version

Summary of OsREG474 (All List)

OrganismOryza sativa  
IDOsREG474  
SequenceAGGCCCAT  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count4828  

Entry Sequences (4828 entries)

LocusGene modelSequenceDescription
Os01g0102700009-009-A07GAGGCCCATCANONE 
AK063774GAGGCCCATCATranslocon-associated beta family protein. 
AK099081GAGGCCCATCANONE 
AK099360GAGGCCCATCANONE 
J013096O20GAGGCCCATCANONE 
J023002P14GAGGCCCATCANONE 
J033046F10GAGGCCCATCANONE 
J033084K08GAGGCCCATCANONE 
J065011H22GAGGCCCATCANONE 
J090017O18GAGGCCCATCANONE 
J090047F15GAGGCCCATCANONE 
J090049G20GAGGCCCATCANONE 
Os01g0132700J065063N10TCATGGGCCTTSurfeit locus 5 family protein. 
J065164N24TCATGGGCCTTNONE 
J065167H04TCATGGGCCTTNONE 
J065187N12TCATGGGCCTTNONE 
Os01g0134500AK111908TAGGCCCATASimilar to Delta-7-sterol-C5(6)-desaturase (EC 1.3.3.-) (Delta-7-C-5 sterol desaturase) (Delta7-sterol-C5-desaturase). 
AK112014TAGGCCCATANONE 
Os01g0155600006-048-F03AGATGGGCCTCNONE 
006-048-F03TAATGGGCCTTNONE 
AK060171AGATGGGCCTCNONE 
AK060171TAATGGGCCTTNONE 
AK071635AGATGGGCCTCSimilar to Splicing factor RSZ33. 
AK071635TAATGGGCCTTSimilar to Splicing factor RSZ33. 
J023080A03AGATGGGCCTCNONE 
J023080A03TAATGGGCCTTNONE 
J023100L15AGATGGGCCTCNONE 
J023100L15TAATGGGCCTTNONE 
J033075I17AGATGGGCCTCNONE 
J033075I17TAATGGGCCTTNONE 
J033085O09AGATGGGCCTCNONE 
J033085O09TAATGGGCCTTNONE 
J033105E15AGATGGGCCTCNONE 
J033105E15TAATGGGCCTTNONE 
J033132N10AGATGGGCCTCNONE 
J033132N10TAATGGGCCTTNONE 
J033132P12AGATGGGCCTCNONE 
J033132P12TAATGGGCCTTNONE 
J033149H12AGATGGGCCTCNONE 
J033149H12TAATGGGCCTTNONE 
J043026M03AGATGGGCCTCNONE 
J043026M03TAATGGGCCTTNONE 
J080305J10AGATGGGCCTCNONE 
J080305J10TAATGGGCCTTNONE 
J080308K03AGATGGGCCTCNONE 
J080308K03TAATGGGCCTTNONE 
J090023M04AGATGGGCCTCNONE 
J090023M04TAATGGGCCTTNONE 
J090078F24AGATGGGCCTCNONE 
J090078F24TAATGGGCCTTNONE 
J100066P05AGATGGGCCTCNONE 
J100066P05TAATGGGCCTTNONE 
Os01g0172000012-070-G06GGATGGGCCTTNONE 
012-070-G06GGGCCGGAGGCCCATGANONE 
AK068405GGATGGGCCTTALG3 family protein. 
AK068405GGGCCGGAGGCCCATGAALG3 family protein. 
J013149A07GGATGGGCCTTNONE 
J013149A07GGGCCGGAGGCCCATGANONE 
J053047H05GGATGGGCCTTNONE 
J053047H05GGGCCGGAGGCCCATGANONE 
J065075N03GGATGGGCCTTNONE 
J065075N03GGGCCGGAGGCCCATGANONE 
J065093G22GGATGGGCCTTNONE 
J065093G22GGGCCGGAGGCCCATGANONE 
J065130N21GGATGGGCCTTNONE 
J065130N21GGGCCGGAGGCCCATGANONE 
J065143P05GGATGGGCCTTNONE 
J065143P05GGGCCGGAGGCCCATGANONE 
J065216H07GGATGGGCCTTNONE 
J065216H07GGGCCGGAGGCCCATGANONE 
J075013B06GGATGGGCCTTNONE 
J075013B06GGGCCGGAGGCCCATGANONE 
J075196M05GGATGGGCCTTNONE 
J075196M05GGGCCGGAGGCCCATGANONE 
J100039G24GGATGGGCCTTNONE 
J100039G24GGGCCGGAGGCCCATGANONE 
J100041B11GGATGGGCCTTNONE 
J100041B11GGGCCGGAGGCCCATGANONE 
J100069A16GGATGGGCCTTNONE 
J100069A16GGGCCGGAGGCCCATGANONE 
J100069L12GGATGGGCCTTNONE 
J100069L12GGGCCGGAGGCCCATGANONE 
J100074P16GGATGGGCCTTNONE 
J100074P16GGGCCGGAGGCCCATGANONE 
Os01g0179901J075009I05GAGGCCCATTGGGCCGAAANONE 
J075058D09GAGGCCCATTGGGCCGAAANONE 
J075153K16GAGGCCCATTGGGCCGAAAConserved hypothetical protein. 
Os01g0184000015-008-B06GAGGCCCATTNONE 
AK071130GAGGCCCATTNUC156 family protein. 
AK100604GAGGCCCATTNONE 
J075155H07GAGGCCCATTNONE 
J100047O19GAGGCCCATTNONE 
J100074A09GAGGCCCATTNONE 
Os01g0191100009-011-A02GCCCATGGGCCTGGNONE 
009-028-D05GCCCATGGGCCTGGNONE 
009-058-B11GCCCATGGGCCTGGNONE 
009-151-D09GCCCATGGGCCTGGNONE 
013-026-G03GCCCATGGGCCTGGNONE 
013-063-F04GCCCATGGGCCTGGNONE 
013-069-B05GCCCATGGGCCTGGNONE 
014-029-E04GCCCATGGGCCTGGNONE 
014-072-H04GCCCATGGGCCTGGNONE 
014-089-E09GCCCATGGGCCTGGNONE 
015-047-G05GCCCATGGGCCTGGNONE 
016-033-G06GCCCATGGGCCTGGNONE 
AK058815GCCCATGGGCCTGGSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08GCCCATGGGCCTGGNONE 
J023077K21GCCCATGGGCCTGGNONE 
J023081F19GCCCATGGGCCTGGNONE 
J033052N11GCCCATGGGCCTGGNONE 
J033058N11GCCCATGGGCCTGGNONE 
J033114G05GCCCATGGGCCTGGNONE 
J033114O17GCCCATGGGCCTGGNONE 
J033129L14GCCCATGGGCCTGGNONE 
J053029I12GCCCATGGGCCTGGNONE 
J065067N19GCCCATGGGCCTGGNONE 
J065084I19GCCCATGGGCCTGGNONE 
J065099O03GCCCATGGGCCTGGNONE 
J065201I08GCCCATGGGCCTGGNONE 
J075035B08GCCCATGGGCCTGGNONE 
J075037B22GCCCATGGGCCTGGNONE 
J075054L16GCCCATGGGCCTGGNONE 
J075059D15GCCCATGGGCCTGGNONE 
J075164I08GCCCATGGGCCTGGNONE 
J075185J01GCCCATGGGCCTGGNONE 
J090042O06GCCCATGGGCCTGGNONE 
J090044F12GCCCATGGGCCTGGNONE 
J090063L02GCCCATGGGCCTGGNONE 
J090073I10GCCCATGGGCCTGGNONE 
J090078E18GCCCATGGGCCTGGNONE 
J100072K16GCCCATGGGCCTGGNONE 
Os01g0203300015-045-F03TAGGCCCATCCANONE 
AK106329TAGGCCCATCCAConserved hypothetical protein. 
Os01g0206600J065041P19TAATGGGCCTGAAGCCCACATGGCCCATAConserved hypothetical protein. 
Os01g0229100006-113-G08CCAGGCCCATTTTGGCCCATACNONE 
006-113-G08GAGGCCCATTANONE 
011-075-E08CCAGGCCCATTTTGGCCCATACNONE 
011-075-E08GAGGCCCATTANONE 
AK061285CCAGGCCCATTTTGGCCCATACNONE 
AK061285GAGGCCCATTANONE 
AK070838CCAGGCCCATTTTGGCCCATACTetratricopeptide-like helical domain containing protein. 
AK070838GAGGCCCATTATetratricopeptide-like helical domain containing protein. 
J013059F08CCAGGCCCATTTTGGCCCATACNONE 
J013059F08GAGGCCCATTANONE 
J013059G08CCAGGCCCATTTTGGCCCATACNONE 
J013059G08GAGGCCCATTANONE 
J013059G09CCAGGCCCATTTTGGCCCATACNONE 
J013059G09GAGGCCCATTANONE 
J013069M12CCAGGCCCATTTTGGCCCATACNONE 
J013069M12GAGGCCCATTANONE 
J013105A19CCAGGCCCATTTTGGCCCATACNONE 
J013105A19GAGGCCCATTANONE 
J013149F07CCAGGCCCATTTTGGCCCATACNONE 
J013149F07GAGGCCCATTANONE 
J023073J07CCAGGCCCATTTTGGCCCATACNONE 
J023073J07GAGGCCCATTANONE 
J023130F24CCAGGCCCATTTTGGCCCATACNONE 
J023130F24GAGGCCCATTANONE 
J023147J08CCAGGCCCATTTTGGCCCATACNONE 
J023147J08GAGGCCCATTANONE 
J033028F13CCAGGCCCATTTTGGCCCATACNONE 
J033028F13GAGGCCCATTANONE 
J033115A16CCAGGCCCATTTTGGCCCATACNONE 
J033115A16GAGGCCCATTANONE 
J033135F02CCAGGCCCATTTTGGCCCATACNONE 
J033135F02GAGGCCCATTANONE 
J065031G16CCAGGCCCATTTTGGCCCATACNONE 
J065031G16GAGGCCCATTANONE 
J065058A09CCAGGCCCATTTTGGCCCATACNONE 
J065058A09GAGGCCCATTANONE 
J065089N15CCAGGCCCATTTTGGCCCATACNONE 
J065089N15GAGGCCCATTANONE 
J065130I09CCAGGCCCATTTTGGCCCATACNONE 
J065130I09GAGGCCCATTANONE 
J065191P09CCAGGCCCATTTTGGCCCATACNONE 
J065191P09GAGGCCCATTANONE 
J065197P14CCAGGCCCATTTTGGCCCATACNONE 
J065197P14GAGGCCCATTANONE 
J080306D15CCAGGCCCATTTTGGCCCATACNONE 
J080306D15GAGGCCCATTANONE 
J080308M06CCAGGCCCATTTTGGCCCATACNONE 
J080308M06GAGGCCCATTANONE 
J080315A03CCAGGCCCATTTTGGCCCATACNONE 
J080315A03GAGGCCCATTANONE 
J080315N11CCAGGCCCATTTTGGCCCATACNONE 
J080315N11GAGGCCCATTANONE 
J090046E14CCAGGCCCATTTTGGCCCATACNONE 
J090046E14GAGGCCCATTANONE 
J090058G09CCAGGCCCATTTTGGCCCATACNONE 
J090058G09GAGGCCCATTANONE 
J090077H05CCAGGCCCATTTTGGCCCATACNONE 
J090077H05GAGGCCCATTANONE 
J090087O20CCAGGCCCATTTTGGCCCATACNONE 
J090087O20GAGGCCCATTANONE 
Os01g0229200AK066024GTATGGGCCAAAATGGGCCTGGVHS domain containing protein. 
AK066024TAATGGGCCTCVHS domain containing protein. 
Os01g0277500AK066984AAGGCCCATASimilar to Dof3 gene (Fragment). 
J013074F19AAGGCCCATANONE 
J013091E10AAGGCCCATANONE 
J023077C19AAGGCCCATANONE 
J033068A02AAGGCCCATANONE 
J065137O05AAGGCCCATANONE 
Os01g0283000AK073165TAGGCCCATCTConserved hypothetical protein. 
J033023G08TAGGCCCATCTNONE 
Os01g0283100004-018-B01AGATGGGCCTANONE 
AK060908AGATGGGCCTANONE 
AK071713AGATGGGCCTASimilar to Ferripyochelin-binding protein-like. 
AK104205AGATGGGCCTANONE 
AK122051AGATGGGCCTANONE 
J023109L19AGATGGGCCTANONE 
Os01g0314300AK073419TAGGCCCATCTUncharacterized domain 2 containing protein. 
AK104939TAGGCCCATCTNONE 
J033044B03TAGGCCCATCTNONE 
J033060E12TAGGCCCATCTNONE 
J043037E21TAGGCCCATCTNONE 
J065019O18TAGGCCCATCTNONE 
J065025P22TAGGCCCATCTNONE 
J065042P06TAGGCCCATCTNONE 
J065074C19TAGGCCCATCTNONE 
J065074E13TAGGCCCATCTNONE 
J065094E05TAGGCCCATCTNONE 
J065108N08TAGGCCCATCTNONE 
J065134L13TAGGCCCATCTNONE 
J065152N24TAGGCCCATCTNONE 
J065162N24TAGGCCCATCTNONE 
J065170P16TAGGCCCATCTNONE 
J065177M20TAGGCCCATCTNONE 
J065187N01TAGGCCCATCTNONE 
J075012N12TAGGCCCATCTNONE 
J075046C17TAGGCCCATCTNONE 
J075055N06TAGGCCCATCTNONE 
J075141H03TAGGCCCATCTNONE 
J075150M11TAGGCCCATCTNONE 
J090005B16TAGGCCCATCTNONE 
J090079L11TAGGCCCATCTNONE 
J100039F16TAGGCCCATCTNONE 
Os01g0331900013-026-D04ATATGGGCCTANONE 
AK064784ATATGGGCCTANONE 
AK121761ATATGGGCCTAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15ATATGGGCCTANONE 
J033090D07ATATGGGCCTANONE 
J090006L21ATATGGGCCTANONE 
Os01g0506200AK073118TCATGGGCCTGTetratricopeptide-like helical domain containing protein. 
J065002A07TCATGGGCCTGNONE 
J065079J08TCATGGGCCTGNONE 
J065167M18TCATGGGCCTGNONE 
Os01g0514300AK121086TGATGGGCCTTLissencephaly type-1-like homology motif domain containing protein. 
Os01g0571200014-074-A10TAGGCCCATTTNONE 
AK121299TAGGCCCATTTSimilar to Ribosomal protein L34. 
J023110L12TAGGCCCATTTNONE 
Os01g0596300016-083-D09TCATGGGCCTTNONE 
AK069151TCATGGGCCTTCyclin-like F-box domain containing protein. 
J023007D17TCATGGGCCTTNONE 
J065141M02TCATGGGCCTTNONE 
Os01g0618500011-019-D03TGATGGGCCTTNONE 
AK067476TGATGGGCCTTSimilar to RNA helicase (Fragment). 
J013020E19TGATGGGCCTTNONE 
J033046J12TGATGGGCCTTNONE 
J033055D06TGATGGGCCTTNONE 
Os01g0661400AK073113TAGGCCCATCTNucleic acid-binding, OB-fold domain containing protein. 
J023014C20TAGGCCCATCTNONE 
J033022G03TAGGCCCATCTNONE 
J065050H15TAGGCCCATCTNONE 
J065059J19TAGGCCCATCTNONE 
J065085I24TAGGCCCATCTNONE 
J065166G12TAGGCCCATCTNONE 
J065182C18TAGGCCCATCTNONE 
Os01g0666500AK102689GAGGCCCATCAConserved hypothetical protein. 
Os01g0686800006-098-B12TAGGCCCATACNONE 
006-113-H04TAGGCCCATACNONE 
AK060428TAGGCCCATACNONE 
AK098877TAGGCCCATACNONE 
AK098893TAGGCCCATACNONE 
AK121587TAGGCCCATACGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231TAGGCCCATACNONE 
J013001E12TAGGCCCATACNONE 
J013001N15TAGGCCCATACNONE 
J013098G22TAGGCCCATACNONE 
J023004P15TAGGCCCATACNONE 
J023014D09TAGGCCCATACNONE 
J023020G09TAGGCCCATACNONE 
J023034A19TAGGCCCATACNONE 
J023050I11TAGGCCCATACNONE 
J023079D13TAGGCCCATACNONE 
J023091B11TAGGCCCATACNONE 
J023099M03TAGGCCCATACNONE 
J023101H20TAGGCCCATACNONE 
J023106P14TAGGCCCATACNONE 
J023111F19TAGGCCCATACNONE 
J023132C22TAGGCCCATACNONE 
J023139O03TAGGCCCATACNONE 
J023146O10TAGGCCCATACNONE 
J033022G16TAGGCCCATACNONE 
J033030C10TAGGCCCATACNONE 
J033032G18TAGGCCCATACNONE 
J033034N09TAGGCCCATACNONE 
J033037K24TAGGCCCATACNONE 
J033038B22TAGGCCCATACNONE 
J033061E06TAGGCCCATACNONE 
J033065F08TAGGCCCATACNONE 
J033065I24TAGGCCCATACNONE 
J033069L01TAGGCCCATACNONE 
J033086N21TAGGCCCATACNONE 
J033102I06TAGGCCCATACNONE 
J033111N07TAGGCCCATACNONE 
J033118K11TAGGCCCATACNONE 
J033125D08TAGGCCCATACNONE 
J033129P22TAGGCCCATACNONE 
J033131L12TAGGCCCATACNONE 
J033139D08TAGGCCCATACNONE 
J033141J08TAGGCCCATACNONE 
J043024B14TAGGCCCATACNONE 
J053048G19TAGGCCCATACNONE 
J065023B15TAGGCCCATACNONE 
J065082C15TAGGCCCATACNONE 
J065087D24TAGGCCCATACNONE 
J065122D11TAGGCCCATACNONE 
J065128P13TAGGCCCATACNONE 
J065149I19TAGGCCCATACNONE 
J065154E16TAGGCCCATACNONE 
J065156K21TAGGCCCATACNONE 
J065166H09TAGGCCCATACNONE 
J065169F24TAGGCCCATACNONE 
J065194I16TAGGCCCATACNONE 
J065213M20TAGGCCCATACNONE 
J075020F19TAGGCCCATACNONE 
J075051J16TAGGCCCATACNONE 
J075093C18TAGGCCCATACNONE 
J075119H02TAGGCCCATACNONE 
J075120J11TAGGCCCATACNONE 
J075173A15TAGGCCCATACNONE 
J080302B05TAGGCCCATACNONE 
J080304G10TAGGCCCATACNONE 
J080305E13TAGGCCCATACNONE 
J080315L11TAGGCCCATACNONE 
J090005H15TAGGCCCATACNONE 
J090021C24TAGGCCCATACNONE 
J090025H24TAGGCCCATACNONE 
J090025M11TAGGCCCATACNONE 
J090026C22TAGGCCCATACNONE 
J090027H15TAGGCCCATACNONE 
J090034B17TAGGCCCATACNONE 
J090045G11TAGGCCCATACNONE 
J090048H02TAGGCCCATACNONE 
J090051N04TAGGCCCATACNONE 
J090052I06TAGGCCCATACNONE 
J090054L17TAGGCCCATACNONE 
J090060M22TAGGCCCATACNONE 
J090075N17TAGGCCCATACNONE 
J090079K13TAGGCCCATACNONE 
J090086H08TAGGCCCATACNONE 
J090094N20TAGGCCCATACNONE 
J100021F03TAGGCCCATACNONE 
J100031M01TAGGCCCATACNONE 
J100033I18TAGGCCCATACNONE 
J100034P07TAGGCCCATACNONE 
J100043M16TAGGCCCATACNONE 
J100046J12TAGGCCCATACNONE 
J100055F09TAGGCCCATACNONE 
J100057D19TAGGCCCATACNONE 
J100060O10TAGGCCCATACNONE 
J100064G09TAGGCCCATACNONE 
J100077F24TAGGCCCATACNONE 
J100080E12TAGGCCCATACNONE 
J100089J04TAGGCCCATACNONE 
Os01g0708600AK111377AAGGCCCATGGTransport protein particle (TRAPP) component, Bet3 family protein. 
J065006D07AAGGCCCATGGNONE 
J065007E03AAGGCCCATGGNONE 
J065015A13AAGGCCCATGGNONE 
J065093J17AAGGCCCATGGNONE 
J065116C09AAGGCCCATGGNONE 
J065120E04AAGGCCCATGGNONE 
J065197I17AAGGCCCATGGNONE 
J065208L13AAGGCCCATGGNONE 
J065213P07AAGGCCCATGGNONE 
J075056K07AAGGCCCATGGNONE 
J090036L08AAGGCCCATGGNONE 
Os01g0709500AK065353AAGGCCCATGGNONE 
AK121129AAGGCCCATGGSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1). 
Os01g0710000AK111794AAATGGGCCTASimilar to WD-repeat protein RBAP1. 
J023006D22AAATGGGCCTANONE 
J065106P04AAATGGGCCTANONE 
J100036G13AAATGGGCCTANONE 
Os01g0710800013-097-E05TTTTGGGCCTTAGGCCCATATNONE 
AK069973TTTTGGGCCTTAGGCCCATATNONE 
AK071099TTTTGGGCCTTAGGCCCATATConserved hypothetical protein. 
J023081K01TTTTGGGCCTTAGGCCCATATNONE 
J023123E16TTTTGGGCCTTAGGCCCATATNONE 
J033066B11TTTTGGGCCTTAGGCCCATATNONE 
J065144G11TTTTGGGCCTTAGGCCCATATNONE 
Os01g0719250AK105184TAGGCCCATTGGGCTConserved hypothetical protein. 
Os01g0720500003-129-C07TAGGCCCATCCNONE 
004-015-C03TAGGCCCATCCNONE 
004-016-C06TAGGCCCATCCNONE 
006-022-A02TAGGCCCATCCNONE 
006-022-C04TAGGCCCATCCNONE 
006-022-C05TAGGCCCATCCNONE 
006-026-H07TAGGCCCATCCNONE 
006-028-A10TAGGCCCATCCNONE 
006-028-B01TAGGCCCATCCNONE 
006-030-F02TAGGCCCATCCNONE 
006-031-H01TAGGCCCATCCNONE 
006-046-G10TAGGCCCATCCNONE 
006-049-C03TAGGCCCATCCNONE 
006-050-C08TAGGCCCATCCNONE 
006-051-B12TAGGCCCATCCNONE 
006-051-F11TAGGCCCATCCNONE 
006-053-E07TAGGCCCATCCNONE 
006-055-H07TAGGCCCATCCNONE 
006-056-A12TAGGCCCATCCNONE 
006-060-C01TAGGCCCATCCNONE 
006-060-D10TAGGCCCATCCNONE 
006-063-B05TAGGCCCATCCNONE 
006-063-B09TAGGCCCATCCNONE 
006-071-H09TAGGCCCATCCNONE 
006-081-A08TAGGCCCATCCNONE 
006-082-G12TAGGCCCATCCNONE 
006-084-C09TAGGCCCATCCNONE 
006-085-A04TAGGCCCATCCNONE 
006-086-A02TAGGCCCATCCNONE 
006-086-G11TAGGCCCATCCNONE 
006-087-E07TAGGCCCATCCNONE 
006-090-H01TAGGCCCATCCNONE 
006-092-G11TAGGCCCATCCNONE 
006-093-E01TAGGCCCATCCNONE 
006-095-F02TAGGCCCATCCNONE 
006-097-C08TAGGCCCATCCNONE 
006-098-A01TAGGCCCATCCNONE 
006-100-A10TAGGCCCATCCNONE 
006-109-C10TAGGCCCATCCNONE 
006-112-A11TAGGCCCATCCNONE 
006-112-F09TAGGCCCATCCNONE 
006-113-B08TAGGCCCATCCNONE 
006-113-F01TAGGCCCATCCNONE 
006-115-B01TAGGCCCATCCNONE 
006-116-B11TAGGCCCATCCNONE 
006-118-B05TAGGCCCATCCNONE 
006-118-E04TAGGCCCATCCNONE 
006-119-G08TAGGCCCATCCNONE 
006-120-F04TAGGCCCATCCNONE 
009-078-E06TAGGCCCATCCNONE 
009-097-A11TAGGCCCATCCNONE 
009-115-F02TAGGCCCATCCNONE 
009-135-H12TAGGCCCATCCNONE 
009-145-C06TAGGCCCATCCNONE 
009-187-B03TAGGCCCATCCNONE 
009-197-C08TAGGCCCATCCNONE 
AK058289TAGGCCCATCCNONE 
AK062725TAGGCCCATCCSimilar to Type I chlorophyll a/b-binding protein b (Fragment). 
