version

Summary of OsREG473 (All List)

OrganismOryza sativa  
IDOsREG473  
SequenceAGGCCCAG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1588  

Entry Sequences (1588 entries)

LocusGene modelSequenceDescription
Os01g0101600AK099952CCTGGGCCTGGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK122118CCTGGGCCTGGNONE 
J013123J12CCTGGGCCTGGNONE 
J033026O19CCTGGGCCTGGNONE 
J033128C08CCTGGGCCTGGNONE 
J065116M14CCTGGGCCTGGNONE 
J090058F15CCTGGGCCTGGNONE 
J090079F20CCTGGGCCTGGNONE 
Os01g0157900AK072658CTTGGGCTGGGCCGGCTGGGCCTTProtein of unknown function Cys-rich family protein. 
Os01g0172000012-070-G06GCTGGGCCTGNONE 
AK068405GCTGGGCCTGALG3 family protein. 
J013149A07GCTGGGCCTGNONE 
J053047H05GCTGGGCCTGNONE 
J065075N03GCTGGGCCTGNONE 
J065093G22GCTGGGCCTGNONE 
J065130N21GCTGGGCCTGNONE 
J065143P05GCTGGGCCTGNONE 
J065216H07GCTGGGCCTGNONE 
J075013B06GCTGGGCCTGNONE 
J075196M05GCTGGGCCTGNONE 
J100039G24GCTGGGCCTGNONE 
J100041B11GCTGGGCCTGNONE 
J100069A16GCTGGGCCTGNONE 
J100069L12GCTGGGCCTGNONE 
J100074P16GCTGGGCCTGNONE 
Os01g0201000J080015E02TCTGGGCCTCHypothetical protein. 
Os01g0231700012-002-F11GCCGGCCCAAGTAGGCCCAGCNONE 
013-082-F05GCCGGCCCAAGTAGGCCCAGCNONE 
AK107453GCCGGCCCAAGTAGGCCCAGCSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22GCCGGCCCAAGTAGGCCCAGCNONE 
J065023E21GCCGGCCCAAGTAGGCCCAGCNONE 
J065036H21GCCGGCCCAAGTAGGCCCAGCNONE 
J065037M24GCCGGCCCAAGTAGGCCCAGCNONE 
J065049L04GCCGGCCCAAGTAGGCCCAGCNONE 
J065072F17GCCGGCCCAAGTAGGCCCAGCNONE 
J065085H10GCCGGCCCAAGTAGGCCCAGCNONE 
J065109N19GCCGGCCCAAGTAGGCCCAGCNONE 
J065117M19GCCGGCCCAAGTAGGCCCAGCNONE 
J065144C15GCCGGCCCAAGTAGGCCCAGCNONE 
J065159G24GCCGGCCCAAGTAGGCCCAGCNONE 
J065164N14GCCGGCCCAAGTAGGCCCAGCNONE 
J075025K16GCCGGCCCAAGTAGGCCCAGCNONE 
J075057L05GCCGGCCCAAGTAGGCCCAGCNONE 
J075070I16GCCGGCCCAAGTAGGCCCAGCNONE 
J075089D10GCCGGCCCAAGTAGGCCCAGCNONE 
J075138F10GCCGGCCCAAGTAGGCCCAGCNONE 
J090018C11GCCGGCCCAAGTAGGCCCAGCNONE 
J100018L19GCCGGCCCAAGTAGGCCCAGCNONE 
J100024B14GCCGGCCCAAGTAGGCCCAGCNONE 
J100048L02GCCGGCCCAAGTAGGCCCAGCNONE 
J100055A22GCCGGCCCAAGTAGGCCCAGCNONE 
J100069K01GCCGGCCCAAGTAGGCCCAGCNONE 
Os01g0276500006-030-E04GGCTGGGCCTGANONE 
AK061002GGCTGGGCCTGASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)]. 
AK099335GGCTGGGCCTGANONE 
Os01g0530300AK111105AAGGCCCAGCCCATACHypothetical protein. 
J090023M11AAGGCCCAGCCCATACNONE 
J090053G13AAGGCCCAGCCCATACNONE 
Os01g0560200AK102003TCAGGCCCAGGSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
J033079N06TCAGGCCCAGGNONE 
J065092F14TCAGGCCCAGGNONE 
J065106D04TCAGGCCCAGGNONE 
J065194K23TCAGGCCCAGGNONE 
Os01g0585400AK103584AGGGCCCATAGGCCCAGAConserved hypothetical protein. 
J033133B01AGGGCCCATAGGCCCAGANONE 
Os01g0660100AK108487AACTGGGCCTTConserved hypothetical protein. 
Os01g0662600009-056-E10AAGGCCCAGTNONE 
009-056-E10GAGGCCCAGTANONE 
AK062234AAGGCCCAGTNONE 
AK062234GAGGCCCAGTANONE 
AK098887AAGGCCCAGTNONE 
AK098887GAGGCCCAGTANONE 
AK099656AAGGCCCAGTNONE 
AK099656GAGGCCCAGTANONE 
AK119723AAGGCCCAGTSimilar to NifU-like protein. 
AK119723GAGGCCCAGTASimilar to NifU-like protein. 
J013001K01AAGGCCCAGTNONE 
J013001K01GAGGCCCAGTANONE 
J013090F20AAGGCCCAGTNONE 
J013090F20GAGGCCCAGTANONE 
J013119A14AAGGCCCAGTNONE 
J013119A14GAGGCCCAGTANONE 
J013121P12AAGGCCCAGTNONE 
J013121P12GAGGCCCAGTANONE 
J033132I15AAGGCCCAGTNONE 
J033132I15GAGGCCCAGTANONE 
J075023F22AAGGCCCAGTNONE 
J075023F22GAGGCCCAGTANONE 
J075023M13AAGGCCCAGTNONE 
J075023M13GAGGCCCAGTANONE 
J100024D10AAGGCCCAGTNONE 
J100024D10GAGGCCCAGTANONE 
J100024N01AAGGCCCAGTNONE 
J100024N01GAGGCCCAGTANONE 
J100026H09AAGGCCCAGTNONE 
J100026H09GAGGCCCAGTANONE 
J100027H07AAGGCCCAGTNONE 
J100027H07GAGGCCCAGTANONE 
J100045K07AAGGCCCAGTNONE 
J100045K07GAGGCCCAGTANONE 
J100057K18AAGGCCCAGTNONE 
J100057K18GAGGCCCAGTANONE 
J100085C22AAGGCCCAGTNONE 
J100085C22GAGGCCCAGTANONE 
Os01g0709000Os01g0709000TCAGGCCCAGCSimilar to Transcription factor MYB1. 
Os01g0748100AK071261GTGGCCCAAGCTGGGCCTAHypothetical protein. 
J023084C08GTGGCCCAAGCTGGGCCTANONE 
J065058A07GTGGCCCAAGCTGGGCCTANONE 
Os01g0773200015-072-C12CCAGGCCCAAATAGGCCCAGTNONE 
Os01g0794900AK106644GAGGCCCAGGConserved hypothetical protein. 
Os01g0833200AK121629ACTGGGCCTGGConserved hypothetical protein. 
J023093N07ACTGGGCCTGGNONE 
J033050C20ACTGGGCCTGGNONE 
J080302F22ACTGGGCCTGGNONE 
J080303H06ACTGGGCCTGGNONE 
J080306J04ACTGGGCCTGGNONE 
J080309K06ACTGGGCCTGGNONE 
J080311E18ACTGGGCCTGGNONE 
J080318A20ACTGGGCCTGGNONE 
J100031F20ACTGGGCCTGGNONE 
J100034P21ACTGGGCCTGGNONE 
J100042K08ACTGGGCCTGGNONE 
J100047H24ACTGGGCCTGGNONE 
J100065C14ACTGGGCCTGGNONE 
J100074E23ACTGGGCCTGGNONE 
Os01g0834700AK101559GAGGCCCAGCCZinc finger, CCCH-type domain containing protein. 
AK106074GAGGCCCAGCCNONE 
Os01g0839700006-051-C07TCTGGGCCTGNONE 
006-068-C11TCTGGGCCTGNONE 
006-110-B10TCTGGGCCTGNONE 
006-116-G06TCTGGGCCTGNONE 
009-105-F07TCTGGGCCTGNONE 
AK099038TCTGGGCCTGNONE 
AK104148TCTGGGCCTGNONE 
AK112030TCTGGGCCTGSimilar to Ubiquitin carrier protein. 
J013042A08TCTGGGCCTGNONE 
J013135H01TCTGGGCCTGNONE 
J033058E09TCTGGGCCTGNONE 
J043020K17TCTGGGCCTGNONE 
J065034F06TCTGGGCCTGNONE 
J065057B21TCTGGGCCTGNONE 
J065075F07TCTGGGCCTGNONE 
J065076D08TCTGGGCCTGNONE 
J065084E10TCTGGGCCTGNONE 
J065109L12TCTGGGCCTGNONE 
J065114J04TCTGGGCCTGNONE 
J065159L23TCTGGGCCTGNONE 
J075009L02TCTGGGCCTGNONE 
J075178P14TCTGGGCCTGNONE 
J075197L07TCTGGGCCTGNONE 
J090060O04TCTGGGCCTGNONE 
J100076I20TCTGGGCCTGNONE 
Os01g0848200AK069425GGCTGGGCCTGSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AK101230GGCTGGGCCTGNONE 
Os01g0870100AK067564GTTGGGCCCACCTGGGCCTGGProtein of unknown function DUF1012 family protein. 
AK072312GTTGGGCCCACCTGGGCCTGGNONE 
AK103428GTTGGGCCCACCTGGGCCTGGNONE 
Os01g0885200AK059113TCTGGGCCTCNONE 
Os01g0887700AF045571TCTGGGCCTTGGGCCTTNONE 
AF047428TCTGGGCCTTGGGCCTTNONE 
AK071139TCTGGGCCTTGGGCCTTZinc finger, FYVE/PHD-type domain containing protein. 
J023082D05TCTGGGCCTTGGGCCTTNONE 
J065062L19TCTGGGCCTTGGGCCTTNONE 
J065116H15TCTGGGCCTTGGGCCTTNONE 
J065194N09TCTGGGCCTTGGGCCTTNONE 
J100074C19TCTGGGCCTTGGGCCTTNONE 
Os01g0894700009-177-F04AAGGCCCAGCCNONE 
009-177-F04GAGGCCCAGCNONE 
AK067623AAGGCCCAGCCConserved hypothetical protein. 
AK067623GAGGCCCAGCConserved hypothetical protein. 
