
Summary of OsREG474 (All List)

OrganismOryza sativa  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count4828  

Entry Sequences (4828 entries)

LocusGene modelSequenceDescription
AK063774GAGGCCCATCATranslocon-associated beta family protein. 
Os01g0132700J065063N10TCATGGGCCTTSurfeit locus 5 family protein. 
Os01g0134500AK111908TAGGCCCATASimilar to Delta-7-sterol-C5(6)-desaturase (EC 1.3.3.-) (Delta-7-C-5 sterol desaturase) (Delta7-sterol-C5-desaturase). 
AK071635AGATGGGCCTCSimilar to Splicing factor RSZ33. 
AK071635TAATGGGCCTTSimilar to Splicing factor RSZ33. 
AK068405GGATGGGCCTTALG3 family protein. 
AK068405GGGCCGGAGGCCCATGAALG3 family protein. 
J075153K16GAGGCCCATTGGGCCGAAAConserved hypothetical protein. 
AK071130GAGGCCCATTNUC156 family protein. 
AK058815GCCCATGGGCCTGGSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
AK106329TAGGCCCATCCAConserved hypothetical protein. 
Os01g0206600J065041P19TAATGGGCCTGAAGCCCACATGGCCCATAConserved hypothetical protein. 
AK070838CCAGGCCCATTTTGGCCCATACTetratricopeptide-like helical domain containing protein. 
AK070838GAGGCCCATTATetratricopeptide-like helical domain containing protein. 
Os01g0229200AK066024GTATGGGCCAAAATGGGCCTGGVHS domain containing protein. 
AK066024TAATGGGCCTCVHS domain containing protein. 
Os01g0277500AK066984AAGGCCCATASimilar to Dof3 gene (Fragment). 
Os01g0283000AK073165TAGGCCCATCTConserved hypothetical protein. 
AK071713AGATGGGCCTASimilar to Ferripyochelin-binding protein-like. 
Os01g0314300AK073419TAGGCCCATCTUncharacterized domain 2 containing protein. 
AK121761ATATGGGCCTAProtein of unknown function DUF846, eukaryotic family protein. 
Os01g0506200AK073118TCATGGGCCTGTetratricopeptide-like helical domain containing protein. 
Os01g0514300AK121086TGATGGGCCTTLissencephaly type-1-like homology motif domain containing protein. 
AK121299TAGGCCCATTTSimilar to Ribosomal protein L34. 
AK069151TCATGGGCCTTCyclin-like F-box domain containing protein. 
AK067476TGATGGGCCTTSimilar to RNA helicase (Fragment). 
Os01g0661400AK073113TAGGCCCATCTNucleic acid-binding, OB-fold domain containing protein. 
Os01g0666500AK102689GAGGCCCATCAConserved hypothetical protein. 
AK121587TAGGCCCATACGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
Os01g0708600AK111377AAGGCCCATGGTransport protein particle (TRAPP) component, Bet3 family protein. 
AK121129AAGGCCCATGGSimilar to Serine/threonine-protein kinase PBS1 (EC (AvrPphB susceptible protein 1). 
Os01g0710000AK111794AAATGGGCCTASimilar to WD-repeat protein RBAP1. 
AK071099TTTTGGGCCTTAGGCCCATATConserved hypothetical protein. 
Os01g0719250AK105184TAGGCCCATTGGGCTConserved hypothetical protein. 
AK062725TAGGCCCATCCSimilar to Type I chlorophyll a/b-binding protein b (Fragment). 
Os01g0727900AK102017AAGGCCCATGAConserved hypothetical protein. 
AK072600AAGGCCCATTGGGCCTTProtein prenyltransferase domain containing protein. 
AK104146AAGGCCCATCTSimilar to 50S ribosomal protein L13. 
AK063730CCAGGCCCATCTConserved hypothetical protein. 
Os01g0773600AK067004TCATGGGCCTAGlycoside hydrolase, family 47 protein. 
Os01g0784600AK067527ACATGGGCTAATGGGCCTAConserved hypothetical protein. 
Os01g0801700AK073813AAATGGGCCTTConserved hypothetical protein. 
J013094D22AAGGCCCATGARibosomal protein L34 family protein. 