AK103946TAGGCCCATCCNONE 
AK104176TAGGCCCATCCNONE 
J023055C17TAGGCCCATCCNONE 
J033101K18TAGGCCCATCCNONE 
J075041N01TAGGCCCATCCNONE 
U74295TAGGCCCATCCNONE 
Os01g0727900AK102017AAGGCCCATGAConserved hypothetical protein. 
J033080F19AAGGCCCATGANONE 
Os01g0737900012-087-D12AAGGCCCATTGGGCCTTNONE 
AK072600AAGGCCCATTGGGCCTTProtein prenyltransferase domain containing protein. 
J023006E12AAGGCCCATTGGGCCTTNONE 
J023130A18AAGGCCCATTGGGCCTTNONE 
J023134O05AAGGCCCATTGGGCCTTNONE 
Os01g0749200006-074-H04AAGGCCCATCTNONE 
AK072760AAGGCCCATCTNONE 
AK099041AAGGCCCATCTNONE 
AK104146AAGGCCCATCTSimilar to 50S ribosomal protein L13. 
AK119189AAGGCCCATCTNONE 
Os01g0754000014-081-F07CCAGGCCCATCTNONE 
AK063730CCAGGCCCATCTConserved hypothetical protein. 
J065219A11CCAGGCCCATCTNONE 
J075136N13CCAGGCCCATCTNONE 
J100051G01CCAGGCCCATCTNONE 
J100053M22CCAGGCCCATCTNONE 
Os01g0773600AK067004TCATGGGCCTAGlycoside hydrolase, family 47 protein. 
J013091F09TCATGGGCCTANONE 
J013134K14TCATGGGCCTANONE 
J013158J15TCATGGGCCTANONE 
J033060O20TCATGGGCCTANONE 
J033074C16TCATGGGCCTANONE 
J075086F05TCATGGGCCTANONE 
J075150H08TCATGGGCCTANONE 
J090006E02TCATGGGCCTANONE 
J090074E02TCATGGGCCTANONE 
J100030M05TCATGGGCCTANONE 
J100036M16TCATGGGCCTANONE 
J100063H18TCATGGGCCTANONE 
Os01g0784600AK067527ACATGGGCTAATGGGCCTAConserved hypothetical protein. 
Os01g0801700AK073813AAATGGGCCTTConserved hypothetical protein. 
J033067K14AAATGGGCCTTNONE 
Os01g0805000009-045-H11AAGGCCCATGANONE 
009-045-H11TAATGGGCCTANONE 
009-196-H08AAGGCCCATGANONE 
009-196-H08TAATGGGCCTANONE 
J013094D22AAGGCCCATGARibosomal protein L34 family protein. 
J013094D22TAATGGGCCTARibosomal protein L34 family protein. 
J013119F23AAGGCCCATGANONE 
J013119F23TAATGGGCCTANONE 
J065128B11AAGGCCCATGANONE 
J065128B11TAATGGGCCTANONE 
Os01g0829266J065010C18AATGGGCCTANONE 
J065037A22AATGGGCCTANONE 
J065044B02AATGGGCCTAConserved hypothetical protein. 
J065044B10AATGGGCCTANONE 
J065051A06AATGGGCCTANONE 
J065073E06AATGGGCCTANONE 
J065074I11AATGGGCCTANONE 
J065086D22AATGGGCCTANONE 
J065104H10AATGGGCCTANONE 
J065107C05AATGGGCCTANONE 
J065124H16AATGGGCCTANONE 
J065165F22AATGGGCCTANONE 
J065169B11AATGGGCCTANONE 
J065172G21AATGGGCCTANONE 
J065191E05AATGGGCCTANONE 
J065191F18AATGGGCCTANONE 
Os01g0833000AK067226CAGGCCCATGAProtein prenyltransferase domain containing protein. 
J013098M23CAGGCCCATGANONE 
Os01g0857700006-045-F05GAGGCCCATGANONE 
AK066959GAGGCCCATGASimilar to G10. 
AK099794GAGGCCCATGANONE 
J013093N15GAGGCCCATGANONE 
J023105B19GAGGCCCATGANONE 
Os01g0876500J053026A07GAGGCCCATTTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17GAGGCCCATTTNONE 
Os01g0888700AK073376GAGGCCCATAAProtein of unknown function RIO1 family protein. 
J033030B16GAGGCCCATAANONE 
J033098D06GAGGCCCATAANONE 
J033112A12GAGGCCCATAANONE 
J043003L24GAGGCCCATAANONE 
Os01g0889000AK103621CCAGGCCCATCATetratricopeptide-like helical domain containing protein. 
Os01g0889800003-107-A06CAAGGCCCATATNONE 
003-107-A06GAAGCCCATGGGCCTCNONE 
005-016-H12CAAGGCCCATATNONE 
005-016-H12GAAGCCCATGGGCCTCNONE 
AK070087CAAGGCCCATATRhodanese-like domain containing protein. 
AK070087GAAGCCCATGGGCCTCRhodanese-like domain containing protein. 
AK104708CAAGGCCCATATNONE 
AK104708GAAGCCCATGGGCCTCNONE 
J013035D13CAAGGCCCATATNONE 
J013035D13GAAGCCCATGGGCCTCNONE 
J013068K01CAAGGCCCATATNONE 
J013068K01GAAGCCCATGGGCCTCNONE 
J023042J18CAAGGCCCATATNONE 
J023042J18GAAGCCCATGGGCCTCNONE 
J053023F13CAAGGCCCATATNONE 
J053023F13GAAGCCCATGGGCCTCNONE 
J053026M13CAAGGCCCATATNONE 
J053026M13GAAGCCCATGGGCCTCNONE 
J053033N15CAAGGCCCATATNONE 
J053033N15GAAGCCCATGGGCCTCNONE 
J053035I16CAAGGCCCATATNONE 
J053035I16GAAGCCCATGGGCCTCNONE 
J053039A11CAAGGCCCATATNONE 
J053039A11GAAGCCCATGGGCCTCNONE 
J053039K22CAAGGCCCATATNONE 
J053039K22GAAGCCCATGGGCCTCNONE 
J053043B08CAAGGCCCATATNONE 
J053043B08GAAGCCCATGGGCCTCNONE 
J053068K09CAAGGCCCATATNONE 
J053068K09GAAGCCCATGGGCCTCNONE 
J053082D11CAAGGCCCATATNONE 
J053082D11GAAGCCCATGGGCCTCNONE 
J053092N12CAAGGCCCATATNONE 
J053092N12GAAGCCCATGGGCCTCNONE 
J053099A19CAAGGCCCATATNONE 
J053099A19GAAGCCCATGGGCCTCNONE 
J065027F17CAAGGCCCATATNONE 
J065027F17GAAGCCCATGGGCCTCNONE 
J065039B13CAAGGCCCATATNONE 
J065039B13GAAGCCCATGGGCCTCNONE 
J065139N16CAAGGCCCATATNONE 
J065139N16GAAGCCCATGGGCCTCNONE 
J065205B22CAAGGCCCATATNONE 
J065205B22GAAGCCCATGGGCCTCNONE 
Os01g0894700009-177-F04AAGGCCCATTTNONE 
009-177-F04AGCCCAAAGGCCCATTTNONE 
AK067623AAGGCCCATTTConserved hypothetical protein. 
AK067623AGCCCAAAGGCCCATTTConserved hypothetical protein. 
AK104876AAGGCCCATTTNONE 
AK104876AGCCCAAAGGCCCATTTNONE 
J013095G01AAGGCCCATTTNONE 
J013095G01AGCCCAAAGGCCCATTTNONE 
J013108L20AAGGCCCATTTNONE 
J013108L20AGCCCAAAGGCCCATTTNONE 
J013120P13AAGGCCCATTTNONE 
J013120P13AGCCCAAAGGCCCATTTNONE 
Os01g0895100AK058611ATATGGGCCTASimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK067698ATATGGGCCTANONE 
AK099166ATATGGGCCTANONE 
J023065I03ATATGGGCCTANONE 
J023081J06ATATGGGCCTANONE 
J023126H17ATATGGGCCTANONE 
J023126O09ATATGGGCCTANONE 
J033035I06ATATGGGCCTANONE 
J090065C10ATATGGGCCTANONE 
J090095O16ATATGGGCCTANONE 
Os01g0896800AK065268GAGGCCCATCANONE 
AK104693GAGGCCCATCAEukaryotic ribosomal protein L5 family protein. 
J013126P09GAGGCCCATCANONE 
J033046N15GAGGCCCATCANONE 
J090008K02GAGGCCCATCANONE 
J090024F15GAGGCCCATCANONE 
J090074I23GAGGCCCATCANONE 
J090093F03GAGGCCCATCANONE 
J090096N02GAGGCCCATCANONE 
Os01g0908400009-140-E01GAGGCCCATTTNONE 
AK062957GAGGCCCATTTConserved hypothetical protein. 
AK099301GAGGCCCATTTNONE 
J065123M13GAGGCCCATTTNONE 
J075020O14GAGGCCCATTTNONE 
J075136L21GAGGCCCATTTNONE 
Os01g0915800AK103859AAATGGGCCTCSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20AAATGGGCCTCNONE 
J090056H03AAATGGGCCTCNONE 
J090058L14AAATGGGCCTCNONE 
J090058P16AAATGGGCCTCNONE 
J090076C19AAATGGGCCTCNONE 
J100086P14AAATGGGCCTCNONE 
Os01g0929500AK111399TAGGCCCATCCSimilar to Carbonyl reductase-like protein. 
AK120263TAGGCCCATCCNONE 
Os01g0934500AK073211CAGGCCCATCTConserved hypothetical protein. 
Os01g0938900006-059-H02AAATGGGCCTTNONE 
009-074-D12AAATGGGCCTTNONE 
AK059437AAATGGGCCTTNONE 
AK101971AAATGGGCCTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK109341AAATGGGCCTTNONE 
J023121P08AAATGGGCCTTNONE 
J033046G24AAATGGGCCTTNONE 
J033048E04AAATGGGCCTTNONE 
J033048F04AAATGGGCCTTNONE 
J033076L24AAATGGGCCTTNONE 
J065173H07AAATGGGCCTTNONE 
J065184H09AAATGGGCCTTNONE 
Os01g0948100AK111411GAGGCCCATGAERCC4 domain containing protein. 
J090089O16GAGGCCCATGANONE 
Os01g0948300009-023-A03AGATGGGCCTTGNONE 
AK102153AGATGGGCCTTGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J013090K24AGATGGGCCTTGNONE 
J023019C13AGATGGGCCTTGNONE 
J023049L21AGATGGGCCTTGNONE 
J023066H02AGATGGGCCTTGNONE 
J033050A07AGATGGGCCTTGNONE 
J033086E01AGATGGGCCTTGNONE 
J033086F11AGATGGGCCTTGNONE 
J090047I04AGATGGGCCTTGNONE 
J100035E10AGATGGGCCTTGNONE 
J100040L06AGATGGGCCTTGNONE 
J100044G21AGATGGGCCTTGNONE 
J100045F13AGATGGGCCTTGNONE 
J100046G12AGATGGGCCTTGNONE 
J100075N10AGATGGGCCTTGNONE 
J100077I01AGATGGGCCTTGNONE 
Os01g0950900AK101121AGATGGGCCTTGGCCCATGAProtein of unknown function DUF221 domain containing protein. 
J023036H24AGATGGGCCTTGGCCCATGANONE 
J023084G23AGATGGGCCTTGGCCCATGANONE 
J033025J04AGATGGGCCTTGGCCCATGANONE 
J033139J18AGATGGGCCTTGGCCCATGANONE 
J090006A09AGATGGGCCTTGGCCCATGANONE 
J090036D02AGATGGGCCTTGGCCCATGANONE 
Os01g0958100AK058574CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTNONE 
Os01g0959900AK058375ATATGGGCCTTConserved hypothetical protein. 
AK066497ATATGGGCCTTNONE 
Os01g0960300AK100099TTATGGGCCTTSimilar to Glucose inhibited division protein A. 
Os01g0960800AK073977TAATGGGCCTAProtein Transporter, Pam16 family protein. 
AK073977TAATGGGCCTGAProtein Transporter, Pam16 family protein. 
AK073977TAATGGGCCTGGProtein Transporter, Pam16 family protein. 
AY313247TAATGGGCCTANONE 
AY313247TAATGGGCCTGANONE 
AY313247TAATGGGCCTGGNONE 
J033075P16TAATGGGCCTANONE 
J033075P16TAATGGGCCTGANONE 
J033075P16TAATGGGCCTGGNONE 
J065051H06TAATGGGCCTANONE 
J065051H06TAATGGGCCTGANONE 
J065051H06TAATGGGCCTGGNONE 
J065167L02TAATGGGCCTANONE 
J065167L02TAATGGGCCTGANONE 
J065167L02TAATGGGCCTGGNONE 
J090083C22TAATGGGCCTANONE 
J090083C22TAATGGGCCTGANONE 
J090083C22TAATGGGCCTGGNONE 
Os01g0962600009-104-A04GAGGCCCATGTNONE 
AK073846GAGGCCCATGTSimilar to 40S ribosomal protein S10-1. 
J033070I05GAGGCCCATGTNONE 
J065079N18GAGGCCCATGTNONE 
J065122H12GAGGCCCATGTNONE 
J065197O14GAGGCCCATGTNONE 
Os01g0969100AK070623GAGGCCCATGCAGGCCCACCAACNAD-dependent epimerase/dehydratase family protein. 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK099169ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J023009L14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075025G03ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J075198E21ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090004B14ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J090071P11ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
J100075A22ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
U34597ATTTGGGCCCATGGGCCTGATAAGCCCAACNONE 
Os02g0116900009-017-C02TAATGGGCCTANONE 
AK121401TAATGGGCCTASimilar to 15.9 kDa subunit of RNA polymerase II. 
J013105H09TAATGGGCCTANONE 
J023131N03TAATGGGCCTANONE 
J033145N08TAATGGGCCTANONE 
J065105G09TAATGGGCCTANONE 
J075086L06TAATGGGCCTANONE 
Os02g0121200AK070123GAGGCCCATGTNONE 
AK121751GAGGCCCATGTProtein of unknown function DUF890 family protein. 
Os02g0136800011-089-E11TTATGGGCCTANONE 
AK070727TTATGGGCCTANONE 
AK103485TTATGGGCCTAProtein of unknown function DUF1677, Oryza sativa family protein. 
J023058D10TTATGGGCCTANONE 
J033140H14TTATGGGCCTANONE 
J033142H14TTATGGGCCTANONE 
J065151O09TTATGGGCCTANONE 
J090076K09TTATGGGCCTANONE 
J090085K04TTATGGGCCTANONE 
Os02g0178400009-151-B08TAGGCCCATGGGCCGGANONE 
009-151-B08TTGGCCCACGAGGCCCATAANONE 
AK063815TAGGCCCATGGGCCGGAProtein transport protein SEC61 gamma subunit. 
AK063815TTGGCCCACGAGGCCCATAAProtein transport protein SEC61 gamma subunit. 
AK121516TAGGCCCATGGGCCGGANONE 
AK121516TTGGCCCACGAGGCCCATAANONE 
J033026A17TAGGCCCATGGGCCGGANONE 
J033026A17TTGGCCCACGAGGCCCATAANONE 
J065011K14TAGGCCCATGGGCCGGANONE 
J065011K14TTGGCCCACGAGGCCCATAANONE 
J065056D01TAGGCCCATGGGCCGGANONE 
J065056D01TTGGCCCACGAGGCCCATAANONE 
J065061L22TAGGCCCATGGGCCGGANONE 
J065061L22TTGGCCCACGAGGCCCATAANONE 
J065076M01TAGGCCCATGGGCCGGANONE 
J065076M01TTGGCCCACGAGGCCCATAANONE 
J075092E14TAGGCCCATGGGCCGGANONE 
J075092E14TTGGCCCACGAGGCCCATAANONE 
Os02g0179100AK058557CCAGGCCCATCAMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10CCAGGCCCATCANONE 
Os02g0188500AK102004TCAGGCCCATATNONE 
AK106917TCAGGCCCATATUbiquitin domain containing protein. 
J090039N13TCAGGCCCATATNONE 
Os02g0189100AK111066GAGGCCCATATConserved hypothetical protein. 
J053061N01GAGGCCCATATNONE 
J053088H13GAGGCCCATATNONE 
J065038F12GAGGCCCATATNONE 
J065083I18GAGGCCCATATNONE 
J065085A17GAGGCCCATATNONE 
J065110G06GAGGCCCATATNONE 
J065117J19GAGGCCCATATNONE 
J065120D21GAGGCCCATATNONE 
J065121C23GAGGCCCATATNONE 
J065174E03GAGGCCCATATNONE 
J075182G01GAGGCCCATATNONE 
J080302D10GAGGCCCATATNONE 
J080309F08GAGGCCCATATNONE 
J080310H15GAGGCCCATATNONE 
Os02g0208200J023104K09AGATGGGCCTGANONE 
J033080L20AGATGGGCCTGANONE 
J033105D08AGATGGGCCTGANONE 
J090079N16AGATGGGCCTGANONE 
Os02g0220600AK103901AAGGCCCATTTCAGCCCAACANONE 
J013058O03AAGGCCCATTTCAGCCCAACANONE 
J013124E21AAGGCCCATTTCAGCCCAACANONE 
J023023L03AAGGCCCATTTCAGCCCAACANONE 
J023023L21AAGGCCCATTTCAGCCCAACANONE 
J023061N01AAGGCCCATTTCAGCCCAACANONE 
J023065O09AAGGCCCATTTCAGCCCAACANONE 
J023106J17AAGGCCCATTTCAGCCCAACANONE 
J023119N08AAGGCCCATTTCAGCCCAACANONE 
J033058A19AAGGCCCATTTCAGCCCAACANONE 
J033098O13AAGGCCCATTTCAGCCCAACANONE 
J033100M18AAGGCCCATTTCAGCCCAACANONE 
J033125A21AAGGCCCATTTCAGCCCAACANONE 
J033148C12AAGGCCCATTTCAGCCCAACANONE 
J043017F03AAGGCCCATTTCAGCCCAACANONE 
J043032J02AAGGCCCATTTCAGCCCAACANONE 
J053047N10AAGGCCCATTTCAGCCCAACANONE 
J053089P04AAGGCCCATTTCAGCCCAACANONE 
J065051K09AAGGCCCATTTCAGCCCAACANONE 
J065064H24AAGGCCCATTTCAGCCCAACANONE 
J090001L06AAGGCCCATTTCAGCCCAACANONE 
J090017C24AAGGCCCATTTCAGCCCAACANONE 
J090058G15AAGGCCCATTTCAGCCCAACANONE 
J090058H23AAGGCCCATTTCAGCCCAACANONE 
J090061G20AAGGCCCATTTCAGCCCAACANONE 
J090069N23AAGGCCCATTTCAGCCCAACANONE 
J090071A08AAGGCCCATTTCAGCCCAACANONE 
J090074A08AAGGCCCATTTCAGCCCAACANONE 
J090077B15AAGGCCCATTTCAGCCCAACANONE 
J090081K06AAGGCCCATTTCAGCCCAACANONE 
J090083I05AAGGCCCATTTCAGCCCAACANONE 
J090091O22AAGGCCCATTTCAGCCCAACANONE 
J090097L10AAGGCCCATTTCAGCCCAACANONE 
J100026B11AAGGCCCATTTCAGCCCAACANONE 
J100044M01AAGGCCCATTTCAGCCCAACANONE 
J100046F10AAGGCCCATTTCAGCCCAACANONE 
J100051K14AAGGCCCATTTCAGCCCAACANONE 
J100060D22AAGGCCCATTTCAGCCCAACANONE 
J100060H18AAGGCCCATTTCAGCCCAACANONE 
J100070I06AAGGCCCATTTCAGCCCAACANONE 
J100071C04AAGGCCCATTTCAGCCCAACANONE 
J100078M13AAGGCCCATTTCAGCCCAACANONE 
J100080E17AAGGCCCATTTCAGCCCAACANONE 
J100083I09AAGGCCCATTTCAGCCCAACANONE 
Os02g0241100Os02g0241100GAGGCCCATGTProtein kinase-like domain containing protein. 
Os02g0255200AK121591AAGGCCCAAGGCCCATTASimilar to Ribosomal protein S15a homolog. 
J033023N03AAGGCCCAAGGCCCATTANONE 
J033031C22AAGGCCCAAGGCCCATTANONE 
J033037P22AAGGCCCAAGGCCCATTANONE 
J090013J10AAGGCCCAAGGCCCATTANONE 
J090030I04AAGGCCCAAGGCCCATTANONE 
Os02g0266500AK100307TAATGGGCCTASimilar to RASPBERRY3. 
AK100307TCAGGCCCATTSimilar to RASPBERRY3. 
Os02g0287000006-107-B10AAATGGGCCTCNONE 
006-120-E07AAATGGGCCTCNONE 
AF052503AAATGGGCCTCNONE 
AK059647AAATGGGCCTCSimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK099131AAATGGGCCTCNONE 
J023048M05AAATGGGCCTCNONE 
J033107L10AAATGGGCCTCNONE 
J065019A12AAATGGGCCTCNONE 
J065064J21AAATGGGCCTCNONE 
J065071D15AAATGGGCCTCNONE 
J065094L12AAATGGGCCTCNONE 
J065095L06AAATGGGCCTCNONE 
J065097J11AAATGGGCCTCNONE 
J065099M08AAATGGGCCTCNONE 
J065104D01AAATGGGCCTCNONE 
J065107L02AAATGGGCCTCNONE 
J065110D14AAATGGGCCTCNONE 
J065135J07AAATGGGCCTCNONE 
J065137C16AAATGGGCCTCNONE 
J065150C07AAATGGGCCTCNONE 
J065165I10AAATGGGCCTCNONE 
J065189F07AAATGGGCCTCNONE 
J065205L22AAATGGGCCTCNONE 
J065214C09AAATGGGCCTCNONE 
J065217G17AAATGGGCCTCNONE 
J075029E17AAATGGGCCTCNONE 
J075054O16AAATGGGCCTCNONE 
J075068N23AAATGGGCCTCNONE 
J075135N18AAATGGGCCTCNONE 
J075152G09AAATGGGCCTCNONE 
J075162D10AAATGGGCCTCNONE 
J075164F11AAATGGGCCTCNONE 
J080036L12AAATGGGCCTCNONE 
J080049K18AAATGGGCCTCNONE 
J080060P03AAATGGGCCTCNONE 
J080062G16AAATGGGCCTCNONE 
J080062G21AAATGGGCCTCNONE 
J080064N07AAATGGGCCTCNONE 
J080075I22AAATGGGCCTCNONE 
J080086F20AAATGGGCCTCNONE 
J080087G07AAATGGGCCTCNONE 
J080088I06AAATGGGCCTCNONE 
J080302B20AAATGGGCCTCNONE 
J080303L14AAATGGGCCTCNONE 
J080309O12AAATGGGCCTCNONE 
J080317F12AAATGGGCCTCNONE 
J080317P18AAATGGGCCTCNONE 
J090013L15AAATGGGCCTCNONE 
J090043N04AAATGGGCCTCNONE 
J090085G01AAATGGGCCTCNONE 
J090085G19AAATGGGCCTCNONE 
Os02g0321900AK058256TAGGCCCATAGCCCATCANONE 
AK062103TAGGCCCATAGCCCATCASimilar to 60S ribosomal protein L10a-1. 