AK104876AAGGCCCAGCCNONE 
AK104876GAGGCCCAGCNONE 
J013095G01AAGGCCCAGCCNONE 
J013095G01GAGGCCCAGCNONE 
J013108L20AAGGCCCAGCCNONE 
J013108L20GAGGCCCAGCNONE 
J013120P13AAGGCCCAGCCNONE 
J013120P13GAGGCCCAGCNONE 
Os01g0916300011-018-B12TACTGGGCCTTNONE 
AK063922TACTGGGCCTTSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
AK103107TACTGGGCCTTNONE 
AK121061TACTGGGCCTTNONE 
AK121997TACTGGGCCTTNONE 
J033118P14TACTGGGCCTTNONE 
J065002N16TACTGGGCCTTNONE 
J065079B04TACTGGGCCTTNONE 
J065102J07TACTGGGCCTTNONE 
J065128F16TACTGGGCCTTNONE 
J065184D11TACTGGGCCTTNONE 
J065186A07TACTGGGCCTTNONE 
J075115C07TACTGGGCCTTNONE 
J075147C04TACTGGGCCTTNONE 
Os01g0918200009-034-H02GAGGCCCAGGNONE 
AK062434GAGGCCCAGGSimilar to Ubiquitin-like protein SMT3. 
AK103092GAGGCCCAGGNONE 
J065093P18GAGGCCCAGGNONE 
J065137C15GAGGCCCAGGNONE 
J065156G01GAGGCCCAGGNONE 
J065206H16GAGGCCCAGGNONE 
J065209D03GAGGCCCAGGNONE 
J075073K05GAGGCCCAGGNONE 
J075099B17GAGGCCCAGGNONE 
J075166N04GAGGCCCAGGNONE 
Os01g0920200AK120182TCAGGCCCAGTASimilar to E(Y)2 homolog (DC6) (Enhancer of yellow 2 homolog). 
J013034A14TCAGGCCCAGTANONE 
J013063O14TCAGGCCCAGTANONE 
J023023D20TCAGGCCCAGTANONE 
J075121J02TCAGGCCCAGTANONE 
Os01g0939700AK059803CAAGGCCCAGGNONE 
AK070588CAAGGCCCAGGSimilar to Esterase D (EC 3.1.1.1). 
AK111469CAAGGCCCAGGNONE 
J090021L11CAAGGCCCAGGNONE 
Os01g0948100AK111411CAAGGCCCAGATERCC4 domain containing protein. 
J090089O16CAAGGCCCAGATNONE 
Os01g0951800AK069239TCAGGCCCAGCCCProtein prenyltransferase domain containing protein. 
Os01g0952600AK067525AAGGCCCAGANONE 
AK070047AAGGCCCAGASimilar to LacZ (Fragment). 
Os01g0959900AK058375GCTGGGCCTGAConserved hypothetical protein. 
AK058375TCAGGCCCAGTConserved hypothetical protein. 
AK066497GCTGGGCCTGANONE 
AK066497TCAGGCCCAGTNONE 
Os01g0960800AK073977TAGGCCCAGTAProtein Transporter, Pam16 family protein. 
AY313247TAGGCCCAGTANONE 
J033075P16TAGGCCCAGTANONE 
J065051H06TAGGCCCAGTANONE 
J065167L02TAGGCCCAGTANONE 
J090083C22TAGGCCCAGTANONE 
Os01g0962600009-104-A04GAGGCCCAGANONE 
AK073846GAGGCCCAGASimilar to 40S ribosomal protein S10-1. 
J033070I05GAGGCCCAGANONE 
J065079N18GAGGCCCAGANONE 
J065122H12GAGGCCCAGANONE 
J065197O14GAGGCCCAGANONE 
Os01g0966200009-079-H11GAGGCCCAGTANONE 
009-124-G10GAGGCCCAGTANONE 
AK058564GAGGCCCAGTAProtein of unknown function YGGT family protein. 
AK098935GAGGCCCAGTANONE 
Os01g0970900011-018-A07GAGGCCCAGCCCATCTNONE 
011-022-E12GAGGCCCAGCCCATCTNONE 
AK063285GAGGCCCAGCCCATCTNONE 
AK101688GAGGCCCAGCCCATCTProtein prenyltransferase domain containing protein. 
J100042L01GAGGCCCAGCCCATCTNONE 
J100053B11GAGGCCCAGCCCATCTNONE 
Os01g0976800J065105P05GAGGCCCAGCZinc finger, GATA-type domain containing protein. 
J065189M03GAGGCCCAGCNONE 
Os02g0176400009-099-H11TAGGCCCAGCNONE 
AK062746TAGGCCCAGCProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0188500AK102004AGCCCATACAACTGGGCCTCGGCCCATCANONE 
AK106917AGCCCATACAACTGGGCCTCGGCCCATCAUbiquitin domain containing protein. 
J090039N13AGCCCATACAACTGGGCCTCGGCCCATCANONE 
Os02g0202600AK068376GCTGGGCCTANONE 
AK099277GCTGGGCCTANONE 
AK101844GCTGGGCCTATetratricopeptide-like helical domain containing protein. 
J080001G13GCTGGGCCTANONE 
J080011J23GCTGGGCCTANONE 
J080015F12GCTGGGCCTANONE 
J080017J03GCTGGGCCTANONE 
J080030J24GCTGGGCCTANONE 
J080038H02GCTGGGCCTANONE 
J080041G13GCTGGGCCTANONE 
J080044B13GCTGGGCCTANONE 
J080044L10GCTGGGCCTANONE 
J080046H11GCTGGGCCTANONE 
J080057J01GCTGGGCCTANONE 
J080062E13GCTGGGCCTANONE 
J080062N11GCTGGGCCTANONE 
J080063C17GCTGGGCCTANONE 
J080064K11GCTGGGCCTANONE 
J080064N09GCTGGGCCTANONE 
J080067C17GCTGGGCCTANONE 
J080067C23GCTGGGCCTANONE 
J080069J21GCTGGGCCTANONE 
J080070L23GCTGGGCCTANONE 
J080085N15GCTGGGCCTANONE 
J080094F03GCTGGGCCTANONE 
Os02g0220600AK103901GAGGCCCAGANONE 
J013058O03GAGGCCCAGANONE 
J013124E21GAGGCCCAGANONE 
J023023L03GAGGCCCAGANONE 
J023023L21GAGGCCCAGANONE 
J023061N01GAGGCCCAGANONE 
J023065O09GAGGCCCAGANONE 
J023106J17GAGGCCCAGANONE 
J023119N08GAGGCCCAGANONE 
J033058A19GAGGCCCAGANONE 
J033098O13GAGGCCCAGANONE 
J033100M18GAGGCCCAGANONE 
J033125A21GAGGCCCAGANONE 
J033148C12GAGGCCCAGANONE 
J043017F03GAGGCCCAGANONE 
J043032J02GAGGCCCAGANONE 
J053047N10GAGGCCCAGANONE 
J053089P04GAGGCCCAGANONE 
J065051K09GAGGCCCAGANONE 
J065064H24GAGGCCCAGANONE 
J090001L06GAGGCCCAGANONE 
J090017C24GAGGCCCAGANONE 
J090058G15GAGGCCCAGANONE 
J090058H23GAGGCCCAGANONE 
J090061G20GAGGCCCAGANONE 
J090069N23GAGGCCCAGANONE 
J090071A08GAGGCCCAGANONE 
J090074A08GAGGCCCAGANONE 
J090077B15GAGGCCCAGANONE 
J090081K06GAGGCCCAGANONE 
J090083I05GAGGCCCAGANONE 
J090091O22GAGGCCCAGANONE 
J090097L10GAGGCCCAGANONE 
J100026B11GAGGCCCAGANONE 
J100044M01GAGGCCCAGANONE 
J100046F10GAGGCCCAGANONE 
J100051K14GAGGCCCAGANONE 
J100060D22GAGGCCCAGANONE 
J100060H18GAGGCCCAGANONE 
J100070I06GAGGCCCAGANONE 
J100071C04GAGGCCCAGANONE 
J100078M13GAGGCCCAGANONE 
J100080E17GAGGCCCAGANONE 
J100083I09GAGGCCCAGANONE 
Os02g0478700AK099723AAGGCCCAGATRibosomal protein S27. 
AK099723AAGGCCCAGCCCACGGGRibosomal protein S27. 
J013089A06AAGGCCCAGATNONE 
J013089A06AAGGCCCAGCCCACGGGNONE 
J065068E01AAGGCCCAGATNONE 
J065068E01AAGGCCCAGCCCACGGGNONE 
J065217F15AAGGCCCAGATNONE 
J065217F15AAGGCCCAGCCCACGGGNONE 
Os02g0499300AK106994CCTGGGCCTAConserved hypothetical protein. 
Os02g0501350J090074D10CCAGCCCAAGGCCCAGCNONE 
J090080M08CCAGCCCAAGGCCCAGCNONE 
J090083F07CCAGCCCAAGGCCCAGCConserved hypothetical protein. 
Os02g0520800AK102815AGCCCAAGGCCCAGCSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
AK102815TACTGGGCCTGGGCCAGSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09AGCCCAAGGCCCAGCNONE 
J033108M09TACTGGGCCTGGGCCAGNONE 
J100038E09AGCCCAAGGCCCAGCNONE 
J100038E09TACTGGGCCTGGGCCAGNONE 
J100076G11AGCCCAAGGCCCAGCNONE 
J100076G11TACTGGGCCTGGGCCAGNONE 
Os02g0530600012-040-G06TCTGGGCCTGNONE 
AK105277TCTGGGCCTGNONE 
J075004K11TCTGGGCCTGNONE 
J075024O04TCTGGGCCTGNONE 
J075031K02TCTGGGCCTGNONE 
J075067K01TCTGGGCCTGNONE 
J075087G22TCTGGGCCTGNONE 
J075097A07TCTGGGCCTGNONE 
J075109O12TCTGGGCCTGNONE 
J075110K07TCTGGGCCTGNONE 
J075117C17TCTGGGCCTGNONE 
J075143O07TCTGGGCCTGNONE 
J075146F13TCTGGGCCTGNONE 
J075166I18TCTGGGCCTGNONE 
J075176N09TCTGGGCCTGNONE 
J075182F16TCTGGGCCTGNONE 
Os02g0533800009-149-F12TAGGCCCAGANONE 
013-058-H02TAGGCCCAGANONE 
014-017-G07TAGGCCCAGANONE 
014-028-F04TAGGCCCAGANONE 
014-050-G04TAGGCCCAGANONE 
014-095-F04TAGGCCCAGANONE 
014-099-C08TAGGCCCAGANONE 
016-046-F05TAGGCCCAGANONE 
AK121139TAGGCCCAGAConserved hypothetical protein. 
J013104A14TAGGCCCAGANONE 
J023077F13TAGGCCCAGANONE 
J023145I11TAGGCCCAGANONE 
J065033D14TAGGCCCAGANONE 
J065079I15TAGGCCCAGANONE 
J065104E21TAGGCCCAGANONE 
J065128E06TAGGCCCAGANONE 
J065174F07TAGGCCCAGANONE 
J065195B12TAGGCCCAGANONE 
J065207B12TAGGCCCAGANONE 
J080304M24TAGGCCCAGANONE 
J090040A13TAGGCCCAGANONE 
J090054B18TAGGCCCAGANONE 
J100037A06TAGGCCCAGANONE 
J100042F24TAGGCCCAGANONE 
J100043N23TAGGCCCAGANONE 
J100044H14TAGGCCCAGANONE 
J100056K24TAGGCCCAGANONE 
J100063O22TAGGCCCAGANONE 
J100071G05TAGGCCCAGANONE 
J100078G15TAGGCCCAGANONE 
Os02g0533900AB062681TCTGGGCCTANONE 
AK061722TCTGGGCCTANONE 
AK106147TCTGGGCCTANONE 
AK121892TCTGGGCCTASimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0537700006-053-C10GAGGCCCAGANONE 
006-055-F06GAGGCCCAGANONE 
006-059-E11GAGGCCCAGANONE 
006-088-G01GAGGCCCAGANONE 
006-088-G12GAGGCCCAGANONE 
009-094-G12GAGGCCCAGANONE 
009-181-C07GAGGCCCAGANONE 
AK068919GAGGCCCAGASimilar to 2-cys peroxiredoxin BAS1, chloroplast precursor (EC 1.11.1.15) (Thiol- specific antioxidant protein) (Fragment). 
