version

Summary of OsREG475 (All List)

OrganismOryza sativa  
IDOsREG475  
SequenceAGGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1349  

Entry Sequences (1349 entries)

LocusGene modelSequenceDescription
Os01g0147700AK066686TGTGGGCCCTRegion of unknown function, putative Zinc finger, XS and XH domain containing protein. 
Os01g0179901J075009I05TGCGGCCCAATTAGGGCCCAACTNONE 
J075058D09TGCGGCCCAATTAGGGCCCAACTNONE 
J075153K16TGCGGCCCAATTAGGGCCCAACTConserved hypothetical protein. 
Os01g0203300015-045-F03AATGGGCCCTNONE 
AK106329AATGGGCCCTConserved hypothetical protein. 
Os01g0221500012-036-F06AGGGCCCACANONE 
AK063996AGGGCCCACAConserved hypothetical protein. 
J065061G22AGGGCCCACANONE 
J065098K21AGGGCCCACANONE 
J065214G03AGGGCCCACANONE 
J065218L03AGGGCCCACANONE 
J080301D09AGGGCCCACANONE 
Os01g0271700J065184P16AGGGCCCACGTNONE 
J075182E21AGGGCCCACGTNONE 
J075191M19AGGGCCCACGTNONE 
J090021E22AGGGCCCACGTNONE 
Os01g0534800AK072168CTGACAGGTGGGCCCTSimilar to PRLI-interacting factor K (Fragment). 
AK104278CTGACAGGTGGGCCCTNONE 
Os01g0585400AK103584AGGGCCCATAGGCCCAGAConserved hypothetical protein. 
J033133B01AGGGCCCATAGGCCCAGANONE 
Os01g0633200AK069077AGATGGGCCCTSimilar to X1 (Fragment). 
Os01g0707300AK059962AGATGGGCCCTNONE 
AK104463AGATGGGCCCTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0727400AK065692AGGGCCCACGGGConserved hypothetical protein. 
Os01g0736900AK062151TGTGGGCCCTNONE 
AK065226TGTGGGCCCTNONE 
AK121245TGTGGGCCCTReticulon family protein. 
J013070F01TGTGGGCCCTNONE 
J013156J22TGTGGGCCCTNONE 
J023067B03TGTGGGCCCTNONE 
J023082O14TGTGGGCCCTNONE 
J023087F01TGTGGGCCCTNONE 
J023099G09TGTGGGCCCTNONE 
J023147M08TGTGGGCCCTNONE 
J033028C13TGTGGGCCCTNONE 
J033060K07TGTGGGCCCTNONE 
J033140C08TGTGGGCCCTNONE 
J033142C08TGTGGGCCCTNONE 
J043005M06TGTGGGCCCTNONE 
J043010C19TGTGGGCCCTNONE 
J043030H20TGTGGGCCCTNONE 
J065006K03TGTGGGCCCTNONE 
J065056E13TGTGGGCCCTNONE 
J065067O06TGTGGGCCCTNONE 
J065117P05TGTGGGCCCTNONE 
J065169I07TGTGGGCCCTNONE 
J080304L01TGTGGGCCCTNONE 
J080319G10TGTGGGCCCTNONE 
J090002N09TGTGGGCCCTNONE 
J090008E16TGTGGGCCCTNONE 
J090010L14TGTGGGCCCTNONE 
J090033C23TGTGGGCCCTNONE 
J090038D19TGTGGGCCCTNONE 
J090051E24TGTGGGCCCTNONE 
J090051H09TGTGGGCCCTNONE 
J090058A20TGTGGGCCCTNONE 
J090058B16TGTGGGCCCTNONE 
J090081I15TGTGGGCCCTNONE 
J090083P18TGTGGGCCCTNONE 
J090089J07TGTGGGCCCTNONE 
J090096D13TGTGGGCCCTNONE 
J100036N19TGTGGGCCCTNONE 
J100043M11TGTGGGCCCTNONE 
J100046C12TGTGGGCCCTNONE 
J100072C01TGTGGGCCCTNONE 
J100088P11TGTGGGCCCTNONE 
Os01g0810000AK102143AGGGCCCAAACNONE 
AK120752AGGGCCCAAACUtp11 family protein. 
J023006E09AGGGCCCAAACNONE 
J033086A13AGGGCCCAAACNONE 
J033133K07AGGGCCCAAACNONE 
J065066L16AGGGCCCAAACNONE 
J065161C01AGGGCCCAAACNONE 
J100027D18AGGGCCCAAACNONE 
J100063J12AGGGCCCAAACNONE 
Os01g0876500J053026A07AGGGCCCAACCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17AGGGCCCAACCNONE 
Os01g0884400AK072566AGATGGGCCCTU box domain containing protein. 
Os01g0908100AK072293AGTGGGCCCTRabGAP/TBC domain containing protein. 
J065010B13AGTGGGCCCTNONE 
J065010M12AGTGGGCCCTNONE 
J065047C19AGTGGGCCCTNONE 
J065069B18AGTGGGCCCTNONE 
J065071K24AGTGGGCCCTNONE 
J065142P04AGTGGGCCCTNONE 
J065170E11AGTGGGCCCTNONE 
Os01g0916700Os01g0916700AATGGGCCCTConserved hypothetical protein. 
Os01g0929500AK111399AATGGGCCCTSimilar to Carbonyl reductase-like protein. 
AK120263AATGGGCCCTNONE 
Os01g0964000AK073599GTATGGGCCCTSimilar to VAMP-like protein YKT61 (AtYKT61) (Geranylgeranylated protein 1) (AtGP1). 
AK104012GTATGGGCCCTNONE 
AK104190GTATGGGCCCTNONE 
Os02g0105500AK063929TGTGGGCCCTNONE 
AK102953TGTGGGCCCTIQ calmodulin-binding region domain containing protein. 
Os02g0109200AK108815CCACTGACACATGGGCCCTNONE 
J100030O18CCACTGACACATGGGCCCTNONE 
Os02g0176400009-099-H11AGCCCAACCAGGGCCCAAATNONE 
AK062746AGCCCAACCAGGGCCCAAATProtein of unknown function DUF872, eukaryotic family protein. 
Os02g0215950J090051K07ATTGGGCCCTConserved hypothetical protein. 
Os02g0226600AK109849AGGGCCCATTPOX domain containing protein. 
Os02g0226900AK064279AGGGCCCATACProtein prenyltransferase domain containing protein. 
Os02g0614400016-088-D04GCTGGGCCCTNONE 
AK071805GCTGGGCCCTConserved hypothetical protein. 
J023108N22GCTGGGCCCTNONE 
Os02g0622400005-010-C04GTTTGGGCCCTNONE 
AK061679GTTTGGGCCCTConserved hypothetical protein. 
J013058H01GTTTGGGCCCTNONE 
J013095D07GTTTGGGCCCTNONE 
J023054G05GTTTGGGCCCTNONE 
J023093A17GTTTGGGCCCTNONE 
J023146P16GTTTGGGCCCTNONE 
J033089D16GTTTGGGCCCTNONE 
J033099G12GTTTGGGCCCTNONE 
J033131N10GTTTGGGCCCTNONE 
J053073J04GTTTGGGCCCTNONE 
J053074P03GTTTGGGCCCTNONE 
J053075M06GTTTGGGCCCTNONE 
J053088K13GTTTGGGCCCTNONE 
J090039F18GTTTGGGCCCTNONE 
J090045M03GTTTGGGCCCTNONE 
Os02g0638300AK107831AGGGCCCAAAASimilar to Ferredoxin-thioredoxin reductase, variable chain (FTR-V) (Ferredoxin- thioredoxin reductase subunit A) (FTR-A). 