J013094D22TAATGGGCCTARibosomal protein L34 family protein. 
J065044B02AATGGGCCTAConserved hypothetical protein. 
Os01g0833000AK067226CAGGCCCATGAProtein prenyltransferase domain containing protein. 
AK066959GAGGCCCATGASimilar to G10. 
Os01g0876500J053026A07GAGGCCCATTTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os01g0888700AK073376GAGGCCCATAAProtein of unknown function RIO1 family protein. 
Os01g0889000AK103621CCAGGCCCATCATetratricopeptide-like helical domain containing protein. 
AK070087CAAGGCCCATATRhodanese-like domain containing protein. 
AK070087GAAGCCCATGGGCCTCRhodanese-like domain containing protein. 
AK067623AAGGCCCATTTConserved hypothetical protein. 
AK067623AGCCCAAAGGCCCATTTConserved hypothetical protein. 
Os01g0895100AK058611ATATGGGCCTASimilar to Membrane-associated 30 kDa protein, chloroplast precursor (M30). 
AK104693GAGGCCCATCAEukaryotic ribosomal protein L5 family protein. 
AK062957GAGGCCCATTTConserved hypothetical protein. 
Os01g0915800AK103859AAATGGGCCTCSimilar to FK506-binding protein 2-2 precursor (EC (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
Os01g0929500AK111399TAGGCCCATCCSimilar to Carbonyl reductase-like protein. 
Os01g0934500AK073211CAGGCCCATCTConserved hypothetical protein. 
AK101971AAATGGGCCTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
Os01g0948100AK111411GAGGCCCATGAERCC4 domain containing protein. 
AK102153AGATGGGCCTTGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
Os01g0950900AK101121AGATGGGCCTTGGCCCATGAProtein of unknown function DUF221 domain containing protein. 
AK103090CAAGTGGGCTTTACATGGGCCTTGAGCCCATGGGCTSimilar to Chloroplast SRP receptor cpFtsY precursor. 
Os01g0959900AK058375ATATGGGCCTTConserved hypothetical protein. 
Os01g0960300AK100099TTATGGGCCTTSimilar to Glucose inhibited division protein A. 
Os01g0960800AK073977TAATGGGCCTAProtein Transporter, Pam16 family protein. 
AK073977TAATGGGCCTGAProtein Transporter, Pam16 family protein. 
AK073977TAATGGGCCTGGProtein Transporter, Pam16 family protein. 
AK073846GAGGCCCATGTSimilar to 40S ribosomal protein S10-1. 
Os01g0969100AK070623GAGGCCCATGCAGGCCCACCAACNAD-dependent epimerase/dehydratase family protein. 
Os01g0970400AK069207ATTTGGGCCCATGGGCCTGATAAGCCCAACEukaryotic translation initiation factor 4E-1 (eIF4E-1) (eIF-4E-1) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F p26 subunit). 
AK121401TAATGGGCCTASimilar to 15.9 kDa subunit of RNA polymerase II. 
AK121751GAGGCCCATGTProtein of unknown function DUF890 family protein. 
AK103485TTATGGGCCTAProtein of unknown function DUF1677, Oryza sativa family protein. 
AK063815TAGGCCCATGGGCCGGAProtein transport protein SEC61 gamma subunit. 
AK063815TTGGCCCACGAGGCCCATAAProtein transport protein SEC61 gamma subunit. 
Os02g0179100AK058557CCAGGCCCATCAMetal-dependent phosphohydrolase, HD region domain containing protein. 
AK106917TCAGGCCCATATUbiquitin domain containing protein. 
Os02g0189100AK111066GAGGCCCATATConserved hypothetical protein. 
Os02g0241100Os02g0241100GAGGCCCATGTProtein kinase-like domain containing protein. 
Os02g0255200AK121591AAGGCCCAAGGCCCATTASimilar to Ribosomal protein S15a homolog. 
Os02g0266500AK100307TAATGGGCCTASimilar to RASPBERRY3. 
AK059647AAATGGGCCTCSimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK062103TAGGCCCATAGCCCATCASimilar to 60S ribosomal protein L10a-1. 
Os02g0332200AK067672GAGGCCCATCASimilar to T-complex protein 1 delta subunit. 
