J013036D23TAGGCCCACGGCCCACCCNONE 
J013037F22TAGGCCCACGGCCCACCCNONE 
J013111M23TAGGCCCACGGCCCACCCNONE 
J023109F14TAGGCCCACGGCCCACCCNONE 
J023119H17TAGGCCCACGGCCCACCCNONE 
J023133H23TAGGCCCACGGCCCACCCNONE 
J033032G17TAGGCCCACGGCCCACCCNONE 
J033038B10TAGGCCCACGGCCCACCCNONE 
J033071M16TAGGCCCACGGCCCACCCNONE 
J033096G04TAGGCCCACGGCCCACCCNONE 
J033109D06TAGGCCCACGGCCCACCCNONE 
J043016E22TAGGCCCACGGCCCACCCNONE 
J043022O09TAGGCCCACGGCCCACCCNONE 
J100023N11TAGGCCCACGGCCCACCCNONE 
J100046I21TAGGCCCACGGCCCACCCNONE 
Os09g0535300AK071211AGTGGGCCTCXAP5 protein family protein. 
Os09g0542200006-092-A09AGTGGGCCTTNONE 
AK064887AGTGGGCCTTThioredoxin fold domain containing protein. 
AK104804AGTGGGCCTTNONE 
J013000K12AGTGGGCCTTNONE 
J013170A19AGTGGGCCTTNONE 
J033103B02AGTGGGCCTTNONE 
J065196J20AGTGGGCCTTNONE 
J075037H17AGTGGGCCTTNONE 
J075069H14AGTGGGCCTTNONE 
J075071C16AGTGGGCCTTNONE 
J075095N02AGTGGGCCTTNONE 
J075136N03AGTGGGCCTTNONE 
J075192L16AGTGGGCCTTNONE 
J100057N23AGTGGGCCTTNONE 
J100060O07AGTGGGCCTTNONE 
J100062F10AGTGGGCCTTNONE 
J100077I08AGTGGGCCTTNONE 
J100086B07AGTGGGCCTTNONE 
J100088L14AGTGGGCCTTNONE 
Os09g0572900AK069270TCGTGGGCCTCTCGGCCCAAGSimilar to Dynamin-related protein 1E (Dynamin-like protein E) (Dynamin-like protein 4) (Dynamin-like protein DLP2). 
Os09g0573000AK073399CTTGGGCCGAGAGGCCCACGAProtein prenyltransferase domain containing protein. 
Os11g0132700AK103286TTGTGGGCCTCCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0157100012-010-F03GGAGTGGGCCTGAAACGGGCCNONE 
J013028H01GGAGTGGGCCTGAAACGGGCCNONE 
J013061L19GGAGTGGGCCTGAAACGGGCCNONE 
J033044L03GGAGTGGGCCTGAAACGGGCCNONE 
J033064P09GGAGTGGGCCTGAAACGGGCCNONE 
J033076A10GGAGTGGGCCTGAAACGGGCCNONE 
J033076K22GGAGTGGGCCTGAAACGGGCCNONE 
J033084J05GGAGTGGGCCTGAAACGGGCCNONE 
J033145A22GGAGTGGGCCTGAAACGGGCCNONE 
J033148L19GGAGTGGGCCTGAAACGGGCCNONE 
J065027P20GGAGTGGGCCTGAAACGGGCCNONE 
J065085D16GGAGTGGGCCTGAAACGGGCCNONE 
J065091L03GGAGTGGGCCTGAAACGGGCCNONE 
J065195C18GGAGTGGGCCTGAAACGGGCCNONE 
J090018N23GGAGTGGGCCTGAAACGGGCCNONE 
J090048A10GGAGTGGGCCTGAAACGGGCCNONE 
J090048M03GGAGTGGGCCTGAAACGGGCCNONE 
J090066L11GGAGTGGGCCTGAAACGGGCCNONE 
J090075G16GGAGTGGGCCTGAAACGGGCCNONE 
J090083G23GGAGTGGGCCTGAAACGGGCCNONE 
J090087E24GGAGTGGGCCTGAAACGGGCCNONE 
J090096H16GGAGTGGGCCTGAAACGGGCCNONE 
Os11g0181900011-064-E11AGTGGGCCTGGNONE 
016-031-C07AGTGGGCCTGGNONE 
AK063374AGTGGGCCTGGPrefoldin domain containing protein. 
J065083K20AGTGGGCCTGGNONE 
Os11g0184900011-088-C07TGCGGCCCAGGCCCACGCNONE 
015-036-B03TGCGGCCCAGGCCCACGCNONE 
016-087-F07TGCGGCCCAGGCCCACGCNONE 
AB028184TGCGGCCCAGGCCCACGCNONE 
AK063399TGCGGCCCAGGCCCACGCSimilar to NAC-domain protein 5-7. 
AK064292TGCGGCCCAGGCCCACGCNONE 
AK102475TGCGGCCCAGGCCCACGCNONE 
J033094I01TGCGGCCCAGGCCCACGCNONE 
J090087J16TGCGGCCCAGGCCCACGCNONE 
Os11g0209100016-063-F03ATGGCCCACGCTTGTGGGCCTGNONE 
AK064391ATGGCCCACGCTTGTGGGCCTGCyclin-like F-box domain containing protein. 