Os02g0666200006-021-D11CTGGCCCACCAGGGCCCACGCNONE 
006-022-F02CTGGCCCACCAGGGCCCACGCNONE 
006-022-H11CTGGCCCACCAGGGCCCACGCNONE 
006-024-C03CTGGCCCACCAGGGCCCACGCNONE 
006-026-G05CTGGCCCACCAGGGCCCACGCNONE 
006-027-F11CTGGCCCACCAGGGCCCACGCNONE 
006-028-G06CTGGCCCACCAGGGCCCACGCNONE 
006-028-H05CTGGCCCACCAGGGCCCACGCNONE 
006-030-H06CTGGCCCACCAGGGCCCACGCNONE 
006-030-H12CTGGCCCACCAGGGCCCACGCNONE 
006-031-C07CTGGCCCACCAGGGCCCACGCNONE 
006-031-G01CTGGCCCACCAGGGCCCACGCNONE 
006-033-F09CTGGCCCACCAGGGCCCACGCNONE 
006-035-A01CTGGCCCACCAGGGCCCACGCNONE 
006-035-A12CTGGCCCACCAGGGCCCACGCNONE 
006-035-F04CTGGCCCACCAGGGCCCACGCNONE 
006-036-G09CTGGCCCACCAGGGCCCACGCNONE 
006-038-A01CTGGCCCACCAGGGCCCACGCNONE 
006-038-A03CTGGCCCACCAGGGCCCACGCNONE 
006-039-D08CTGGCCCACCAGGGCCCACGCNONE 
006-042-C11CTGGCCCACCAGGGCCCACGCNONE 
006-042-H06CTGGCCCACCAGGGCCCACGCNONE 
006-044-E01CTGGCCCACCAGGGCCCACGCNONE 
006-045-E05CTGGCCCACCAGGGCCCACGCNONE 
006-046-G05CTGGCCCACCAGGGCCCACGCNONE 
006-047-A03CTGGCCCACCAGGGCCCACGCNONE 
006-048-H08CTGGCCCACCAGGGCCCACGCNONE 
006-052-A07CTGGCCCACCAGGGCCCACGCNONE 
006-053-A05CTGGCCCACCAGGGCCCACGCNONE 
006-054-G06CTGGCCCACCAGGGCCCACGCNONE 
006-056-D10CTGGCCCACCAGGGCCCACGCNONE 
006-057-B07CTGGCCCACCAGGGCCCACGCNONE 
006-058-F12CTGGCCCACCAGGGCCCACGCNONE 
006-060-D01CTGGCCCACCAGGGCCCACGCNONE 
006-061-A12CTGGCCCACCAGGGCCCACGCNONE 
006-062-E02CTGGCCCACCAGGGCCCACGCNONE 
006-063-F11CTGGCCCACCAGGGCCCACGCNONE 
006-063-H02CTGGCCCACCAGGGCCCACGCNONE 
006-066-F12CTGGCCCACCAGGGCCCACGCNONE 
006-067-H12CTGGCCCACCAGGGCCCACGCNONE 
006-068-B09CTGGCCCACCAGGGCCCACGCNONE 
006-068-D08CTGGCCCACCAGGGCCCACGCNONE 
006-071-A12CTGGCCCACCAGGGCCCACGCNONE 
006-072-H06CTGGCCCACCAGGGCCCACGCNONE 
006-074-A02CTGGCCCACCAGGGCCCACGCNONE 
006-074-F10CTGGCCCACCAGGGCCCACGCNONE 
006-077-H10CTGGCCCACCAGGGCCCACGCNONE 
006-078-G02CTGGCCCACCAGGGCCCACGCNONE 
006-081-B03CTGGCCCACCAGGGCCCACGCNONE 
006-084-H01CTGGCCCACCAGGGCCCACGCNONE 
006-084-H02CTGGCCCACCAGGGCCCACGCNONE 
006-084-H04CTGGCCCACCAGGGCCCACGCNONE 
006-087-H08CTGGCCCACCAGGGCCCACGCNONE 
006-090-B08CTGGCCCACCAGGGCCCACGCNONE 
006-091-E10CTGGCCCACCAGGGCCCACGCNONE 
006-093-G02CTGGCCCACCAGGGCCCACGCNONE 
006-094-B12CTGGCCCACCAGGGCCCACGCNONE 
006-094-E03CTGGCCCACCAGGGCCCACGCNONE 
006-095-G07CTGGCCCACCAGGGCCCACGCNONE 
006-095-H07CTGGCCCACCAGGGCCCACGCNONE 
006-097-G08CTGGCCCACCAGGGCCCACGCNONE 
006-098-E12CTGGCCCACCAGGGCCCACGCNONE 
006-099-A04CTGGCCCACCAGGGCCCACGCNONE 
006-099-E08CTGGCCCACCAGGGCCCACGCNONE 
006-103-F12CTGGCCCACCAGGGCCCACGCNONE 
006-104-G02CTGGCCCACCAGGGCCCACGCNONE 
006-105-F02CTGGCCCACCAGGGCCCACGCNONE 
006-107-D12CTGGCCCACCAGGGCCCACGCNONE 
006-108-F10CTGGCCCACCAGGGCCCACGCNONE 
006-108-H05CTGGCCCACCAGGGCCCACGCNONE 
006-110-G11CTGGCCCACCAGGGCCCACGCNONE 
006-111-D10CTGGCCCACCAGGGCCCACGCNONE 
006-111-E03CTGGCCCACCAGGGCCCACGCNONE 
006-111-H01CTGGCCCACCAGGGCCCACGCNONE 
006-113-C12CTGGCCCACCAGGGCCCACGCNONE 
006-114-C10CTGGCCCACCAGGGCCCACGCNONE 
006-115-B02CTGGCCCACCAGGGCCCACGCNONE 
006-117-D11CTGGCCCACCAGGGCCCACGCNONE 
006-117-E01CTGGCCCACCAGGGCCCACGCNONE 
009-131-C02CTGGCCCACCAGGGCCCACGCNONE 
009-133-G05CTGGCCCACCAGGGCCCACGCNONE 
009-152-E01CTGGCCCACCAGGGCCCACGCNONE 
009-154-E08CTGGCCCACCAGGGCCCACGCNONE 
009-196-C11CTGGCCCACCAGGGCCCACGCNONE 
012-010-E10CTGGCCCACCAGGGCCCACGCNONE 
013-018-C05CTGGCCCACCAGGGCCCACGCNONE 
013-074-A06CTGGCCCACCAGGGCCCACGCNONE 
013-078-E06CTGGCCCACCAGGGCCCACGCNONE 
AB009665CTGGCCCACCAGGGCCCACGCNONE 
AF022737CTGGCCCACCAGGGCCCACGCNONE 
AJ224327CTGGCCCACCAGGGCCCACGCNONE 
AK061769CTGGCCCACCAGGGCCCACGCNONE 
AK103807CTGGCCCACCAGGGCCCACGCAquaporin. 