Os02g0467700AK121672GAGGCCCATGTGlycosyltransferase 28, C-terminal domain containing protein. 
Os02g0468200AK103767CCAGGCCCATCAAAGCCCAAATProtein of unknown function DUF652 family protein. 
Os02g0562300AK073250GAGGCCCATGACalmodulin binding protein-like family protein. 
AK102380TGGATGGGCCTTHeavy metal transport/detoxification protein domain containing protein. 
Os02g0618700AK070657GAGGCCCATTTLung seven transmembrane receptor family protein. 
AK101006TAGGCCCATGASimilar to Succinyl-CoA ligase [GDP-forming] beta-chain, mitochondrial precursor (EC (Succinyl-CoA synthetase, beta chain) (SCS-beta). 
AK063500CACGGCCCAATAGGCCCATTAProtein prenyltransferase domain containing protein. 
Os02g0643500AK068423AAGGCCCATAAPentapeptide repeat containing protein. 
Os02g0655700AK101068AAATGGGCCTCAmino acid/polyamine transporter I family protein. 
AK101068AAATGGGCCTTAmino acid/polyamine transporter I family protein. 
Os02g0658300AK073923AAGGCCCATTAConserved hypothetical protein. 
Os02g0666800AK101444CAAGGCCCATTTProtein of unknown function DUF788 family protein. 
AK101444TAATGGGCCTCProtein of unknown function DUF788 family protein. 
Os02g0679200AK110789AGATGGGCCTCTGGGCCTCTetratricopeptide-like helical domain containing protein. 
AK102993TGATGGGCCTGATGGGCCTTConserved hypothetical protein. 
Os02g0700100AK102954TAGGCCCATATSimilar to WD-repeat protein. 
AK063491GAGGCCCATTEpoxide hydrolase family protein. 
Os02g0736500AK065166AAGGCCCATAAAAGCCCAACNicastrin family protein. 
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein. 
Os02g0743800AK064134GGATGGGCCTTGCS domain containing protein. 
AK061274TGATGGGCCTASAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0762300AK106684CAGGCCCATAAProtein of unknown function UPF0021 family protein. 
AK103640ACATGGGCCTCConserved hypothetical protein. 
Os02g0769700AK111328AAATGGGCCTGGProtein kinase-like domain containing protein. 
AK101869AAGGCCCATGANOT2/NOT3/NOT5 domain containing protein. 
Os02g0787100Os02g0787100TGATGGGCCTTProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0798700AK101070GAGGCCCATTTNeurochondrin family protein. 
AK067584GAGGCCCATGASAM (and some other nucleotide) binding motif domain containing protein. 
AK099516CCAGGCCCAAGGCCCATCTSimilar to Alcohol dehydrogenase, zinc-containing. 
Os02g0810300AK059363CCAGGCCCATAASimilar to NBD-like protein. 
AK059572TAATGGGCCGTAGGCCCATTTConserved hypothetical protein. 
AK059572TAATGGGCCTAConserved hypothetical protein. 
AK102271AAATGGGCCTACGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
AK102271TAGGCCCATTANAD-dependent epimerase/dehydratase family protein. 
Os02g0819700AK067374TAGGCCCATAZinc finger, Zim17-type family protein. 
Os02g0820600AK066549TAGGCCCATTAConserved hypothetical protein. 
AK060869TAATGGGCCTASimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
AK060869TAATGGGCCTCSimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
Os02g0823600AK070498CAGGCCCATGAConserved hypothetical protein. 
Os02g0832200AK108268TCAGGCCCATCGConserved hypothetical protein. 
Os02g0832700AK099439CAGGCCCATTASimilar to Metal tolerance protein C2 (AtMTPc2). 
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein. 
Os03g0104000AK063829TTATGGGCCTGSimilar to Centromere protein. 
Os03g0108600AK065776CAGGCCCATAADEAD/DEAH box helicase, N-terminal domain containing protein. 
AK101870TAGGCCCATGAAAGCCCAAACConstitutive photomorphogenic 11. 
AK070213TCAGGCCCATATPeroxisomal biogenesis factor 11 family protein. 