AK104703GAGGCCCAGANONE 
J013070I22GAGGCCCAGANONE 
J013169M13GAGGCCCAGANONE 
J013170F14GAGGCCCAGANONE 
J023010P12GAGGCCCAGANONE 
J023095B04GAGGCCCAGANONE 
J090043L04GAGGCCCAGANONE 
Os02g0542500AK109859AAGGCCCAGGConserved hypothetical protein. 
Os02g0595700006-057-E01CCTGGGCCTCNONE 
006-082-F10CCTGGGCCTCNONE 
006-087-C10CCTGGGCCTCNONE 
006-091-H03CCTGGGCCTCNONE 
006-094-A11CCTGGGCCTCNONE 
AF145053CCTGGGCCTCNONE 
AK064937CCTGGGCCTCNONE 
AK066858CCTGGGCCTCNONE 
AK104785CCTGGGCCTCNONE 
AK119587CCTGGGCCTCChloroplast translational elongation factor Tu. 
J013000P03CCTGGGCCTCNONE 
Os02g0622400005-010-C04TACTGGGCCTCNONE 
AK061679TACTGGGCCTCConserved hypothetical protein. 
J013058H01TACTGGGCCTCNONE 
J013095D07TACTGGGCCTCNONE 
J023054G05TACTGGGCCTCNONE 
J023093A17TACTGGGCCTCNONE 
J023146P16TACTGGGCCTCNONE 
J033089D16TACTGGGCCTCNONE 
J033099G12TACTGGGCCTCNONE 
J033131N10TACTGGGCCTCNONE 
J053073J04TACTGGGCCTCNONE 
J053074P03TACTGGGCCTCNONE 
J053075M06TACTGGGCCTCNONE 
J053088K13TACTGGGCCTCNONE 
J090039F18TACTGGGCCTCNONE 
J090045M03TACTGGGCCTCNONE 
Os02g0633200012-053-F09TAGGCCCAGTANONE 
015-051-C09TAGGCCCAGTANONE 
AK063500TAGGCCCAGTAProtein prenyltransferase domain containing protein. 
J065019K23TAGGCCCAGTANONE 
J065205C16TAGGCCCAGTANONE 
Os02g0637900AK110708CAGGCCCAGCCConserved hypothetical protein. 
J065038O03CAGGCCCAGCCNONE 
J065052A19CAGGCCCAGCCNONE 
J065052A20CAGGCCCAGCCNONE 
J065063D06CAGGCCCAGCCNONE 
J065069D12CAGGCCCAGCCNONE 
J065074H07CAGGCCCAGCCNONE 
J065174K17CAGGCCCAGCCNONE 
J065215M12CAGGCCCAGCCNONE 
J075007E12CAGGCCCAGCCNONE 
J075057K20CAGGCCCAGCCNONE 
J075119I10CAGGCCCAGCCNONE 
Os02g0673600009-071-C12AAGGCCCAGTANONE 
J023037G24AAGGCCCAGTANONE 
J023038E07AAGGCCCAGTAORMDL family protein. 
J023142L24AAGGCCCAGTANONE 
J033115B14AAGGCCCAGTANONE 
J075004B15AAGGCCCAGTANONE 
J075067J21AAGGCCCAGTANONE 
J075072K07AAGGCCCAGTANONE 
J075147H21AAGGCCCAGTANONE 
J075154F03AAGGCCCAGTANONE 
Os02g0677300006-102-D12GAGGCCCAGAGCGGCCCACTNONE 
AK060550GAGGCCCAGAGCGGCCCACTNONE 
AK106041GAGGCCCAGAGCGGCCCACTSimilar to CRT/DRE binding factor 1. 
Os02g0679200AK110789AGATGGGCCTCTGGGCCTCTetratricopeptide-like helical domain containing protein. 
Os02g0717800009-009-B02TAGGCCCAGTANONE 
J065185P06TAGGCCCAGTANONE 
J100061J04TAGGCCCAGTANONE 
J100064M21TAGGCCCAGTANONE 
Os02g0740300AK067833TCTGGGCCTGAAA ATPase domain containing protein. 
Os02g0767100011-054-E05TCTGGGCCTANONE 
AK063351TCTGGGCCTANONE 
AK103640TCTGGGCCTAConserved hypothetical protein. 
J090022G11TCTGGGCCTANONE 
J090072L18TCTGGGCCTANONE 
Os02g0775200AB038319AAGGCCCAGTTNONE 
AK069984AAGGCCCAGTTSimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAGGCCCAGTTNONE 
Os02g0783700AK064521AAGGCCCAGANONE 
AK120371AAGGCCCAGASimilar to Lysine-ketoglutarate reductase/saccharopine dehydrogenase bifunctional enzyme. 
J013070J19AAGGCCCAGANONE 
J033095H21AAGGCCCAGANONE 
J065038I07AAGGCCCAGANONE 
J065044C13AAGGCCCAGANONE 
J065060L11AAGGCCCAGANONE 
J065082G20AAGGCCCAGANONE 
J065146N24AAGGCCCAGANONE 
J065147B10AAGGCCCAGANONE 
J065181L07AAGGCCCAGANONE 
J065202K06AAGGCCCAGANONE 
J065219J12AAGGCCCAGANONE 
J075107D03AAGGCCCAGANONE 
J090020F02AAGGCCCAGANONE 
Os02g0796900009-121-E06TAGGCCCAGTNONE 
D29725TAGGCCCAGTSimilar to 60S ribosomal protein L39. 
J075016N24TAGGCCCAGTNONE 
J075085F03TAGGCCCAGTNONE 
J075147P11TAGGCCCAGTNONE 
J075180E16TAGGCCCAGTNONE 
J075182A19TAGGCCCAGTNONE 
Os02g0800000J100043O08GCTGGGCCTTGGGCCTTGGGCTNONE 
J100064O18GCTGGGCCTTGGGCCTTGGGCTNONE 
Os02g0810300AK059363TCGGCCCAAGGCCCAGTASimilar to NBD-like protein. 
AK099203TCGGCCCAAGGCCCAGTANONE 
Os02g0823000AK122065TAGGCCCAGGPeptidase A22B, minor histocompatibility antigen H13 family protein. 
Os02g0824400AK121390AACTGGGCCTTTGATGGGCTTTConserved hypothetical protein. 
J023128P21AACTGGGCCTTTGATGGGCTTTNONE 
J053097O16AACTGGGCCTTTGATGGGCTTTNONE 
J065012I02AACTGGGCCTTTGATGGGCTTTNONE 
J065049C06AACTGGGCCTTTGATGGGCTTTNONE 
J065051H02AACTGGGCCTTTGATGGGCTTTNONE 
J065069A13AACTGGGCCTTTGATGGGCTTTNONE 
J065082E04AACTGGGCCTTTGATGGGCTTTNONE 
J065102N09AACTGGGCCTTTGATGGGCTTTNONE 
J065157O10AACTGGGCCTTTGATGGGCTTTNONE 
J065188N23AACTGGGCCTTTGATGGGCTTTNONE 
J065190J11AACTGGGCCTTTGATGGGCTTTNONE 
J065202M09AACTGGGCCTTTGATGGGCTTTNONE 
Os02g0830700AK101172AAGGCCCAGTTLeucine rich repeat, N-terminal domain containing protein. 
Os03g0102200AK120183TAGGCCCAGTTSimilar to DNA-directed RNA polymerase II 14.5 kDa polypeptide (EC 2.7.7.6) (RPB9) (RPB14.5). 
J013034D10TAGGCCCAGTTNONE 
J065116C05TAGGCCCAGTTNONE 
J065120N21TAGGCCCAGTTNONE 
J090049D24TAGGCCCAGTTNONE 
Os03g0121300AK120047AAGGCCCAGGNONE 
Os03g0122200009-052-H10TAGGCCCAGGNONE 
AB042934TAGGCCCAGGNONE 
AK065033TAGGCCCAGGSimilar to 50S ribosomal protein L11. 
J013001H03TAGGCCCAGGNONE 
J023149C23TAGGCCCAGGNONE 
J065025J15TAGGCCCAGGNONE 
J065093D22TAGGCCCAGGNONE 
Os03g0126300AK061256GCTGGGCCTCNONE 
AK061961GCTGGGCCTCNONE 
AY346336GCTGGGCCTCSAM (and some other nucleotide) binding motif domain containing protein. 
J065023J17GCTGGGCCTCNONE 
J090023H12GCTGGGCCTCNONE 
Os03g0127000AK068479TAGGCCCAGCAAAGCCCACGTConserved hypothetical protein. 
J013152D10TAGGCCCAGCAAAGCCCACGTNONE 
J075167I20TAGGCCCAGCAAAGCCCACGTNONE 
J090067O04TAGGCCCAGCAAAGCCCACGTNONE 
Os03g0142900011-054-A05CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK067103CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK120438CCAGGCCCAGGCCCAGGCCCGGCCCProtein of unknown function DUF946, plant family protein. 
J013097D18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013098E18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013099I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013108C09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J023045J15CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033095F07CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033102N22CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065016C14CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065065F21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065159M09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075012C13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075017P18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075018M03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075021H19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075070K23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075077B18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075085E20CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075090N23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075137M16CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075151E03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090042L02CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090060C21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090089I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100024L19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100025A06CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100033C24CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100052J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100063H10CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100073P04CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100075D01CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100077J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
Os03g0152800AK066205GCTGGGCCTTGProtein kinase-like domain containing protein. 
AK100518GCTGGGCCTTGNONE 
Os03g0213800AK103114ATCTGGGCCTCMitochondrial substrate carrier family protein. 
Os03g0232500AK110980TCTGGGCCTAGTP-binding protein, HSR1-related domain containing protein. 
J100036C06TCTGGGCCTANONE 
Os03g0240500003-116-E06CAGGCCCAGCCCNONE 
AK058676CAGGCCCAGCCCSimilar to Toc34-2 protein. 
AK099032CAGGCCCAGCCCNONE 
J013128A13CAGGCCCAGCCCNONE 
J075064H17CAGGCCCAGCCCNONE 
J075075N03CAGGCCCAGCCCNONE 
J075079H24CAGGCCCAGCCCNONE 
J075127D23CAGGCCCAGCCCNONE 
J075132C09CAGGCCCAGCCCNONE 
J075159D02CAGGCCCAGCCCNONE 
J090053O11CAGGCCCAGCCCNONE 
J090062N04CAGGCCCAGCCCNONE 
Os03g0243700011-089-H03GCTGGGCCTTNONE 
AK059149GCTGGGCCTTGlycoside hydrolase, family 10 protein. 