AK104658CTGGCCCACCAGGGCCCACGCNONE 
J013065I12CTGGCCCACCAGGGCCCACGCNONE 
J013067L09CTGGCCCACCAGGGCCCACGCNONE 
J013089I10CTGGCCCACCAGGGCCCACGCNONE 
J013095N22CTGGCCCACCAGGGCCCACGCNONE 
J013130E17CTGGCCCACCAGGGCCCACGCNONE 
J013131A06CTGGCCCACCAGGGCCCACGCNONE 
J013154E06CTGGCCCACCAGGGCCCACGCNONE 
J023004D16CTGGCCCACCAGGGCCCACGCNONE 
J023010A15CTGGCCCACCAGGGCCCACGCNONE 
J023010H04CTGGCCCACCAGGGCCCACGCNONE 
J023049K10CTGGCCCACCAGGGCCCACGCNONE 
J023056H24CTGGCCCACCAGGGCCCACGCNONE 
J023064J12CTGGCCCACCAGGGCCCACGCNONE 
J023078I06CTGGCCCACCAGGGCCCACGCNONE 
J023081D05CTGGCCCACCAGGGCCCACGCNONE 
J023099I19CTGGCCCACCAGGGCCCACGCNONE 
J023100F05CTGGCCCACCAGGGCCCACGCNONE 
J023131F16CTGGCCCACCAGGGCCCACGCNONE 
J033025F16CTGGCCCACCAGGGCCCACGCNONE 
J033028F10CTGGCCCACCAGGGCCCACGCNONE 
J033058H13CTGGCCCACCAGGGCCCACGCNONE 
J033064P18CTGGCCCACCAGGGCCCACGCNONE 
J033070H04CTGGCCCACCAGGGCCCACGCNONE 
J033107P20CTGGCCCACCAGGGCCCACGCNONE 
J033114E09CTGGCCCACCAGGGCCCACGCNONE 
J033125G23CTGGCCCACCAGGGCCCACGCNONE 
J033136G05CTGGCCCACCAGGGCCCACGCNONE 
J033147A07CTGGCCCACCAGGGCCCACGCNONE 
J053048M24CTGGCCCACCAGGGCCCACGCNONE 
J053056K02CTGGCCCACCAGGGCCCACGCNONE 
J053057N24CTGGCCCACCAGGGCCCACGCNONE 
J053060C13CTGGCCCACCAGGGCCCACGCNONE 
J065053C22CTGGCCCACCAGGGCCCACGCNONE 
J065067J11CTGGCCCACCAGGGCCCACGCNONE 
J065085A01CTGGCCCACCAGGGCCCACGCNONE 
J065189K01CTGGCCCACCAGGGCCCACGCNONE 
J075024G24CTGGCCCACCAGGGCCCACGCNONE 
J075060O04CTGGCCCACCAGGGCCCACGCNONE 
J075075M07CTGGCCCACCAGGGCCCACGCNONE 
J075090A10CTGGCCCACCAGGGCCCACGCNONE 
J075110P11CTGGCCCACCAGGGCCCACGCNONE 
J075114H02CTGGCCCACCAGGGCCCACGCNONE 
J075127L13CTGGCCCACCAGGGCCCACGCNONE 
J075151B19CTGGCCCACCAGGGCCCACGCNONE 
J075187M17CTGGCCCACCAGGGCCCACGCNONE 
J075198E22CTGGCCCACCAGGGCCCACGCNONE 
J080006J20CTGGCCCACCAGGGCCCACGCNONE 
J080081J10CTGGCCCACCAGGGCCCACGCNONE 
J080087C03CTGGCCCACCAGGGCCCACGCNONE 
J090029E22CTGGCCCACCAGGGCCCACGCNONE 
J090037C19CTGGCCCACCAGGGCCCACGCNONE 
J090037P10CTGGCCCACCAGGGCCCACGCNONE 
J090047M10CTGGCCCACCAGGGCCCACGCNONE 
J090055K05CTGGCCCACCAGGGCCCACGCNONE 
J090057N19CTGGCCCACCAGGGCCCACGCNONE 
J090062M13CTGGCCCACCAGGGCCCACGCNONE 
J090066F22CTGGCCCACCAGGGCCCACGCNONE 
J090066N12CTGGCCCACCAGGGCCCACGCNONE 
J090071K08CTGGCCCACCAGGGCCCACGCNONE 
J090080F16CTGGCCCACCAGGGCCCACGCNONE 
J090081J21CTGGCCCACCAGGGCCCACGCNONE 
J090083F22CTGGCCCACCAGGGCCCACGCNONE 
J090083I12CTGGCCCACCAGGGCCCACGCNONE 
J090088B16CTGGCCCACCAGGGCCCACGCNONE 
J090088E01CTGGCCCACCAGGGCCCACGCNONE 
J090091C11CTGGCCCACCAGGGCCCACGCNONE 
J090091F17CTGGCCCACCAGGGCCCACGCNONE 
J090097A05CTGGCCCACCAGGGCCCACGCNONE 
J090098B15CTGGCCCACCAGGGCCCACGCNONE 
J100018B04CTGGCCCACCAGGGCCCACGCNONE 
J100021J08CTGGCCCACCAGGGCCCACGCNONE 
J100026M12CTGGCCCACCAGGGCCCACGCNONE 
J100032F02CTGGCCCACCAGGGCCCACGCNONE 
J100034B03CTGGCCCACCAGGGCCCACGCNONE 
J100037D13CTGGCCCACCAGGGCCCACGCNONE 
J100041C16CTGGCCCACCAGGGCCCACGCNONE 
J100044D14CTGGCCCACCAGGGCCCACGCNONE 
J100044E21CTGGCCCACCAGGGCCCACGCNONE 
J100047M16CTGGCCCACCAGGGCCCACGCNONE 
J100051D22CTGGCCCACCAGGGCCCACGCNONE 
J100056M13CTGGCCCACCAGGGCCCACGCNONE 
J100061J12CTGGCCCACCAGGGCCCACGCNONE 
J100065A22CTGGCCCACCAGGGCCCACGCNONE 
J100067L12CTGGCCCACCAGGGCCCACGCNONE 
J100068F06CTGGCCCACCAGGGCCCACGCNONE 
J100070C24CTGGCCCACCAGGGCCCACGCNONE 
J100072N09CTGGCCCACCAGGGCCCACGCNONE 
J100073A10CTGGCCCACCAGGGCCCACGCNONE 
J100073B15CTGGCCCACCAGGGCCCACGCNONE 
J100077F05CTGGCCCACCAGGGCCCACGCNONE 
J100078B03CTGGCCCACCAGGGCCCACGCNONE 
J100078F01CTGGCCCACCAGGGCCCACGCNONE 
J100079B08CTGGCCCACCAGGGCCCACGCNONE 
J100083J06CTGGCCCACCAGGGCCCACGCNONE 
Os02g0673600009-071-C12AGGGCCCAGANONE 
J023037G24AGGGCCCAGANONE 
J023038E07AGGGCCCAGAORMDL family protein. 
J023142L24AGGGCCCAGANONE 
J033115B14AGGGCCCAGANONE 
J075004B15AGGGCCCAGANONE 
J075067J21AGGGCCCAGANONE 
J075072K07AGGGCCCAGANONE 
J075147H21AGGGCCCAGANONE 
J075154F03AGGGCCCAGANONE 
Os02g0679500AK067772AGGGCCCAAAASimilar to Rac GTPase activating protein 1. 
AY364311AGGGCCCAAAANONE 
Os02g0686700AK111294AGGGCCCACTCCProtein of unknown function DUF581 family protein. 
Os02g0699700AK072471AGGGCCCACAASimilar to DNA topoisomerase II. 
Os02g0745400AK072229AGGGCCCACGAGlycosyl transferase, family 8 protein. 
AK108072AGGGCCCACGANONE 
Os02g0789600AK101046CAAGTGGGCCCTNONE 
AK112100CAAGTGGGCCCTSimilar to DEM2. 
Os02g0798300AK120999AGGGCCCACTConserved hypothetical protein. 
Os02g0810300AK059363AAATGGGCCAGGGCCCAGGSimilar to NBD-like protein. 
AK099203AAATGGGCCAGGGCCCAGGNONE 
Os02g0815200AK067252AGGGCCCACASimilar to 29 kDa ribonucleoprotein, chloroplast precursor (RNA-binding protein cp29). 
AK104489AGGGCCCACANONE 
Os02g0819700AK067374AGGGCCCAATTZinc finger, Zim17-type family protein. 
AK099160AGGGCCCAATTNONE 
J100086K17AGGGCCCAATTNONE 
Os02g0830700AK101172AGGGCCCAGGCCCAACTLeucine rich repeat, N-terminal domain containing protein. 
Os03g0119100AK069519CAAGTGGGCCCTSimilar to Phospholipase D beta 2. 
J023024E17CAAGTGGGCCCTNONE 
J023122B02CAAGTGGGCCCTNONE 
J090094E15CAAGTGGGCCCTNONE 
Os03g0145600015-010-B10TGGGCCCTNONE 
AK106243TGGGCCCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os03g0145700AK065716AGGGCCCATGNONE 
J013039F14AGGGCCCATGNONE 
J013091M20AGGGCCCATGNONE 
J065059P20AGGGCCCATGNONE 
J065128M07AGGGCCCATGNONE 
J065136N23AGGGCCCATGNONE 
J065163H21AGGGCCCATGNONE 
J065176B18AGGGCCCATGNONE 
J065177A17AGGGCCCATGNONE 
J065201F24AGGGCCCATGNONE 
Os03g0214400AK067931AGGGCCCAGGSimilar to Digalactosyldiacylglycerol synthase 2. 
Os03g0218200AK073971AGGGCCCAGCCyclin-like F-box domain containing protein. 