AK070779TGATGGGCCTASimilar to 50S ribosomal protein L5, chloroplast. 
AK070779TGATGGGCCTAAGGCCCAAATSimilar to 50S ribosomal protein L5, chloroplast. 
AK062913AAATGGGCCTTAAAGCCCATTTConserved hypothetical protein. 
Os03g0127000AK068479AAGGCCCATTTConserved hypothetical protein. 
AK067991TTATGGGCCTGASimilar to DNA polymerase delta small subunit (EC 
Os03g0143400AK073999CAGGCCCATGASimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
Os03g0152800AK066205CATGGGCCTCProtein kinase-like domain containing protein. 
AK105523TATGGGCCTTPeptidase S10, serine carboxypeptidase family protein. 
Os03g0197000AK071163TAGGCCCATTConserved hypothetical protein. 
AK069251AATGGGCCTT40S ribosomal protein S3a (CYC07 protein). 
AK069251CATGGGCCTA40S ribosomal protein S3a (CYC07 protein). 
Os03g0232500AK110980TAGGCCCATATGTP-binding protein, HSR1-related domain containing protein. 
Os03g0238700AK073387ATATGGGCCGGATGGGCCTTGSimilar to Acid phosphatase type 5. 
AK071799AATGGGCCTAGCCCAACAConserved hypothetical protein. 
AK069944TAGGCCCATTAClass I peptide chain release factor domain containing protein. 
Os03g0249900AK058379GAGGCCCATGTConserved hypothetical protein. 
Os03g0260100AK066143GAGGCCCATCAConserved hypothetical protein. 
AK102161ACAGCCCAAGAAGGCCCATGTConserved hypothetical protein. 
AK102161TAATGGGCCTAGCCCATTTAGGCCCATTTConserved hypothetical protein. 
AK063663ATATGGGCCTCSimilar to Protein disulfide isomerase. 
Os03g0288400Os03g0288400GAGGCCCATTGGCCCAATAConserved hypothetical protein. 
AK069970CAAGGCCCATCCSimilar to Ran binding protein 1 homolog. 
AK066250AAATGGGCCTASimilar to Chaperone protein dnaJ. 
Os03g0300700AK071770TCATGGGCCTARetrotransposon gag protein family protein. 
Os03g0308900AK064183GAGGCCCATGAConserved hypothetical protein. 
AK106255TAGGCCCATAGuanylate kinase family protein. 
AK063782TATGGGCCTCConserved hypothetical protein. 
Os03g0332700AK072820TAAGCCCATTAGGCCCATAASimilar to ABC Transporter, ATP binding component. 
Os03g0333000AK109811AAGGCCCAGGCCCATTTConserved hypothetical protein. 
Os03g0333100AK101050AAATGGGCCTGGGCCTTProtein of unknown function DUF663 domain containing protein. 
AK099999TAGGCCCAGGCCCATCTNucleoporin interacting component family protein. 
AK101285GGATGGGCCTGGProtein of unknown function DUF1077 family protein. 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0379500AK064760TAGGCCCATAASimilar to 40S ribosomal protein S9. 
Os03g0381500AK108125TCATGGGCCTCATGGGCCTCConserved hypothetical protein. 
Os03g0383100AK107106TCAGGCCCATAConserved hypothetical protein. 
Os03g0393900AK069809TATTGGGCTTCCATGGGCCTCSimilar to S.tuberosum patatin (Fragment). 
AK071057TAGGCCCATGAPeptidase S14, ClpP family protein. 
AK063006AAGGCCCATTTConserved hypothetical protein. 
AK072995CCAGGCCCATATPeptidase M50, putative membrane-associated zinc metallopeptidase family protein. 
AK063765CCAGGCCCATTTSimilar to Lysyl-tRNA synthetase (EC (Lysine--tRNA ligase) (LysRS). 
Os03g0598200AK068322TAGGCCCATTANop14-like protein family protein. 
AB055076GAGGCCCATCTMitochondrial ATP synthase 6 KD subunit. 
Os03g0639700AK099587GAGGCCCATTTSimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
Os03g0646100AK100526CCATGGGCCTCGCCCSimilar to Plastid division protein ftsZ1 precursor. 