J065048D08GCTGGGCCTTNONE 
J065075F03GCTGGGCCTTNONE 
J065093L06GCTGGGCCTTNONE 
J065120A17GCTGGGCCTTNONE 
J065131J21GCTGGGCCTTNONE 
J065140D06GCTGGGCCTTNONE 
J065155F01GCTGGGCCTTNONE 
J065157G07GCTGGGCCTTNONE 
J065157G24GCTGGGCCTTNONE 
J065165D02GCTGGGCCTTNONE 
J065179P03GCTGGGCCTTNONE 
J065179P04GCTGGGCCTTNONE 
J065183F18GCTGGGCCTTNONE 
J065185A02GCTGGGCCTTNONE 
J100018L10GCTGGGCCTTNONE 
Os03g0245800013-094-D06CACGGCCCACCAGGCCCAGANONE 
AB020973CACGGCCCACCAGGCCCAGANONE 
AK063618CACGGCCCACCAGGCCCAGANONE 
AK120045CACGGCCCACCAGGCCCAGANONE 
AK120048CACGGCCCACCAGGCCCAGASimilar to Heat shock protein 26. 
J075104O17CACGGCCCACCAGGCCCAGANONE 
Os03g0288900AK100329GAGGCCCAGATConserved hypothetical protein. 
J023080H15GAGGCCCAGATNONE 
J033136I21GAGGCCCAGATNONE 
J065036A16GAGGCCCAGATNONE 
J065186A16GAGGCCCAGATNONE 
J065187B08GAGGCCCAGATNONE 
J065202E24GAGGCCCAGATNONE 
Os03g0299900AK069075TAGGCCCAGCCCATGASimilar to Plastid aminotransferase (Fragment). 
AY338235TAGGCCCAGCCCATGANONE 
J053077F07TAGGCCCAGCCCATGANONE 
Os03g0308000016-023-H09AAGGCCCAGCCNONE 
AK100355AAGGCCCAGCCUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05AAGGCCCAGCCNONE 
J023043K04AAGGCCCAGCCNONE 
J023083I20AAGGCCCAGCCNONE 
J033068F22AAGGCCCAGCCNONE 
J033125P21AAGGCCCAGCCNONE 
J065207A22AAGGCCCAGCCNONE 
J100018D20AAGGCCCAGCCNONE 
J100026L17AAGGCCCAGCCNONE 
J100055D14AAGGCCCAGCCNONE 
J100060P03AAGGCCCAGCCNONE 
J100078A20AAGGCCCAGCCNONE 
Os03g0312600AK073391TAGGCCCAGGSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0333000AK109811AAGGCCCAGGCCCATTTConserved hypothetical protein. 
J065152D04AAGGCCCAGGCCCATTTNONE 
J090011B05AAGGCCCAGGCCCATTTNONE 
Os03g0333100AK101050AAATGGGCCTGGGCCTTProtein of unknown function DUF663 domain containing protein. 
Os03g0337100AK107981TAGGCCCAGCConserved hypothetical protein. 
Os03g0349000011-089-G05TAGGCCCAGGCCCATCTNONE 
AK099999TAGGCCCAGGCCCATCTNucleoporin interacting component family protein. 
J013134K18TAGGCCCAGGCCCATCTNONE 
J033024G23TAGGCCCAGGCCCATCTNONE 
J033098A12TAGGCCCAGGCCCATCTNONE 
J090001N18TAGGCCCAGGCCCATCTNONE 
J090058F11TAGGCCCAGGCCCATCTNONE 
J090065C04TAGGCCCAGGCCCATCTNONE 
J100067M17TAGGCCCAGGCCCATCTNONE 
J100083P13TAGGCCCAGGCCCATCTNONE 
Os03g0386000AK072984GGCTGGGCCTGGSimilar to WD domain protein-like. 
J065009K18GGCTGGGCCTGGNONE 
J065165P09GGCTGGGCCTGGNONE 
Os03g0438400AK070383AAGGCCCAGCCConserved hypothetical protein. 
J023054E02AAGGCCCAGCCNONE 
Os03g0566800AK103270CAAGGCCCAGTSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18CAAGGCCCAGTNONE 
J023136P06CAAGGCCCAGTNONE 
J033081A22CAAGGCCCAGTNONE 
J033109N12CAAGGCCCAGTNONE 
J033124H10CAAGGCCCAGTNONE 
J033141B09CAAGGCCCAGTNONE 
J090026G23CAAGGCCCAGTNONE 
J090077J20CAAGGCCCAGTNONE 
Os03g0580200AK107849GAGGCCCAGGLipolytic enzyme, G-D-S-L family protein. 
Os03g0587600Os03g0587600TAGGCCCAGTZinc finger, CCHC-type domain containing protein. 
Os03g0626250J075100A11ACTGGGCCTANONE 
J075134H15ACTGGGCCTANONE 
J075142J02ACTGGGCCTANONE 
J075181A14ACTGGGCCTANONE 
J075192K17ACTGGGCCTANONE 
J090046B06ACTGGGCCTANONE 
Os03g0668400AK119454AGCCCACGATGGCCCAGGCCCAGGCCCAGGProtein of unknown function DUF860, plant family protein. 
Os03g0681900006-042-F08ATCTGGGCCTTGNONE 
009-043-F12ATCTGGGCCTTGNONE 
AK061750ATCTGGGCCTTGNONE 
AK062094ATCTGGGCCTTGSimilar to RGP-3 (Fragment). 
J033034F01ATCTGGGCCTTGNONE 
J033131F11ATCTGGGCCTTGNONE 
J033143N03ATCTGGGCCTTGNONE 
Os03g0683700AK065067TAGGCCCAAAGGCCCAGGProtein of unknown function DUF810 family protein. 
Os03g0688200015-014-E12AAGGCCCAGGGTGGGTCCNONE 
AK103539AAGGCCCAGGGTGGGTCCConserved hypothetical protein. 
Os03g0704400AK101297AAGGCCCAGCProtein kinase domain containing protein. 
J033033I19AAGGCCCAGCNONE 
J090009M06AAGGCCCAGCNONE 
Os03g0712600015-008-G03CAGGCCCAGCCNONE 
015-008-G03TACTGGGCCTCNONE 
AK103705CAGGCCCAGCCHypothetical protein. 
AK103705TACTGGGCCTCHypothetical protein. 
J033136N14CAGGCCCAGCCNONE 
J033136N14TACTGGGCCTCNONE 
Os03g0736600AK060375ACTGGGCCTCTCCGCConserved hypothetical protein. 
Os03g0746600AK069559TACTGGGCCTAWD40-like domain containing protein. 
J023141K22TACTGGGCCTANONE 
Os03g0747700AK058795TCTGGGCCTCConserved hypothetical protein. 
Os03g0785500AK067718GAGGCCCAGATProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0800400AK071430CAGGCCCAGAProtein of unknown function DUF1618 domain containing protein. 
J023019H20CAGGCCCAGANONE 
J023097A10CAGGCCCAGANONE 
J023100K15CAGGCCCAGANONE 
J075095I09CAGGCCCAGANONE 
J090014B19CAGGCCCAGANONE 
J090072D02CAGGCCCAGANONE 
J100029E17CAGGCCCAGANONE 
J100047F04CAGGCCCAGANONE 
Os03g0807800AK064984TATTGGGCCGAAGAGGCCCAGCCCACTTGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065015J20TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065122L11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065217E10TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075023C02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075102O04TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080024G24TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080033F02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080047M13TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080048A22TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080056E06TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080064O11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
Os03g0829100AK072669TAGGCCCAGTASimilar to Soluble epoxide hydrolase. 
J013073C22TAGGCCCAGTANONE 
J033067O15TAGGCCCAGTANONE 
J065021D04TAGGCCCAGTANONE 
J065102E20TAGGCCCAGTANONE 
Os03g0831100AK103115TAGGCCCAGCCCATGGGCArmadillo-like helical domain containing protein. 
J033119F15TAGGCCCAGCCCATGGGCNONE 
J065011M19TAGGCCCAGCCCATGGGCNONE 
J075019I08TAGGCCCAGCCCATGGGCNONE 
J075047A01TAGGCCCAGCCCATGGGCNONE 
J075096P21TAGGCCCAGCCCATGGGCNONE 
J075121I05TAGGCCCAGCCCATGGGCNONE 
J075121I07TAGGCCCAGCCCATGGGCNONE 
J090063F13TAGGCCCAGCCCATGGGCNONE 
J090068F16TAGGCCCAGCCCATGGGCNONE 
J090094E14TAGGCCCAGCCCATGGGCNONE 
Os03g0850100AK101126TACTGGGCCTGNLI interacting factor domain containing protein. 
Os03g0851900AK102145AAGGCCCAGGCCCATCTAFG1-like ATPase family protein. 
J033086B08AAGGCCCAGGCCCATCTNONE 
Os03g0859550J065092L21CGTGGGGGCTCAGCTGGGCCTCConserved hypothetical protein. 
Os04g0107900013-017-E10CAAGGCCCAGCCCAAGNONE 
014-025-A02CAAGGCCCAGCCCAAGNONE 
014-100-C01CAAGGCCCAGCCCAAGNONE 
AK063568CAAGGCCCAGCCCAAGNONE 
AK063698CAAGGCCCAGCCCAAGNONE 
AK063751CAAGGCCCAGCCCAAGSimilar to Heat shock protein 80. 
J013118G22CAAGGCCCAGCCCAAGNONE 
J033131C17CAAGGCCCAGCCCAAGNONE 
J065036G05CAAGGCCCAGCCCAAGNONE 
J065106E24CAAGGCCCAGCCCAAGNONE 
J065171K16CAAGGCCCAGCCCAAGNONE 
J065213C11CAAGGCCCAGCCCAAGNONE 
J065218L17CAAGGCCCAGCCCAAGNONE 
Os04g0117800Os04g0117800GCAGCCCAGGCCCAGCCAmidase family protein. 
Os04g0170500AK103323GAGGCCCAGCHypothetical protein. 
Os04g0370600AK103855AATGGGCCAGGAGGCCCAGG4Fe-4S ferredoxin, iron-sulfur binding domain containing protein. 
J023115N20AATGGGCCAGGAGGCCCAGGNONE 
J033148N10AATGGGCCAGGAGGCCCAGGNONE 
J090031L24AATGGGCCAGGAGGCCCAGGNONE 
J090089F12AATGGGCCAGGAGGCCCAGGNONE 
Os04g0430100009-125-A01AACTGGGCCTGAAAAGCCCAGCCCNONE 
AK102190AACTGGGCCTGAAAAGCCCAGCCCSimilar to 40S ribosomal protein S10-1. 