Os03g0248600AK073611CGGGTGGGCCCTSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK099342CGGGTGGGCCCTNONE 
AK104877CGGGTGGGCCCTNONE 
J013026L10CGGGTGGGCCCTNONE 
J013055P12CGGGTGGGCCCTNONE 
J023091A14CGGGTGGGCCCTNONE 
J033034G07CGGGTGGGCCCTNONE 
J033048H19CGGGTGGGCCCTNONE 
J033128D07CGGGTGGGCCCTNONE 
J065060L24CGGGTGGGCCCTNONE 
J065176A19CGGGTGGGCCCTNONE 
J090018K08CGGGTGGGCCCTNONE 
J090023C03CGGGTGGGCCCTNONE 
Os03g0255200AK058212AGGGCCCACCTGNONE 
AK071625AGGGCCCACCTGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0256400AK073854GTTTGGGCCGCAGGGCCCACAASimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0268300AK102684AGGGCCCAAGSimilar to Digalactosyldiacylglycerol synthase 2. 
AK102684ATCTGGGCCCTSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22AGGGCCCAAGNONE 
J013043J22ATCTGGGCCCTNONE 
J013057J23AGGGCCCAAGNONE 
J013057J23ATCTGGGCCCTNONE 
J013149I10AGGGCCCAAGNONE 
J013149I10ATCTGGGCCCTNONE 
J013149M20AGGGCCCAAGNONE 
J013149M20ATCTGGGCCCTNONE 
J013151D14AGGGCCCAAGNONE 
J013151D14ATCTGGGCCCTNONE 
J013162O11AGGGCCCAAGNONE 
J013162O11ATCTGGGCCCTNONE 
J023001F12AGGGCCCAAGNONE 
J023001F12ATCTGGGCCCTNONE 
J023031B21AGGGCCCAAGNONE 
J023031B21ATCTGGGCCCTNONE 
J023080A07AGGGCCCAAGNONE 
J023080A07ATCTGGGCCCTNONE 
J023081N04AGGGCCCAAGNONE 
J023081N04ATCTGGGCCCTNONE 
J023090C08AGGGCCCAAGNONE 
J023090C08ATCTGGGCCCTNONE 
J023134G05AGGGCCCAAGNONE 
J023134G05ATCTGGGCCCTNONE 
J023139G17AGGGCCCAAGNONE 
J023139G17ATCTGGGCCCTNONE 
J023143I10AGGGCCCAAGNONE 
J023143I10ATCTGGGCCCTNONE 
J023147D04AGGGCCCAAGNONE 
J023147D04ATCTGGGCCCTNONE 
J023147O15AGGGCCCAAGNONE 
J023147O15ATCTGGGCCCTNONE 
J033102K23AGGGCCCAAGNONE 
J033102K23ATCTGGGCCCTNONE 
J033106C17AGGGCCCAAGNONE 
J033106C17ATCTGGGCCCTNONE 
J075033G19AGGGCCCAAGNONE 
J075033G19ATCTGGGCCCTNONE 
J075039J18AGGGCCCAAGNONE 
J075039J18ATCTGGGCCCTNONE 
J075050K20AGGGCCCAAGNONE 
J075050K20ATCTGGGCCCTNONE 
J075075J03AGGGCCCAAGNONE 
J075075J03ATCTGGGCCCTNONE 
J075080E16AGGGCCCAAGNONE 
J075080E16ATCTGGGCCCTNONE 
J075086L08AGGGCCCAAGNONE 
J075086L08ATCTGGGCCCTNONE 
J075091K19AGGGCCCAAGNONE 
J075091K19ATCTGGGCCCTNONE 
J075099O20AGGGCCCAAGNONE 
J075099O20ATCTGGGCCCTNONE 
J075104I06AGGGCCCAAGNONE 
J075104I06ATCTGGGCCCTNONE 
J075137C16AGGGCCCAAGNONE 
J075137C16ATCTGGGCCCTNONE 
J075152G03AGGGCCCAAGNONE 
J075152G03ATCTGGGCCCTNONE 
J075176N12AGGGCCCAAGNONE 
J075176N12ATCTGGGCCCTNONE 
J100086K11AGGGCCCAAGNONE 
J100086K11ATCTGGGCCCTNONE 
Os03g0283300AK070169ATGGCCCAAGGGCCCATTTConserved hypothetical protein. 
Os03g0316200009-196-H10AGGGCCCACAANONE 
013-011-H03AGGGCCCACAANONE 
014-031-F04AGGGCCCACAANONE 
014-083-C08AGGGCCCACAANONE 
AK071812AGGGCCCACAASimilar to Galactinol synthase (Fragment). 
AK103958AGGGCCCACAANONE 
J023054E12AGGGCCCACAANONE 
J023075G21AGGGCCCACAANONE 
J023113D08AGGGCCCACAANONE 
J065067M09AGGGCCCACAANONE 
J065102E07AGGGCCCACAANONE 
J065103M07AGGGCCCACAANONE 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0336000AK100067GTTGGGCCCTProtein prenyltransferase domain containing protein. 
J065161K02GTTGGGCCCTNONE 
J065162C21GTTGGGCCCTNONE 
Os03g0337600AF119232AGGGCCCATAANONE 
AK070859AGGGCCCATAASimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18AGGGCCCATAANONE 
J013147M17AGGGCCCATAANONE 
J065083M01AGGGCCCATAANONE 
J065199H24AGGGCCCATAANONE 
Os03g0347800AK073756AGCCCACAGGGCCCAACAPeptidyl-tRNA hydrolase family protein. 
Os03g0415500AK108435TGGTGGGCCCTGGCCCATCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12TGGTGGGCCCTGGCCCATCANONE 
Os03g0577000012-055-F04AGGGCCCAACCCGCGCNONE 
AK061051AGGGCCCAACCCGCGCSimilar to Ribosomal protein S3 (Fragment). 
AK099146AGGGCCCAACCCGCGCNONE 
J065060A01AGGGCCCAACCCGCGCNONE 
J075079B17AGGGCCCAACCCGCGCNONE 
J075134K12AGGGCCCAACCCGCGCNONE 
J090048F23AGGGCCCAACCCGCGCNONE 
J090072I19AGGGCCCAACCCGCGCNONE 
J100087C19AGGGCCCAACCCGCGCNONE 
J100090C21AGGGCCCAACCCGCGCNONE 
Os03g0584300009-018-H09GGGCTTTTCTGGGCCCTNONE 
AK105133GGGCTTTTCTGGGCCCTProtein of unknown function UPF0136, Transmembrane family protein. 
J065053M11GGGCTTTTCTGGGCCCTNONE 
Os03g0604600J090093K23AGGGCCCAGTTConserved hypothetical protein. 
J090093K23AGGGCCCATTTConserved hypothetical protein. 
Os03g0625900AK101109AAAAGCCCAACAGGGCCCATATWD40-like domain containing protein. 
Os03g0751400AK069033AGGGCCCAGASimilar to 50S ribosomal protein l6. 
J023004G24AGGGCCCAGANONE 
J065176D08AGGGCCCAGANONE 
Os03g0756800009-100-H11GGTGGGCCCTNONE 
AK120423GGTGGGCCCTProtein of unknown function UPF0139 family protein. 
J013095D02GGTGGGCCCTNONE 
J023091G12GGTGGGCCCTNONE 
J065207J17GGTGGGCCCTNONE 
J100067G13GGTGGGCCCTNONE 
J100089L11GGTGGGCCCTNONE 
Os03g0769600AK100054TCATGGGCCCTResB-like family protein. 
Os03g0780400011-100-D09AGGGCCCACANONE 
AK061347AGGGCCCACANONE 
AK073162AGGGCCCACASimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22AGGGCCCACANONE 
J065045I07AGGGCCCACANONE 
J090036F17AGGGCCCACANONE 
J090077M14AGGGCCCACANONE 
J100055G20AGGGCCCACANONE 
Os03g0799100AK058959ACACGTGGGCCCTNONE 
AK102772ACACGTGGGCCCTSimilar to WAVE-DAMPENED2. 