AK102574TAGGCCCATAGCCCATCANONE 
J065176M06TAGGCCCATAGCCCATCANONE 
J075112D24TAGGCCCATAGCCCATCANONE 
Os02g0332200AK067672GAGGCCCATCASimilar to T-complex protein 1 delta subunit. 
Os02g0467700AK121672GAGGCCCATGTGlycosyltransferase 28, C-terminal domain containing protein. 
J033068B18GAGGCCCATGTNONE 
J080035D09GAGGCCCATGTNONE 
J080039E21GAGGCCCATGTNONE 
J080054N01GAGGCCCATGTNONE 
J080071C12GAGGCCCATGTNONE 
Os02g0468200AK103767CCAGGCCCATCAAAGCCCAAATProtein of unknown function DUF652 family protein. 
J033071N12CCAGGCCCATCAAAGCCCAAATNONE 
J033143I02CCAGGCCCATCAAAGCCCAAATNONE 
J100019J22CCAGGCCCATCAAAGCCCAAATNONE 
J100075O13CCAGGCCCATCAAAGCCCAAATNONE 
Os02g0526500006-107-D09AAATGGGCCTCNONE 
006-107-D09AATGGGCCTANONE 
Os02g0562300AK073250GAGGCCCATGACalmodulin binding protein-like family protein. 
Os02g0582600006-041-F11TGGATGGGCCTTNONE 
AK059791TGGATGGGCCTTNONE 
AK102380TGGATGGGCCTTHeavy metal transport/detoxification protein domain containing protein. 
J033092A09TGGATGGGCCTTNONE 
Os02g0618700AK070657GAGGCCCATTTLung seven transmembrane receptor family protein. 
J023056H15GAGGCCCATTTNONE 
Os02g0621700011-079-F10TAGGCCCATGANONE 
AK101006TAGGCCCATGASimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC 6.2.1.4) (Succinyl-CoA synthetase, beta chain) (SCS-beta). 
AK103525TAGGCCCATGANONE 
J013026C02TAGGCCCATGANONE 
J013104M10TAGGCCCATGANONE 
J023003D01TAGGCCCATGANONE 
J023007H13TAGGCCCATGANONE 
J023019G09TAGGCCCATGANONE 
J023020L19TAGGCCCATGANONE 
J023022L12TAGGCCCATGANONE 
J023022O14TAGGCCCATGANONE 
J023036F16TAGGCCCATGANONE 
J023047D16TAGGCCCATGANONE 
J023052P08TAGGCCCATGANONE 
J023077C01TAGGCCCATGANONE 
J023083M06TAGGCCCATGANONE 
J023105A11TAGGCCCATGANONE 
J023117F21TAGGCCCATGANONE 
J023119D20TAGGCCCATGANONE 
J023148E03TAGGCCCATGANONE 
J023149B13TAGGCCCATGANONE 
J033029A10TAGGCCCATGANONE 
J033046L17TAGGCCCATGANONE 
J033052M04TAGGCCCATGANONE 
J033057M14TAGGCCCATGANONE 
J033066K24TAGGCCCATGANONE 
J033069K02TAGGCCCATGANONE 
J033079G14TAGGCCCATGANONE 
J033101E06TAGGCCCATGANONE 
J033116E06TAGGCCCATGANONE 
J033118L18TAGGCCCATGANONE 
J033135B13TAGGCCCATGANONE 
J033136C10TAGGCCCATGANONE 
J033136P08TAGGCCCATGANONE 
J043027B13TAGGCCCATGANONE 
J065039I03TAGGCCCATGANONE 
J065185N21TAGGCCCATGANONE 
J090008D14TAGGCCCATGANONE 
J090029K17TAGGCCCATGANONE 
J090047H20TAGGCCCATGANONE 
J090048N17TAGGCCCATGANONE 
J090085G08TAGGCCCATGANONE 
J090089F07TAGGCCCATGANONE 
Os02g0633200012-053-F09CACGGCCCAATAGGCCCATTANONE 
015-051-C09CACGGCCCAATAGGCCCATTANONE 
AK063500CACGGCCCAATAGGCCCATTAProtein prenyltransferase domain containing protein. 
J065019K23CACGGCCCAATAGGCCCATTANONE 
J065205C16CACGGCCCAATAGGCCCATTANONE 
Os02g0643500AK068423AAGGCCCATAAPentapeptide repeat containing protein. 
Os02g0655700AK101068AAATGGGCCTCAmino acid/polyamine transporter I family protein. 
AK101068AAATGGGCCTTAmino acid/polyamine transporter I family protein. 
J013026C06AAATGGGCCTCNONE 
J013026C06AAATGGGCCTTNONE 
J033023I17AAATGGGCCTCNONE 
J033023I17AAATGGGCCTTNONE 
Os02g0658300AK073923AAGGCCCATTAConserved hypothetical protein. 
J065152M15AAGGCCCATTANONE 
Os02g0666800AK101444CAAGGCCCATTTProtein of unknown function DUF788 family protein. 
AK101444TAATGGGCCTCProtein of unknown function DUF788 family protein. 
J033039F09CAAGGCCCATTTNONE 
J033039F09TAATGGGCCTCNONE 
J065041E15CAAGGCCCATTTNONE 
J065041E15TAATGGGCCTCNONE 
J075087I24CAAGGCCCATTTNONE 
J075087I24TAATGGGCCTCNONE 
J100079A10CAAGGCCCATTTNONE 
J100079A10TAATGGGCCTCNONE 
Os02g0679200AK110789AGATGGGCCTCTGGGCCTCTetratricopeptide-like helical domain containing protein. 
Os02g0697200015-013-B10TGATGGGCCTGATGGGCCTTNONE 
AK059475TGATGGGCCTGATGGGCCTTNONE 
AK102993TGATGGGCCTGATGGGCCTTConserved hypothetical protein. 
J033079I18TGATGGGCCTGATGGGCCTTNONE 
J033082A14TGATGGGCCTGATGGGCCTTNONE 
J065047H08TGATGGGCCTGATGGGCCTTNONE 
J065131M14TGATGGGCCTGATGGGCCTTNONE 
Os02g0700100AK102954TAGGCCCATATSimilar to WD-repeat protein. 
Os02g0705100012-046-E01GAGGCCCATTNONE 
AK063491GAGGCCCATTEpoxide hydrolase family protein. 
J065184H07GAGGCCCATTNONE 
Os02g0736500AK065166AAGGCCCATAAAAGCCCAACNicastrin family protein. 
J013099D16AAGGCCCATAAAAGCCCAACNONE 
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein. 
Os02g0743800AK064134GGATGGGCCTTGCS domain containing protein. 
AK111254GGATGGGCCTTGNONE 
Os02g0744100006-070-H12TGATGGGCCTANONE 
006-115-C05TGATGGGCCTANONE 
AK061274TGATGGGCCTASAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0762300AK106684CAGGCCCATAAProtein of unknown function UPF0021 family protein. 
J090060M09CAGGCCCATAANONE 
J100083E05CAGGCCCATAANONE 
Os02g0767100011-054-E05ACATGGGCCTCNONE 
AK063351ACATGGGCCTCNONE 
AK103640ACATGGGCCTCConserved hypothetical protein. 
J090022G11ACATGGGCCTCNONE 
J090072L18ACATGGGCCTCNONE 
Os02g0769700AK111328AAATGGGCCTGGProtein kinase-like domain containing protein. 
Os02g0782200AK070439AAGGCCCATGANONE 
AK101869AAGGCCCATGANOT2/NOT3/NOT5 domain containing protein. 
Os02g0787100Os02g0787100TGATGGGCCTTProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0798700AK101070GAGGCCCATTTNeurochondrin family protein. 
AK103079GAGGCCCATTTNONE 
J090045L09GAGGCCCATTTNONE 
Os02g0804300006-046-D12GAGGCCCATGANONE 
AK060165GAGGCCCATGANONE 
AK067584GAGGCCCATGASAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12GAGGCCCATGANONE 
J023098C22GAGGCCCATGANONE 
J033123P06GAGGCCCATGANONE 
J065060N24GAGGCCCATGANONE 
J065069H22GAGGCCCATGANONE 
J065155N20GAGGCCCATGANONE 
J065170K07GAGGCCCATGANONE 
J090033D12GAGGCCCATGANONE 
Os02g0805600006-054-D07CCAGGCCCAAGGCCCATCTNONE 
AK059822CCAGGCCCAAGGCCCATCTNONE 
AK099516CCAGGCCCAAGGCCCATCTSimilar to Alcohol dehydrogenase, zinc-containing. 
AK104587CCAGGCCCAAGGCCCATCTNONE 
J065037H22CCAGGCCCAAGGCCCATCTNONE 
J090015P17CCAGGCCCAAGGCCCATCTNONE 
Os02g0810300AK059363CCAGGCCCATAASimilar to NBD-like protein. 
AK099203CCAGGCCCATAANONE 
Os02g0816700009-132-E07TAATGGGCCGTAGGCCCATTTNONE 
009-132-E07TAATGGGCCTANONE 
AK059572TAATGGGCCGTAGGCCCATTTConserved hypothetical protein. 
AK059572TAATGGGCCTAConserved hypothetical protein. 
Os02g0816800013-089-A09AAATGGGCCTACGGCCCATTANONE 
013-089-A09TAGGCCCATTANONE 
AK102271AAATGGGCCTACGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
AK102271TAGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
J013105O04AAATGGGCCTACGGCCCATTANONE 
J013105O04TAGGCCCATTANONE 
J013124I08AAATGGGCCTACGGCCCATTANONE 
J013124I08TAGGCCCATTANONE 
J023002E08AAATGGGCCTACGGCCCATTANONE 
J023002E08TAGGCCCATTANONE 
J023025C01AAATGGGCCTACGGCCCATTANONE 
J023025C01TAGGCCCATTANONE 
J023037O12AAATGGGCCTACGGCCCATTANONE 
J023037O12TAGGCCCATTANONE 
J023049N06AAATGGGCCTACGGCCCATTANONE 
J023049N06TAGGCCCATTANONE 
J023069G18AAATGGGCCTACGGCCCATTANONE 
J023069G18TAGGCCCATTANONE 
J033029M02AAATGGGCCTACGGCCCATTANONE 
J033029M02TAGGCCCATTANONE 
J033037L22AAATGGGCCTACGGCCCATTANONE 
J033037L22TAGGCCCATTANONE 
J033089A08AAATGGGCCTACGGCCCATTANONE 
J033089A08TAGGCCCATTANONE 
J033103L07AAATGGGCCTACGGCCCATTANONE 
J033103L07TAGGCCCATTANONE 
J033125L19AAATGGGCCTACGGCCCATTANONE 
J033125L19TAGGCCCATTANONE 
J090008N20AAATGGGCCTACGGCCCATTANONE 
J090008N20TAGGCCCATTANONE 
J090041F23AAATGGGCCTACGGCCCATTANONE 
J090041F23TAGGCCCATTANONE 
J090092H16AAATGGGCCTACGGCCCATTANONE 
J090092H16TAGGCCCATTANONE 
Os02g0819700AK067374TAGGCCCATAZinc finger, Zim17-type family protein. 
AK099160TAGGCCCATANONE 
J100086K17TAGGCCCATANONE 
Os02g0820600AK066549TAGGCCCATTAConserved hypothetical protein. 
J013070F02TAGGCCCATTANONE 
Os02g0820700006-025-E04TAATGGGCCTANONE 
006-025-E04TAATGGGCCTCNONE 
006-052-F06TAATGGGCCTANONE 
006-052-F06TAATGGGCCTCNONE 
006-082-A05TAATGGGCCTANONE 
006-082-A05TAATGGGCCTCNONE 
006-089-B06TAATGGGCCTANONE 
006-089-B06TAATGGGCCTCNONE 
AK060869TAATGGGCCTASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK060869TAATGGGCCTCSimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK061365TAATGGGCCTANONE 
AK061365TAATGGGCCTCNONE 
AK103008TAATGGGCCTANONE 
AK103008TAATGGGCCTCNONE 
AK104724TAATGGGCCTANONE 
AK104724TAATGGGCCTCNONE 
J013049H21TAATGGGCCTANONE 
J013049H21TAATGGGCCTCNONE 
J043027N22TAATGGGCCTANONE 
J043027N22TAATGGGCCTCNONE 
J075031I15TAATGGGCCTANONE 
J075031I15TAATGGGCCTCNONE 
J075132D23TAATGGGCCTANONE 
J075132D23TAATGGGCCTCNONE 
Os02g0823600AK070498CAGGCCCATGAConserved hypothetical protein. 
J065055C02CAGGCCCATGANONE 
J065098A17CAGGCCCATGANONE 
J065119B13CAGGCCCATGANONE 
J065146F10CAGGCCCATGANONE 
J065209G06CAGGCCCATGANONE 
J080001K12CAGGCCCATGANONE 
J080004O17CAGGCCCATGANONE 
J080005P21CAGGCCCATGANONE 
J080009M18CAGGCCCATGANONE 
J080013O18CAGGCCCATGANONE 
J080014B04CAGGCCCATGANONE 
J080014O21CAGGCCCATGANONE 
J080015B04CAGGCCCATGANONE 
J080016B17CAGGCCCATGANONE 
J080017G09CAGGCCCATGANONE 
J080022A17CAGGCCCATGANONE 
J080024M10CAGGCCCATGANONE 
J080025F17CAGGCCCATGANONE 
J080025O16CAGGCCCATGANONE 
J080029H09CAGGCCCATGANONE 
J080030G24CAGGCCCATGANONE 
J080031E02CAGGCCCATGANONE 
J080032A18CAGGCCCATGANONE 
J080032G24CAGGCCCATGANONE 
J080033C05CAGGCCCATGANONE 
J080033N19CAGGCCCATGANONE 
J080035H10CAGGCCCATGANONE 
J080035L05CAGGCCCATGANONE 
J080042N09CAGGCCCATGANONE 
J080044C14CAGGCCCATGANONE 
J080048K16CAGGCCCATGANONE 
J080050L07CAGGCCCATGANONE 
J080051L06CAGGCCCATGANONE 
J080051P22CAGGCCCATGANONE 
J080053D09CAGGCCCATGANONE 
J080053J15CAGGCCCATGANONE 
J080053O12CAGGCCCATGANONE 
J080057L01CAGGCCCATGANONE 
J080062E08CAGGCCCATGANONE 
J080062I09CAGGCCCATGANONE 
J080063A21CAGGCCCATGANONE 
J080063E04CAGGCCCATGANONE 
J080063E08CAGGCCCATGANONE 
J080064D15CAGGCCCATGANONE 
J080064N15CAGGCCCATGANONE 
J080068F13CAGGCCCATGANONE 
J080070L16CAGGCCCATGANONE 
J080072O17CAGGCCCATGANONE 
J080075A07CAGGCCCATGANONE 
J080076H10CAGGCCCATGANONE 
J080077K19CAGGCCCATGANONE 
J080078E19CAGGCCCATGANONE 
J080082A02CAGGCCCATGANONE 
J080083O05CAGGCCCATGANONE 
J080091I07CAGGCCCATGANONE 
J080094K10CAGGCCCATGANONE 
J080094N03CAGGCCCATGANONE 
J080096F09CAGGCCCATGANONE 
J080097O04CAGGCCCATGANONE 
J090037B19CAGGCCCATGANONE 
J100017A13CAGGCCCATGANONE 
J100068N22CAGGCCCATGANONE 
J100072C06CAGGCCCATGANONE 
Os02g0832200AK108268TCAGGCCCATCGConserved hypothetical protein. 
J065053F07TCAGGCCCATCGNONE 
J065095B09TCAGGCCCATCGNONE 
J065137I11TCAGGCCCATCGNONE 
J065187O12TCAGGCCCATCGNONE 
J075193O05TCAGGCCCATCGNONE 
Os02g0832700AK099439CAGGCCCATTASimilar to Metal tolerance protein C2 (AtMTPc2). 
Os03g0100200009-022-G08TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-012-C04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-039-F04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein. 
AK104982TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J013039N23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J023131F13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065013G18TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065056M02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065197O22TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075055L17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075076F02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075085M06TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075104E21TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075123P09TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075125G07TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075138M13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075142J17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075152F05TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075191L23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J090074I04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
Os03g0104000AK063829TTATGGGCCTGSimilar to Centromere protein. 
Os03g0108600AK065776CAGGCCCATAADEAD/DEAH box helicase, N-terminal domain containing protein. 
J013038N14CAGGCCCATAANONE 
Os03g0116500AF106844TAGGCCCATGAAAGCCCAAACNONE 
AK101870TAGGCCCATGAAAGCCCAAACConstitutive photomorphogenic 11. 
J023055L16TAGGCCCATGAAAGCCCAAACNONE 
J023088I16TAGGCCCATGAAAGCCCAAACNONE 
J033070E21TAGGCCCATGAAAGCCCAAACNONE 
J065124N22TAGGCCCATGAAAGCCCAAACNONE 
J075152A19TAGGCCCATGAAAGCCCAAACNONE 
J075181J21TAGGCCCATGAAAGCCCAAACNONE 
J090011F23TAGGCCCATGAAAGCCCAAACNONE 
Os03g0117100005-014-F09TCAGGCCCATATNONE 
006-027-C07TCAGGCCCATATNONE 
006-036-G11TCAGGCCCATATNONE 
006-038-H10TCAGGCCCATATNONE 
006-044-D08TCAGGCCCATATNONE 
006-105-H12TCAGGCCCATATNONE 
009-190-G08TCAGGCCCATATNONE 
AK070213TCAGGCCCATATPeroxisomal biogenesis factor 11 family protein. 
AK104570TCAGGCCCATATNONE 
AK104706TCAGGCCCATATNONE 
J013055H24TCAGGCCCATATNONE 
J023044I05TCAGGCCCATATNONE 
J075111G05TCAGGCCCATATNONE 
J080002K23TCAGGCCCATATNONE 
J080002N12TCAGGCCCATATNONE 
J080004B01TCAGGCCCATATNONE 
J080007H19TCAGGCCCATATNONE 
J080008M18TCAGGCCCATATNONE 
J080011D18TCAGGCCCATATNONE 
J080012J01TCAGGCCCATATNONE 
J080018C19TCAGGCCCATATNONE 
J080022C20TCAGGCCCATATNONE 
J080022I05TCAGGCCCATATNONE 
J080022M12TCAGGCCCATATNONE 
J080023P03TCAGGCCCATATNONE 
J080025A05TCAGGCCCATATNONE 
J080029C02TCAGGCCCATATNONE 
J080036H08TCAGGCCCATATNONE 
J080039P12TCAGGCCCATATNONE 
J080040H05TCAGGCCCATATNONE 
J080045I23TCAGGCCCATATNONE 
J080057O04TCAGGCCCATATNONE 
J080059K18TCAGGCCCATATNONE 
J080061E04TCAGGCCCATATNONE 
J080062C20TCAGGCCCATATNONE 
J080062F10TCAGGCCCATATNONE 
J080062L05TCAGGCCCATATNONE 
J080068L06TCAGGCCCATATNONE 
J080069N09TCAGGCCCATATNONE 
J080071M14TCAGGCCCATATNONE 
J080072K17TCAGGCCCATATNONE 
J080080A09TCAGGCCCATATNONE 
J080086A18TCAGGCCCATATNONE 
J080088O14TCAGGCCCATATNONE 
J080089O04TCAGGCCCATATNONE 
J080092G21TCAGGCCCATATNONE 
J080094K09TCAGGCCCATATNONE 
Os03g0125000006-032-D09TGATGGGCCTANONE 
006-032-D09TGATGGGCCTAAGGCCCAAATNONE 
006-033-B05TGATGGGCCTANONE 
006-033-B05TGATGGGCCTAAGGCCCAAATNONE 
006-048-G06TGATGGGCCTANONE 
006-048-G06TGATGGGCCTAAGGCCCAAATNONE 
006-048-G09TGATGGGCCTANONE 
006-048-G09TGATGGGCCTAAGGCCCAAATNONE 
006-052-D09TGATGGGCCTANONE 
006-052-D09TGATGGGCCTAAGGCCCAAATNONE 
006-072-A04TGATGGGCCTANONE 
006-072-A04TGATGGGCCTAAGGCCCAAATNONE 
006-076-F12TGATGGGCCTANONE 
006-076-F12TGATGGGCCTAAGGCCCAAATNONE 
006-080-B03TGATGGGCCTANONE 
006-080-B03TGATGGGCCTAAGGCCCAAATNONE 
006-092-H03TGATGGGCCTANONE 
006-092-H03TGATGGGCCTAAGGCCCAAATNONE 
006-103-G04TGATGGGCCTANONE 
006-103-G04TGATGGGCCTAAGGCCCAAATNONE 
009-079-E01TGATGGGCCTANONE 
009-079-E01TGATGGGCCTAAGGCCCAAATNONE 
009-150-F03TGATGGGCCTANONE 
009-150-F03TGATGGGCCTAAGGCCCAAATNONE 
AF095708TGATGGGCCTANONE 
AF095708TGATGGGCCTAAGGCCCAAATNONE 
AK059557TGATGGGCCTANONE 
AK059557TGATGGGCCTAAGGCCCAAATNONE 
AK070779TGATGGGCCTASimilar to 50S ribosomal protein L5, chloroplast. 
AK070779TGATGGGCCTAAGGCCCAAATSimilar to 50S ribosomal protein L5, chloroplast. 
AK098999TGATGGGCCTANONE 
AK098999TGATGGGCCTAAGGCCCAAATNONE 
AK104137TGATGGGCCTANONE 
AK104137TGATGGGCCTAAGGCCCAAATNONE 
J065002D07TGATGGGCCTANONE 
J065002D07TGATGGGCCTAAGGCCCAAATNONE 
J065167E24TGATGGGCCTANONE 
J065167E24TGATGGGCCTAAGGCCCAAATNONE 
J075199O14TGATGGGCCTANONE 
J075199O14TGATGGGCCTAAGGCCCAAATNONE 
J100083L01TGATGGGCCTANONE 
J100083L01TGATGGGCCTAAGGCCCAAATNONE 
Os03g0125700009-132-G03AAATGGGCCTTAAAGCCCATTTNONE 
AK062913AAATGGGCCTTAAAGCCCATTTConserved hypothetical protein. 