J033087A06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J053032M06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065033D05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045D15AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045K10AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065049N05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065064N09AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065068F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065088F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065104N22AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065117B19AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065119O12AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065134G24AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065150G16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065176C03AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065212M23AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075009P18AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075019G06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075037H14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075057C13AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075100E14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075120I16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075130F07AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075156M16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J100043J03AACTGGGCCTGAAAAGCCCAGCCCNONE 
Os04g0441800AK064785TAGGCCCAGCCTGF-beta receptor, type I/II extracellular region family protein. 
J013000B16TAGGCCCAGCCNONE 
J100043P07TAGGCCCAGCCNONE 
Os04g0446500015-073-B06AAGGCCCAGANONE 
AB118009AAGGCCCAGANONE 
AK073743AAGGCCCAGANONE 
AK103814AAGGCCCAGASimilar to FK506-binding protein 2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (FKBP-13) (FKBP-15). 
J033055H15AAGGCCCAGANONE 
J033067L09AAGGCCCAGANONE 
J033147C19AAGGCCCAGANONE 
J033147C20AAGGCCCAGANONE 
Os04g0479000AK106344CAAGGCCCAGGSimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0525000AK067753TCAGGCCCAGCCCATCTConserved hypothetical protein. 
J013118G14TCAGGCCCAGCCCATCTNONE 
J065026J15TCAGGCCCAGCCCATCTNONE 
J065184H21TCAGGCCCAGCCCATCTNONE 
J065186H22TCAGGCCCAGCCCATCTNONE 
J065193D20TCAGGCCCAGCCCATCTNONE 
J075060D12TCAGGCCCAGCCCATCTNONE 
J075179L24TCAGGCCCAGCCCATCTNONE 
Os04g0564600009-038-A02AACTGGGCCTCNONE 
AK105145AACTGGGCCTCNONE 
AK120614AACTGGGCCTCSimilar to HMG1 protein. 
J013102D16AACTGGGCCTCNONE 
J013151P06AACTGGGCCTCNONE 
J033082C11AACTGGGCCTCNONE 
J065073N13AACTGGGCCTCNONE 
J065142E11AACTGGGCCTCNONE 
J065187I19AACTGGGCCTCNONE 
J065204K02AACTGGGCCTCNONE 
J090089P22AACTGGGCCTCNONE 
J100060B16AACTGGGCCTCNONE 
Os04g0584100012-063-E01GCTGGGCCTGGNONE 
AK105292GCTGGGCCTGGConserved hypothetical protein. 
Os04g0594500015-024-B07TCAGGCCCAGCNONE 
AK106269TCAGGCCCAGCProtein of unknown function DUF674 family protein. 
Os04g0625000J065157C10CCAGGCCCAGATNONE 
Os04g0636400006-064-G07TTCGGCCCAGGCCCAGCNONE 
006-097-D05TTCGGCCCAGGCCCAGCNONE 
AK061848TTCGGCCCAGGCCCAGCSimilar to Senescence-associated protein 6. 
AK099573TTCGGCCCAGGCCCAGCNONE 
J013035J20TTCGGCCCAGGCCCAGCNONE 
Os04g0650500AK066690AATGGGCTGGGCCTGAConserved hypothetical protein. 
AK104273AATGGGCTGGGCCTGANONE 
Os04g0660600009-113-A11CAAGGCCCAGATNONE 
AK120899CAAGGCCCAGATATPase, V0 complex, subunit H family protein. 
J023030J05CAAGGCCCAGATNONE 
J065068M07CAAGGCCCAGATNONE 
J065120G22CAAGGCCCAGATNONE 
J065168J18CAAGGCCCAGATNONE 
J065211M10CAAGGCCCAGATNONE 
J075175E21CAAGGCCCAGATNONE 
J090021C06CAAGGCCCAGATNONE 
J090032P15CAAGGCCCAGATNONE 
J090082E05CAAGGCCCAGATNONE 
J100090O11CAAGGCCCAGATNONE 
Os04g0676100Os04g0676100TCTGGGCCTACATGGGCCAGGCCGAAASimilar to Thioredoxin X, chloroplast precursor. 
Os04g0678800AK072212CAAGGCCCAGTAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065CAAGGCCCAGTANONE 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os05g0110700AK102486ATCTGGGCCTAAGCCCAATAKinetochore-Ndc80 subunit Spc25 family protein. 
J065089I12ATCTGGGCCTAAGCCCAATANONE 
Os05g0121000009-181-E02TAGGCCCAGGNONE 
AK058867TAGGCCCAGGNONE 
AK071341TAGGCCCAGGProtein of unknown function DUF1218 family protein. 
J023024H24TAGGCCCAGGNONE 
J023090B22TAGGCCCAGGNONE 
J023111G15TAGGCCCAGGNONE 
J023134K14TAGGCCCAGGNONE 
J033057C05TAGGCCCAGGNONE 
J033067J15TAGGCCCAGGNONE 
J033084L15TAGGCCCAGGNONE 
J033088B04TAGGCCCAGGNONE 
J043027A08TAGGCCCAGGNONE 
J043029L03TAGGCCCAGGNONE 
J053031K22TAGGCCCAGGNONE 
J053046I01TAGGCCCAGGNONE 
J053070B05TAGGCCCAGGNONE 
J053072C10TAGGCCCAGGNONE 
J065097M22TAGGCCCAGGNONE 
J065164I17TAGGCCCAGGNONE 
J075058I08TAGGCCCAGGNONE 
J075064C09TAGGCCCAGGNONE 
J080304C16TAGGCCCAGGNONE 
J080304H16TAGGCCCAGGNONE 
J080306E17TAGGCCCAGGNONE 
J080310L03TAGGCCCAGGNONE 
J080316J07TAGGCCCAGGNONE 
J080317L23TAGGCCCAGGNONE 
J080319A10TAGGCCCAGGNONE 
J090060F01TAGGCCCAGGNONE 
J100042N16TAGGCCCAGGNONE 
J100047F05TAGGCCCAGGNONE 
J100075J19TAGGCCCAGGNONE 
Os05g0128100009-051-B07CCTGGGCCTGANONE 
009-127-B08CCTGGGCCTGANONE 
009-144-H03CCTGGGCCTGANONE 
009-176-B05CCTGGGCCTGANONE 
AK108556CCTGGGCCTGANONE 
AK119308CCTGGGCCTGANONE 
AK120934CCTGGGCCTGAConserved hypothetical protein. 
J023036J15CCTGGGCCTGANONE 
J065122L01CCTGGGCCTGANONE 
J075104P10CCTGGGCCTGANONE 
Os05g0129400AK102359ACTGGGCCTCAnkyrin repeat containing protein. 
J033091I05ACTGGGCCTCNONE 
Os05g0140800AK110652TGCGGCCCATAAAGGCCCAGATSimilar to Dormancy related protein (Fragment). 
J075019K14TGCGGCCCATAAAGGCCCAGATNONE 
J075020O11TGCGGCCCATAAAGGCCCAGATNONE 
J075028P06TGCGGCCCATAAAGGCCCAGATNONE 
J075050A16TGCGGCCCATAAAGGCCCAGATNONE 
J075051F18TGCGGCCCATAAAGGCCCAGATNONE 
J075085K03TGCGGCCCATAAAGGCCCAGATNONE 
J075112P22TGCGGCCCATAAAGGCCCAGATNONE 
J075118I09TGCGGCCCATAAAGGCCCAGATNONE 
J075144H09TGCGGCCCATAAAGGCCCAGATNONE 
J075166I07TGCGGCCCATAAAGGCCCAGATNONE 
J075191J02TGCGGCCCATAAAGGCCCAGATNONE 
J075195I23TGCGGCCCATAAAGGCCCAGATNONE 
Os05g0168400006-039-A06TAGGCCCAGTANONE 
AK069800TAGGCCCAGTANONE 
AK106195TAGGCCCAGTAConserved hypothetical protein. 
J065086N09TAGGCCCAGTANONE 
J065137B10TAGGCCCAGTANONE 
J075062B04TAGGCCCAGTANONE 
J075193I07TAGGCCCAGTANONE 
J075193K24TAGGCCCAGTANONE 
J075194D10TAGGCCCAGTANONE 
J100037F01TAGGCCCAGTANONE 
J100071E09TAGGCCCAGTANONE 
Os05g0172100006-076-G10CAGGCCCAGGNONE 
AK068467CAGGCCCAGGGalactose oxidase, central domain containing protein. 
AK105962CAGGCCCAGGNONE 
J013156C03CAGGCCCAGGNONE 
J053091E24CAGGCCCAGGNONE 
Os05g0446900AK101748CTTGGGCCTCTGGGCCTAGlycoside hydrolase, starch-binding domain containing protein. 
Os05g0481600009-067-H08CACGGCCCATCCAAGGCCCAGANONE 
009-085-H10CACGGCCCATCCAAGGCCCAGANONE 
009-147-F04CACGGCCCATCCAAGGCCCAGANONE 
AK063820CACGGCCCATCCAAGGCCCAGAConserved hypothetical protein. 
AK121540CACGGCCCATCCAAGGCCCAGANONE 
J023027H12CACGGCCCATCCAAGGCCCAGANONE 
J033031M01CACGGCCCATCCAAGGCCCAGANONE 
J053031M02CACGGCCCATCCAAGGCCCAGANONE 
Os05g0490000011-076-C07CCTGGGCCTCNONE 
015-026-D07CCTGGGCCTCNONE 
015-074-A08CCTGGGCCTCNONE 
AK064335CCTGGGCCTCNONE 
AK101340CCTGGGCCTCKrr1 family protein. 
J033034J18CCTGGGCCTCNONE 
Os05g0512500009-036-D05ATCTGGGCCTANONE 
AK062441ATCTGGGCCTACT20 family protein. 
J080003C10ATCTGGGCCTANONE 
J080046G11ATCTGGGCCTANONE 
Os05g0541900009-130-F05AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
009-200-E07AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
013-057-G09AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
Os05g0547850009-102-F03GAGGCCCAGATNONE 
013-076-H08GAGGCCCAGATNONE 
AK058330GAGGCCCAGATNONE 
AK122158GAGGCCCAGATDNA-binding TFAR19-related protein family protein. 
AY626826GAGGCCCAGATNONE 
J043012O19GAGGCCCAGATNONE 
J043038O15GAGGCCCAGATNONE 
J053094L06GAGGCCCAGATNONE 
Os05g0548100AK060333TACTGGGCCTTConserved hypothetical protein. 
AK100682TACTGGGCCTTNONE 
J013151E01TACTGGGCCTTNONE 
J023113L22TACTGGGCCTTNONE 
J043027A19TACTGGGCCTTNONE 
J075093E06TACTGGGCCTTNONE 
J090060D15TACTGGGCCTTNONE 
J090082J03TACTGGGCCTTNONE 
J100050E01TACTGGGCCTTNONE 
Os05g0558000015-029-G05TAATGGGCCTGACTGGGCCTGANONE 
AK073857TAATGGGCCTGACTGGGCCTGARibosomal protein L1 family protein. 
J033074P11TAATGGGCCTGACTGGGCCTGANONE 
J090060I16TAATGGGCCTGACTGGGCCTGANONE 
Os05g0561500006-066-D12ATTTGGGCTAGGCCCAGGNONE 
AK061788ATTTGGGCTAGGCCCAGGSimilar to CMP-KDO synthetase (EC 2.7.7.38) (Fragment). 