J023093D03ACACGTGGGCCCTNONE 
J033099D22ACACGTGGGCCCTNONE 
J090054G18ACACGTGGGCCCTNONE 
J100031H24ACACGTGGGCCCTNONE 
J100065H09ACACGTGGGCCCTNONE 
J100082G10ACACGTGGGCCCTNONE 
Os03g0819400009-131-F02TGTGGGCCCTNONE 
AK070263TGTGGGCCCTHeavy metal transport/detoxification protein domain containing protein. 
J023043H06TGTGGGCCCTNONE 
J033097J18TGTGGGCCCTNONE 
J033133G11TGTGGGCCCTNONE 
J065037K10TGTGGGCCCTNONE 
J065200J12TGTGGGCCCTNONE 
J075172I11TGTGGGCCCTNONE 
J100082F10TGTGGGCCCTNONE 
Os03g0819900006-058-B05ACTGGGCCCTNONE 
AK111912ACTGGGCCCTNONE 
AK112029ACTGGGCCCTSimilar to RAB8C. 
AY576526ACTGGGCCCTNONE 
AY579410ACTGGGCCCTNONE 
J075041G24ACTGGGCCCTNONE 
J100070N08ACTGGGCCCTNONE 
Os03g0828100009-088-D04TTATGGGCCCTNONE 
009-125-F01TTATGGGCCCTNONE 
009-169-C06TTATGGGCCCTNONE 
AK059132TTATGGGCCCTNONE 
AK062799TTATGGGCCCTNONE 
AK099043TTATGGGCCCTSimilar to 50S ribosomal protein L18. 
J013146D01TTATGGGCCCTNONE 
J065057J16TTATGGGCCCTNONE 
Os03g0833900AK073655AAATGGGCCCTSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800AAATGGGCCCTNONE 
AK104068AAATGGGCCCTNONE 
J075031J11AAATGGGCCCTNONE 
J075051N01AAATGGGCCCTNONE 
J075166D18AAATGGGCCCTNONE 
J075171E14AAATGGGCCCTNONE 
Os03g0848300AK059137AGGGCCCAGATNONE 
AK102089AGGGCCCAGATSimilar to Actin-related protein 2/3 complex subunit 4 (ARP2/3 complex 20 kDa subunit) (p20-ARC). 
J033037E05AGGGCCCAGATNONE 
J033082P03AGGGCCCAGATNONE 
J065110J17AGGGCCCAGATNONE 
J075012L14AGGGCCCAGATNONE 
J075013G06AGGGCCCAGATNONE 
J075021D21AGGGCCCAGATNONE 
J075162K12AGGGCCCAGATNONE 
Os03g0851100AF303468GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
AK102069GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTSimilar to Translational elongation factor EF-TuM. 
J033082G06GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J043036M21GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065158H05GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065192A04GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
Os03g0851200009-035-B01AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-134-F10AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-154-H05AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
AK059425AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCSimilar to CAXIP1 protein. 
J065065D24AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046O19AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075048O04AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075181I09AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J080303G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090086F12AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090088E07AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
Os03g0859500AK070637AGGTGGGCCCTABC transporter related domain containing protein. 
J023056J01AGGTGGGCCCTNONE 
J043003A05AGGTGGGCCCTNONE 
J065021L12AGGTGGGCCCTNONE 
J065022K11AGGTGGGCCCTNONE 
J065215B13AGGTGGGCCCTNONE 
J075025N20AGGTGGGCCCTNONE 
J075090B03AGGTGGGCCCTNONE 
J075090B04AGGTGGGCCCTNONE 
J075118C07AGGTGGGCCCTNONE 
J090026E21AGGTGGGCCCTNONE 
J090085D18AGGTGGGCCCTNONE 
J100028H06AGGTGGGCCCTNONE 
J100051L23AGGTGGGCCCTNONE 
J100052G02AGGTGGGCCCTNONE 
J100061O13AGGTGGGCCCTNONE 
Os04g0175000AK101746AGGGCCCACAConserved hypothetical protein. 
Os04g0244400006-089-A08ATTGGGCCCTNONE 
AK061168ATTGGGCCCTNONE 
AK103892ATTGGGCCCTGlutaredoxin domain containing protein. 
J033150E08ATTGGGCCCTNONE 
J065063D07ATTGGGCCCTNONE 
J065070L22ATTGGGCCCTNONE 
J075022J16ATTGGGCCCTNONE 
J075136O21ATTGGGCCCTNONE 
J075150O05ATTGGGCCCTNONE 
J075197O15ATTGGGCCCTNONE 
J080307A14ATTGGGCCCTNONE 
J100080A07ATTGGGCCCTNONE 
Os04g0320200012-089-H09AGGGCCCAACANONE 
AK069513AGGGCCCAACAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK104028AGGGCCCAACANONE 
AK119256AGGGCCCAACANONE 
J023020H09AGGGCCCAACANONE 
J065112F21AGGGCCCAACANONE 
J100036M07AGGGCCCAACANONE 
Os04g0367400006-079-G12AGGGCCCACCTGTCAGNONE 
AK061121AGGGCCCACCTGTCAGReticulon family protein. 
AK100139AGGGCCCACCTGTCAGNONE 
J065009F13AGGGCCCACCTGTCAGNONE 
J065032N11AGGGCCCACCTGTCAGNONE 
J065039P10AGGGCCCACCTGTCAGNONE 
J065124I05AGGGCCCACCTGTCAGNONE 
J065197E16AGGGCCCACCTGTCAGNONE 
Os04g0463400AK059730AGGGCCCACCAProtein of unknown function DUF125, transmembrane family protein. 
Os04g0492900AK102780AGGGCCCAACTCRS1/YhbY domain containing protein. 
AK120004AGGGCCCAACTNONE 
AK120369AGGGCCCAACTNONE 
Os04g0495800003-009-C11TATGGGCCCTNONE 
AK060753TATGGGCCCTNONE 
Os04g0498600006-068-G08AGGGCCCAGATNONE 
006-095-H08AGGGCCCAGATNONE 
006-108-E12AGGGCCCAGATNONE 
009-194-E05AGGGCCCAGATNONE 
AK062001AGGGCCCAGATNONE 
Os04g0538400AK108230ATCTGGGCCCTSimilar to Nodulin 21 (N-21). 
J090006J20ATCTGGGCCCTNONE 
Os04g0551300AK103502AGGGCCCAAAASimilar to Growth regulator like protein. 
Os04g0577000AK073711AATTGGGCCCTUbiquitin fusion degradation protein UFD1 family protein. 
AK119957AATTGGGCCCTNONE 
J013127H04AATTGGGCCCTNONE 
J033035G06AATTGGGCCCTNONE 
J033061G23AATTGGGCCCTNONE 
J033127L07AATTGGGCCCTNONE 
J065015F17AATTGGGCCCTNONE 
J065062G08AATTGGGCCCTNONE 
J065132M07AATTGGGCCCTNONE 
J065155C12AATTGGGCCCTNONE 
J075055I08AATTGGGCCCTNONE 
J075140D07AATTGGGCCCTNONE 
J090055B21AATTGGGCCCTNONE 
J100031D23AATTGGGCCCTNONE 
Os04g0667600009-131-H09GTATGGGCCCTNONE 
009-200-A04GTATGGGCCCTNONE 
AK068657GTATGGGCCCTHeavy metal transport/detoxification protein domain containing protein. 