J075027K02ATGGCCCACGCTTGTGGGCCTGNONE 
J075154K15ATGGCCCACGCTTGTGGGCCTGNONE 
Os11g0216400Os11g0216400GAGGCCCACCTProteinase inhibitor, propeptide domain containing protein. 
Os11g0216900AK060326CTCGCGCGCGTGGGCCTTGSimilar to IDI2. 
AK060326GGTGGGCCTASimilar to IDI2. 
AK060549CTCGCGCGCGTGGGCCTTGNONE 
AK060549GGTGGGCCTANONE 
AK100869CTCGCGCGCGTGGGCCTTGNONE 
AK100869GGTGGGCCTANONE 
Os11g0602600006-046-H02TGTGGGCCTANONE 
006-056-H08TGTGGGCCTANONE 
009-116-D05TGTGGGCCTANONE 
AK072671TGTGGGCCTASimilar to 40S ribosomal protein S9. 
AK104660TGTGGGCCTANONE 
J023134P20TGTGGGCCTANONE 
J023141O13TGTGGGCCTANONE 
J033066I15TGTGGGCCTANONE 
J033076A08TGTGGGCCTANONE 
J033150J23TGTGGGCCTANONE 
J065114P19TGTGGGCCTANONE 
J065176B01TGTGGGCCTANONE 
J065207H21TGTGGGCCTANONE 
J080301L21TGTGGGCCTANONE 
J080308A08TGTGGGCCTANONE 
J080318K23TGTGGGCCTANONE 
J080319F17TGTGGGCCTANONE 
J080319I10TGTGGGCCTANONE 
J090028C08TGTGGGCCTANONE 
J090051I24TGTGGGCCTANONE 
J090053L21TGTGGGCCTANONE 
J090069C20TGTGGGCCTANONE 
J100017G08TGTGGGCCTANONE 
J100042B06TGTGGGCCTANONE 
J100045G24TGTGGGCCTANONE 
J100050J19TGTGGGCCTANONE 
J100052D23TGTGGGCCTANONE 
J100053M03TGTGGGCCTANONE 
J100056D08TGTGGGCCTANONE 
J100066B19TGTGGGCCTANONE 
J100071N23TGTGGGCCTANONE 
J100074H01TGTGGGCCTANONE 
J100074H19TGTGGGCCTANONE 
J100077C06TGTGGGCCTANONE 
Os11g0704700AK102518TGGTGGGCCTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023012E06TGGTGGGCCTCNONE 
J023022M10TGGTGGGCCTCNONE 
J023086E15TGGTGGGCCTCNONE 
J033022B08TGGTGGGCCTCNONE 
J033091K11TGGTGGGCCTCNONE 
J033095N01TGGTGGGCCTCNONE 
J090020H24TGGTGGGCCTCNONE 
Os12g0115900AK058318TGTGGGCCTTElongation factor P/YeiP family protein. 
J065078K17TGTGGGCCTTNONE 
J065102G03TGTGGGCCTTNONE 
J065122B14TGTGGGCCTTNONE 
J065122C10TGTGGGCCTTNONE 
J065134I23TGTGGGCCTTNONE 
J065176B12TGTGGGCCTTNONE 
Os12g0131300J090086B06TCGTGGGCCTCHypothetical protein. 
Os12g0133600AK103096TTGTGGGCCTTGConserved hypothetical protein. 
J033118M03TTGTGGGCCTTGNONE 
Os12g0190100AK109819CAAGGCCCACCASimilar to Auxin-independent growth promoter-like protein. 
Os12g0242500J065129F10AGTGACACGTGGGCCTCNONE 
J090032G12AGTGACACGTGGGCCTCConserved hypothetical protein. 
Os12g0403800AK059940ACGTGGGCCTCACGTGGGNONE 
AK064189ACGTGGGCCTCACGTGGGExoribonuclease domain containing protein. 
Os12g0507600009-155-B05AGTGGGCCTANONE 
AK070613AGTGGGCCTAConserved hypothetical protein. 
J023063G03AGTGGGCCTANONE 
Os12g0572400016-084-F04AAAGCCCATAAGGCCCACCCNONE 
AK065531AAAGCCCATAAGGCCCACCCSimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03AAAGCCCATAAGGCCCACCCNONE 
J013034H02AAAGCCCATAAGGCCCACCCNONE 
J033117N05AAAGCCCATAAGGCCCACCCNONE 
J065027L09AAAGCCCATAAGGCCCACCCNONE 
J065037D09AAAGCCCATAAGGCCCACCCNONE 
J065197I09AAAGCCCATAAGGCCCACCCNONE 
J090045C01AAAGCCCATAAGGCCCACCCNONE 
J100031E11AAAGCCCATAAGGCCCACCCNONE 
Os12g0597500AK101904CAGGTGGGCCTCNONE 
AK103799CAGGTGGGCCTCAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CAGGTGGGCCTCNONE 
J100078O15CAGGTGGGCCTCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.