AK098862ATTTGGGCTAGGCCCAGGNONE 
J013000O09ATTTGGGCTAGGCCCAGGNONE 
J033145C24ATTTGGGCTAGGCCCAGGNONE 
Os06g0103400009-138-H04AAGGCCCAGGCCCACCANONE 
AK067021AAGGCCCAGGCCCACCANucleic acid-binding, OB-fold domain containing protein. 
AK071627AAGGCCCAGGCCCACCANONE 
J080307A01AAGGCCCAGGCCCACCANONE 
Os06g0119300AK067271CAAGGCCCAGTProtein of unknown function DUF594 family protein. 
AK067271CCTGGGCCTGAProtein of unknown function DUF594 family protein. 
Os06g0128400AK064390AAGGCCCAGCNONE 
AK121983AAGGCCCAGCWD40-like domain containing protein. 
Os06g0131100AK112079CCAGGCCCAGCCCTCCGGCCCACTWD40-like domain containing protein. 
J033066L01CCAGGCCCAGCCCTCCGGCCCACTNONE 
J100044P22CCAGGCCCAGCCCTCCGGCCCACTNONE 
Os06g0134000AJ417525AACTGGGCCTANONE 
AK062184AACTGGGCCTANONE 
AK106717AACTGGGCCTASimilar to 40S ribosomal protein S20. 
AK120319AACTGGGCCTANONE 
D10402AACTGGGCCTANONE 
D12632AACTGGGCCTANONE 
J013056N13AACTGGGCCTANONE 
J023100G01AACTGGGCCTANONE 
J053059F04AACTGGGCCTANONE 
J053068M21AACTGGGCCTANONE 
J053078H15AACTGGGCCTANONE 
J065050O15AACTGGGCCTANONE 
J065060G15AACTGGGCCTANONE 
J065080K10AACTGGGCCTANONE 
J065108G05AACTGGGCCTANONE 
J065186K16AACTGGGCCTANONE 
J075150J12AACTGGGCCTANONE 
J080002I18AACTGGGCCTANONE 
J080005H04AACTGGGCCTANONE 
J080008I06AACTGGGCCTANONE 
J080010G20AACTGGGCCTANONE 
J080010N10AACTGGGCCTANONE 
J080018H02AACTGGGCCTANONE 
J080022O14AACTGGGCCTANONE 
J080023F23AACTGGGCCTANONE 
J080025D16AACTGGGCCTANONE 
J080027L12AACTGGGCCTANONE 
J080030F16AACTGGGCCTANONE 
J080038N04AACTGGGCCTANONE 
J080048O17AACTGGGCCTANONE 
J080056B05AACTGGGCCTANONE 
J080061D02AACTGGGCCTANONE 
J080062H18AACTGGGCCTANONE 
J080064E06AACTGGGCCTANONE 
J080066D23AACTGGGCCTANONE 
J080071F08AACTGGGCCTANONE 
J080089E06AACTGGGCCTANONE 
J080089K22AACTGGGCCTANONE 
J080091C18AACTGGGCCTANONE 
J080095G10AACTGGGCCTANONE 
J090038G01AACTGGGCCTANONE 
J090062K07AACTGGGCCTANONE 
J100051G19AACTGGGCCTANONE 
Os06g0140400AK059116GGCTGGGCCTCNONE 
AK102692GGCTGGGCCTCSimilar to HAHB-6 (Fragment). 
AY554033GGCTGGGCCTCNONE 
J033103D12GGCTGGGCCTCNONE 
Os06g0181500AK068950CCTGGGCCTCNONE 
AK100878CCTGGGCCTCSimilar to Plasma membrane H+-ATPase (EC 3.6.1.3). 
J023001P16CCTGGGCCTCNONE 
Os06g0215100J090029F19GAGGCCCAGCProtein of unknown function DUF1645 family protein. 
Os06g0309000AK121021AAGGCCCAGACAGCCCAACZinc finger, FYVE/PHD-type domain containing protein. 
Os06g0343100AK058622CAGGCCCAGGNONE 
Os06g0472200AK059428CAGGCCCAGCCNONE 
AK103043CAGGCCCAGCCSimilar to Isoflavone reductase homolog Bet v 6.0101 (Fragment). 
J033117F05CAGGCCCAGCCNONE 
Os06g0539066J065210J16CCTGGGCCTTConserved hypothetical protein. 
Os06g0560400AK103575TCAGGCCCAGGGCCCAGGNONE 
AK108074TCAGGCCCAGGGCCCAGGProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0602600AK121619ACTGGGCCTGAlba, DNA/RNA-binding protein family protein. 
J033044O03ACTGGGCCTGNONE 
J043036G04ACTGGGCCTGNONE 
J075107E08ACTGGGCCTGNONE 
J090060N14ACTGGGCCTGNONE 
J090094K04ACTGGGCCTGNONE 
Os06g0625500006-034-A05TACTGGGCCTCNONE 
AK058459TACTGGGCCTCSimilar to Thioredoxin peroxidase. 
AK068955TACTGGGCCTCNONE 
AK104130TACTGGGCCTCNONE 
J023003C09TACTGGGCCTCNONE 
J033043I02TACTGGGCCTCNONE 
J065063E05TACTGGGCCTCNONE 
J065190D24TACTGGGCCTCNONE 
J065198I01TACTGGGCCTCNONE 
J075107A02TACTGGGCCTCNONE 
Os07g0155200006-036-E03AAAGCCCATTTAGGCCCAGCCNONE 
006-036-E04AAAGCCCATTTAGGCCCAGCCNONE 
AK061006AAAGCCCATTTAGGCCCAGCCProtein of unknown function DUF150 family protein. 
AK104606AAAGCCCATTTAGGCCCAGCCNONE 
Os07g0164100AK111557GCTGGGCCTAHistone deacetylase superfamily protein. 
Os07g0170900015-094-H05CGTGTGGGTCTGGGCCTCNONE 
AK106442CGTGTGGGTCTGGGCCTCConserved hypothetical protein. 
Os07g0180900006-055-B11CAAGGCCCAGCCCANONE 
006-103-F09CAAGGCCCAGCCCANONE 
011-009-E03CAAGGCCCAGCCCANONE 
011-035-H08CAAGGCCCAGCCCANONE 
014-043-F08CAAGGCCCAGCCCANONE 
AK060711CAAGGCCCAGCCCARibosomal protein L4/L1e family protein. 
AK060963CAAGGCCCAGCCCANONE 
AK104447CAAGGCCCAGCCCANONE 
AK104504CAAGGCCCAGCCCANONE 
AK104629CAAGGCCCAGCCCANONE 
J023003P15CAAGGCCCAGCCCANONE 
J023075H14CAAGGCCCAGCCCANONE 
J033101N17CAAGGCCCAGCCCANONE 
J033132M11CAAGGCCCAGCCCANONE 
J065081C24CAAGGCCCAGCCCANONE 
J080004L10CAAGGCCCAGCCCANONE 
J080009H21CAAGGCCCAGCCCANONE 
J080013F01CAAGGCCCAGCCCANONE 
J080022K24CAAGGCCCAGCCCANONE 
J080023C22CAAGGCCCAGCCCANONE 
J080024M16CAAGGCCCAGCCCANONE 
J080026K06CAAGGCCCAGCCCANONE 
J080030J23CAAGGCCCAGCCCANONE 
J080030L05CAAGGCCCAGCCCANONE 
J080031G03CAAGGCCCAGCCCANONE 
J080033C03CAAGGCCCAGCCCANONE 
J080033D02CAAGGCCCAGCCCANONE 
J080035A11CAAGGCCCAGCCCANONE 
J080035A14CAAGGCCCAGCCCANONE 
J080039E08CAAGGCCCAGCCCANONE 
J080040L15CAAGGCCCAGCCCANONE 
J080040M03CAAGGCCCAGCCCANONE 
J080041L21CAAGGCCCAGCCCANONE 
J080043E09CAAGGCCCAGCCCANONE 
J080048B14CAAGGCCCAGCCCANONE 
J080048O09CAAGGCCCAGCCCANONE 
J080051H01CAAGGCCCAGCCCANONE 
J080052H06CAAGGCCCAGCCCANONE 
J080065K05CAAGGCCCAGCCCANONE 
J080066D10CAAGGCCCAGCCCANONE 
J080066E23CAAGGCCCAGCCCANONE 
J080069F10CAAGGCCCAGCCCANONE 
J080074M06CAAGGCCCAGCCCANONE 
J080075D13CAAGGCCCAGCCCANONE 
J080076G02CAAGGCCCAGCCCANONE 
J080082G15CAAGGCCCAGCCCANONE 
J080082K06CAAGGCCCAGCCCANONE 
J080082P12CAAGGCCCAGCCCANONE 
J080085F01CAAGGCCCAGCCCANONE 
J080090H22CAAGGCCCAGCCCANONE 
J080092D07CAAGGCCCAGCCCANONE 
J080094M03CAAGGCCCAGCCCANONE 
J080094O10CAAGGCCCAGCCCANONE 
J090008I06CAAGGCCCAGCCCANONE 
J100058N20CAAGGCCCAGCCCANONE 
J100060M07CAAGGCCCAGCCCANONE 
J100062M08CAAGGCCCAGCCCANONE 
J100064L07CAAGGCCCAGCCCANONE 
J100073H16CAAGGCCCAGCCCANONE 
J100074C10CAAGGCCCAGCCCANONE 
J100075N06CAAGGCCCAGCCCANONE 
J100087P11CAAGGCCCAGCCCANONE 
J100088B13CAAGGCCCAGCCCANONE 
J100088J16CAAGGCCCAGCCCANONE 
J100088L17CAAGGCCCAGCCCANONE 
J100088O12CAAGGCCCAGCCCANONE 
Os07g0191700AK066389GAGGCCCAGASimilar to AT.I.24-9 protein (Fragment). 
AK103768GAGGCCCAGANONE 
Os07g0225100016-021-E05AACTGGGCCTCNONE 
AK064193AACTGGGCCTCAromatic amino acid permease family protein. 
Os07g0413800006-021-H08CCTGGGCCTANONE 
006-030-D01CCTGGGCCTANONE 
006-034-B05CCTGGGCCTANONE 
006-034-G03CCTGGGCCTANONE 
006-040-B11CCTGGGCCTANONE 
006-043-D03CCTGGGCCTANONE 
006-052-B04CCTGGGCCTANONE 
006-054-H11CCTGGGCCTANONE 
006-081-A04CCTGGGCCTANONE 
006-095-D10CCTGGGCCTANONE 
006-102-A01CCTGGGCCTANONE 
006-111-E02CCTGGGCCTANONE 
009-136-D03CCTGGGCCTANONE 
009-163-H08CCTGGGCCTANONE 
009-164-D03CCTGGGCCTANONE 
AK060411CCTGGGCCTANONE 
AK061478CCTGGGCCTAConserved hypothetical protein. 