J065013M12GTATGGGCCCTNONE 
J065024H17GTATGGGCCCTNONE 
J065025P10GTATGGGCCCTNONE 
J065028I11GTATGGGCCCTNONE 
J065044K11GTATGGGCCCTNONE 
J065045B14GTATGGGCCCTNONE 
J065052B02GTATGGGCCCTNONE 
J065061F20GTATGGGCCCTNONE 
J065061K16GTATGGGCCCTNONE 
J065063E12GTATGGGCCCTNONE 
J065065E16GTATGGGCCCTNONE 
J065082M02GTATGGGCCCTNONE 
J065084O10GTATGGGCCCTNONE 
J065096H18GTATGGGCCCTNONE 
J065122F02GTATGGGCCCTNONE 
J065131F09GTATGGGCCCTNONE 
J065139P06GTATGGGCCCTNONE 
J065148L17GTATGGGCCCTNONE 
J065164D23GTATGGGCCCTNONE 
J065167M17GTATGGGCCCTNONE 
J065174B15GTATGGGCCCTNONE 
J065176G01GTATGGGCCCTNONE 
J065186K17GTATGGGCCCTNONE 
J065186N05GTATGGGCCCTNONE 
J065213N24GTATGGGCCCTNONE 
J075001P17GTATGGGCCCTNONE 
J075004A15GTATGGGCCCTNONE 
J075007B03GTATGGGCCCTNONE 
J075026D23GTATGGGCCCTNONE 
J075032D17GTATGGGCCCTNONE 
J075058C22GTATGGGCCCTNONE 
J075080L14GTATGGGCCCTNONE 
J075094K18GTATGGGCCCTNONE 
J075097K15GTATGGGCCCTNONE 
J075098E02GTATGGGCCCTNONE 
J075104D11GTATGGGCCCTNONE 
J075120L16GTATGGGCCCTNONE 
J075126A18GTATGGGCCCTNONE 
J075129M08GTATGGGCCCTNONE 
J075143N14GTATGGGCCCTNONE 
J075146D07GTATGGGCCCTNONE 
J075149L10GTATGGGCCCTNONE 
J075171F22GTATGGGCCCTNONE 
J090058C05GTATGGGCCCTNONE 
J100018N19GTATGGGCCCTNONE 
J100024K09GTATGGGCCCTNONE 
J100036F15GTATGGGCCCTNONE 
J100042A15GTATGGGCCCTNONE 
J100042P14GTATGGGCCCTNONE 
J100051N18GTATGGGCCCTNONE 
J100055K14GTATGGGCCCTNONE 
J100056F05GTATGGGCCCTNONE 
J100058L10GTATGGGCCCTNONE 
J100083J17GTATGGGCCCTNONE 
J100086N07GTATGGGCCCTNONE 
Os04g0670800AK073170GGATGGGCCCTNONE 
Os05g0115200AK106709CACTGACAAGGTGGGCCCTConserved hypothetical protein. 
Os05g0116600AK109828GCTGGGCCCTGGGCCATF-box associated type 1 domain containing protein. 
Os05g0121800AK101222CCCACGCGTGGGCCCTConserved hypothetical protein. 
J033031D02CCCACGCGTGGGCCCTNONE 
J065078F10CCCACGCGTGGGCCCTNONE 
J065151J16CCCACGCGTGGGCCCTNONE 
J065151K04CCCACGCGTGGGCCCTNONE 
J090057E18CCCACGCGTGGGCCCTNONE 
Os05g0123400AK069521TCTGGGCCCTConserved hypothetical protein. 
J023022O05TCTGGGCCCTNONE 
Os05g0152400Os05g0152400AGGGCCCACCACGlycosyl transferase, family 14 protein. 
Os05g0152400AGGGCCCACCTGlycosyl transferase, family 14 protein. 
Os05g0194600AK102487TTTTGGGCTTAAGGGCCCAATTPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01TTTTGGGCTTAAGGGCCCAATTNONE 
J100041A08TTTTGGGCTTAAGGGCCCAATTNONE 
Os05g0198700Os05g0198700ATATGGGCCCTREX1 DNA Repair family protein. 
Os05g0214100AK100400TGTGGGCCCTSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y- 1140 of Kluyveromyces lactis. 
AK107105TGTGGGCCCTNONE 
J013073B12TGTGGGCCCTNONE 
J013093B07TGTGGGCCCTNONE 
J023086N14TGTGGGCCCTNONE 
J065143B06TGTGGGCCCTNONE 
J090009B02TGTGGGCCCTNONE 
J090075A13TGTGGGCCCTNONE 
Os05g0255600AK073067CTTGGGCTGGGCCCTThioredoxin domain 2 containing protein. 
J033022A04CTTGGGCTGGGCCCTNONE 
J033022B03CTTGGGCTGGGCCCTNONE 
J033116F22CTTGGGCTGGGCCCTNONE 
J065017H13CTTGGGCTGGGCCCTNONE 
J065038G20CTTGGGCTGGGCCCTNONE 
J065076J16CTTGGGCTGGGCCCTNONE 
J065135D06CTTGGGCTGGGCCCTNONE 
J065168P22CTTGGGCTGGGCCCTNONE 
J065188G21CTTGGGCTGGGCCCTNONE 
J065207C14CTTGGGCTGGGCCCTNONE 
J080014C23CTTGGGCTGGGCCCTNONE 
J080018G12CTTGGGCTGGGCCCTNONE 
J080021F03CTTGGGCTGGGCCCTNONE 
J100068C14CTTGGGCTGGGCCCTNONE 
Os05g0401300009-111-H03AGGGCCCACCANONE 
AK060678AGGGCCCACCATwin-arginine translocation pathway signal domain containing protein. 
Os05g0412300AK107782GTGTGGGCCCTHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os05g0414400AK102320CAAGTGGGCCCTNONE 
AK119358CAAGTGGGCCCTProtein of unknown function DUF659 domain containing protein. 
Os05g0415600AK065818GTGGCCCACAAACTGGGCCCTNONE 
J013042K21GTGGCCCACAAACTGGGCCCTNONE 
J013114E15GTGGCCCACAAACTGGGCCCTNONE 
J013131H02GTGGCCCACAAACTGGGCCCTNONE 
J023041G06GTGGCCCACAAACTGGGCCCTNONE 
J100037M21GTGGCCCACAAACTGGGCCCTNONE 
Os05g0486200009-099-B03AGTGGGCCCTTCATGGGCCCACGCCACNONE 
AK121022AGTGGGCCCTTCATGGGCCCACGCCACConserved hypothetical protein. 
J023049I09AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J033029N07AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J075074I18AGTGGGCCCTTCATGGGCCCACGCCACNONE 
Os05g0513400AK069309TGTGGGCCCTProtein of unknown function DUF803 family protein. 
AK121638TGTGGGCCCTNONE 
Os05g0529300AK102648TGTGGGCCCTSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06AGGGCCCACANONE 
AK063846AGGGCCCACAConserved hypothetical protein. 
AK122038AGGGCCCACANONE 
J033113C01AGGGCCCACANONE 
Os05g0554100AK073023AAATGGGCCCTRibosomal protein L7/L12 family protein. 
AK101756AAATGGGCCCTNONE 
Os05g0555300009-032-C03GTTTGGGCCCTNONE 
009-125-E08GTTTGGGCCCTNONE 
009-149-C12GTTTGGGCCCTNONE 
009-172-C01GTTTGGGCCCTNONE 
AK062890GTTTGGGCCCTFerredoxin domain containing protein. 
AK062997GTTTGGGCCCTNONE 
Os05g0557200AK062090AGGGCCCAAGNONE 
AK102111AGGGCCCAAGArmadillo-like helical domain containing protein. 
J013047E13AGGGCCCAAGNONE 
J013089P04AGGGCCCAAGNONE 
J013130H17AGGGCCCAAGNONE 
J013132C20AGGGCCCAAGNONE 
J023001E06AGGGCCCAAGNONE 
J023108C09AGGGCCCAAGNONE 
J023125C12AGGGCCCAAGNONE 
J033023O10AGGGCCCAAGNONE 
J033033K16AGGGCCCAAGNONE 
J033064C11AGGGCCCAAGNONE 
J033071P07AGGGCCCAAGNONE 
J033072H14AGGGCCCAAGNONE 
J033084F06AGGGCCCAAGNONE 
J033084H11AGGGCCCAAGNONE 
J033097C05AGGGCCCAAGNONE 
J043009E20AGGGCCCAAGNONE 
J053035M10AGGGCCCAAGNONE 
J053043J22AGGGCCCAAGNONE 
J053082K10AGGGCCCAAGNONE 
J053094N13AGGGCCCAAGNONE 
Os05g0557800009-156-G05AGGGCCCACTGTCAGTGNONE 
013-049-C12AGGGCCCACTGTCAGTGNONE 
AK068460AGGGCCCACTGTCAGTGSimilar to 50S ribosomal protein L21, mitochondrial precursor. 