J075046C16AAATGGGCCTTAAAGCCCATTTNONE 
J075115L05AAATGGGCCTTAAAGCCCATTTNONE 
J075143I05AAATGGGCCTTAAAGCCCATTTNONE 
J075197O07AAATGGGCCTTAAAGCCCATTTNONE 
Os03g0127000AK068479AAGGCCCATTTConserved hypothetical protein. 
J013152D10AAGGCCCATTTNONE 
J075167I20AAGGCCCATTTNONE 
J090067O04AAGGCCCATTTNONE 
Os03g0128500AB037900TTATGGGCCTGANONE 
AK067991TTATGGGCCTGASimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
J013124O04TTATGGGCCTGANONE 
J090032P09TTATGGGCCTGANONE 
Os03g0143400AK073999CAGGCCCATGASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21CAGGCCCATGANONE 
J033073C08CAGGCCCATGANONE 
J033094C19CAGGCCCATGANONE 
J065017L10CAGGCCCATGANONE 
J065070H22CAGGCCCATGANONE 
J065079M09CAGGCCCATGANONE 
J065091N18CAGGCCCATGANONE 
J065109N03CAGGCCCATGANONE 
J065113F05CAGGCCCATGANONE 
J065135D23CAGGCCCATGANONE 
J065156L16CAGGCCCATGANONE 
J065207O04CAGGCCCATGANONE 
J065208F03CAGGCCCATGANONE 
J090010M15CAGGCCCATGANONE 
J090056J18CAGGCCCATGANONE 
Os03g0152800AK066205CATGGGCCTCProtein kinase-like domain containing protein. 
AK100518CATGGGCCTCNONE 
Os03g0192100AK064747TATGGGCCTTNONE 
AK105523TATGGGCCTTPeptidase S10, serine carboxypeptidase family protein. 
Os03g0195900J065063O15GAGGCCCATGANONE 
J065063O15GGATGGGCCTCNONE 
Os03g0197000AK071163TAGGCCCATTConserved hypothetical protein. 
J023079A07TAGGCCCATTNONE 
Os03g0200500005-016-A06AATGGGCCTTNONE 
005-016-A06CATGGGCCTANONE 
AK069251AATGGGCCTT40S ribosomal protein S3a (CYC07 protein). 
AK069251CATGGGCCTA40S ribosomal protein S3a (CYC07 protein). 
AK104243AATGGGCCTTNONE 
AK104243CATGGGCCTANONE 
AK104699AATGGGCCTTNONE 
AK104699CATGGGCCTANONE 
D26060AATGGGCCTTNONE 
D26060CATGGGCCTANONE 
J013024H20AATGGGCCTTNONE 
J013024H20CATGGGCCTANONE 
J013029C14AATGGGCCTTNONE 
J013029C14CATGGGCCTANONE 
J013035O17AATGGGCCTTNONE 
J013035O17CATGGGCCTANONE 
J013066B11AATGGGCCTTNONE 
J013066B11CATGGGCCTANONE 
J013066B12AATGGGCCTTNONE 
J013066B12CATGGGCCTANONE 
J013066B13AATGGGCCTTNONE 
J013066B13CATGGGCCTANONE 
J013152M04AATGGGCCTTNONE 
J013152M04CATGGGCCTANONE 
J023001A03AATGGGCCTTNONE 
J023001A03CATGGGCCTANONE 
J023013H23AATGGGCCTTNONE 
J023013H23CATGGGCCTANONE 
J023042L07AATGGGCCTTNONE 
J023042L07CATGGGCCTANONE 
J023081L11AATGGGCCTTNONE 
J023081L11CATGGGCCTANONE 
J023088I23AATGGGCCTTNONE 
J023088I23CATGGGCCTANONE 
J023092N22AATGGGCCTTNONE 
J023092N22CATGGGCCTANONE 
J023126A20AATGGGCCTTNONE 
J023126A20CATGGGCCTANONE 
J023139A17AATGGGCCTTNONE 
J023139A17CATGGGCCTANONE 
J023150G12AATGGGCCTTNONE 
J023150G12CATGGGCCTANONE 
J033026M10AATGGGCCTTNONE 
J033026M10CATGGGCCTANONE 
J033031H24AATGGGCCTTNONE 
J033031H24CATGGGCCTANONE 
J033036C22AATGGGCCTTNONE 
J033036C22CATGGGCCTANONE 
J033037P08AATGGGCCTTNONE 
J033037P08CATGGGCCTANONE 
J033045G14AATGGGCCTTNONE 
J033045G14CATGGGCCTANONE 
J033048A13AATGGGCCTTNONE 
J033048A13CATGGGCCTANONE 
J033048B13AATGGGCCTTNONE 
J033048B13CATGGGCCTANONE 
J033048K11AATGGGCCTTNONE 
J033048K11CATGGGCCTANONE 
J033066A06AATGGGCCTTNONE 
J033066A06CATGGGCCTANONE 
J033072H01AATGGGCCTTNONE 
J033072H01CATGGGCCTANONE 
J033082K07AATGGGCCTTNONE 
J033082K07CATGGGCCTANONE 
J033091G20AATGGGCCTTNONE 
J033091G20CATGGGCCTANONE 
J033095C14AATGGGCCTTNONE 
J033095C14CATGGGCCTANONE 
J033101N24AATGGGCCTTNONE 
J033101N24CATGGGCCTANONE 
J033105L15AATGGGCCTTNONE 
J033105L15CATGGGCCTANONE 
J033107J18AATGGGCCTTNONE 
J033107J18CATGGGCCTANONE 
J033112L02AATGGGCCTTNONE 
J033112L02CATGGGCCTANONE 
J033117I17AATGGGCCTTNONE 
J033117I17CATGGGCCTANONE 
J043003K06AATGGGCCTTNONE 
J043003K06CATGGGCCTANONE 
J043016I20AATGGGCCTTNONE 
J043016I20CATGGGCCTANONE 
J043021A10AATGGGCCTTNONE 
J043021A10CATGGGCCTANONE 
J043034F14AATGGGCCTTNONE 
J043034F14CATGGGCCTANONE 
J065002O17AATGGGCCTTNONE 
J065002O17CATGGGCCTANONE 
J065014B14AATGGGCCTTNONE 
J065014B14CATGGGCCTANONE 
J065054N19AATGGGCCTTNONE 
J065054N19CATGGGCCTANONE 
J065112P18AATGGGCCTTNONE 
J065112P18CATGGGCCTANONE 
J065121B20AATGGGCCTTNONE 
J065121B20CATGGGCCTANONE 
J065170M08AATGGGCCTTNONE 
J065170M08CATGGGCCTANONE 
J065194B05AATGGGCCTTNONE 
J065194B05CATGGGCCTANONE 
J090040F01AATGGGCCTTNONE 
J090040F01CATGGGCCTANONE 
J090078O20AATGGGCCTTNONE 
J090078O20CATGGGCCTANONE 
J090078P21AATGGGCCTTNONE 
J090078P21CATGGGCCTANONE 
J090084E11AATGGGCCTTNONE 
J090084E11CATGGGCCTANONE 
J100080B11AATGGGCCTTNONE 
J100080B11CATGGGCCTANONE 
Os03g0232500AK110980TAGGCCCATATGTP-binding protein, HSR1-related domain containing protein. 
J100036C06TAGGCCCATATNONE 
Os03g0238700AK073387ATATGGGCCGGATGGGCCTTGSimilar to Acid phosphatase type 5. 
J033043K11ATATGGGCCGGATGGGCCTTGNONE 
Os03g0240700009-086-G10AATGGGCCTAGCCCAACANONE 
AK071799AATGGGCCTAGCCCAACAConserved hypothetical protein. 
J023112A13AATGGGCCTAGCCCAACANONE 
J043022A01AATGGGCCTAGCCCAACANONE 
J065106A01AATGGGCCTAGCCCAACANONE 
J075023P22AATGGGCCTAGCCCAACANONE 
J075138I21AATGGGCCTAGCCCAACANONE 
J075173L02AATGGGCCTAGCCCAACANONE 
Os03g0240800006-092-D05TGTTGGGCTAGGCCCATTNONE 
AK059292TGTTGGGCTAGGCCCATTNONE 
AK061178TGTTGGGCTAGGCCCATTSimilar to AGL157Cp. 
AK121552TGTTGGGCTAGGCCCATTNONE 
J023131D06TGTTGGGCTAGGCCCATTNONE 
J033033E14TGTTGGGCTAGGCCCATTNONE 
J033105B01TGTTGGGCTAGGCCCATTNONE 
J033114L18TGTTGGGCTAGGCCCATTNONE 
J033132N24TGTTGGGCTAGGCCCATTNONE 
J065032H03TGTTGGGCTAGGCCCATTNONE 
J065115J20TGTTGGGCTAGGCCCATTNONE 
J065150C05TGTTGGGCTAGGCCCATTNONE 
J080302A11TGTTGGGCTAGGCCCATTNONE 
J080302H16TGTTGGGCTAGGCCCATTNONE 
J080305M12TGTTGGGCTAGGCCCATTNONE 
J080306F13TGTTGGGCTAGGCCCATTNONE 
J080312A06TGTTGGGCTAGGCCCATTNONE 
J090088P09TGTTGGGCTAGGCCCATTNONE 
Os03g0249200009-103-B08TAGGCCCATTANONE 
AK069944TAGGCCCATTAClass I peptide chain release factor domain containing protein. 
J065166E13TAGGCCCATTANONE 
Os03g0249900AK058379GAGGCCCATGTConserved hypothetical protein. 
Os03g0260100AK066143GAGGCCCATCAConserved hypothetical protein. 
Os03g0282900006-088-H05ACAGCCCAAGAAGGCCCATGTNONE 
006-088-H05TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
AK061166ACAGCCCAAGAAGGCCCATGTNONE 
AK061166TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
AK102161ACAGCCCAAGAAGGCCCATGTConserved hypothetical protein. 
AK102161TAATGGGCCTAGCCCATTTAGGCCCATTTConserved hypothetical protein. 
AK104514ACAGCCCAAGAAGGCCCATGTNONE 
AK104514TAATGGGCCTAGCCCATTTAGGCCCATTTNONE 
Os03g0287900009-074-B07ATATGGGCCTCNONE 
014-027-E07ATATGGGCCTCNONE 
AK063663ATATGGGCCTCSimilar to Protein disulfide isomerase. 
J065009N21ATATGGGCCTCNONE 
Os03g0288400Os03g0288400GAGGCCCATTGGCCCAATAConserved hypothetical protein. 
Os03g0292800012-077-B05CAAGGCCCATCCNONE 
AK069970CAAGGCCCATCCSimilar to Ran binding protein 1 homolog. 
J065138F22CAAGGCCCATCCNONE 
Os03g0297100AK059192AAGGCCCATTTNONE 
AK122143AAGGCCCATTTNONE 
J023012D24AAGGCCCATTTNONE 
J023041A08AAGGCCCATTTNONE 
J033067H08AAGGCCCATTTNONE 
J033131K19AAGGCCCATTTNONE 
J033136J20AAGGCCCATTTNONE 
J053027D07AAGGCCCATTTNONE 
J065191B01AAGGCCCATTTNONE 
J075112A12AAGGCCCATTTNONE 
J075136D05AAGGCCCATTTNONE 
J090073P06AAGGCCCATTTNONE 
J100026B16AAGGCCCATTTNONE 
J100068P21AAGGCCCATTTNONE 
J100088C15AAGGCCCATTTNONE 
Os03g0300600003-125-G06AAATGGGCCTANONE 
006-048-C04AAATGGGCCTANONE 
009-044-A09AAATGGGCCTANONE 
AK059801AAATGGGCCTANONE 
AK066250AAATGGGCCTASimilar to Chaperone protein dnaJ. 
AK069897AAATGGGCCTANONE 
AK104186AAATGGGCCTANONE 
J065197D15AAATGGGCCTANONE 
J090031C11AAATGGGCCTANONE 
J100024C23AAATGGGCCTANONE 
J100030B16AAATGGGCCTANONE 
J100033K12AAATGGGCCTANONE 
J100043M19AAATGGGCCTANONE 
J100056N09AAATGGGCCTANONE 
J100058E12AAATGGGCCTANONE 
J100084J08AAATGGGCCTANONE 
Os03g0300700AK071770TCATGGGCCTARetrotransposon gag protein family protein. 
J023112P05TCATGGGCCTANONE 
Os03g0308900AK064183GAGGCCCATGAConserved hypothetical protein. 
Os03g0320900015-016-D07TAGGCCCATANONE 
AK106255TAGGCCCATAGuanylate kinase family protein. 
Os03g0331600009-025-C11TATGGGCCTCNONE 
AK063782TATGGGCCTCConserved hypothetical protein. 
Os03g0332700AK072820TAAGCCCATTAGGCCCATAASimilar to ABC Transporter, ATP binding component. 
Os03g0333000AK109811AAGGCCCAGGCCCATTTConserved hypothetical protein. 
J065152D04AAGGCCCAGGCCCATTTNONE 
J090011B05AAGGCCCAGGCCCATTTNONE 
Os03g0333100AK101050AAATGGGCCTGGGCCTTProtein of unknown function DUF663 domain containing protein. 
Os03g0349000011-089-G05TAGGCCCAGGCCCATCTNONE 
AK099999TAGGCCCAGGCCCATCTNucleoporin interacting component family protein. 
J013134K18TAGGCCCAGGCCCATCTNONE 
J033024G23TAGGCCCAGGCCCATCTNONE 
J033098A12TAGGCCCAGGCCCATCTNONE 
J090001N18TAGGCCCAGGCCCATCTNONE 
J090058F11TAGGCCCAGGCCCATCTNONE 
J090065C04TAGGCCCAGGCCCATCTNONE 
J100067M17TAGGCCCAGGCCCATCTNONE 
J100083P13TAGGCCCAGGCCCATCTNONE 
Os03g0360500009-103-B05GGATGGGCCTGGNONE 
AK059166GGATGGGCCTGGNONE 
AK101285GGATGGGCCTGGProtein of unknown function DUF1077 family protein. 
J033061G19GGATGGGCCTGGNONE 
J065169P12GGATGGGCCTGGNONE 
J075104C18GGATGGGCCTGGNONE 
J075166G07GGATGGGCCTGGNONE 
J075170J04GGATGGGCCTGGNONE 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0364000J065042L07TCATGGGCCTGNONE 
J065061O16TCATGGGCCTGNONE 
J065075L02TCATGGGCCTGNONE 
J065138N02TCATGGGCCTGNONE 
J065209H20TCATGGGCCTGNONE 
J075019G03TCATGGGCCTGNONE 
J075086E23TCATGGGCCTGNONE 
J075094M12TCATGGGCCTGNONE 
J075139L07TCATGGGCCTGNONE 
J075162I16TCATGGGCCTGNONE 
J075199G20TCATGGGCCTGNONE 
Os03g0379500AK064760TAGGCCCATAASimilar to 40S ribosomal protein S9. 
J080024D11TAGGCCCATAANONE 
J080044J02TAGGCCCATAANONE 
J080050F01TAGGCCCATAANONE 
J080063D21TAGGCCCATAANONE 
J080063G04TAGGCCCATAANONE 
J080078E02TAGGCCCATAANONE 
Os03g0381500AK108125TCATGGGCCTCATGGGCCTCConserved hypothetical protein. 
Os03g0383100AK107106TCAGGCCCATAConserved hypothetical protein. 
Os03g0393900AK069809TATTGGGCTTCCATGGGCCTCSimilar to S.tuberosum patatin (Fragment). 
J023030J03TATTGGGCTTCCATGGGCCTCNONE 
Os03g0411500AK058696TAGGCCCATGANONE 
AK071057TAGGCCCATGAPeptidase S14, ClpP family protein. 
Os03g0569900009-027-A11CAAGGCCCATTANONE 
AK063783CAAGGCCCATTANONE 
Os03g0574600009-151-F06AAGGCCCATTTNONE 
AK063006AAGGCCCATTTConserved hypothetical protein. 
AK104941AAGGCCCATTTNONE 
J065063L24AAGGCCCATTTNONE 
Os03g0579000AK061586CCAGGCCCATATNONE 
AK072995CCAGGCCCATATPeptidase M50, putative membrane-associated zinc metallopeptidase family protein. 
Os03g0581600J065037H09TCATGGGCCTGNONE 
J065183O12TCATGGGCCTGNONE 
Os03g0586800003-114-H11CCAGGCCCATTTNONE 
AK063765CCAGGCCCATTTSimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302CCAGGCCCATTTNONE 
J090004H06CCAGGCCCATTTNONE 
J090022N15CCAGGCCCATTTNONE 
J100035E05CCAGGCCCATTTNONE 
J100041L05CCAGGCCCATTTNONE 
J100041M18CCAGGCCCATTTNONE 
J100057P04CCAGGCCCATTTNONE 
J100089H06CCAGGCCCATTTNONE 
J100090C23CCAGGCCCATTTNONE 
Os03g0598200AK068322TAGGCCCATTANop14-like protein family protein. 
Os03g0606200009-030-E09GAGGCCCATCTNONE 
009-076-H10GAGGCCCATCTNONE 
009-122-H12GAGGCCCATCTNONE 
009-153-F09GAGGCCCATCTNONE 
AB055076GAGGCCCATCTMitochondrial ATP synthase 6 KD subunit. 
AK072384GAGGCCCATCTNONE 
AK107928GAGGCCCATCTNONE 
J023078E13GAGGCCCATCTNONE 
J053031N01GAGGCCCATCTNONE 
J053046K19GAGGCCCATCTNONE 
J053062P07GAGGCCCATCTNONE 
J053091C23GAGGCCCATCTNONE 
J053099N19GAGGCCCATCTNONE 
J065005E06GAGGCCCATCTNONE 
J065030N03GAGGCCCATCTNONE 
J065138O21GAGGCCCATCTNONE 
J065159K03GAGGCCCATCTNONE 
J075030M08GAGGCCCATCTNONE 
J080006E23GAGGCCCATCTNONE 
J080010D10GAGGCCCATCTNONE 
J080016N17GAGGCCCATCTNONE 
J080024N09GAGGCCCATCTNONE 
J080028E23GAGGCCCATCTNONE 
J080035I11GAGGCCCATCTNONE 
J080038D15GAGGCCCATCTNONE 
J080040H08GAGGCCCATCTNONE 
J080043L04GAGGCCCATCTNONE 
J080047C06GAGGCCCATCTNONE 
J080061G04GAGGCCCATCTNONE 
J080066E10GAGGCCCATCTNONE 
J080067P03GAGGCCCATCTNONE 
J080082D07GAGGCCCATCTNONE 
J080089M13GAGGCCCATCTNONE 
J080094O09GAGGCCCATCTNONE 
J080095C24GAGGCCCATCTNONE 
J080309E21GAGGCCCATCTNONE 
J090016G15GAGGCCCATCTNONE 
J090031C20GAGGCCCATCTNONE 
J090033A15GAGGCCCATCTNONE 
J090037L07GAGGCCCATCTNONE 
J090038I10GAGGCCCATCTNONE 
J090072P19GAGGCCCATCTNONE 
J100040J02GAGGCCCATCTNONE 
J100047N05GAGGCCCATCTNONE 
J100048M10GAGGCCCATCTNONE 
J100076C02GAGGCCCATCTNONE 
J100077G23GAGGCCCATCTNONE 
J100080O08GAGGCCCATCTNONE 
J100085C06GAGGCCCATCTNONE 
J100085F16GAGGCCCATCTNONE 
Os03g0639700AK099587GAGGCCCATTTSimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
Os03g0646100AK100526CCATGGGCCTCGCCCSimilar to Plastid division protein ftsZ1 precursor. 
Os03g0655400009-090-G04CGATGGGCCTTNONE 
009-133-B12CGATGGGCCTTNONE 
009-136-A10CGATGGGCCTTNONE 
009-156-C02CGATGGGCCTTNONE 
009-157-C04CGATGGGCCTTNONE 
009-159-F06CGATGGGCCTTNONE 
009-192-A07CGATGGGCCTTNONE 
009-192-B05CGATGGGCCTTNONE 
011-082-F01CGATGGGCCTTNONE 
013-041-G11CGATGGGCCTTNONE 
013-077-E04CGATGGGCCTTNONE 
014-001-A12CGATGGGCCTTNONE 
015-039-A12CGATGGGCCTTNONE 
016-094-G11CGATGGGCCTTNONE 
AB011368CGATGGGCCTTNONE 
AF010584CGATGGGCCTTSimilar to Water stress induced protein. 
AK059150CGATGGGCCTTNONE 
D26538CGATGGGCCTTNONE 
J065013M08CGATGGGCCTTNONE 
J065021G11CGATGGGCCTTNONE 
J065027K20CGATGGGCCTTNONE 
J065034A02CGATGGGCCTTNONE 
J065040F23CGATGGGCCTTNONE 
J065098G21CGATGGGCCTTNONE 
J065153J21CGATGGGCCTTNONE 
J065163C13CGATGGGCCTTNONE 
J065173C23CGATGGGCCTTNONE 
J065178I22CGATGGGCCTTNONE 
J065198K21CGATGGGCCTTNONE 
J065201H19CGATGGGCCTTNONE 
J065205F11CGATGGGCCTTNONE 
J100080E05CGATGGGCCTTNONE 
Os03g0679000AK059913TCATGGGCCTGConserved hypothetical protein. 
J065094N08TCATGGGCCTGNONE 
J065108H06TCATGGGCCTGNONE 
Os03g0685700AK066043CGATGGGCCTTGGGCTTTProtein prenyltransferase domain containing protein. 
J013048F08CGATGGGCCTTGGGCTTTNONE 
Os03g0719100AK065127TAGGCCCATCCAAGCCCAACADNA-binding SAP domain containing protein. 
J013001P07TAGGCCCATCCAAGCCCAACANONE 
J065102J01TAGGCCCATCCAAGCCCAACANONE 
J065205K05TAGGCCCATCCAAGCCCAACANONE 
Os03g0721700AK106706CCAGGCCCATCAProtein of unknown function DUF569 family protein. 
Os03g0735300AK071715CAGGCCCATTAlba, DNA/RNA-binding protein family protein. 
J065100I07CAGGCCCATTNONE 
Os03g0737600014-094-E01GAGGCCCATCTNONE 
AB038234GAGGCCCATCTNONE 
AK101854GAGGCCCATCTCyclin H-1. 
AK105468GAGGCCCATCTNONE 
J033069N12GAGGCCCATCTNONE 
J043017A22GAGGCCCATCTNONE 
J065154A20GAGGCCCATCTNONE 
Os03g0749900006-112-A05CCAGCCCATTGAGGCCCATGGGCTNONE 
006-112-A05CTCGGCCCACCTAGGCCCATTTNONE 
AK061252CCAGCCCATTGAGGCCCATGGGCTConserved hypothetical protein. 
AK061252CTCGGCCCACCTAGGCCCATTTConserved hypothetical protein. 
J023020I01CCAGCCCATTGAGGCCCATGGGCTNONE 
J023020I01CTCGGCCCACCTAGGCCCATTTNONE 
J033060N21CCAGCCCATTGAGGCCCATGGGCTNONE 
J033060N21CTCGGCCCACCTAGGCCCATTTNONE 
Os03g0754800AK101584TAATGGGCCTAMitochondrial substrate carrier family protein. 