AK104124CCTGGGCCTANONE 
AK104173CCTGGGCCTANONE 
AK120684CCTGGGCCTANONE 
J065112P06CCTGGGCCTANONE 
Os07g0480900012-002-E04GCTGGGCCTTNONE 
AK063422GCTGGGCCTTSimilar to Cysteine protease (Fragment). 
J065073E02GCTGGGCCTTNONE 
J065122P21GCTGGGCCTTNONE 
J075108D13GCTGGGCCTTNONE 
J075147K14GCTGGGCCTTNONE 
Os07g0513200015-004-B02TCTGGGCCTANONE 
AK101410TCTGGGCCTANONE 
AK106227TCTGGGCCTANONE 
AK119451TCTGGGCCTAProtein prenyltransferase domain containing protein. 
Os07g0549800AK120874AACTGGGCCTASimilar to RGP-3 (Fragment). 
J023026P08AACTGGGCCTANONE 
J065205C05AACTGGGCCTANONE 
J065219M14AACTGGGCCTANONE 
J080010N21AACTGGGCCTANONE 
J080016K09AACTGGGCCTANONE 
J080017M18AACTGGGCCTANONE 
J080024C07AACTGGGCCTANONE 
J080027K09AACTGGGCCTANONE 
J080028E12AACTGGGCCTANONE 
J080028I22AACTGGGCCTANONE 
J080029C01AACTGGGCCTANONE 
J080030I18AACTGGGCCTANONE 
J080030M03AACTGGGCCTANONE 
J080032B11AACTGGGCCTANONE 
J080035B15AACTGGGCCTANONE 
J080038I09AACTGGGCCTANONE 
J080041C15AACTGGGCCTANONE 
J080042B01AACTGGGCCTANONE 
J080042F04AACTGGGCCTANONE 
J080048H05AACTGGGCCTANONE 
J080057F02AACTGGGCCTANONE 
J080069D04AACTGGGCCTANONE 
J080077K01AACTGGGCCTANONE 
J080085N11AACTGGGCCTANONE 
J080093P13AACTGGGCCTANONE 
J080097G10AACTGGGCCTANONE 
J080097L17AACTGGGCCTANONE 
J090026L10AACTGGGCCTANONE 
J090075O05AACTGGGCCTANONE 
Os07g0573600AK073925ATCTGGGCCTAREX1 DNA Repair family protein. 
J033072E11ATCTGGGCCTANONE 
Os07g0578600AK067155GCTGGGCCTTSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065GCTGGGCCTTNONE 
Os07g0586500AK072668GAGGCCCAGANONE 
AK120683GAGGCCCAGASimilar to SUMO activating enzyme 2. 
J065033L18GAGGCCCAGANONE 
J065038H20GAGGCCCAGANONE 
J065045M20GAGGCCCAGANONE 
J065046E10GAGGCCCAGANONE 
J065055A10GAGGCCCAGANONE 
J065098P14GAGGCCCAGANONE 
J065156B19GAGGCCCAGANONE 
J065195P22GAGGCCCAGANONE 
J075002O06GAGGCCCAGANONE 
J075003D13GAGGCCCAGANONE 
J075004K05GAGGCCCAGANONE 
J075010C10GAGGCCCAGANONE 
J075011C14GAGGCCCAGANONE 
J075026E16GAGGCCCAGANONE 
J075041L23GAGGCCCAGANONE 
J075044C21GAGGCCCAGANONE 
J075071M16GAGGCCCAGANONE 
J075076O13GAGGCCCAGANONE 
J075080G12GAGGCCCAGANONE 
J075091A03GAGGCCCAGANONE 
J075091A21GAGGCCCAGANONE 
J075106K17GAGGCCCAGANONE 
J075120G20GAGGCCCAGANONE 
J075125H10GAGGCCCAGANONE 
J075129E05GAGGCCCAGANONE 
J075143B18GAGGCCCAGANONE 
J075153P22GAGGCCCAGANONE 
J075156A12GAGGCCCAGANONE 
J075156E19GAGGCCCAGANONE 
J075159E16GAGGCCCAGANONE 
J075165E16GAGGCCCAGANONE 
J075174L21GAGGCCCAGANONE 
J075176N06GAGGCCCAGANONE 
J075176N13GAGGCCCAGANONE 
J075179L20GAGGCCCAGANONE 
J075186P20GAGGCCCAGANONE 
J090044I17GAGGCCCAGANONE 
J090051K13GAGGCCCAGANONE 
Os07g0604500009-018-C07CCTGGGCCTANONE 
009-194-C02CCTGGGCCTANONE 
011-023-C06CCTGGGCCTANONE 
015-035-B10CCTGGGCCTANONE 
AK064312CCTGGGCCTASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK069085CCTGGGCCTANONE 
J090050I12CCTGGGCCTANONE 
J100027C10CCTGGGCCTANONE 
J100029A05CCTGGGCCTANONE 
J100031P17CCTGGGCCTANONE 
J100039E20CCTGGGCCTANONE 
J100064L15CCTGGGCCTANONE 
J100066K08CCTGGGCCTANONE 
Os07g0626600Os07g0626600GCTGGGCCTTSimilar to Embryogenic callus protein-like. 
Os07g0639800AK074012ATCTGGGCCTCSimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592ATCTGGGCCTCNONE 
AK104739ATCTGGGCCTCNONE 
Os07g0681600AK073504AACTGGGCCTCATP-dependent DNA helicase RecQ family protein. 
Os07g0695100AB189039AGATGGGCCGGATAGGCCCAGANONE 
AB189042AGATGGGCCGGATAGGCCCAGANONE 
AK059514AGATGGGCCGGATAGGCCCAGANONE 
AK066112AGATGGGCCGGATAGGCCCAGACheY-like domain containing protein. 
J013051N02AGATGGGCCGGATAGGCCCAGANONE 
J013127M02AGATGGGCCGGATAGGCCCAGANONE 
J023007I05AGATGGGCCGGATAGGCCCAGANONE 
Os08g0126700AK111805GAGGCCCAGGNONE 
AK111902GAGGCCCAGGZinc finger, CCCH-type domain containing protein. 
Os08g0162500AK121633ATCTGGGCCTGGConserved hypothetical protein. 
J033105E19ATCTGGGCCTGGNONE 
J080012K11ATCTGGGCCTGGNONE 
J080041I12ATCTGGGCCTGGNONE 
J080049G05ATCTGGGCCTGGNONE 
J080050P09ATCTGGGCCTGGNONE 
J080051A10ATCTGGGCCTGGNONE 
J080054G05ATCTGGGCCTGGNONE 
J080058M08ATCTGGGCCTGGNONE 
J080064N23ATCTGGGCCTGGNONE 
J080072L15ATCTGGGCCTGGNONE 
J080096H09ATCTGGGCCTGGNONE 
J100079I08ATCTGGGCCTGGNONE 
Os08g0208200009-112-E06CCTGGGCCTANONE 
AK062824CCTGGGCCTAPeptidase A1, pepsin family protein. 
Os08g0230000014-096-F01AAGGCCCAGANONE 
AK067127AAGGCCCAGAConserved hypothetical protein. 
J013096C05AAGGCCCAGANONE 
J100032D12AAGGCCCAGANONE 
Os08g0236900AK109597GAGGCGTGGACTGGGCCTGConserved hypothetical protein. 
Os08g0390700009-094-H10GGGCTGGGCCTCNONE 
AK062714GGGCTGGGCCTCSimilar to 2-oxoglutarate-dependent oxygenase. 
Os08g0433200013-023-E07AAGGCCCAGCNONE 
AK099471AAGGCCCAGCConserved hypothetical protein. 
J013024A05AAGGCCCAGCNONE 
J013065N03AAGGCCCAGCNONE 
J023111A21AAGGCCCAGCNONE 
J065035F10AAGGCCCAGCNONE 
J065083H01AAGGCCCAGCNONE 
J065159E03AAGGCCCAGCNONE 
J065186A03AAGGCCCAGCNONE 
J075032B02AAGGCCCAGCNONE 
J075038L14AAGGCCCAGCNONE 
J075047N21AAGGCCCAGCNONE 
J075076H05AAGGCCCAGCNONE 
J075110C08AAGGCCCAGCNONE 
J090096K17AAGGCCCAGCNONE 
Os08g0460800015-094-E01TTGGCCCAAGGCCCAGTTCyclin-like F-box domain containing protein. 
Os08g0474700AK064878AACTGGGCCCTGGGCCTGGSimilar to COPII subunit Sec23 (Fragment). 
Os08g0526400J065038L03GGCTGGGCCTTNONE 
J065048D07GGCTGGGCCTTNONE 
J065057B11GGCTGGGCCTTNONE 
J065149F16GGCTGGGCCTTNONE 
J065152P03GGCTGGGCCTTNONE 
J065192J12GGCTGGGCCTTNONE 
Os08g0558000J080005K14TCCGGCCCAAAAGGCCCAGTANONE 
Os09g0307800AK060843ACTGGGCCTTGNuclear protein SET domain containing protein. 
Os09g0313500AK065687TAGGCCCAGADisease resistance protein family protein. 
J013039H12TAGGCCCAGANONE 
J090060B10TAGGCCCAGANONE 
Os09g0395600015-050-D12GAGGCCCAGGNONE 
015-089-A12GAGGCCCAGGNONE 
016-076-D03GAGGCCCAGGNONE 
AK060495GAGGCCCAGGConcanavalin A-like lectin/glucanase domain containing protein. 
AK122079GAGGCCCAGGNONE 
Os09g0434200AK062015ACTGGGCCTCNONE 
AK103447ACTGGGCCTCZinc finger, RING-type domain containing protein. 
Os09g0479100012-013-H04TACTGGGCCTTNONE 
AK063439TACTGGGCCTTCyclin-like F-box domain containing protein. 
J065042M05TACTGGGCCTTNONE 
J065048D23TACTGGGCCTTNONE 
J065048E20TACTGGGCCTTNONE 
J065097H24TACTGGGCCTTNONE 
J065156P09TACTGGGCCTTNONE 
J065160M11TACTGGGCCTTNONE 
J065209A11TACTGGGCCTTNONE 
J075010M19TACTGGGCCTTNONE 
J075021B22TACTGGGCCTTNONE 
J075033A10TACTGGGCCTTNONE 
J075046B05TACTGGGCCTTNONE 
J075064A21TACTGGGCCTTNONE 
J075083B22TACTGGGCCTTNONE 
J075097F21TACTGGGCCTTNONE 
J075107K10TACTGGGCCTTNONE 
J075108C05TACTGGGCCTTNONE 
J075148C06TACTGGGCCTTNONE 
J075154D09TACTGGGCCTTNONE 
J075196M02TACTGGGCCTTNONE 
J090016F05TACTGGGCCTTNONE 
Os09g0482400012-003-B01AAGGCCCAGCNONE 
012-008-B05AAGGCCCAGCNONE 
012-010-C09AAGGCCCAGCNONE 
012-080-B07AAGGCCCAGCNONE 
012-083-G11AAGGCCCAGCNONE 
012-089-D09AAGGCCCAGCNONE 
012-091-C01AAGGCCCAGCNONE 
015-053-A11AAGGCCCAGCNONE 
AB111810AAGGCCCAGCSimilar to Heat shock protein 82. 