AK105327AGGGCCCACTGTCAGTGNONE 
J013153H24AGGGCCCACTGTCAGTGNONE 
J023003F16AGGGCCCACTGTCAGTGNONE 
J065216G02AGGGCCCACTGTCAGTGNONE 
J075037C20AGGGCCCACTGTCAGTGNONE 
J100032H16AGGGCCCACTGTCAGTGNONE 
Os05g0591600Os05g0591600AGGGCCCACCASimilar to Lysine decarboxylase-like protein. 
Os06g0102600J065187I04TTGTGGGCCCTHypothetical protein. 
Os06g0114700AK061552AGGGCCCAACAProtein of unknown function DUF1218 family protein. 
AK098848AGGGCCCAACANONE 
AK122142AGGGCCCAACANONE 
J013000D16AGGGCCCAACANONE 
Os06g0129000Os06g0129000GACACGTGGGCCCTConserved hypothetical protein. 
Os06g0136600AK069316CACTGACATGTGGGCCCTSimilar to Enolase 1 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 1) (2-phospho- D-glycerate hydro-lyase 1). 
J075010L23CACTGACATGTGGGCCCTNONE 
Os06g0168600AK068858AGGGCCCACASimilar to Ribonucleotide reductase. 
Os06g0172000AK068738AAATGGGCCCTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os06g0199300J065045H01CACTGACATGTGGGCCCTNONE 
J075177C22CACTGACATGTGGGCCCTNONE 
J080068H06CACTGACATGTGGGCCCTNONE 
J090048F01CACTGACATGTGGGCCCTNONE 
J100066F17CACTGACATGTGGGCCCTNONE 
Os06g0269300AK064807AGGGCCCAAAANONE 
AK122070AGGGCCCAAAASoluble quinoprotein glucose dehydrogenase domain containing protein. 
J013000D18AGGGCCCAAAANONE 
J023060J19AGGGCCCAAAANONE 
J033028I01AGGGCCCAAAANONE 
J033032M06AGGGCCCAAAANONE 
J033038E05AGGGCCCAAAANONE 
J033106J02AGGGCCCAAAANONE 
Os06g0287700AK067966AGGGCCCATGTSimilar to NBS-LRR disease resistance protein homologue (Fragment). 
J013122I17AGGGCCCATGTNONE 
J065038I02AGGGCCCATGTNONE 
J065214J02AGGGCCCATGTNONE 
Os06g0320000009-030-C04ACTGGGCCCTNONE 
009-135-F08ACTGGGCCCTNONE 
J075103B05ACTGGGCCCTProtein of unknown function DUF953, thioredoxin-like family protein. 
J075187J24ACTGGGCCCTNONE 
Os06g0326500AK068142CTTGGGCCCTMitochondrial glycoprotein family protein. 
AK071483CTTGGGCCCTNONE 
J053065A20CTTGGGCCCTNONE 
J065082D14CTTGGGCCCTNONE 
Os06g0332400AK058294AGGGCCCACTCTNONE 
AK101738AGGGCCCACTCTVHS domain containing protein. 
J013119B12AGGGCCCACTCTNONE 
J013132G17AGGGCCCACTCTNONE 
J023034E06AGGGCCCACTCTNONE 
J023039I05AGGGCCCACTCTNONE 
J033024E14AGGGCCCACTCTNONE 
J033039N04AGGGCCCACTCTNONE 
J033048P16AGGGCCCACTCTNONE 
J033069F24AGGGCCCACTCTNONE 
J033071D15AGGGCCCACTCTNONE 
J033106D01AGGGCCCACTCTNONE 
J033106D09AGGGCCCACTCTNONE 
J033106F09AGGGCCCACTCTNONE 
J033107K03AGGGCCCACTCTNONE 
J033129G10AGGGCCCACTCTNONE 
J065016B15AGGGCCCACTCTNONE 
J065022H07AGGGCCCACTCTNONE 
J065048E07AGGGCCCACTCTNONE 
J065068B11AGGGCCCACTCTNONE 
J065157C13AGGGCCCACTCTNONE 
J100042J02AGGGCCCACTCTNONE 
Os06g0486900AK064610CCTGGGCCCTSimilar to Formate dehydrogenase, mitochondrial precursor (EC 1.2.1.2) (NAD- dependent formate dehydrogenase) (FDH). 
Os06g0542200AK058589TCGTGGGCCCTNADP oxidoreductase, coenzyme F420-dependent family protein. 
Os06g0560400AK103575TCAGGCCCAGGGCCCAGGNONE 
AK108074TCAGGCCCAGGGCCCAGGProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0561200AK120422AAATGGGCCCTSimilar to Potassium/proton antiporter-like protein. 
Os06g0581300AK070987TGATGGGCCCTProtein of unknown function DUF1475 family protein. 
AK073185TGATGGGCCCTNONE 
J065209C10TGATGGGCCCTNONE 
J075060B03TGATGGGCCCTNONE 
J075117M08TGATGGGCCCTNONE 
J075126E04TGATGGGCCCTNONE 
J075189G04TGATGGGCCCTNONE 
J075189L16TGATGGGCCCTNONE 
J100061E16TGATGGGCCCTNONE 
Os06g0603400AK060002AGGGCCCAAATNONE 
AK102325AGGGCCCAAATNONE 
AK106905AGGGCCCAAATSimilar to DNA-directed RNA polymerase III 39 kDa polypeptide (EC 2.7.7.6) (RNA polymerase III C39 subunit). 
J090039I22AGGGCCCAAATNONE 
J100022N15AGGGCCCAAATNONE 
J100023E09AGGGCCCAAATNONE 
J100052D21AGGGCCCAAATNONE 
Os06g0646600AB061818AGGGCCCATATKNOX family class 2 homeodomain protein. 
J023088C09AGGGCCCATATNONE 
J065162G03AGGGCCCATATNONE 
Os06g0688100AK063450AGATGGGCCCTNONE 
AK101144AGATGGGCCCTRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0708500AK060865AGGGCCCACCTGTCAGNONE 
AK072490AGGGCCCACCTGTCAGSimilar to Cyclophilin. 
J013052B11AGGGCCCACCTGTCAGNONE 
J013052B13AGGGCCCACCTGTCAGNONE 
J065214H07AGGGCCCACCTGTCAGNONE 
J075192D20AGGGCCCACCTGTCAGNONE 
J090090C15AGGGCCCACCTGTCAGNONE 
J100051J18AGGGCCCACCTGTCAGNONE 
J100055A07AGGGCCCACCTGTCAGNONE 
J100060B10AGGGCCCACCTGTCAGNONE 
J100061D02AGGGCCCACCTGTCAGNONE 
Os06g0714800006-033-C09AGGGCCCATTTNONE 
006-042-G10AGGGCCCATTTNONE 
006-081-G10AGGGCCCATTTNONE 
006-120-F12AGGGCCCATTTNONE 
009-149-F08AGGGCCCATTTNONE 
AK059793AGGGCCCATTTProtein of unknown function DUF581 family protein. 
AK071528AGGGCCCATTTNONE 
J023102E22AGGGCCCATTTNONE 
J065099H06AGGGCCCATTTNONE 
J065127G22AGGGCCCATTTNONE 
J075089J03AGGGCCCATTTNONE 
J075109B02AGGGCCCATTTNONE 
J075179K22AGGGCCCATTTNONE 
Os07g0122300015-004-G08CTTGGGCCCTNONE 
AK103212CTTGGGCCCTNONE 
AK119295CTTGGGCCCTProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09CTTGGGCCCTNONE 
J090007P13CTTGGGCCCTNONE 
Os07g0158300006-049-G04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK099188CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK104773CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013106F16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013123H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J03CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J033138N08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075011F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075022F10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075071L13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075094B08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075119B21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075140L02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075199O21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080001I17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080005M04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080011P17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026B14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026C12CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080030N16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080035K23CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080039J22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080045D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050C06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050K14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080051I09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053F18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053G10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080055F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080057E22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080058F17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080063C18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080065E02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080066E06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080067O05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080068N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080071O04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074A20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074E14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074L05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075E08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075H07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080078A07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080079H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080F20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080M22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081L04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080090K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080093O13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094A18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094E10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094H06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080096I21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J100081A19CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
Os07g0171200AK071075AGGGCCCACTGalactose-1-phosphate uridyl transferase, class I family protein. 