J080305A09TAATGGGCCTANONE 
J080310E24TAATGGGCCTANONE 
J080310O12TAATGGGCCTANONE 
J080311N04TAATGGGCCTANONE 
J080313N20TAATGGGCCTANONE 
J080317H24TAATGGGCCTANONE 
Os03g0755000AK068540GAGGCCCATTTGGGCCCAACCSimilar to Serine/threonine kinase (Fragment). 
Os03g0776900AK107941TATTGGGCCACATGGGCCTCSimilar to DNAJ protein-like. 
J053100E14TATTGGGCCACATGGGCCTCNONE 
J075111A12TATTGGGCCACATGGGCCTCNONE 
Os03g0786000AK061286TATGGGCCTCConserved hypothetical protein. 
AK073187TATGGGCCTCNONE 
Os03g0787100006-022-G04CAAGGCCCATGANONE 
AK110858CAAGGCCCATGAConserved hypothetical protein. 
J065197C24CAAGGCCCATGANONE 
J075147E03CAAGGCCCATGANONE 
J100065K06CAAGGCCCATGANONE 
Os03g0788200AK106623AAGGCCCATAE1 protein and Def2/Der2 allergen family protein. 
AK106623TAGGCCCATTAE1 protein and Def2/Der2 allergen family protein. 
J065112K18AAGGCCCATANONE 
J065112K18TAGGCCCATTANONE 
J065123A19AAGGCCCATANONE 
J065123A19TAGGCCCATTANONE 
J065131C15AAGGCCCATANONE 
J065131C15TAGGCCCATTANONE 
J065174D05AAGGCCCATANONE 
J065174D05TAGGCCCATTANONE 
J075011P16AAGGCCCATANONE 
J075011P16TAGGCCCATTANONE 
J075017N24AAGGCCCATANONE 
J075017N24TAGGCCCATTANONE 
J075028P19AAGGCCCATANONE 
J075028P19TAGGCCCATTANONE 
J075052I01AAGGCCCATANONE 
J075052I01TAGGCCCATTANONE 
J075057H20AAGGCCCATANONE 
J075057H20TAGGCCCATTANONE 
J075080F06AAGGCCCATANONE 
J075080F06TAGGCCCATTANONE 
J075091A10AAGGCCCATANONE 
J075091A10TAGGCCCATTANONE 
J075140L23AAGGCCCATANONE 
J075140L23TAGGCCCATTANONE 
J075156J08AAGGCCCATANONE 
J075156J08TAGGCCCATTANONE 
J075182D16AAGGCCCATANONE 
J075182D16TAGGCCCATTANONE 
J075191O21AAGGCCCATANONE 
J075191O21TAGGCCCATTANONE 
J090079E21AAGGCCCATANONE 
J090079E21TAGGCCCATTANONE 
Os03g0795900012-092-G05CCAGGCCCATTANONE 
015-043-D09CCAGGCCCATTANONE 
016-078-G11CCAGGCCCATTANONE 
AK068660CCAGGCCCATTASimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14CCAGGCCCATTANONE 
J023001L04CCAGGCCCATTANONE 
J053032K11CCAGGCCCATTANONE 
J065059E10CCAGGCCCATTANONE 
J065095H19CCAGGCCCATTANONE 
J065181M06CCAGGCCCATTANONE 
J100047D11CCAGGCCCATTANONE 
J100068G04CCAGGCCCATTANONE 
Os03g0797600006-034-B06ATATGGGCCTTNONE 
006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
006-034-B06TAGGCCCATCANONE 
009-066-A01ATATGGGCCTTNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01TAGGCCCATCANONE 
014-035-H08ATATGGGCCTTNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08TAGGCCCATCANONE 
AK067446ATATGGGCCTTSimilar to Helix-loop-helix protein homolog. 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK067446TAGGCCCATCASimilar to Helix-loop-helix protein homolog. 
AK068388ATATGGGCCTTNONE 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK068388TAGGCCCATCANONE 
AK104412ATATGGGCCTTNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412TAGGCCCATCANONE 
Os03g0807800AK064984TGATGGGCCTGASimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TGATGGGCCTGANONE 
J065015J20TGATGGGCCTGANONE 
J065122L11TGATGGGCCTGANONE 
J065217E10TGATGGGCCTGANONE 
J075023C02TGATGGGCCTGANONE 
J075102O04TGATGGGCCTGANONE 
J080024G24TGATGGGCCTGANONE 
J080033F02TGATGGGCCTGANONE 
J080047M13TGATGGGCCTGANONE 
J080048A22TGATGGGCCTGANONE 
J080056E06TGATGGGCCTGANONE 
J080064O11TGATGGGCCTGANONE 
Os03g0819900006-058-B05TAATGGGCCTGAATGGGCCGGGCCNONE 
AK111912TAATGGGCCTGAATGGGCCGGGCCNONE 
AK112029TAATGGGCCTGAATGGGCCGGGCCSimilar to RAB8C. 
AY576526TAATGGGCCTGAATGGGCCGGGCCNONE 
AY579410TAATGGGCCTGAATGGGCCGGGCCNONE 
J075041G24TAATGGGCCTGAATGGGCCGGGCCNONE 
J100070N08TAATGGGCCTGAATGGGCCGGGCCNONE 
Os03g0823500AK058972TAGGCCCATCGTGF-beta receptor, type I/II extracellular region family protein. 
AK099193TAGGCCCATCGNONE 
J023109G05TAGGCCCATCGNONE 
J023114H09TAGGCCCATCGNONE 
J065017L13TAGGCCCATCGNONE 
J065093G04TAGGCCCATCGNONE 
J065218D16TAGGCCCATCGNONE 
J090036G14TAGGCCCATCGNONE 
Os03g0826000AK072695AAGGCCCATCTConserved hypothetical protein. 
Os03g0831100AK103115TGATGGGCCTAArmadillo-like helical domain containing protein. 
J033119F15TGATGGGCCTANONE 
J065011M19TGATGGGCCTANONE 
J075019I08TGATGGGCCTANONE 
J075047A01TGATGGGCCTANONE 
J075096P21TGATGGGCCTANONE 
J075121I05TGATGGGCCTANONE 
J075121I07TGATGGGCCTANONE 
J090063F13TGATGGGCCTANONE 
J090068F16TGATGGGCCTANONE 
J090094E14TGATGGGCCTANONE 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800CAGGCCCATGGGCTGGCCCACCCGNONE 
AK104068CAGGCCCATGGGCTGGCCCACCCGNONE 
J075031J11CAGGCCCATGGGCTGGCCCACCCGNONE 
J075051N01CAGGCCCATGGGCTGGCCCACCCGNONE 
J075166D18CAGGCCCATGGGCTGGCCCACCCGNONE 
J075171E14CAGGCCCATGGGCTGGCCCACCCGNONE 
Os03g0834000AB080084GAGGCCCATTTFlap endonuclease-1b (EC 3.-.-.-) (OsFEN-1b). 
AB088391GAGGCCCATTTNONE 
AK062149GAGGCCCATTTNONE 
AK069540GAGGCCCATTTNONE 
J013047J01GAGGCCCATTTNONE 
J023019F12GAGGCCCATTTNONE 
J043004H21GAGGCCCATTTNONE 
Os03g0843400009-195-F11TAATGGGCCTCNONE 
AK061198TAATGGGCCTCSimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076TAATGGGCCTCNONE 
Os03g0843500AK067985GAGGCCCATCCNONE 
AK101661GAGGCCCATCCSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454GAGGCCCATCCNONE 
J080302L23GAGGCCCATCCNONE 
Os03g0847500AK073859TGATGGGCCTTSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0851900AK102145AAGGCCCAGGCCCATCTAFG1-like ATPase family protein. 
AK102145TAGGCCCATTTAFG1-like ATPase family protein. 
J033086B08AAGGCCCAGGCCCATCTNONE 
J033086B08TAGGCCCATTTNONE 
Os03g0854000009-186-C03GAGGCCCATGNONE 
AK061374GAGGCCCATGProtein of unknown function UPF0131 family protein. 
J065138B11GAGGCCCATGNONE 
Os03g0854500012-067-H08AAGGCCCATCCNONE 
AK100430AAGGCCCATCCSimilar to Heat shock transcription factor 31 (Fragment). 
AK106118AAGGCCCATCCNONE 
AY344485AAGGCCCATCCNONE 
J023088F14AAGGCCCATCCNONE 
J100041G01AAGGCCCATCCNONE 
J100046N19AAGGCCCATCCNONE 
J100052O08AAGGCCCATCCNONE 
Os03g0857500AK072880TAGGCCCATCGProtein of unknown function DUF303, acetylesterase putative domain containing protein. 
Os04g0105700004-005-E05AAATGGGCCTANONE 
006-037-C11AAATGGGCCTANONE 
006-039-E07AAATGGGCCTANONE 
006-049-A02AAATGGGCCTANONE 
006-076-D05AAATGGGCCTANONE 
006-089-E04AAATGGGCCTANONE 
006-097-F12AAATGGGCCTANONE 
AK060872AAATGGGCCTANONE 
AK065082AAATGGGCCTANONE 
AK104254AAATGGGCCTAConserved hypothetical protein. 
AK104546AAATGGGCCTANONE 
AK104634AAATGGGCCTANONE 
AY224557AAATGGGCCTANONE 
J013001L09AAATGGGCCTANONE 
J013151B18AAATGGGCCTANONE 
J023054G18AAATGGGCCTANONE 
Os04g0194000AK102654TCAGGCCCATTCyclin-like F-box domain containing protein. 
J033101G08TCAGGCCCATTNONE 
J090084B18TCAGGCCCATTNONE 
Os04g0218600009-123-A05AAGGCCCAAGGCCCATCCNONE 
AK062873AAGGCCCAAGGCCCATCCNONE 
AK103472AAGGCCCAAGGCCCATCCConserved hypothetical protein. 
J090077A20AAGGCCCAAGGCCCATCCNONE 
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein. 
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
Os04g0430100009-125-A01AAGGCCCATTANONE 
AK102190AAGGCCCATTASimilar to 40S ribosomal protein S10-1. 
J033087A06AAGGCCCATTANONE 
J053032M06AAGGCCCATTANONE 
J065033D05AAGGCCCATTANONE 
J065045D15AAGGCCCATTANONE 
J065045K10AAGGCCCATTANONE 
J065049N05AAGGCCCATTANONE 
J065064N09AAGGCCCATTANONE 
J065068F17AAGGCCCATTANONE 
J065088F17AAGGCCCATTANONE 
J065104N22AAGGCCCATTANONE 
J065117B19AAGGCCCATTANONE 
J065119O12AAGGCCCATTANONE 
J065134G24AAGGCCCATTANONE 
J065150G16AAGGCCCATTANONE 
J065176C03AAGGCCCATTANONE 
J065212M23AAGGCCCATTANONE 
J075009P18AAGGCCCATTANONE 
J075019G06AAGGCCCATTANONE 
J075037H14AAGGCCCATTANONE 
J075057C13AAGGCCCATTANONE 
J075100E14AAGGCCCATTANONE 
J075120I16AAGGCCCATTANONE 
J075130F07AAGGCCCATTANONE 
J075156M16AAGGCCCATTANONE 
J100043J03AAGGCCCATTANONE 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK103967TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
AK121724TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033081P13TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J033128L11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065038G19TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065129A21TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065131P11TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065166I03TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J065181L05TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100018I15TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100019H22TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
J100037O10TCAGGCCCATGGAGGCCCACACGGCCCATGTNONE 
Os04g0465700016-043-B01AAGGCCCATCANONE 
AK064379AAGGCCCATCARNA dependent RNA polymerase family protein. 
Os04g0475300AK066351TATTGGGCTTTGAGGCCCATAConserved hypothetical protein. 
J065138J21TATTGGGCTTTGAGGCCCATANONE 
Os04g0486400AJ535489TGATGGGCCTGANONE 
AK103296TGATGGGCCTGARML1 protein. 
J013045L03TGATGGGCCTGANONE 
J013045M03TGATGGGCCTGANONE 
J033034L24TGATGGGCCTGANONE 
J033125B02TGATGGGCCTGANONE 
J075001G08TGATGGGCCTGANONE 
J075011I16TGATGGGCCTGANONE 
J075033M08TGATGGGCCTGANONE 
J075044G01TGATGGGCCTGANONE 
J075047D04TGATGGGCCTGANONE 
J075061J09TGATGGGCCTGANONE 
J075085L07TGATGGGCCTGANONE 
J075087D20TGATGGGCCTGANONE 
J075117A04TGATGGGCCTGANONE 
J075134H06TGATGGGCCTGANONE 
J075184J12TGATGGGCCTGANONE 
Os04g0502300009-116-F02TCAGGCCCATCTCGGCCCACTCTNONE 
009-130-H06TCAGGCCCATCTCGGCCCACTCTNONE 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
J013124K01TCAGGCCCATCTCGGCCCACTCTNONE 
J023102F03TCAGGCCCATCTCGGCCCACTCTNONE 
J033094F17TCAGGCCCATCTCGGCCCACTCTNONE 
J053054C22TCAGGCCCATCTCGGCCCACTCTNONE 
J065024N13TCAGGCCCATCTCGGCCCACTCTNONE 
J065083J18TCAGGCCCATCTCGGCCCACTCTNONE 
J065132O14TCAGGCCCATCTCGGCCCACTCTNONE 
J065156M09TCAGGCCCATCTCGGCCCACTCTNONE 
J065176N15TCAGGCCCATCTCGGCCCACTCTNONE 
J065208H08TCAGGCCCATCTCGGCCCACTCTNONE 
J075054B03TCAGGCCCATCTCGGCCCACTCTNONE 
J090053E20TCAGGCCCATCTCGGCCCACTCTNONE 
J100075B09TCAGGCCCATCTCGGCCCACTCTNONE 
J100089H12TCAGGCCCATCTCGGCCCACTCTNONE 
Os04g0528100009-090-G06CCATGGGCCTCNONE 
009-168-C11CCATGGGCCTCNONE 
AK065957CCATGGGCCTCConserved hypothetical protein. 
J013039G20CCATGGGCCTCNONE 
J013044D08CCATGGGCCTCNONE 
J065013L14CCATGGGCCTCNONE 
J065143H08CCATGGGCCTCNONE 
J065146C14CCATGGGCCTCNONE 
J065149K22CCATGGGCCTCNONE 
J065156B18CCATGGGCCTCNONE 
J065201A04CCATGGGCCTCNONE 
J065209A04CCATGGGCCTCNONE 
Os04g0551300AK103502TAGGCCCATGTSimilar to Growth regulator like protein. 
Os04g0551800016-049-G12CAAGGCCCATCANONE 
AK121568CAAGGCCCATCASimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06CAAGGCCCATCANONE 
J013111B11CAAGGCCCATCANONE 
J013121H23CAAGGCCCATCANONE 
J023012A17CAAGGCCCATCANONE 
J023092M05CAAGGCCCATCANONE 
J033026P14CAAGGCCCATCANONE 
J033033C10CAAGGCCCATCANONE 
J033033M10CAAGGCCCATCANONE 
J033035C24CAAGGCCCATCANONE 
J033052E19CAAGGCCCATCANONE 
J033140K19CAAGGCCCATCANONE 
J065036F18CAAGGCCCATCANONE 
J065067L12CAAGGCCCATCANONE 
J065095G09CAAGGCCCATCANONE 
J065115B08CAAGGCCCATCANONE 
J065218E24CAAGGCCCATCANONE 
J090002N13CAAGGCCCATCANONE 
J090008B12CAAGGCCCATCANONE 
J090016F24CAAGGCCCATCANONE 
J090019H14CAAGGCCCATCANONE 
J090020G20CAAGGCCCATCANONE 
J090029L18CAAGGCCCATCANONE 
J090057C23CAAGGCCCATCANONE 
J090073H23CAAGGCCCATCANONE 
J090081C16CAAGGCCCATCANONE 
J090081E21CAAGGCCCATCANONE 
J090084L14CAAGGCCCATCANONE 
J090086M01CAAGGCCCATCANONE 
J090089E16CAAGGCCCATCANONE 
J100031P12CAAGGCCCATCANONE 
J100090N23CAAGGCCCATCANONE 
Os04g0555900009-154-G03GAGGCCCATTANONE 
AK063168GAGGCCCATTAPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
J065012D11GAGGCCCATTANONE 
Os04g0573200AK065277CAAGGCCCATCTNONE 
AK120348CAAGGCCCATCTHeavy metal transport/detoxification protein domain containing protein. 
Os04g0581300009-171-H01ATATGGGCCTCNONE 
AK063093ATATGGGCCTCSimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0584100012-063-E01AGATGGGCCTCNONE 
AK105292AGATGGGCCTCConserved hypothetical protein. 
Os04g0585600006-117-A02GAGGCCCATTNONE 
AK106073GAGGCCCATTConserved hypothetical protein. 
J053089I23GAGGCCCATTNONE 
J065112K06GAGGCCCATTNONE 
J065128D09GAGGCCCATTNONE 
J100038D09GAGGCCCATTNONE 
Os04g0597900J065038C09GAGGCCCATTANONE 
J065059G21GAGGCCCATTANONE 
J065079G06GAGGCCCATTAConserved hypothetical protein. 
Os04g0607200J065082C16TTATGGGCCTTNONE 
J065167I02TTATGGGCCTTNONE 
Os04g0610500006-115-C07TATGGGCCTCNONE 
AK066289TATGGGCCTCPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817TATGGGCCTCNONE 
J013096N09TATGGGCCTCNONE 
J023054I11TATGGGCCTCNONE 
J023121P20TATGGGCCTCNONE 
J053039O20TATGGGCCTCNONE 
J053071L20TATGGGCCTCNONE 
J053088H23TATGGGCCTCNONE 
J053096J03TATGGGCCTCNONE 
Os04g0611300009-006-G08TAGGCCCATCANONE 
009-011-C01TAGGCCCATCANONE 
009-036-B09TAGGCCCATCANONE 
009-116-G09TAGGCCCATCANONE 
009-126-E09TAGGCCCATCANONE 
009-132-F09TAGGCCCATCANONE 
009-151-G07TAGGCCCATCANONE 
009-155-C07TAGGCCCATCANONE 
009-163-G01TAGGCCCATCANONE 
009-169-G08TAGGCCCATCANONE 
009-191-B02TAGGCCCATCANONE 
009-196-A08TAGGCCCATCANONE 
009-198-E07TAGGCCCATCANONE 
014-015-F04TAGGCCCATCANONE 
015-087-H04TAGGCCCATCANONE 
AK062605TAGGCCCATCANONE 
AK063022TAGGCCCATCAConserved hypothetical protein. 
AK066749TAGGCCCATCANONE 
AK104924TAGGCCCATCANONE 
J065002M20TAGGCCCATCANONE 
J065045L23TAGGCCCATCANONE 
J065101E05TAGGCCCATCANONE 
J065140J23TAGGCCCATCANONE 
J065179G11TAGGCCCATCANONE 
J065191B18TAGGCCCATCANONE 
J065192E03TAGGCCCATCANONE 
J065199H21TAGGCCCATCANONE 
J075067F01TAGGCCCATCANONE 
J075089L01TAGGCCCATCANONE 
J075147K22TAGGCCCATCANONE 
J080069G23TAGGCCCATCANONE 
J100053D10TAGGCCCATCANONE 
J100078C10TAGGCCCATCANONE 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
Os04g0635700009-079-G03AAGGCCCATGTNONE 
AK062025AAGGCCCATGTRibbon-helix-helix domain containing protein. 
AK098916AAGGCCCATGTNONE 
J013002J07AAGGCCCATGTNONE 
J013109L20AAGGCCCATGTNONE 
J023055C07AAGGCCCATGTNONE 
J065036K04AAGGCCCATGTNONE 
J065164G12AAGGCCCATGTNONE 
Os04g0635800006-033-E07AATGGGCCGGCCCATCAAGGCCCATTANONE 
011-067-A08AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK060110AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK099507AATGGGCCGGCCCATCAAGGCCCATTAGCN5-related N-acetyltransferase domain containing protein. 
AK104741AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK120021AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013029B17AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013134M07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013149N18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013153L10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J033131F08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J043010E02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075030K04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075178K05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080001B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080003N19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005F20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005G16AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080007N02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080009J04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080017D04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080020M22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021A15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021F21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080023P05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080024P22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080027C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080029K03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080035M18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039F22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039J03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039L03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039P14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080042E12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047D19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047M21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080049N03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080056J12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080060B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080062K08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080064L07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080069C15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080074H06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080086O14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090L14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080095G08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080097C07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090011F03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090082O17AATGGGCCGGCCCATCAAGGCCCATTANONE 
Os04g0636400006-064-G07GAGGCCCATTANONE 
006-097-D05GAGGCCCATTANONE 
AK061848GAGGCCCATTASimilar to Senescence-associated protein 6. 
AK099573GAGGCCCATTANONE 
J013035J20GAGGCCCATTANONE 
Os04g0636900011-028-G03CCATGGGCCTTNONE 
012-040-G03CCATGGGCCTTNONE 
AK058405CCATGGGCCTTNONE 
AK065789CCATGGGCCTTNONE 
AK101408CCATGGGCCTTNONE 
AK119286CCATGGGCCTTNONE 
J013042J24CCATGGGCCTTNONE 
J033037I12CCATGGGCCTTNONE 
J043031B12CCATGGGCCTTNONE 
J065152N10CCATGGGCCTTNONE 
J090060K17CCATGGGCCTTNONE 
J090083K14CCATGGGCCTTNONE 
J100046O13CCATGGGCCTTNONE 
J100066G22CCATGGGCCTTNONE 
Os04g0670800AK073170TAGGCCCATATNONE 
Os05g0102900006-056-A01AGATGGGCCTTNONE 
AK061764AGATGGGCCTTNONE 
AK065749AGATGGGCCTTSnf7 family protein. 
AK104101AGATGGGCCTTNONE 
J013042C01AGATGGGCCTTNONE 
J033038P15AGATGGGCCTTNONE 
J065032F16AGATGGGCCTTNONE 
J065039I22AGATGGGCCTTNONE 
J065150F19AGATGGGCCTTNONE 
J075079I21AGATGGGCCTTNONE 
J075082F14AGATGGGCCTTNONE 
J075098G16AGATGGGCCTTNONE 
J075167I08AGATGGGCCTTNONE 
Os05g0111000AK073598CAGGCCCATCTSimilar to Gag polyprotein [Contains: Core protein p15 (Matrix protein); Core protein p24; Core protein p12]. 
Os05g0112800AK108350CAGGCCCATGProtein of unknown function DUF26 domain containing protein. 
J065163K08CAGGCCCATGNONE 
Os05g0121500006-117-B10TCAGGCCCATCCANONE 
009-059-D04TCAGGCCCATCCANONE 
J065066C12TCAGGCCCATCCAConserved hypothetical protein. 
J075013I12TCAGGCCCATCCANONE 
J090046D18TCAGGCCCATCCANONE 
Os05g0129900AK060436TAGGCCCATATTetratricopeptide-like helical domain containing protein. 
AK102515TAGGCCCATATNONE 
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein. 
Os05g0148300009-031-A08AGATGGGCCTGANONE 
AK062421AGATGGGCCTGARibosomal protein S27, mitochondrial family protein. 
Os05g0177100AK064652CCAGGCCCATAAConserved hypothetical protein. 
Os05g0180700J100062K04CCATGGGCCTAConserved hypothetical protein. 