AF010584CGATGGGCCTTSimilar to Water stress induced protein. 
Os03g0679000AK059913TCATGGGCCTGConserved hypothetical protein. 
Os03g0685700AK066043CGATGGGCCTTGGGCTTTProtein prenyltransferase domain containing protein. 
Os03g0719100AK065127TAGGCCCATCCAAGCCCAACADNA-binding SAP domain containing protein. 
Os03g0721700AK106706CCAGGCCCATCAProtein of unknown function DUF569 family protein. 
Os03g0735300AK071715CAGGCCCATTAlba, DNA/RNA-binding protein family protein. 
AK101854GAGGCCCATCTCyclin H-1. 
AK061252CCAGCCCATTGAGGCCCATGGGCTConserved hypothetical protein. 
AK061252CTCGGCCCACCTAGGCCCATTTConserved hypothetical protein. 
Os03g0754800AK101584TAATGGGCCTAMitochondrial substrate carrier family protein. 
Os03g0755000AK068540GAGGCCCATTTGGGCCCAACCSimilar to Serine/threonine kinase (Fragment). 
Os03g0776900AK107941TATTGGGCCACATGGGCCTCSimilar to DNAJ protein-like. 
Os03g0786000AK061286TATGGGCCTCConserved hypothetical protein. 
AK110858CAAGGCCCATGAConserved hypothetical protein. 
Os03g0788200AK106623AAGGCCCATAE1 protein and Def2/Der2 allergen family protein. 
AK106623TAGGCCCATTAE1 protein and Def2/Der2 allergen family protein. 
AK068660CCAGGCCCATTASimilar to Heat shock transcription factor 31 (Fragment). 
AK067446ATATGGGCCTTSimilar to Helix-loop-helix protein homolog. 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK067446TAGGCCCATCASimilar to Helix-loop-helix protein homolog. 
Os03g0807800AK064984TGATGGGCCTGASimilar to 40S ribosomal protein S2 (Fragment). 
Os03g0823500AK058972TAGGCCCATCGTGF-beta receptor, type I/II extracellular region family protein. 
Os03g0826000AK072695AAGGCCCATCTConserved hypothetical protein. 
Os03g0831100AK103115TGATGGGCCTAArmadillo-like helical domain containing protein. 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 
Os03g0834000AB080084GAGGCCCATTTFlap endonuclease-1b (EC 3.-.-.-) (OsFEN-1b). 
AK061198TAATGGGCCTCSimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK101661GAGGCCCATCCSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
Os03g0847500AK073859TGATGGGCCTTSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0851900AK102145AAGGCCCAGGCCCATCTAFG1-like ATPase family protein. 
AK102145TAGGCCCATTTAFG1-like ATPase family protein. 
AK061374GAGGCCCATGProtein of unknown function UPF0131 family protein. 
AK100430AAGGCCCATCCSimilar to Heat shock transcription factor 31 (Fragment). 
Os03g0857500AK072880TAGGCCCATCGProtein of unknown function DUF303, acetylesterase putative domain containing protein. 
AK104254AAATGGGCCTAConserved hypothetical protein. 
Os04g0194000AK102654TCAGGCCCATTCyclin-like F-box domain containing protein. 
AK103472AAGGCCCAAGGCCCATCCConserved hypothetical protein. 
AK102190AAGGCCCATTASimilar to 40S ribosomal protein S10-1. 
Os04g0432600AK058925TCAGGCCCATGGAGGCCCACACGGCCCATGTConserved hypothetical protein. 
AK064379AAGGCCCATCARNA dependent RNA polymerase family protein. 
Os04g0475300AK066351TATTGGGCTTTGAGGCCCATAConserved hypothetical protein. 
AK103296TGATGGGCCTGARML1 protein. 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
AK065957CCATGGGCCTCConserved hypothetical protein. 
Os04g0551300AK103502TAGGCCCATGTSimilar to Growth regulator like protein. 
AK121568CAAGGCCCATCASimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
AK063168GAGGCCCATTAPyridoxal-5'-phosphate-dependent enzyme, beta subunit domain containing protein. 
AK120348CAAGGCCCATCTHeavy metal transport/detoxification protein domain containing protein. 