J033032D17AAGGCCCAGCNONE 
J033124F14AAGGCCCAGCNONE 
J065054M12AAGGCCCAGCNONE 
J065085K18AAGGCCCAGCNONE 
J065103F22AAGGCCCAGCNONE 
J065120O18AAGGCCCAGCNONE 
J065122B08AAGGCCCAGCNONE 
J065127I15AAGGCCCAGCNONE 
J065128C06AAGGCCCAGCNONE 
J065130N10AAGGCCCAGCNONE 
J065152D21AAGGCCCAGCNONE 
J065207P17AAGGCCCAGCNONE 
J065208E07AAGGCCCAGCNONE 
J075011C19AAGGCCCAGCNONE 
J075020E07AAGGCCCAGCNONE 
J075079G06AAGGCCCAGCNONE 
J075092D22AAGGCCCAGCNONE 
J080042F22AAGGCCCAGCNONE 
J080057N10AAGGCCCAGCNONE 
J080059D14AAGGCCCAGCNONE 
J090009E01AAGGCCCAGCNONE 
J090016L14AAGGCCCAGCNONE 
J090026O14AAGGCCCAGCNONE 
J090030D09AAGGCCCAGCNONE 
J090030E13AAGGCCCAGCNONE 
J090044D22AAGGCCCAGCNONE 
J090047O17AAGGCCCAGCNONE 
J090065K19AAGGCCCAGCNONE 
J090066J12AAGGCCCAGCNONE 
J090068D04AAGGCCCAGCNONE 
J090074B12AAGGCCCAGCNONE 
J090078L24AAGGCCCAGCNONE 
J090083A07AAGGCCCAGCNONE 
J090091E02AAGGCCCAGCNONE 
J090093F23AAGGCCCAGCNONE 
J090095K09AAGGCCCAGCNONE 
J100021G05AAGGCCCAGCNONE 
J100022I18AAGGCCCAGCNONE 
J100028G20AAGGCCCAGCNONE 
J100035E22AAGGCCCAGCNONE 
J100037I09AAGGCCCAGCNONE 
J100039L12AAGGCCCAGCNONE 
J100041O10AAGGCCCAGCNONE 
J100045N10AAGGCCCAGCNONE 
J100049H24AAGGCCCAGCNONE 
J100057E17AAGGCCCAGCNONE 
J100058H08AAGGCCCAGCNONE 
J100063D02AAGGCCCAGCNONE 
J100064E04AAGGCCCAGCNONE 
J100068D15AAGGCCCAGCNONE 
J100069J01AAGGCCCAGCNONE 
J100070E03AAGGCCCAGCNONE 
J100074G01AAGGCCCAGCNONE 
J100080C21AAGGCCCAGCNONE 
J100082M08AAGGCCCAGCNONE 
J100086E08AAGGCCCAGCNONE 
Os09g0509200AK069525GGCTGGGCCTTTGGGCCAASimilar to Pyruvate dehydrogenase E1 beta subunit isoform 3 (EC 1.2.4.1). 
Os09g0516300AK065222ATCTGGGCCTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0521700014-005-C08GCGGGTCGCTGGGCCTCNONE 
AK063628GCGGGTCGCTGGGCCTCSimilar to H/ACA ribonucleoprotein complex subunit 1 (Nucleolar protein family A member 1) (snoRNP protein GAR1). 
AK064507GCGGGTCGCTGGGCCTCNONE 
Os09g0525500AK107918GAGGCCCAGGYY1 protein precursor. 
D50575GAGGCCCAGGNONE 
Os09g0535300AK071211AAGGCCCAGCCCAAGXAP5 protein family protein. 
Os09g0567000012-071-E09TACTGGGCCTCNONE 
013-099-E05TACTGGGCCTCNONE 
AK065613TACTGGGCCTCConserved hypothetical protein. 
J013026M04TACTGGGCCTCNONE 
J023103F04TACTGGGCCTCNONE 
J033119N04TACTGGGCCTCNONE 
J065011I19TACTGGGCCTCNONE 
J065042A10TACTGGGCCTCNONE 
J100023F16TACTGGGCCTCNONE 
Os09g0571100AK106869CAGGCCCAGAVirulence factor, pectin lyase fold family protein. 
Os11g0109900011-064-B04CAAGTGGGCCCATCGCTGGGCCTCNONE 
AK063961CAAGTGGGCCCATCGCTGGGCCTCDouble-stranded RNA binding domain containing protein. 
AK121852CAAGTGGGCCCATCGCTGGGCCTCNONE 
J065183M14CAAGTGGGCCCATCGCTGGGCCTCNONE 
Os11g0148600AK100066CAGGCCCAGATConserved hypothetical protein. 
AK102442CAGGCCCAGATNONE 
J065167F17CAGGCCCAGATNONE 
Os11g0482000006-056-D12GGCTGGGCCTTGNONE 
006-102-C10GGCTGGGCCTTGNONE 
009-005-E07GGCTGGGCCTTGNONE 
014-088-D03GGCTGGGCCTTGNONE 
AK059558GGCTGGGCCTTGSimilar to 40S ribosomal protein S5-1. 
AK103918GGCTGGGCCTTGNONE 
Os11g0513900AK101049GGCTGGGCTGGGCCTTGConserved hypothetical protein. 
Os11g0549665006-027-H01GCCACACGGCCCAAGTAGGCCCAGGNONE 
006-083-C01GCCACACGGCCCAAGTAGGCCCAGGNONE 
AK072644GCCACACGGCCCAAGTAGGCCCAGGNONE 
AK101587GCCACACGGCCCAAGTAGGCCCAGGConserved hypothetical protein. 
AK106162GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013051C18GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013067E02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013169N16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023049M16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023050I19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023063H21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023063K01GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023108O17GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023115H08GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023117O16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023129J01GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023133I23GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023143P10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033045J08GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033050I15GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033051A04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033060C24GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033069L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033103H04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033112L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033118O16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033126B10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033133P10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033144H19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033145H19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J043029L04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075066N17GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075150D02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075158D05GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090009I10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090048D05GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090085E02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090085H13GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100029L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100041M06GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100045B04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100077C04GCCACACGGCCCAAGTAGGCCCAGGNONE 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os11g0592500AK067078GAGGCCCAGCCCAAAANONE 
Os11g0664700012-064-D03TCATGGGCCTGGGCCTGNONE 
AK100084TCATGGGCCTGGGCCTGConserved hypothetical protein. 
J023002K05TCATGGGCCTGGGCCTGNONE 
J023037C21TCATGGGCCTGGGCCTGNONE 
J033029N10TCATGGGCCTGGGCCTGNONE 
J090047F07TCATGGGCCTGGGCCTGNONE 
Os12g0167900005-004-A06GAGGCCCAGTNONE 
006-024-H01GAGGCCCAGTNONE 
006-044-H12GAGGCCCAGTNONE 
006-053-B08GAGGCCCAGTNONE 
015-080-F12GAGGCCCAGTNONE 
AK060925GAGGCCCAGT60S ribosomal protein L3. 
D10403GAGGCCCAGTNONE 
D12630GAGGCCCAGTNONE 
J013046A17GAGGCCCAGTNONE 
J013048A16GAGGCCCAGTNONE 
J013057L14GAGGCCCAGTNONE 
J023058G08GAGGCCCAGTNONE 
J023058I08GAGGCCCAGTNONE 
J023078E17GAGGCCCAGTNONE 
J023087E03GAGGCCCAGTNONE 
J023097D18GAGGCCCAGTNONE 
J023141E14GAGGCCCAGTNONE 
J023150P21GAGGCCCAGTNONE 
J033045K05GAGGCCCAGTNONE 
J033071G03GAGGCCCAGTNONE 
J033071I15GAGGCCCAGTNONE 
J033136D08GAGGCCCAGTNONE 
J043012M21GAGGCCCAGTNONE 
J043015C13GAGGCCCAGTNONE 
J053031L19GAGGCCCAGTNONE 
J053050C01GAGGCCCAGTNONE 
J053055I20GAGGCCCAGTNONE 
J053074B18GAGGCCCAGTNONE 
J053091I08GAGGCCCAGTNONE 
J053097N01GAGGCCCAGTNONE 
J065058A02GAGGCCCAGTNONE 
J065141H11GAGGCCCAGTNONE 
J075019D10GAGGCCCAGTNONE 
J075078G18GAGGCCCAGTNONE 
J075094C12GAGGCCCAGTNONE 
J075165H12GAGGCCCAGTNONE 
J090011E05GAGGCCCAGTNONE 
J090021H18GAGGCCCAGTNONE 
J090027N07GAGGCCCAGTNONE 
J090035F04GAGGCCCAGTNONE 
J090050F21GAGGCCCAGTNONE 
J090051M02GAGGCCCAGTNONE 
J090060F21GAGGCCCAGTNONE 
J090075G15GAGGCCCAGTNONE 
J090092P11GAGGCCCAGTNONE 
J090097B18GAGGCCCAGTNONE 
J100019C17GAGGCCCAGTNONE 
J100022O04GAGGCCCAGTNONE 
J100034G13GAGGCCCAGTNONE 
J100048A13GAGGCCCAGTNONE 
J100050P18GAGGCCCAGTNONE 
J100054B21GAGGCCCAGTNONE 
J100062L01GAGGCCCAGTNONE 
J100065E11GAGGCCCAGTNONE 
J100074P09GAGGCCCAGTNONE 
J100086E10GAGGCCCAGTNONE 
Os12g0168700AK065708CAGGCCCAGTAMP-dependent synthetase and ligase domain containing protein. 
AK065718CAGGCCCAGTNONE 
Os12g0189300AK068710GTGGCGTGGGCCCCACTCCCGGCCCACCAGGCCCAGCCCIsocitrate lyase and phosphorylmutase family protein. 
Os12g0506500AK119779TAGGCCCAGAGalactokinase/homoserine kinase family protein. 
Os12g0533600J065106H15AACTGGGCCTAConserved hypothetical protein. 
J065194D13AACTGGGCCTANONE 
Os12g0554400AK072345TAGGCCCAGATetratricopeptide-like helical domain containing protein. 
Os12g0556100J065083C21TACTGGGCCTCDrought induced 19 family protein. 
J065124M18TACTGGGCCTCNONE 
J100032P22TACTGGGCCTCNONE 
J100048N01TACTGGGCCTCNONE 
Os12g0580600AK108584TCTGGGCCTCConserved hypothetical protein. 
Os12g0584100006-083-C12TAGGCCCAGCCCACCCNONE 
006-104-C06TAGGCCCAGCCCACCCNONE 
AK066829TAGGCCCAGCCCACCCNONE 
AK071424TAGGCCCAGCCCACCCConserved hypothetical protein. 
J013075O22TAGGCCCAGCCCACCCNONE 
J023091J20TAGGCCCAGCCCACCCNONE 
J065167K15TAGGCCCAGCCCACCCNONE 
J065213C02TAGGCCCAGCCCACCCNONE 
J075001B17TAGGCCCAGCCCACCCNONE 
J075165D13TAGGCCCAGCCCACCCNONE 
J075195C24TAGGCCCAGCCCACCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.