Os05g0182800AK121273TAATGGGCCTAGlutamyl-tRNA synthetase, class Ic family protein. 
AK121273TGATGGGCCTAGlutamyl-tRNA synthetase, class Ic family protein. 
Os05g0186000006-103-D10AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-047-D06AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-073-G05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-084-G09AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-097-G04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-111-D11AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-115-G01AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-131-B04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-144-F05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-154-D08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
014-004-H02AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK058675AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK060420AAAGCCCAATCCATGGGCCTGGGCTTCSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J065155C08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J075143K12AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
Os05g0193800AK058865TCATGGGCCTCNONE 
AK067940TCATGGGCCTCConserved hypothetical protein. 
J065043K19TCATGGGCCTCNONE 
J065095O10TCATGGGCCTCNONE 
J065095O12TCATGGGCCTCNONE 
J080002K02TCATGGGCCTCNONE 
J080012L17TCATGGGCCTCNONE 
J080013J02TCATGGGCCTCNONE 
J080013O11TCATGGGCCTCNONE 
J080020A17TCATGGGCCTCNONE 
J080028E18TCATGGGCCTCNONE 
J080036P11TCATGGGCCTCNONE 
J080042E10TCATGGGCCTCNONE 
J080042L10TCATGGGCCTCNONE 
J080047B11TCATGGGCCTCNONE 
J080048N05TCATGGGCCTCNONE 
J080057E20TCATGGGCCTCNONE 
J080057K13TCATGGGCCTCNONE 
J080058L03TCATGGGCCTCNONE 
J080063H07TCATGGGCCTCNONE 
J080066L23TCATGGGCCTCNONE 
J080069G22TCATGGGCCTCNONE 
J080072E12TCATGGGCCTCNONE 
J080076D06TCATGGGCCTCNONE 
J080077A22TCATGGGCCTCNONE 
J080081A01TCATGGGCCTCNONE 
J080090M13TCATGGGCCTCNONE 
J080093G07TCATGGGCCTCNONE 
J080094O20TCATGGGCCTCNONE 
J080097F13TCATGGGCCTCNONE 
Os05g0241400AK107803ATATGGGCCTATTGGGCCGGGCConserved hypothetical protein. 
Os05g0243300AK108395GAGGCCCATCASimilar to 50S ribosomal protein L13. 
J090098J16GAGGCCCATCANONE 
J100042H03GAGGCCCATCANONE 
J100088D02GAGGCCCATCANONE 
Os05g0295800AK070232AAGGCCCATCASimilar to Glyoxalase I (EC 4.4.1.5). 
J023043J03AAGGCCCATCANONE 
Os05g0295900AK069962TAGGCCCATTAGCCCAAACConserved hypothetical protein. 
Os05g0327000014-005-A12GAGGCCCATTANONE 
AK064059GAGGCCCATTACyclin-like domain containing protein. 
AK101588GAGGCCCATTANONE 
J033051A05GAGGCCCATTANONE 
J065106E02GAGGCCCATTANONE 
J065183D01GAGGCCCATTANONE 
Os05g0346300009-033-C06GCGGCCCAGCAAGGCCCATCGNONE 
AF529175GCGGCCCAGCAAGGCCCATCGNONE 
AK061627GCGGCCCAGCAAGGCCCATCGSimilar to 40S ribosomal protein S7. 
AK103081GCGGCCCAGCAAGGCCCATCGNONE 
AK104191GCGGCCCAGCAAGGCCCATCGNONE 
J013049B09GCGGCCCAGCAAGGCCCATCGNONE 
J023142E24GCGGCCCAGCAAGGCCCATCGNONE 
J033052M14GCGGCCCAGCAAGGCCCATCGNONE 
J033089N04GCGGCCCAGCAAGGCCCATCGNONE 
J033118F01GCGGCCCAGCAAGGCCCATCGNONE 
J065054E07GCGGCCCAGCAAGGCCCATCGNONE 
J065066L18GCGGCCCAGCAAGGCCCATCGNONE 
J065078C21GCGGCCCAGCAAGGCCCATCGNONE 
J065127G23GCGGCCCAGCAAGGCCCATCGNONE 
J065128N24GCGGCCCAGCAAGGCCCATCGNONE 
J065144P17GCGGCCCAGCAAGGCCCATCGNONE 
J065147P14GCGGCCCAGCAAGGCCCATCGNONE 
J065170E16GCGGCCCAGCAAGGCCCATCGNONE 
J065175D17GCGGCCCAGCAAGGCCCATCGNONE 
J065176M05GCGGCCCAGCAAGGCCCATCGNONE 
J065218G20GCGGCCCAGCAAGGCCCATCGNONE 
J090074J12GCGGCCCAGCAAGGCCCATCGNONE 
J100019H16GCGGCCCAGCAAGGCCCATCGNONE 
J100031N24GCGGCCCAGCAAGGCCCATCGNONE 
J100072G08GCGGCCCAGCAAGGCCCATCGNONE 
J100086I23GCGGCCCAGCAAGGCCCATCGNONE 
Os05g0363600AK108572TAATGGGCCTConserved hypothetical protein. 
Os05g0367100AK108334TAATGGGCCTCConserved hypothetical protein. 
Os05g0378900AK103841AGATGGGCCTAConserved hypothetical protein. 
J033148I18AGATGGGCCTANONE 
J065085F12AGATGGGCCTANONE 
J075041H24AGATGGGCCTANONE 
J075180P06AGATGGGCCTANONE 
Os05g0400600AK072045GAGGCCCATGACobalt transport protein family protein. 
Os05g0417200AK071955ATTTGGGCCACAATGGGCCTTGCGGGCCThioredoxin-like fold domain containing protein. 
AK071955TAATGGGCCACGATGGGCCTTThioredoxin-like fold domain containing protein. 
Os05g0435400AK109595TAGGCCCATTTConserved hypothetical protein. 
Os05g0443300Os05g0443300AAATGGGCCTGASec23/Sec24 trunk region domain containing protein. 
Os05g0443800AK106590CGATGGGCCTASimilar to Plastid division protein ftsZ1 precursor. 
AK106590TCAGGCCCATATSimilar to Plastid division protein ftsZ1 precursor. 
Os05g0452600009-022-A05AAGGCCCATTANONE 
009-166-F05AAGGCCCATTANONE 
AK121541AAGGCCCATTASimilar to Ribosomal protein L33. 
J033031N19AAGGCCCATTANONE 
Os05g0456000AK058420TCCGGCCCAACATGGATGGGCCTAMitochondrial glycoprotein family protein. 
AK102036TCCGGCCCAACATGGATGGGCCTANONE 
J065066F02TCCGGCCCAACATGGATGGGCCTANONE 
Os05g0459900AK058918AAGGCCCATTTAGCCCAGCCCSimilar to 60S ribosomal protein L36-1. 
AK111268AAGGCCCATTTAGCCCAGCCCNONE 
J013129N08AAGGCCCATTTAGCCCAGCCCNONE 
J065191E01AAGGCCCATTTAGCCCAGCCCNONE 
J065216P03AAGGCCCATTTAGCCCAGCCCNONE 
J075089K21AAGGCCCATTTAGCCCAGCCCNONE 
Os05g0470800011-027-A06GAGGCCCATGGGCCATNONE 
AK069780GAGGCCCATGGGCCATBacterial surface antigen (D15) family protein. 
J023007A20GAGGCCCATGGGCCATNONE 
J023028F19GAGGCCCATGGGCCATNONE 
J023081E20GAGGCCCATGGGCCATNONE 
J023089D13GAGGCCCATGGGCCATNONE 
J023115D18GAGGCCCATGGGCCATNONE 
J033087E22GAGGCCCATGGGCCATNONE 
J033143O14GAGGCCCATGGGCCATNONE 
Os05g0481000AK059369GAGGCCCATAAGCN5-related N-acetyltransferase domain containing protein. 
AK068619GAGGCCCATAANONE 
Os05g0490000011-076-C07AGATGGGCCTTNONE 
015-026-D07AGATGGGCCTTNONE 
015-074-A08AGATGGGCCTTNONE 
AK064335AGATGGGCCTTNONE 
AK101340AGATGGGCCTTKrr1 family protein. 
J033034J18AGATGGGCCTTNONE 
Os05g0494200006-042-H12GGGCCGCAGGCCCATANONE 
009-020-F06GGGCCGCAGGCCCATANONE 
009-069-C06GGGCCGCAGGCCCATANONE 
009-118-B01GGGCCGCAGGCCCATANONE 
AK059563GGGCCGCAGGCCCATANONE 
AK061025GGGCCGCAGGCCCATANONE 
J043031L14GGGCCGCAGGCCCATANONE 
J05595GGGCCGCAGGCCCATASimilar to Cysteine proteinase inhibitor-II (Oryzacystatin-II). 
J075068F23GGGCCGCAGGCCCATANONE 
Os05g0502800016-060-H05CAAGGCCCATAANONE 
AK064242CAAGGCCCATAANONE 
AK065486CAAGGCCCATAANAF1 domain containing protein. 
Os05g0519400AK072976GAGGCCCATAASimilar to N-ethylmaleimide sensitive factor NSF (Fragment). 
Os05g0535200AK070696AGATGGGCCTCCyclin-like F-box domain containing protein. 
J023057L12AGATGGGCCTCNONE 
Os05g0540800AK060731TAGGCCCATACNONE 
AK071090TAGGCCCATACHomeodomain-like containing protein. 
J013095F03TAGGCCCATACNONE 
J023079C11TAGGCCCATACNONE 
J033080E08TAGGCCCATACNONE 
Os05g0541500AK101190CCATGGGCCTTCyclin-like F-box domain containing protein. 
AK101190TAGGCCCATCACyclin-like F-box domain containing protein. 
AK101190TCAGGCCCATCTCyclin-like F-box domain containing protein. 
AK101531CCATGGGCCTTNONE 
AK101531TAGGCCCATCANONE 
AK101531TCAGGCCCATCTNONE 
J033030F10CCATGGGCCTTNONE 
J033030F10TAGGCCCATCANONE 
J033030F10TCAGGCCCATCTNONE 
Os05g0543800AK072185AATGGGCCTAConserved hypothetical protein. 
Os05g0547850009-102-F03AGATGGGCCTTGGGCCGAAANONE 
013-076-H08AGATGGGCCTTGGGCCGAAANONE 
AK058330AGATGGGCCTTGGGCCGAAANONE 
AK122158AGATGGGCCTTGGGCCGAAADNA-binding TFAR19-related protein family protein. 
AY626826AGATGGGCCTTGGGCCGAAANONE 
J043012O19AGATGGGCCTTGGGCCGAAANONE 
J043038O15AGATGGGCCTTGGGCCGAAANONE 
J053094L06AGATGGGCCTTGGGCCGAAANONE 
Os05g0548100AK060333TTTCGGCCCAAGGCCCATATConserved hypothetical protein. 
AK100682TTTCGGCCCAAGGCCCATATNONE 
J013151E01TTTCGGCCCAAGGCCCATATNONE 
J023113L22TTTCGGCCCAAGGCCCATATNONE 
J043027A19TTTCGGCCCAAGGCCCATATNONE 
J075093E06TTTCGGCCCAAGGCCCATATNONE 
J090060D15TTTCGGCCCAAGGCCCATATNONE 
J090082J03TTTCGGCCCAAGGCCCATATNONE 
J100050E01TTTCGGCCCAAGGCCCATATNONE 
Os05g0552900AK102095TAGGCCCATATMAP65/ASE1 family protein. 
Os05g0553700006-100-D08TCAGGCCCATATNONE 
AK099747TCAGGCCCATATNONE 
AK101606TCAGGCCCATATNONE 
AK103396TCAGGCCCATATSimilar to Syntaxin 71 (AtSYP71). 
J033022M23TCAGGCCCATATNONE 
J090086G01TCAGGCCCATATNONE 
Os05g0558000015-029-G05TAATGGGCCTGACTGGGCCTGANONE 
AK073857TAATGGGCCTGACTGGGCCTGARibosomal protein L1 family protein. 
J033074P11TAATGGGCCTGACTGGGCCTGANONE 
J090060I16TAATGGGCCTGACTGGGCCTGANONE 
Os05g0559900AK067197AAATGGGCCTAtRNA-binding arm domain containing protein. 
J013074C15AAATGGGCCTANONE 
J013098O16AAATGGGCCTANONE 
J033030M01AAATGGGCCTANONE 
J090058H12AAATGGGCCTANONE 
J090075M06AAATGGGCCTANONE 
Os05g0567500AK073046AAATGGGCCTCNONE 
AK121133AAATGGGCCTCDNA glycosylase family protein. 
J023075P20AAATGGGCCTCNONE 
Os05g0574500006-021-A08ATCTCGGCCCATTAGGCCCATATNONE 
006-049-A11ATCTCGGCCCATTAGGCCCATATNONE 
006-086-F03ATCTCGGCCCATTAGGCCCATATNONE 
009-051-F06ATCTCGGCCCATTAGGCCCATATNONE 
AB015287ATCTCGGCCCATTAGGCCCATATNONE 
AB015972ATCTCGGCCCATTAGGCCCATATNONE 
AK061714ATCTCGGCCCATTAGGCCCATATNONE 
AK098889ATCTCGGCCCATTAGGCCCATATNONE 
AK121699ATCTCGGCCCATTAGGCCCATATSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCTCGGCCCATTAGGCCCATATNONE 
J013072D17ATCTCGGCCCATTAGGCCCATATNONE 
J023028M04ATCTCGGCCCATTAGGCCCATATNONE 
J023031F01ATCTCGGCCCATTAGGCCCATATNONE 
J023114L22ATCTCGGCCCATTAGGCCCATATNONE 
J033058L12ATCTCGGCCCATTAGGCCCATATNONE 
J033073D17ATCTCGGCCCATTAGGCCCATATNONE 
J043031D08ATCTCGGCCCATTAGGCCCATATNONE 
J043036G01ATCTCGGCCCATTAGGCCCATATNONE 
J065144O04ATCTCGGCCCATTAGGCCCATATNONE 
J065181O08ATCTCGGCCCATTAGGCCCATATNONE 
J080066B20ATCTCGGCCCATTAGGCCCATATNONE 
Os05g0584600AK072537CCATGGGCCTTAAA ATPase domain containing protein. 
AK107350CCATGGGCCTTNONE 
Os05g0596600AK107823TCAGGCCCATTANONE 
AK121149TCAGGCCCATTASimilar to SMC5 protein. 
Os06g0103400009-138-H04AAGGCCCATCCNONE 
009-138-H04TAGGCCCATCANONE 
AK067021AAGGCCCATCCNucleic acid-binding, OB-fold domain containing protein. 
AK067021TAGGCCCATCANucleic acid-binding, OB-fold domain containing protein. 
AK071627AAGGCCCATCCNONE 
AK071627TAGGCCCATCANONE 
J080307A01AAGGCCCATCCNONE 
J080307A01TAGGCCCATCANONE 
Os06g0116800AK058985AATGGGCCTASimilar to GFA2. 
AK058985AATGGGCCTTGSimilar to GFA2. 
AK058985GAGGCCCATCASimilar to GFA2. 
AK120746AATGGGCCTANONE 
AK120746AATGGGCCTTGNONE 
AK120746GAGGCCCATCANONE 
Os06g0132600006-104-C03TAGGCCCATTTNONE 
AK061226TAGGCCCATTTConserved hypothetical protein. 
AK074010TAGGCCCATTTNONE 
J033076A22TAGGCCCATTTNONE 
Os06g0136000AK060303AATGGGCCTCSimilar to Hypersensitive-induced reaction protein 4. 
AK102678AATGGGCCTCNONE 
J075185K19AATGGGCCTCNONE 
J090028C16AATGGGCCTCNONE 
J090099N12AATGGGCCTCNONE 
J100070O10AATGGGCCTCNONE 
Os06g0139700006-052-C07CCATGGGCCAAGGCCCATTNONE 
009-009-A08CCATGGGCCAAGGCCCATTNONE 
015-020-D09CCATGGGCCAAGGCCCATTNONE 
015-087-H06CCATGGGCCAAGGCCCATTNONE 
016-078-A03CCATGGGCCAAGGCCCATTNONE 
AK067884CCATGGGCCAAGGCCCATTNONE 
AK103245CCATGGGCCAAGGCCCATTConserved hypothetical protein. 
AK106116CCATGGGCCAAGGCCCATTNONE 
AK106220CCATGGGCCAAGGCCCATTNONE 
Os06g0156700AK107226GCCCAGTAAGGCCCATGGGCCTTGLipolytic enzyme, G-D-S-L family protein. 
J075021O05GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075023M12GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075041C14GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075041C19GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075064F08GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075116I03GCCCAGTAAGGCCCATGGGCCTTGNONE 
J075123I02GCCCAGTAAGGCCCATGGGCCTTGNONE 
Os06g0156900AK110688TAGGCCCATTTGlycosyl transferase, family 31 protein. 
Os06g0178900011-082-D06GAGGCCCATGTNONE 
AK066933GAGGCCCATGTVacuolar H+-pyrophosphatase (EC 3.6.1.1) (Ovp2). 
D45384GAGGCCCATGTNONE 
J013025O19GAGGCCCATGTNONE 
J013067J23GAGGCCCATGTNONE 
J013119G12GAGGCCCATGTNONE 
J013119I17GAGGCCCATGTNONE 
J013132B18GAGGCCCATGTNONE 
J023108D14GAGGCCCATGTNONE 
J033034C17GAGGCCCATGTNONE 
J033088E10GAGGCCCATGTNONE 
J065013C19GAGGCCCATGTNONE 
J065047E17GAGGCCCATGTNONE 
J090004E24GAGGCCCATGTNONE 
J090008I11GAGGCCCATGTNONE 
J090011F12GAGGCCCATGTNONE 
J090014D19GAGGCCCATGTNONE 
J090030B11GAGGCCCATGTNONE 
J090038J24GAGGCCCATGTNONE 
J090045I05GAGGCCCATGTNONE 
J090046C11GAGGCCCATGTNONE 
J090046F19GAGGCCCATGTNONE 
J090048G03GAGGCCCATGTNONE 
J090050A14GAGGCCCATGTNONE 
J090051B15GAGGCCCATGTNONE 
J090052E04GAGGCCCATGTNONE 
J090052L10GAGGCCCATGTNONE 
J090071O13GAGGCCCATGTNONE 
J090075F03GAGGCCCATGTNONE 
J090080I15GAGGCCCATGTNONE 
J090088B04GAGGCCCATGTNONE 
J100029D12GAGGCCCATGTNONE 
J100032D14GAGGCCCATGTNONE 
J100037J15GAGGCCCATGTNONE 
J100045D01GAGGCCCATGTNONE 
J100045K04GAGGCCCATGTNONE 
J100053M07GAGGCCCATGTNONE 
J100056F04GAGGCCCATGTNONE 
J100056L21GAGGCCCATGTNONE 
J100073N11GAGGCCCATGTNONE 
J100076O13GAGGCCCATGTNONE 
Os06g0199500AK060939ATGGGCCTANONE 
AK064613ATGGGCCTASimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138ATGGGCCTANONE 
Os06g0227200AK066970AAGGCCCATAAConserved hypothetical protein. 
AK073517AAGGCCCATAANONE 
J013088F13AAGGCCCATAANONE 
J013089B21AAGGCCCATAANONE 
J013109D18AAGGCCCATAANONE 
J023138G01AAGGCCCATAANONE 
J033040I03AAGGCCCATAANONE 
J033042L14AAGGCCCATAANONE 
J065207L20AAGGCCCATAANONE 
J090019A12AAGGCCCATAANONE 
J090053M23AAGGCCCATAANONE 
Os06g0251000J033111L12TCAGGCCCATAANONE 
J043001C08TCAGGCCCATAAMolybdenum cofactor biosynthesis domain containing protein. 
Os06g0274200009-090-A02GAGGCCCATCTNONE 
AK073155GAGGCCCATCTSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065001C08GAGGCCCATCTNONE 
J065061C07GAGGCCCATCTNONE 
J065105L08GAGGCCCATCTNONE 
J075013C12GAGGCCCATCTNONE 
J090010N17GAGGCCCATCTNONE 
J090068K07GAGGCCCATCTNONE 
J100058A21GAGGCCCATCTNONE 
J100066C07GAGGCCCATCTNONE 
Os06g0275500AK111743TAGGCCCATATSimilar to Polycomb protein EZ1 (Enhancer of zeste protein 1). 
Os06g0287700AK067966CCAGGCCCATCCSimilar to NBS-LRR disease resistance protein homologue (Fragment). 
J013122I17CCAGGCCCATCCNONE 
J065038I02CCAGGCCCATCCNONE 
J065214J02CCAGGCCCATCCNONE 
Os06g0298500AK108252GTATGGGCCTAConserved hypothetical protein. 
J065144C04GTATGGGCCTANONE 
J075054P09GTATGGGCCTANONE 
J075165A13GTATGGGCCTANONE 
J075172E10GTATGGGCCTANONE 
Os06g0304500AK119441CATGGGCCTACRS1/YhbY domain containing protein. 
J075143M24CATGGGCCTANONE 
J075194D03CATGGGCCTANONE 
Os06g0543400AK065374TGATGGGCCTCSimilar to CBL-interacting serine/threonine-protein kinase 11 (EC 2.7.1.37) (SOS2-like protein kinase PKS5) (SOS-interacting protein 4) (SNF1- related kinase 3.22). 
J065019L09TGATGGGCCTCNONE 
J065041F08TGATGGGCCTCNONE 
J065081P20TGATGGGCCTCNONE 
J065087C11TGATGGGCCTCNONE 
J065136F12TGATGGGCCTCNONE 
J065152F17TGATGGGCCTCNONE 
J065152M10TGATGGGCCTCNONE 
J065168F13TGATGGGCCTCNONE 
J065169K12TGATGGGCCTCNONE 
J065171C10TGATGGGCCTCNONE 
J065180B14TGATGGGCCTCNONE 
J090014B17TGATGGGCCTCNONE 
Os06g0547900AK100950CGATGGGCCTTSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665CGATGGGCCTTNONE 
J023139I22CGATGGGCCTTNONE 
J090066J10CGATGGGCCTTNONE 
Y13437CGATGGGCCTTNONE 
Os06g0555500016-056-B08TAGGCCCATAANONE 
AK102375TAGGCCCATAANONE 
AK106546TAGGCCCATAAInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08TAGGCCCATAANONE 
J033091P04TAGGCCCATAANONE 
J090082P16TAGGCCCATAANONE 
Os06g0573700015-015-F02CCAGGCCCATATNONE 
AK106254CCAGGCCCATATConserved hypothetical protein. 