AK063093ATATGGGCCTCSimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
AK105292AGATGGGCCTCConserved hypothetical protein. 
AK106073GAGGCCCATTConserved hypothetical protein. 
J065079G06GAGGCCCATTAConserved hypothetical protein. 
AK066289TATGGGCCTCPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK063022TAGGCCCATCAConserved hypothetical protein. 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
AK062025AAGGCCCATGTRibbon-helix-helix domain containing protein. 
AK099507AATGGGCCGGCCCATCAAGGCCCATTAGCN5-related N-acetyltransferase domain containing protein. 
AK061848GAGGCCCATTASimilar to Senescence-associated protein 6. 
AK065749AGATGGGCCTTSnf7 family protein. 
Os05g0111000AK073598CAGGCCCATCTSimilar to Gag polyprotein [Contains: Core protein p15 (Matrix protein); Core protein p24; Core protein p12]. 
Os05g0112800AK108350CAGGCCCATGProtein of unknown function DUF26 domain containing protein. 
J065066C12TCAGGCCCATCCAConserved hypothetical protein. 
Os05g0129900AK060436TAGGCCCATATTetratricopeptide-like helical domain containing protein. 
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein. 
AK062421AGATGGGCCTGARibosomal protein S27, mitochondrial family protein. 
Os05g0177100AK064652CCAGGCCCATAAConserved hypothetical protein. 
Os05g0180700J100062K04CCATGGGCCTAConserved hypothetical protein. 
Os05g0182800AK121273TAATGGGCCTAGlutamyl-tRNA synthetase, class Ic family protein. 
AK121273TGATGGGCCTAGlutamyl-tRNA synthetase, class Ic family protein. 
AK060420AAAGCCCAATCCATGGGCCTGGGCTTCSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK067940TCATGGGCCTCConserved hypothetical protein. 
Os05g0241400AK107803ATATGGGCCTATTGGGCCGGGCConserved hypothetical protein. 
Os05g0243300AK108395GAGGCCCATCASimilar to 50S ribosomal protein L13. 
Os05g0295800AK070232AAGGCCCATCASimilar to Glyoxalase I (EC 
Os05g0295900AK069962TAGGCCCATTAGCCCAAACConserved hypothetical protein. 
AK064059GAGGCCCATTACyclin-like domain containing protein. 
AK061627GCGGCCCAGCAAGGCCCATCGSimilar to 40S ribosomal protein S7. 
Os05g0363600AK108572TAATGGGCCTConserved hypothetical protein. 
Os05g0367100AK108334TAATGGGCCTCConserved hypothetical protein. 
Os05g0378900AK103841AGATGGGCCTAConserved hypothetical protein. 
Os05g0400600AK072045GAGGCCCATGACobalt transport protein family protein. 
Os05g0417200AK071955ATTTGGGCCACAATGGGCCTTGCGGGCCThioredoxin-like fold domain containing protein. 
AK071955TAATGGGCCACGATGGGCCTTThioredoxin-like fold domain containing protein. 
Os05g0435400AK109595TAGGCCCATTTConserved hypothetical protein. 
Os05g0443300Os05g0443300AAATGGGCCTGASec23/Sec24 trunk region domain containing protein. 
Os05g0443800AK106590CGATGGGCCTASimilar to Plastid division protein ftsZ1 precursor. 
AK106590TCAGGCCCATATSimilar to Plastid division protein ftsZ1 precursor. 
AK121541AAGGCCCATTASimilar to Ribosomal protein L33. 
Os05g0456000AK058420TCCGGCCCAACATGGATGGGCCTAMitochondrial glycoprotein family protein. 
Os05g0459900AK058918AAGGCCCATTTAGCCCAGCCCSimilar to 60S ribosomal protein L36-1. 
AK069780GAGGCCCATGGGCCATBacterial surface antigen (D15) family protein. 
Os05g0481000AK059369GAGGCCCATAAGCN5-related N-acetyltransferase domain containing protein. 
AK101340AGATGGGCCTTKrr1 family protein. 
J05595GGGCCGCAGGCCCATASimilar to Cysteine proteinase inhibitor-II (Oryzacystatin-II). 
AK065486CAAGGCCCATAANAF1 domain containing protein. 
Os05g0519400AK072976GAGGCCCATAASimilar to N-ethylmaleimide sensitive factor NSF (Fragment). 
Os05g0535200AK070696AGATGGGCCTCCyclin-like F-box domain containing protein. 
AK071090TAGGCCCATACHomeodomain-like containing protein. 
Os05g0541500AK101190CCATGGGCCTTCyclin-like F-box domain containing protein. 
AK101190TAGGCCCATCACyclin-like F-box domain containing protein. 
AK101190TCAGGCCCATCTCyclin-like F-box domain containing protein. 
Os05g0543800AK072185AATGGGCCTAConserved hypothetical protein. 
AK122158AGATGGGCCTTGGGCCGAAADNA-binding TFAR19-related protein family protein. 
Os05g0548100AK060333TTTCGGCCCAAGGCCCATATConserved hypothetical protein. 
Os05g0552900AK102095TAGGCCCATATMAP65/ASE1 family protein. 
AK103396TCAGGCCCATATSimilar to Syntaxin 71 (AtSYP71). 
AK073857TAATGGGCCTGACTGGGCCTGARibosomal protein L1 family protein. 
Os05g0559900AK067197AAATGGGCCTAtRNA-binding arm domain containing protein. 
AK121133AAATGGGCCTCDNA glycosylase family protein. 
AK121699ATCTCGGCCCATTAGGCCCATATSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
Os05g0584600AK072537CCATGGGCCTTAAA ATPase domain containing protein. 
AK121149TCAGGCCCATTASimilar to SMC5 protein. 
AK067021AAGGCCCATCCNucleic acid-binding, OB-fold domain containing protein. 
AK067021TAGGCCCATCANucleic acid-binding, OB-fold domain containing protein. 
Os06g0116800AK058985AATGGGCCTASimilar to GFA2. 
AK058985AATGGGCCTTGSimilar to GFA2. 
AK058985GAGGCCCATCASimilar to GFA2. 
AK061226TAGGCCCATTTConserved hypothetical protein. 
Os06g0136000AK060303AATGGGCCTCSimilar to Hypersensitive-induced reaction protein 4. 
AK103245CCATGGGCCAAGGCCCATTConserved hypothetical protein. 
Os06g0156700AK107226GCCCAGTAAGGCCCATGGGCCTTGLipolytic enzyme, G-D-S-L family protein. 
Os06g0156900AK110688TAGGCCCATTTGlycosyl transferase, family 31 protein. 
AK066933GAGGCCCATGTVacuolar H+-pyrophosphatase (EC (Ovp2). 
AK064613ATGGGCCTASimilar to Phosphopantothenoylcysteine decarboxylase (EC (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
Os06g0227200AK066970AAGGCCCATAAConserved hypothetical protein. 
J043001C08TCAGGCCCATAAMolybdenum cofactor biosynthesis domain containing protein. 
AK073155GAGGCCCATCTSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
Os06g0275500AK111743TAGGCCCATATSimilar to Polycomb protein EZ1 (Enhancer of zeste protein 1). 
Os06g0287700AK067966CCAGGCCCATCCSimilar to NBS-LRR disease resistance protein homologue (Fragment). 
Os06g0298500AK108252GTATGGGCCTAConserved hypothetical protein. 
Os06g0304500AK119441CATGGGCCTACRS1/YhbY domain containing protein. 
Os06g0543400AK065374TGATGGGCCTCSimilar to CBL-interacting serine/threonine-protein kinase 11 (EC (SOS2-like protein kinase PKS5) (SOS-interacting protein 4) (SNF1- related kinase 3.22). 
Os06g0547900AK100950CGATGGGCCTTSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK106546TAGGCCCATAAInitiator tRNA phosphoribosyl transferase family protein. 
AK106254CCAGGCCCATATConserved hypothetical protein. 
AK063158ATATGGGCCTASimilar to 26S proteasome regulatory complex subunit p42D. 
Os06g0663600AK100787AAGGCCCATTEndonuclease V family protein. 
AK071621ACATGGGCCTASimilar to Glycine decarboxylase complex H-protein. 
J100072F13CCATGGGCCTTSimilar to Ubiquitin. 