J065172G24CCAGGCCCATATNONE 
Os06g0583500J013034M04TTGGCCCATGAGGCCCATANONE 
J013169I02TTGGCCCATGAGGCCCATANONE 
J023024B09TTGGCCCATGAGGCCCATANONE 
J023132L02TTGGCCCATGAGGCCCATANONE 
J033026C23TTGGCCCATGAGGCCCATANONE 
J033094E23TTGGCCCATGAGGCCCATANONE 
J033101D23TTGGCCCATGAGGCCCATANONE 
J033125B15TTGGCCCATGAGGCCCATANONE 
J033144I11TTGGCCCATGAGGCCCATANONE 
J033145E13TTGGCCCATGAGGCCCATANONE 
J033145I11TTGGCCCATGAGGCCCATANONE 
J065022M23TTGGCCCATGAGGCCCATANONE 
J065043I24TTGGCCCATGAGGCCCATANONE 
J065053G06TTGGCCCATGAGGCCCATANONE 
J065088K03TTGGCCCATGAGGCCCATANONE 
J065121L09TTGGCCCATGAGGCCCATANONE 
J065143M08TTGGCCCATGAGGCCCATANONE 
J065146H02TTGGCCCATGAGGCCCATANONE 
J065206M03TTGGCCCATGAGGCCCATANONE 
J075004L13TTGGCCCATGAGGCCCATANONE 
J075005L17TTGGCCCATGAGGCCCATANONE 
J075007G18TTGGCCCATGAGGCCCATANONE 
J075027E20TTGGCCCATGAGGCCCATANONE 
J075029A19TTGGCCCATGAGGCCCATANONE 
J075041C15TTGGCCCATGAGGCCCATANONE 
J075046M05TTGGCCCATGAGGCCCATANONE 
J075066P21TTGGCCCATGAGGCCCATANONE 
J075069E07TTGGCCCATGAGGCCCATANONE 
J075107P21TTGGCCCATGAGGCCCATANONE 
J075123F03TTGGCCCATGAGGCCCATANONE 
J075124E07TTGGCCCATGAGGCCCATANONE 
J075140J22TTGGCCCATGAGGCCCATANONE 
J075160N03TTGGCCCATGAGGCCCATANONE 
Os06g0607800012-010-G03ATATGGGCCTANONE 
AB070254ATATGGGCCTANONE 
AK063158ATATGGGCCTASimilar to 26S proteasome regulatory complex subunit p42D. 
AK066695ATATGGGCCTANONE 
J013074G13ATATGGGCCTANONE 
J090015C16ATATGGGCCTANONE 
J090069H10ATATGGGCCTANONE 
Os06g0663600AK100787AAGGCCCATTEndonuclease V family protein. 
Os06g0667600AK058606ACATGGGCCTANONE 
AK071621ACATGGGCCTASimilar to Glycine decarboxylase complex H-protein. 
J023101D03ACATGGGCCTANONE 
J033095E17ACATGGGCCTANONE 
J065020B16ACATGGGCCTANONE 
Os06g0673500J100018J12CCATGGGCCTTNONE 
J100072F13CCATGGGCCTTSimilar to Ubiquitin. 
Os06g0678200AK059456CCAGGCCCATCGNONE 
AK071299CCAGGCCCATCGSimilar to Geranyl diphosphate synthase. 
Os06g0681000009-105-G11AGATGGGCCTGNONE 
009-105-G11GGATGGGCCTANONE 
AK062780AGATGGGCCTGConserved hypothetical protein. 
AK062780GGATGGGCCTAConserved hypothetical protein. 
J100021E01AGATGGGCCTGNONE 
J100021E01GGATGGGCCTANONE 
Os06g0682800011-092-E01ACATGGGCCTGANONE 
011-092-E01GAGGCCCATTTNONE 
AK064816ACATGGGCCTGAZinc finger, CCCH-type domain containing protein. 
AK064816GAGGCCCATTTZinc finger, CCCH-type domain containing protein. 
J013000E13ACATGGGCCTGANONE 
J013000E13GAGGCCCATTTNONE 
J013035J22ACATGGGCCTGANONE 
J013035J22GAGGCCCATTTNONE 
J013045M06ACATGGGCCTGANONE 
J013045M06GAGGCCCATTTNONE 
J013120A07ACATGGGCCTGANONE 
J013120A07GAGGCCCATTTNONE 
J033144H15ACATGGGCCTGANONE 
J033144H15GAGGCCCATTTNONE 
J033145H15ACATGGGCCTGANONE 
J033145H15GAGGCCCATTTNONE 
J033145N16ACATGGGCCTGANONE 
J033145N16GAGGCCCATTTNONE 
J090019J02ACATGGGCCTGANONE 
J090019J02GAGGCCCATTTNONE 
Os06g0683200AK060024GAGGCCCATTTSimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432GAGGCCCATTTNONE 
J023002B12GAGGCCCATTTNONE 
J023054E10GAGGCCCATTTNONE 
J023123F19GAGGCCCATTTNONE 
J065035K13GAGGCCCATTTNONE 
J065129P09GAGGCCCATTTNONE 
J065184B14GAGGCCCATTTNONE 
Os06g0688100AK063450CAGGCCCATCANONE 
AK101144CAGGCCCATCARNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0693000AK064280CAAGGCCCATATProtein kinase-like domain containing protein. 
Os06g0711600016-047-G09CATGGGCCTTGNONE 
AK064384CATGGGCCTTGmRNA splicing factor SYF2 family protein. 
AK102831CATGGGCCTTGNONE 
J013072P18CATGGGCCTTGNONE 
J023049G01CATGGGCCTTGNONE 
J023088I01CATGGGCCTTGNONE 
J033023I22CATGGGCCTTGNONE 
J033106I12CATGGGCCTTGNONE 
J033109G07CATGGGCCTTGNONE 
J065030F22CATGGGCCTTGNONE 
J065132H19CATGGGCCTTGNONE 
J080301D07CATGGGCCTTGNONE 
J080305C09CATGGGCCTTGNONE 
J080312C03CATGGGCCTTGNONE 
J080313I15CATGGGCCTTGNONE 
J080315B09CATGGGCCTTGNONE 
J090056N21CATGGGCCTTGNONE 
J100027B07CATGGGCCTTGNONE 
Os06g0712500AK068531AAATGGGCCTASimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os06g0712900AK106648TCATGGGCCGAAAAGGCCCATATDihydrouridine synthase, DuS family protein. 
J075055M19TCATGGGCCGAAAAGGCCCATATNONE 
J075122I03TCATGGGCCGAAAAGGCCCATATNONE 
Os06g0715400012-007-C01GAGGCCCAAGGCCCATACNONE 
012-038-G03GAGGCCCAAGGCCCATACNONE 
AK071262GAGGCCCAAGGCCCATACt-snare domain containing protein. 
AK073963GAGGCCCAAGGCCCATACNONE 
J023085J06GAGGCCCAAGGCCCATACNONE 
J033073I09GAGGCCCAAGGCCCATACNONE 
J080316N15GAGGCCCAAGGCCCATACNONE 
J090062N15GAGGCCCAAGGCCCATACNONE 
Os06g0725400J065086O07TCAGGCCCATTASimilar to BLE1 protein. 
J065114J19TCAGGCCCATTANONE 
Os06g0726400AF136268GACACGTGAAGGCCCATGGNONE 
AK065121GACACGTGAAGGCCCATGGNONE 
AK119436GACACGTGAAGGCCCATGGBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
AK120332GACACGTGAAGGCCCATGGNONE 
AY302112GACACGTGAAGGCCCATGGNONE 
D10752GACACGTGAAGGCCCATGGNONE 
D11082GACACGTGAAGGCCCATGGNONE 
J013031L12GACACGTGAAGGCCCATGGNONE 
J013042M09GACACGTGAAGGCCCATGGNONE 
J013058E01GACACGTGAAGGCCCATGGNONE 
J013058O09GACACGTGAAGGCCCATGGNONE 
J013063J17GACACGTGAAGGCCCATGGNONE 
J013066I24GACACGTGAAGGCCCATGGNONE 
J013069F17GACACGTGAAGGCCCATGGNONE 
J013106E01GACACGTGAAGGCCCATGGNONE 
J013118D19GACACGTGAAGGCCCATGGNONE 
J013162M11GACACGTGAAGGCCCATGGNONE 
J023028B19GACACGTGAAGGCCCATGGNONE 
J023031A13GACACGTGAAGGCCCATGGNONE 
J023047H18GACACGTGAAGGCCCATGGNONE 
J023059N10GACACGTGAAGGCCCATGGNONE 
J023104N22GACACGTGAAGGCCCATGGNONE 
J033025J03GACACGTGAAGGCCCATGGNONE 
J033045B05GACACGTGAAGGCCCATGGNONE 
J033067M08GACACGTGAAGGCCCATGGNONE 
J033113D04GACACGTGAAGGCCCATGGNONE 
J043003D11GACACGTGAAGGCCCATGGNONE 
J043009O20GACACGTGAAGGCCCATGGNONE 
J043016P06GACACGTGAAGGCCCATGGNONE 
J043017C21GACACGTGAAGGCCCATGGNONE 
J043017J20GACACGTGAAGGCCCATGGNONE 
J043021P15GACACGTGAAGGCCCATGGNONE 
J043026I22GACACGTGAAGGCCCATGGNONE 
J043032L15GACACGTGAAGGCCCATGGNONE 
J043034G14GACACGTGAAGGCCCATGGNONE 
J043039L16GACACGTGAAGGCCCATGGNONE 
J075003D02GACACGTGAAGGCCCATGGNONE 
J075003O22GACACGTGAAGGCCCATGGNONE 
J075005I24GACACGTGAAGGCCCATGGNONE 
J075006N09GACACGTGAAGGCCCATGGNONE 
J075011A22GACACGTGAAGGCCCATGGNONE 
J075012K24GACACGTGAAGGCCCATGGNONE 
J075017D01GACACGTGAAGGCCCATGGNONE 
J075017I23GACACGTGAAGGCCCATGGNONE 
J075023D17GACACGTGAAGGCCCATGGNONE 
J075024B03GACACGTGAAGGCCCATGGNONE 
J075025H05GACACGTGAAGGCCCATGGNONE 
J075031D19GACACGTGAAGGCCCATGGNONE 
J075034B02GACACGTGAAGGCCCATGGNONE 
J075035C02GACACGTGAAGGCCCATGGNONE 
J075037J12GACACGTGAAGGCCCATGGNONE 
J075038M11GACACGTGAAGGCCCATGGNONE 
J075039J17GACACGTGAAGGCCCATGGNONE 
J075042P10GACACGTGAAGGCCCATGGNONE 
J075046J20GACACGTGAAGGCCCATGGNONE 
J075047F21GACACGTGAAGGCCCATGGNONE 
J075053E05GACACGTGAAGGCCCATGGNONE 
J075054D11GACACGTGAAGGCCCATGGNONE 
J075054K06GACACGTGAAGGCCCATGGNONE 
J075059E15GACACGTGAAGGCCCATGGNONE 
J075061O04GACACGTGAAGGCCCATGGNONE 
J075062I20GACACGTGAAGGCCCATGGNONE 
J075066I12GACACGTGAAGGCCCATGGNONE 
J075066L06GACACGTGAAGGCCCATGGNONE 
J075071H12GACACGTGAAGGCCCATGGNONE 
J075071N19GACACGTGAAGGCCCATGGNONE 
J075074K01GACACGTGAAGGCCCATGGNONE 
J075077H22GACACGTGAAGGCCCATGGNONE 
J075083H18GACACGTGAAGGCCCATGGNONE 
J075085F04GACACGTGAAGGCCCATGGNONE 
J075085K09GACACGTGAAGGCCCATGGNONE 
J075086C06GACACGTGAAGGCCCATGGNONE 
J075086E06GACACGTGAAGGCCCATGGNONE 
J075087A15GACACGTGAAGGCCCATGGNONE 
J075090N02GACACGTGAAGGCCCATGGNONE 
J075090N22GACACGTGAAGGCCCATGGNONE 
J075091C04GACACGTGAAGGCCCATGGNONE 
J075091G16GACACGTGAAGGCCCATGGNONE 
J075097E04GACACGTGAAGGCCCATGGNONE 
J075099E04GACACGTGAAGGCCCATGGNONE 
J075102P22GACACGTGAAGGCCCATGGNONE 
J075109B08GACACGTGAAGGCCCATGGNONE 
J075109J02GACACGTGAAGGCCCATGGNONE 
J075115I12GACACGTGAAGGCCCATGGNONE 
J075117E17GACACGTGAAGGCCCATGGNONE 
J075123C07GACACGTGAAGGCCCATGGNONE 
J075124N05GACACGTGAAGGCCCATGGNONE 
J075125E12GACACGTGAAGGCCCATGGNONE 
J075126B11GACACGTGAAGGCCCATGGNONE 
J075129E14GACACGTGAAGGCCCATGGNONE 
J075130N15GACACGTGAAGGCCCATGGNONE 
J075131I07GACACGTGAAGGCCCATGGNONE 
J075141B13GACACGTGAAGGCCCATGGNONE 
J075141B20GACACGTGAAGGCCCATGGNONE 
J075144D23GACACGTGAAGGCCCATGGNONE 
J075144N01GACACGTGAAGGCCCATGGNONE 
J075147M24GACACGTGAAGGCCCATGGNONE 
J075148L16GACACGTGAAGGCCCATGGNONE 
J075151A22GACACGTGAAGGCCCATGGNONE 
J075151D03GACACGTGAAGGCCCATGGNONE 
J075151D04GACACGTGAAGGCCCATGGNONE 
J075153E23GACACGTGAAGGCCCATGGNONE 
J075156D02GACACGTGAAGGCCCATGGNONE 
J075156P05GACACGTGAAGGCCCATGGNONE 
J075162E23GACACGTGAAGGCCCATGGNONE 
J075165J22GACACGTGAAGGCCCATGGNONE 
J075166A06GACACGTGAAGGCCCATGGNONE 
J075168H13GACACGTGAAGGCCCATGGNONE 
J075170D04GACACGTGAAGGCCCATGGNONE 
J075171C19GACACGTGAAGGCCCATGGNONE 
J075173B12GACACGTGAAGGCCCATGGNONE 
J075173M23GACACGTGAAGGCCCATGGNONE 
J075174C03GACACGTGAAGGCCCATGGNONE 
J075185O11GACACGTGAAGGCCCATGGNONE 
J075186G21GACACGTGAAGGCCCATGGNONE 
J075187D06GACACGTGAAGGCCCATGGNONE 
J075195G21GACACGTGAAGGCCCATGGNONE 
J090003D18GACACGTGAAGGCCCATGGNONE 
J090005I12GACACGTGAAGGCCCATGGNONE 
J090007D15GACACGTGAAGGCCCATGGNONE 
J090007G20GACACGTGAAGGCCCATGGNONE 
J090014G13GACACGTGAAGGCCCATGGNONE 
J090014L08GACACGTGAAGGCCCATGGNONE 
J090016J03GACACGTGAAGGCCCATGGNONE 
J090023P22GACACGTGAAGGCCCATGGNONE 
J090025C19GACACGTGAAGGCCCATGGNONE 
J090028F11GACACGTGAAGGCCCATGGNONE 
J090028G01GACACGTGAAGGCCCATGGNONE 
J090028H02GACACGTGAAGGCCCATGGNONE 
J090037I11GACACGTGAAGGCCCATGGNONE 
J090040F21GACACGTGAAGGCCCATGGNONE 
J090040N24GACACGTGAAGGCCCATGGNONE 
J090044M12GACACGTGAAGGCCCATGGNONE 
J090045B13GACACGTGAAGGCCCATGGNONE 
J090045M22GACACGTGAAGGCCCATGGNONE 
J090048C10GACACGTGAAGGCCCATGGNONE 
J090051J02GACACGTGAAGGCCCATGGNONE 
J090058O15GACACGTGAAGGCCCATGGNONE 
J090062F11GACACGTGAAGGCCCATGGNONE 
J090067D23GACACGTGAAGGCCCATGGNONE 
J090069G15GACACGTGAAGGCCCATGGNONE 
J090072I06GACACGTGAAGGCCCATGGNONE 
J090073H18GACACGTGAAGGCCCATGGNONE 
J090073L01GACACGTGAAGGCCCATGGNONE 
J090075O21GACACGTGAAGGCCCATGGNONE 
J090084K24GACACGTGAAGGCCCATGGNONE 
J090087P11GACACGTGAAGGCCCATGGNONE 
J090092B17GACACGTGAAGGCCCATGGNONE 
J100042H08GACACGTGAAGGCCCATGGNONE 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J033064G11TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065044F12TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065047I05TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065059P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065180P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J075131M22TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
Os07g0122300015-004-G08GCAGCCCATGGGCCTTNONE 
AK103212GCAGCCCATGGGCCTTNONE 
AK119295GCAGCCCATGGGCCTTProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09GCAGCCCATGGGCCTTNONE 
J090007P13GCAGCCCATGGGCCTTNONE 
Os07g0124500012-092-F01GAGGCCCATTTNONE 
AK070529GAGGCCCATTTSimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000GAGGCCCATTTNONE 
J090007O11GAGGCCCATTTNONE 
J090010E02GAGGCCCATTTNONE 
J090078C04GAGGCCCATTTNONE 
Os07g0130500AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
Os07g0150200009-152-C07TGATGGGCCTCNONE 
AK058680TGATGGGCCTCNONE 
AK121635TGATGGGCCTCSimilar to 40S ribosomal protein S12-1. 
J033051C16TGATGGGCCTCNONE 
J033123H15TGATGGGCCTCNONE 
J065093I01TGATGGGCCTCNONE 
J065197C05TGATGGGCCTCNONE 
J075037B11TGATGGGCCTCNONE 
J075114B08TGATGGGCCTCNONE 
J075123N01TGATGGGCCTCNONE 
J075129O04TGATGGGCCTCNONE 
J075160H17TGATGGGCCTCNONE 
J075166H17TGATGGGCCTCNONE 
J080310F11TGATGGGCCTCNONE 
J080315P11TGATGGGCCTCNONE 
J090025A22TGATGGGCCTCNONE 
Os07g0154300009-070-E08TAGGCCCATCCNONE 
009-077-E01TAGGCCCATCCNONE 
009-196-F05TAGGCCCATCCNONE 
AK105386TAGGCCCATCCConserved hypothetical protein. 
AK122093TAGGCCCATCCNONE 
J033124K14TAGGCCCATCCNONE 
J075006I22TAGGCCCATCCNONE 
J075185G02TAGGCCCATCCNONE 
J090039C02TAGGCCCATCCNONE 
Os07g0164500J013094M18TCAGGCCCATGGGCTNONE 
J013153L05TCAGGCCCATGGGCTNONE 
J023011J18TCAGGCCCATGGGCTNONE 
J023106H21TCAGGCCCATGGGCTNONE 
J033105F10TCAGGCCCATGGGCTNONE 
J065210M20TCAGGCCCATGGGCTSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05TCAGGCCCATGGGCTNONE 
J090061C13TCAGGCCCATGGGCTNONE 
J090074K15TCAGGCCCATGGGCTNONE 
Os07g0188700011-058-D09ATATGGGCCTANONE 
AK063957ATATGGGCCTANONE 
AK073755ATATGGGCCTASimilar to EXO. 
AK107609ATATGGGCCTANONE 
J033066N03ATATGGGCCTANONE 
Os07g0202100AK101736TAATGGGCCTCSimilar to ATP-dependent RNA helicase ded1. 
Os07g0270900015-039-A02AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
AK068904AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J013169N21AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065039I11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065081J11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065162P04AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
Os07g0435400AK111603TAATGGGCCTCSimilar to WD40. 
Os07g0448800003-112-B05AAGGCCCATCCANONE 
003-118-A02AAGGCCCATCCANONE 
006-029-E09AAGGCCCATCCANONE 
006-056-F11AAGGCCCATCCANONE 
006-081-F01AAGGCCCATCCANONE 
006-084-H12AAGGCCCATCCANONE 
006-094-A12AAGGCCCATCCANONE 
006-095-C01AAGGCCCATCCANONE 
006-098-F09AAGGCCCATCCANONE 
009-151-B09AAGGCCCATCCANONE 
009-169-C08AAGGCCCATCCANONE 
009-172-F09AAGGCCCATCCANONE 
009-200-H03AAGGCCCATCCANONE 
011-008-B03AAGGCCCATCCANONE 
011-035-C10AAGGCCCATCCANONE 
011-041-G11AAGGCCCATCCANONE 
011-059-H01AAGGCCCATCCANONE 
011-071-D12AAGGCCCATCCANONE 
013-010-E11AAGGCCCATCCANONE 
013-015-B06AAGGCCCATCCANONE 
013-028-A11AAGGCCCATCCANONE 
013-037-A04AAGGCCCATCCANONE 
013-057-B07AAGGCCCATCCANONE 
014-041-D03AAGGCCCATCCANONE 
014-073-G04AAGGCCCATCCANONE 
014-093-D10AAGGCCCATCCANONE 
016-030-F03AAGGCCCATCCANONE 
016-034-B08AAGGCCCATCCANONE 
016-064-D05AAGGCCCATCCANONE 
AB029446AAGGCCCATCCANONE 
AF062393AAGGCCCATCCANONE 
AK072519AAGGCCCATCCAAquaporin. 
AK103938AAGGCCCATCCANONE 
AK103970AAGGCCCATCCANONE 
AK119656AAGGCCCATCCANONE 
J023026N01AAGGCCCATCCANONE 
J023055M16AAGGCCCATCCANONE 
J023063J21AAGGCCCATCCANONE 
J023128K12AAGGCCCATCCANONE 
J065041P10AAGGCCCATCCANONE 
J065134L07AAGGCCCATCCANONE 
J075198L17AAGGCCCATCCANONE 
J090031G17AAGGCCCATCCANONE 
J090032B21AAGGCCCATCCANONE 
J090032D13AAGGCCCATCCANONE 
J090057J22AAGGCCCATCCANONE 
J090062J02AAGGCCCATCCANONE 
J100028J09AAGGCCCATCCANONE 
J100053C06AAGGCCCATCCANONE 
J100056I11AAGGCCCATCCANONE 
J100067E10AAGGCCCATCCANONE 
Os07g0515700AK103117TAATGGGCCTCAnkyrin repeat containing protein. 
Os07g0529600006-066-F05GAGGCCCATACNONE 
009-049-D10GAGGCCCATACNONE 
009-180-A06GAGGCCCATACNONE 
013-001-E04GAGGCCCATACNONE 
013-011-G03GAGGCCCATACNONE 
013-015-D04GAGGCCCATACNONE 
013-016-B02GAGGCCCATACNONE 
013-021-B11GAGGCCCATACNONE 
013-021-F07GAGGCCCATACNONE 
013-022-B02GAGGCCCATACNONE 
013-029-D10GAGGCCCATACNONE 
013-029-E04GAGGCCCATACNONE 
013-032-A07GAGGCCCATACNONE 
013-035-D07GAGGCCCATACNONE 
013-036-B03GAGGCCCATACNONE 
013-036-B10GAGGCCCATACNONE 
013-037-F08GAGGCCCATACNONE 
013-040-B02GAGGCCCATACNONE 
013-040-B10GAGGCCCATACNONE 
013-041-D07GAGGCCCATACNONE 
013-044-H10GAGGCCCATACNONE 
013-046-C06GAGGCCCATACNONE 
013-047-E03GAGGCCCATACNONE 
013-051-E06GAGGCCCATACNONE 
013-055-B07GAGGCCCATACNONE 
013-055-H04GAGGCCCATACNONE 
013-057-G06GAGGCCCATACNONE 
013-060-E04GAGGCCCATACNONE 
013-062-C07GAGGCCCATACNONE 
013-064-B11GAGGCCCATACNONE 
013-065-A09GAGGCCCATACNONE 
013-065-H03GAGGCCCATACNONE 
013-066-C07GAGGCCCATACNONE 
013-069-B03GAGGCCCATACNONE 
013-070-B08GAGGCCCATACNONE 
013-074-A03GAGGCCCATACNONE 
013-082-B08GAGGCCCATACNONE 
013-083-C10GAGGCCCATACNONE 
013-088-H12GAGGCCCATACNONE 
013-089-A10GAGGCCCATACNONE 
013-089-H06GAGGCCCATACNONE 
013-091-B09GAGGCCCATACNONE 
013-095-D09GAGGCCCATACNONE 
013-099-D03GAGGCCCATACNONE 
014-008-H04GAGGCCCATACNONE 
014-015-D12GAGGCCCATACNONE 
014-017-H12GAGGCCCATACNONE 
014-040-C05GAGGCCCATACNONE 
014-045-D07GAGGCCCATACNONE 
014-053-B03GAGGCCCATACNONE 
014-073-B05GAGGCCCATACNONE 
014-098-F10GAGGCCCATACNONE 
AB110170GAGGCCCATACNONE 
AK064916GAGGCCCATACNONE 
AK099918GAGGCCCATACSimilar to Thiazole biosynthetic enzyme 1-1, chloroplast precursor. 