AK071299CCAGGCCCATCGSimilar to Geranyl diphosphate synthase. 
AK062780AGATGGGCCTGConserved hypothetical protein. 
AK062780GGATGGGCCTAConserved hypothetical protein. 
AK064816ACATGGGCCTGAZinc finger, CCCH-type domain containing protein. 
AK064816GAGGCCCATTTZinc finger, CCCH-type domain containing protein. 
Os06g0683200AK060024GAGGCCCATTTSimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK101144CAGGCCCATCARNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0693000AK064280CAAGGCCCATATProtein kinase-like domain containing protein. 
AK064384CATGGGCCTTGmRNA splicing factor SYF2 family protein. 
Os06g0712500AK068531AAATGGGCCTASimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os06g0712900AK106648TCATGGGCCGAAAAGGCCCATATDihydrouridine synthase, DuS family protein. 
AK071262GAGGCCCAAGGCCCATACt-snare domain containing protein. 
Os06g0725400J065086O07TCAGGCCCATTASimilar to BLE1 protein. 
AK119436GACACGTGAAGGCCCATGGBranching enzyme-I precursor (Starch-branching enzyme I) (1,4-alpha- glucan branching enzyme I). 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
AK119295GCAGCCCATGGGCCTTProtein of unknown function DUF1719, Oryza sativa family protein. 
AK070529GAGGCCCATTTSimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK121635TGATGGGCCTCSimilar to 40S ribosomal protein S12-1. 
AK105386TAGGCCCATCCConserved hypothetical protein. 
J065210M20TCAGGCCCATGGGCTSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
AK073755ATATGGGCCTASimilar to EXO. 
Os07g0202100AK101736TAATGGGCCTCSimilar to ATP-dependent RNA helicase ded1. 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
Os07g0435400AK111603TAATGGGCCTCSimilar to WD40. 
Os07g0515700AK103117TAATGGGCCTCAnkyrin repeat containing protein. 
AK099918GAGGCCCATACSimilar to Thiazole biosynthetic enzyme 1-1, chloroplast precursor. 
Os07g0537500AK111734GAGGCCCATTProtein of unknown function DUF26 domain containing protein. 
AK062660TAATGGGCCTTATTGGGCTTAConserved hypothetical protein. 
Os07g0569000AK073915TAAGCCCAATAAGGCCCATTAConserved hypothetical protein. 
AK105064GTATGGGCCTTSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC (EC (Complex I-18KD) (CI-18KD) (Fragment). 
Os07g0598100AK068136GTATGGGCCTGGGCCGTASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
Os07g0603100AK101352TCATGGGCCTGGNuclear transport factor 2 domain containing protein. 
Os07g0656400011-061-F11CACGGCCCATCAAGGCCCATAAAGGCCCATGAConserved hypothetical protein. 
Os07g0659500AK073537GAGGCCCATCCANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
AK073537TGGATGGGCCTANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
J075101B12AATGGGCCTASuperoxide dismutase [Cu-Zn] 2 (EC 
AK103678GAGGCCCATATRibosomal protein S8E family protein. 
AK063800TCAGGCCCATASimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC (CR6). 
AK063800TCGGCCCACTTAGGCCCATATSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC (CR6). 
Os07g0687300AK073043AAATGGGCTTAGGCCCATTSimilar to SNF1 kinase complex anchoring protein (Fragment). 
Os08g0110200AK068841GAGGCCCATATSimilar to Fertility restorer. 
AK121176AAGGCCCATTARickettsia 17 kDa surface antigen family protein. 
AK059891TGATGGGCCTGSimilar to Calmodulin 1 (Fragment). 
AK059891TGATGGGCCTGASimilar to Calmodulin 1 (Fragment). 
Os08g0127600AK058365ACATGGGCCGAAAGCCCAGTAGGCCCATTAHeat shock protein DnaJ, N-terminal domain containing protein. 
AK121348TAATGGGCCTACTGGGCTTTCGGCCCATGTConserved hypothetical protein. 
AK064857AGCCCAATAAGGCCCATCT60S acidic ribosomal protein P0. 
AK064857CAAGGCCCATAC60S acidic ribosomal protein P0.