J013000M17GAGGCCCATACNONE 
J013039J16GAGGCCCATACNONE 
J013055B12GAGGCCCATACNONE 
J013059A13GAGGCCCATACNONE 
J013060H05GAGGCCCATACNONE 
J013067A05GAGGCCCATACNONE 
J013071H11GAGGCCCATACNONE 
J013075I24GAGGCCCATACNONE 
J013102B09GAGGCCCATACNONE 
J013123E11GAGGCCCATACNONE 
J013123I22GAGGCCCATACNONE 
J013123L17GAGGCCCATACNONE 
J013156A11GAGGCCCATACNONE 
J013158K17GAGGCCCATACNONE 
J013160E19GAGGCCCATACNONE 
J023022F22GAGGCCCATACNONE 
J023045D15GAGGCCCATACNONE 
J023063E21GAGGCCCATACNONE 
J023078H19GAGGCCCATACNONE 
J023107E18GAGGCCCATACNONE 
J023107O16GAGGCCCATACNONE 
J023108B07GAGGCCCATACNONE 
J023113M14GAGGCCCATACNONE 
J023122K02GAGGCCCATACNONE 
J023134I12GAGGCCCATACNONE 
J033024O07GAGGCCCATACNONE 
J033045E09GAGGCCCATACNONE 
J033050O12GAGGCCCATACNONE 
J033052B16GAGGCCCATACNONE 
J033052F10GAGGCCCATACNONE 
J033052L07GAGGCCCATACNONE 
J033055D16GAGGCCCATACNONE 
J033093C13GAGGCCCATACNONE 
J033107I04GAGGCCCATACNONE 
J033122D23GAGGCCCATACNONE 
J043029H01GAGGCCCATACNONE 
J053043E04GAGGCCCATACNONE 
J053059G17GAGGCCCATACNONE 
J053069L11GAGGCCCATACNONE 
J053095I18GAGGCCCATACNONE 
J065035I11GAGGCCCATACNONE 
J065087P10GAGGCCCATACNONE 
J065124B14GAGGCCCATACNONE 
J065198E12GAGGCCCATACNONE 
J065210N22GAGGCCCATACNONE 
J065210P16GAGGCCCATACNONE 
J080309H11GAGGCCCATACNONE 
J080316C05GAGGCCCATACNONE 
J090039D18GAGGCCCATACNONE 
J090053F06GAGGCCCATACNONE 
J090084D01GAGGCCCATACNONE 
J090085K24GAGGCCCATACNONE 
J090096C10GAGGCCCATACNONE 
J090097N18GAGGCCCATACNONE 
J100045M09GAGGCCCATACNONE 
Os07g0537500AK111734GAGGCCCATTProtein of unknown function DUF26 domain containing protein. 
Os07g0568900009-083-H02TAATGGGCCTTATTGGGCTTANONE 
AK062660TAATGGGCCTTATTGGGCTTAConserved hypothetical protein. 
Os07g0569000AK073915TAAGCCCAATAAGGCCCATTAConserved hypothetical protein. 
Os07g0585800006-106-A05GTATGGGCCTTNONE 
AK066419GTATGGGCCTTNONE 
AK105064GTATGGGCCTTSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01GTATGGGCCTTNONE 
J065085B08GTATGGGCCTTNONE 
J065099I23GTATGGGCCTTNONE 
J065169A01GTATGGGCCTTNONE 
J065187N13GTATGGGCCTTNONE 
J065191L18GTATGGGCCTTNONE 
J065194D04GTATGGGCCTTNONE 
J065211M09GTATGGGCCTTNONE 
J065212I02GTATGGGCCTTNONE 
J090003C10GTATGGGCCTTNONE 
J090025O11GTATGGGCCTTNONE 
J090092F10GTATGGGCCTTNONE 
J100055A04GTATGGGCCTTNONE 
J100064A01GTATGGGCCTTNONE 
J100080L02GTATGGGCCTTNONE 
Os07g0598100AK068136GTATGGGCCTGGGCCGTASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
Os07g0603100AK101352TCATGGGCCTGGNuclear transport factor 2 domain containing protein. 
J023077E09TCATGGGCCTGGNONE 
J023081N15TCATGGGCCTGGNONE 
J033022N22TCATGGGCCTGGNONE 
J033024M18TCATGGGCCTGGNONE 
J033034P09TCATGGGCCTGGNONE 
J033046A06TCATGGGCCTGGNONE 
J033051K01TCATGGGCCTGGNONE 
J033081P09TCATGGGCCTGGNONE 
J033091B17TCATGGGCCTGGNONE 
J033092K23TCATGGGCCTGGNONE 
J033132J09TCATGGGCCTGGNONE 
J033144A14TCATGGGCCTGGNONE 
J033145A14TCATGGGCCTGGNONE 
J043021B20TCATGGGCCTGGNONE 
J053024D23TCATGGGCCTGGNONE 
J065212J10TCATGGGCCTGGNONE 
J090055M05TCATGGGCCTGGNONE 
J090065E14TCATGGGCCTGGNONE 
J090092J06TCATGGGCCTGGNONE 
Os07g0606500AK068811TGATGGGCCTCNONE 
AK121873TGATGGGCCTCNONE 
J013159C05TGATGGGCCTCNONE 
J075158B14TGATGGGCCTCNONE 
Os07g0656400011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
Os07g0659500AK073537GAGGCCCATCCANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
AK073537TGGATGGGCCTANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os07g0665200003-019-A05AATGGGCCTANONE 
009-087-A09AATGGGCCTANONE 
D01000AATGGGCCTANONE 
J033143H14AATGGGCCTANONE 
J043022G14AATGGGCCTANONE 
J043040G10AATGGGCCTANONE 
J065046K22AATGGGCCTANONE 
J065162K09AATGGGCCTANONE 
J065164G02AATGGGCCTANONE 
J075003D09AATGGGCCTANONE 
J075004F23AATGGGCCTANONE 
J075025F23AATGGGCCTANONE 
J075026E23AATGGGCCTANONE 
J075028N04AATGGGCCTANONE 
J075046L05AATGGGCCTANONE 
J075047G14AATGGGCCTANONE 
J075052I05AATGGGCCTANONE 
J075060K13AATGGGCCTANONE 
J075066I02AATGGGCCTANONE 
J075082L08AATGGGCCTANONE 
J075086C20AATGGGCCTANONE 
J075087E13AATGGGCCTANONE 
J075101B12AATGGGCCTASuperoxide dismutase [Cu-Zn] 2 (EC 1.15.1.1). 
J075114M12AATGGGCCTANONE 
J075120J06AATGGGCCTANONE 
J075141D13AATGGGCCTANONE 
J075155D09AATGGGCCTANONE 
J075155N05AATGGGCCTANONE 
J075163H19AATGGGCCTANONE 
J075165C16AATGGGCCTANONE 
J075172N15AATGGGCCTANONE 
J075174A22AATGGGCCTANONE 
J075175M10AATGGGCCTANONE 
J075176D14AATGGGCCTANONE 
J075180H01AATGGGCCTANONE 
J075188H09AATGGGCCTANONE 
J075192G18AATGGGCCTANONE 
J080003I11AATGGGCCTANONE 
J080013F21AATGGGCCTANONE 
J080027D23AATGGGCCTANONE 
J080033F06AATGGGCCTANONE 
J080034C04AATGGGCCTANONE 
J080044E15AATGGGCCTANONE 
J080048M04AATGGGCCTANONE 
J080049J23AATGGGCCTANONE 
J080059A17AATGGGCCTANONE 
J080063A12AATGGGCCTANONE 
J080069K04AATGGGCCTANONE 
J080070K24AATGGGCCTANONE 
J080075F04AATGGGCCTANONE 
J080076A11AATGGGCCTANONE 
J080076J10AATGGGCCTANONE 
J080082C24AATGGGCCTANONE 
J080085B06AATGGGCCTANONE 
J080089C13AATGGGCCTANONE 
J080096E20AATGGGCCTANONE 
J100021E15AATGGGCCTANONE 
J100029A07AATGGGCCTANONE 
J100053A11AATGGGCCTANONE 
J100058L04AATGGGCCTANONE 
J100061J11AATGGGCCTANONE 
J100063A11AATGGGCCTANONE 
Os07g0673100AK060100GAGGCCCATATNONE 
AK103678GAGGCCCATATRibosomal protein S8E family protein. 
AK104794GAGGCCCATATNONE 
Os07g0680300009-195-E06TCAGGCCCATANONE 
009-195-E06TCGGCCCACTTAGGCCCATATNONE 
AK063800TCAGGCCCATASimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
AK063800TCGGCCCACTTAGGCCCATATSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
J065093F19TCAGGCCCATANONE 
J065093F19TCGGCCCACTTAGGCCCATATNONE 
J075066A20TCAGGCCCATANONE 
J075066A20TCGGCCCACTTAGGCCCATATNONE 
J075088I17TCAGGCCCATANONE 
J075088I17TCGGCCCACTTAGGCCCATATNONE 
J075147M19TCAGGCCCATANONE 
J075147M19TCGGCCCACTTAGGCCCATATNONE 
J075153L02TCAGGCCCATANONE 
J075153L02TCGGCCCACTTAGGCCCATATNONE 
J080013A21TCAGGCCCATANONE 
J080013A21TCGGCCCACTTAGGCCCATATNONE 
J080051B13TCAGGCCCATANONE 
J080051B13TCGGCCCACTTAGGCCCATATNONE 
J080077I24TCAGGCCCATANONE 
J080077I24TCGGCCCACTTAGGCCCATATNONE 
J080302B14TCAGGCCCATANONE 
J080302B14TCGGCCCACTTAGGCCCATATNONE 
J080309D22TCAGGCCCATANONE 
J080309D22TCGGCCCACTTAGGCCCATATNONE 
J100083B16TCAGGCCCATANONE 
J100083B16TCGGCCCACTTAGGCCCATATNONE 
Os07g0687300AK073043AAATGGGCTTAGGCCCATTSimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0110200AK068841GAGGCCCATATSimilar to Fertility restorer. 
J090071I18GAGGCCCATATNONE 
Os08g0112800009-113-D03AAGGCCCATTANONE 
AK121176AAGGCCCATTARickettsia 17 kDa surface antigen family protein. 
J023083C18AAGGCCCATTANONE 
J033074M10AAGGCCCATTANONE 
J033097G10AAGGCCCATTANONE 
J065090F05AAGGCCCATTANONE 
J090001J03AAGGCCCATTANONE 
J090044F23AAGGCCCATTANONE 
J090078H09AAGGCCCATTANONE 
J100088G23AAGGCCCATTANONE 
Os08g0117400006-086-A09TGATGGGCCTGNONE 
006-086-A09TGATGGGCCTGANONE 
006-103-C02TGATGGGCCTGNONE 
006-103-C02TGATGGGCCTGANONE 
AK059891TGATGGGCCTGSimilar to Calmodulin 1 (Fragment). 
AK059891TGATGGGCCTGASimilar to Calmodulin 1 (Fragment). 
AK103863TGATGGGCCTGNONE 
AK103863TGATGGGCCTGANONE 
AY224521TGATGGGCCTGNONE 
AY224521TGATGGGCCTGANONE 
J033149E23TGATGGGCCTGNONE 
J033149E23TGATGGGCCTGANONE 
J065062E05TGATGGGCCTGNONE 
J065062E05TGATGGGCCTGANONE 
J065083O05TGATGGGCCTGNONE 
J065083O05TGATGGGCCTGANONE 
J065116D14TGATGGGCCTGNONE 
J065116D14TGATGGGCCTGANONE 
J065158F16TGATGGGCCTGNONE 
J065158F16TGATGGGCCTGANONE 
J065179N16TGATGGGCCTGNONE 
J065179N16TGATGGGCCTGANONE 
J065206N23TGATGGGCCTGNONE 
J065206N23TGATGGGCCTGANONE 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J013149L10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075027H17ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
J075060F10ACATGGGCCGAAAGCCCAGTAGGCCCATTANONE 
Os08g0127700012-086-F03TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK059350TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK099242TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
J033027J18TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065012F22TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065046N17TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J065197B02TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100018P04TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100052C14TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
J100083A12TAATGGGCCTACTGGGCTTTCGGCCCATGTNONE 
Os08g0130500006-024-B12AGCCCAATAAGGCCCATCTNONE 
006-024-B12CAAGGCCCATACNONE 
006-032-F11AGCCCAATAAGGCCCATCTNONE 
006-032-F11CAAGGCCCATACNONE 
006-047-B12AGCCCAATAAGGCCCATCTNONE 
006-047-B12CAAGGCCCATACNONE 
006-058-H06AGCCCAATAAGGCCCATCTNONE 
006-058-H06CAAGGCCCATACNONE 
006-062-D07AGCCCAATAAGGCCCATCTNONE 
006-062-D07CAAGGCCCATACNONE 
006-083-F11AGCCCAATAAGGCCCATCTNONE 
006-083-F11CAAGGCCCATACNONE 
006-084-A11AGCCCAATAAGGCCCATCTNONE 
006-084-A11CAAGGCCCATACNONE 
006-096-F12AGCCCAATAAGGCCCATCTNONE 
006-096-F12CAAGGCCCATACNONE 
006-105-A04AGCCCAATAAGGCCCATCTNONE 
006-105-A04CAAGGCCCATACNONE 
006-110-D11AGCCCAATAAGGCCCATCTNONE 
006-110-D11CAAGGCCCATACNONE 
011-022-D11AGCCCAATAAGGCCCATCTNONE 
011-022-D11CAAGGCCCATACNONE 
AK064857AGCCCAATAAGGCCCATCT60S acidic ribosomal protein P0. 
AK064857CAAGGCCCATAC60S acidic ribosomal protein P0. 
D21130AGCCCAATAAGGCCCATCTNONE 
D21130CAAGGCCCATACNONE 
J013000H12AGCCCAATAAGGCCCATCTNONE 
J013000H12CAAGGCCCATACNONE 
J013024M17AGCCCAATAAGGCCCATCTNONE 
J013024M17CAAGGCCCATACNONE 
J013028H09AGCCCAATAAGGCCCATCTNONE 
J013028H09CAAGGCCCATACNONE 
J013045N22AGCCCAATAAGGCCCATCTNONE 
J013045N22CAAGGCCCATACNONE 
J013092K19AGCCCAATAAGGCCCATCTNONE 
J013092K19CAAGGCCCATACNONE 
J013106L12AGCCCAATAAGGCCCATCTNONE 
J013106L12CAAGGCCCATACNONE 
J013107A03AGCCCAATAAGGCCCATCTNONE 
J013107A03CAAGGCCCATACNONE 
J013109E12AGCCCAATAAGGCCCATCTNONE 
J013109E12CAAGGCCCATACNONE 
J013114N08AGCCCAATAAGGCCCATCTNONE 
J013114N08CAAGGCCCATACNONE 
J013120J12AGCCCAATAAGGCCCATCTNONE 
J013120J12CAAGGCCCATACNONE 
J013121E21AGCCCAATAAGGCCCATCTNONE 
J013121E21CAAGGCCCATACNONE 
J013135P20AGCCCAATAAGGCCCATCTNONE 
J013135P20CAAGGCCCATACNONE 
J023006J08AGCCCAATAAGGCCCATCTNONE 
J023006J08CAAGGCCCATACNONE 
J023014L16AGCCCAATAAGGCCCATCTNONE 
J023014L16CAAGGCCCATACNONE 
J023020N03AGCCCAATAAGGCCCATCTNONE 
J023020N03CAAGGCCCATACNONE 
J023027M24AGCCCAATAAGGCCCATCTNONE 
J023027M24CAAGGCCCATACNONE 
J023029D18AGCCCAATAAGGCCCATCTNONE 
J023029D18CAAGGCCCATACNONE 
J023030A14AGCCCAATAAGGCCCATCTNONE 
J023030A14CAAGGCCCATACNONE 
J023041G23AGCCCAATAAGGCCCATCTNONE 
J023041G23CAAGGCCCATACNONE 
J023049H05AGCCCAATAAGGCCCATCTNONE 
J023049H05CAAGGCCCATACNONE 
J023060I23AGCCCAATAAGGCCCATCTNONE 
J023060I23CAAGGCCCATACNONE 
J023099D07AGCCCAATAAGGCCCATCTNONE 
J023099D07CAAGGCCCATACNONE 
J023104A20AGCCCAATAAGGCCCATCTNONE 
J023104A20CAAGGCCCATACNONE 
J023105F18AGCCCAATAAGGCCCATCTNONE 
J023105F18CAAGGCCCATACNONE 
J023112D21AGCCCAATAAGGCCCATCTNONE 
J023112D21CAAGGCCCATACNONE 
J023122M18AGCCCAATAAGGCCCATCTNONE 
J023122M18CAAGGCCCATACNONE 
J023139J20AGCCCAATAAGGCCCATCTNONE 
J023139J20CAAGGCCCATACNONE 
J023149L20AGCCCAATAAGGCCCATCTNONE 
J023149L20CAAGGCCCATACNONE 
J023150G04AGCCCAATAAGGCCCATCTNONE 
J023150G04CAAGGCCCATACNONE 
J033036G02AGCCCAATAAGGCCCATCTNONE 
J033036G02CAAGGCCCATACNONE 
J033045P13AGCCCAATAAGGCCCATCTNONE 
J033045P13CAAGGCCCATACNONE 
J033046A22AGCCCAATAAGGCCCATCTNONE 
J033046A22CAAGGCCCATACNONE 
J033086H16AGCCCAATAAGGCCCATCTNONE 
J033086H16CAAGGCCCATACNONE 
J033087D07AGCCCAATAAGGCCCATCTNONE 
J033087D07CAAGGCCCATACNONE 
J033089M14AGCCCAATAAGGCCCATCTNONE 
J033089M14CAAGGCCCATACNONE 
J033095F14AGCCCAATAAGGCCCATCTNONE 
J033095F14CAAGGCCCATACNONE 
J033108M01AGCCCAATAAGGCCCATCTNONE 
J033108M01CAAGGCCCATACNONE 
J033117A17AGCCCAATAAGGCCCATCTNONE 
J033117A17CAAGGCCCATACNONE 
J033122F03AGCCCAATAAGGCCCATCTNONE 
J033122F03CAAGGCCCATACNONE 
J033126A04AGCCCAATAAGGCCCATCTNONE 
J033126A04CAAGGCCCATACNONE 
J033144D13AGCCCAATAAGGCCCATCTNONE 
J033144D13CAAGGCCCATACNONE 
J033145D13AGCCCAATAAGGCCCATCTNONE 
J033145D13CAAGGCCCATACNONE 
J043022M09AGCCCAATAAGGCCCATCTNONE 
J043022M09CAAGGCCCATACNONE 
J053025I11AGCCCAATAAGGCCCATCTNONE 
J053025I11CAAGGCCCATACNONE 
J053027K06AGCCCAATAAGGCCCATCTNONE 
J053027K06CAAGGCCCATACNONE 
J053029D15AGCCCAATAAGGCCCATCTNONE 
J053029D15CAAGGCCCATACNONE 
J053048I22AGCCCAATAAGGCCCATCTNONE 
J053048I22CAAGGCCCATACNONE 
J053055I01AGCCCAATAAGGCCCATCTNONE 
J053055I01CAAGGCCCATACNONE 
J053079P07AGCCCAATAAGGCCCATCTNONE 
J053079P07CAAGGCCCATACNONE 
J053090J23AGCCCAATAAGGCCCATCTNONE 
J053090J23CAAGGCCCATACNONE 
J053094C24AGCCCAATAAGGCCCATCTNONE 
J053094C24CAAGGCCCATACNONE 
J065023F18AGCCCAATAAGGCCCATCTNONE 
J065023F18CAAGGCCCATACNONE 
J065029I12AGCCCAATAAGGCCCATCTNONE 
J065029I12CAAGGCCCATACNONE 
J065044B18AGCCCAATAAGGCCCATCTNONE 
J065044B18CAAGGCCCATACNONE 
J065045C07AGCCCAATAAGGCCCATCTNONE 
J065045C07CAAGGCCCATACNONE 
J065063K22AGCCCAATAAGGCCCATCTNONE 
J065063K22CAAGGCCCATACNONE 
J065093D11AGCCCAATAAGGCCCATCTNONE 
J065093D11CAAGGCCCATACNONE 
J065096P09AGCCCAATAAGGCCCATCTNONE 
J065096P09CAAGGCCCATACNONE 
J065099N04AGCCCAATAAGGCCCATCTNONE 
J065099N04CAAGGCCCATACNONE 
J065103K24AGCCCAATAAGGCCCATCTNONE 
J065103K24CAAGGCCCATACNONE 
J065110H12AGCCCAATAAGGCCCATCTNONE 
J065110H12CAAGGCCCATACNONE 
J065132F24AGCCCAATAAGGCCCATCTNONE 
J065132F24CAAGGCCCATACNONE 
J065157K16AGCCCAATAAGGCCCATCTNONE 
J065157K16CAAGGCCCATACNONE 
J065185D11AGCCCAATAAGGCCCATCTNONE 
J065185D11CAAGGCCCATACNONE 
J065202E16AGCCCAATAAGGCCCATCTNONE 
J065202E16CAAGGCCCATACNONE 
J065217D07AGCCCAATAAGGCCCATCTNONE 
J065217D07CAAGGCCCATACNONE 
J075053I19AGCCCAATAAGGCCCATCTNONE 
J075053I19CAAGGCCCATACNONE 
J075055L24AGCCCAATAAGGCCCATCTNONE 
J075055L24CAAGGCCCATACNONE 
J075056H24AGCCCAATAAGGCCCATCTNONE 
J075056H24CAAGGCCCATACNONE 
J075070D02AGCCCAATAAGGCCCATCTNONE 
J075070D02CAAGGCCCATACNONE 
J075084O15AGCCCAATAAGGCCCATCTNONE 
J075084O15CAAGGCCCATACNONE 
J075090F24AGCCCAATAAGGCCCATCTNONE 
J075090F24CAAGGCCCATACNONE 
J075135E03AGCCCAATAAGGCCCATCTNONE 
J075135E03CAAGGCCCATACNONE 
J075174A01AGCCCAATAAGGCCCATCTNONE 
J075174A01CAAGGCCCATACNONE 
J075188F05AGCCCAATAAGGCCCATCTNONE 
J075188F05CAAGGCCCATACNONE 
J075192C17AGCCCAATAAGGCCCATCTNONE 
J075192C17CAAGGCCCATACNONE 
J080001B02AGCCCAATAAGGCCCATCTNONE 
J080001B02CAAGGCCCATACNONE