Os07g0185700012-040-A11AGGGCCCACGGGCCCATCGNONE 
AK070572AGGGCCCACGGGCCCATCGConserved hypothetical protein. 
J065116D10AGGGCCCACGGGCCCATCGNONE 
J065122F20AGGGCCCACGGGCCCATCGNONE 
Os07g0561300AK072982TGTGGGCCCTCyclin-like F-box domain containing protein. 
J023149I22TGTGGGCCCTNONE 
J065149C18TGTGGGCCCTNONE 
J065166N15TGTGGGCCCTNONE 
J075011J01TGTGGGCCCTNONE 
J075013I05TGTGGGCCCTNONE 
J075039H11TGTGGGCCCTNONE 
J075067J09TGTGGGCCCTNONE 
J075084E08TGTGGGCCCTNONE 
J075085E12TGTGGGCCCTNONE 
J075090D11TGTGGGCCCTNONE 
J075092D12TGTGGGCCCTNONE 
J075126N17TGTGGGCCCTNONE 
J075179F01TGTGGGCCCTNONE 
J075184P21TGTGGGCCCTNONE 
Os07g0616900AK071047ACGTGGGCCCTProtein of unknown function DUF500 family protein. 
J013106G03ACGTGGGCCCTNONE 
J013124C20ACGTGGGCCCTNONE 
J033096D16ACGTGGGCCCTNONE 
J043005E08ACGTGGGCCCTNONE 
J065197K12ACGTGGGCCCTNONE 
J065211I03ACGTGGGCCCTNONE 
Os07g0664400006-092-E02AGGGCCCAATGCCCATACNONE 
J065053N04AGGGCCCAATGCCCATACGlucose/ribitol dehydrogenase family protein. 
J065057F09AGGGCCCAATGCCCATACNONE 
J065105C24AGGGCCCAATGCCCATACNONE 
J065192I04AGGGCCCAATGCCCATACNONE 
J065199L10AGGGCCCAATGCCCATACNONE 
J065200C14AGGGCCCAATGCCCATACNONE 
J065214L10AGGGCCCAATGCCCATACNONE 
Os08g0110400AK100025GGGTGGGCCCTProtein of unknown function DUF266, plant family protein. 
Os08g0112800009-113-D03GTGGTGGGCCCTNONE 
AK121176GTGGTGGGCCCTRickettsia 17 kDa surface antigen family protein. 
J023083C18GTGGTGGGCCCTNONE 
J033074M10GTGGTGGGCCCTNONE 
J033097G10GTGGTGGGCCCTNONE 
J065090F05GTGGTGGGCCCTNONE 
J090001J03GTGGTGGGCCCTNONE 
J090044F23GTGGTGGGCCCTNONE 
J090078H09GTGGTGGGCCCTNONE 
J100088G23GTGGTGGGCCCTNONE 
Os08g0116500009-007-E05AGGGCCCATCTNONE 
009-074-C07AGGGCCCATCTNONE 
009-098-A07AGGGCCCATCTNONE 
009-100-C03AGGGCCCATCTNONE 
009-136-E04AGGGCCCATCTNONE 
009-138-B08AGGGCCCATCTNONE 
009-144-B06AGGGCCCATCTNONE 
009-184-E04AGGGCCCATCTNONE 
009-189-F01AGGGCCCATCTNONE 
013-006-E05AGGGCCCATCTNONE 
013-015-C10AGGGCCCATCTNONE 
013-019-F09AGGGCCCATCTNONE 
013-020-C01AGGGCCCATCTNONE 
013-021-F05AGGGCCCATCTNONE 
013-035-D08AGGGCCCATCTNONE 
013-038-C09AGGGCCCATCTNONE 
013-054-B07AGGGCCCATCTNONE 
013-061-G10AGGGCCCATCTNONE 
013-074-B01AGGGCCCATCTNONE 
013-079-B06AGGGCCCATCTNONE 
013-099-B09AGGGCCCATCTNONE 
013-099-G11AGGGCCCATCTNONE 
014-023-F04AGGGCCCATCTNONE 
014-032-C07AGGGCCCATCTNONE 
014-045-E02AGGGCCCATCTNONE 
014-085-C02AGGGCCCATCTNONE 
014-087-F04AGGGCCCATCTNONE 
014-089-C04AGGGCCCATCTNONE 
014-090-E01AGGGCCCATCTNONE 
014-094-G11AGGGCCCATCTNONE 
014-097-B07AGGGCCCATCTNONE 
015-024-A12AGGGCCCATCTNONE 
015-032-C06AGGGCCCATCTNONE 
016-053-E09AGGGCCCATCTNONE 
016-081-F10AGGGCCCATCTNONE 
AK058240AGGGCCCATCTSimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09AGGGCCCATCTNONE 
J023107O19AGGGCCCATCTNONE 
J053029K21AGGGCCCATCTNONE 
J053073P11AGGGCCCATCTNONE 
J053074B04AGGGCCCATCTNONE 
J053078M14AGGGCCCATCTNONE 
J065001E12AGGGCCCATCTNONE 
J065006J12AGGGCCCATCTNONE 
J065015C06AGGGCCCATCTNONE 
J065025D13AGGGCCCATCTNONE 
J065029A04AGGGCCCATCTNONE 
J065031D23AGGGCCCATCTNONE 
J065032E24AGGGCCCATCTNONE 
J065034P16AGGGCCCATCTNONE 
J065043B04AGGGCCCATCTNONE 
J065044A15AGGGCCCATCTNONE 
J065062D18AGGGCCCATCTNONE 
J065079G13AGGGCCCATCTNONE 
J065080A19AGGGCCCATCTNONE 
J065080A20AGGGCCCATCTNONE 
J065089N19AGGGCCCATCTNONE 
J065111O07AGGGCCCATCTNONE 
J065115N15AGGGCCCATCTNONE 
J065131A04AGGGCCCATCTNONE 
J065138H02AGGGCCCATCTNONE 
J065139K10AGGGCCCATCTNONE 
J065144A02AGGGCCCATCTNONE 
J065155J17AGGGCCCATCTNONE 
J065159D18AGGGCCCATCTNONE 
J065159I18AGGGCCCATCTNONE 
J065167H12AGGGCCCATCTNONE 
J065174C22AGGGCCCATCTNONE 
J065184A05AGGGCCCATCTNONE 
J065188M15AGGGCCCATCTNONE 
J065191D23AGGGCCCATCTNONE 
J065203C07AGGGCCCATCTNONE 
J065207C23AGGGCCCATCTNONE 
J065207L16AGGGCCCATCTNONE 
J065212F01AGGGCCCATCTNONE 
J065212F05AGGGCCCATCTNONE 
J075037B07AGGGCCCATCTNONE 
J075042F15AGGGCCCATCTNONE 
J075059J03AGGGCCCATCTNONE 
J075068M18AGGGCCCATCTNONE 
J075079E13AGGGCCCATCTNONE 
J075081F12AGGGCCCATCTNONE 
J075083I05AGGGCCCATCTNONE 
J075123K23AGGGCCCATCTNONE 
J075142F16AGGGCCCATCTNONE 
J075156N03AGGGCCCATCTNONE 
J075162K05AGGGCCCATCTNONE 
J075171E08AGGGCCCATCTNONE 
J075177N03AGGGCCCATCTNONE 
J075182K17AGGGCCCATCTNONE 
J075186K02AGGGCCCATCTNONE 
J075191K05AGGGCCCATCTNONE 
J080011E10AGGGCCCATCTNONE 
J080016M21AGGGCCCATCTNONE 
J080017A17AGGGCCCATCTNONE 
J080031O09AGGGCCCATCTNONE 
J080039G21AGGGCCCATCTNONE 
J080041B01AGGGCCCATCTNONE 
J080050G20AGGGCCCATCTNONE 
J080054A12AGGGCCCATCTNONE 
J080058O08AGGGCCCATCTNONE 
J080061N04AGGGCCCATCTNONE 
J080064L23AGGGCCCATCTNONE 
J080064P05AGGGCCCATCTNONE 
J080069I17AGGGCCCATCTNONE 
J080070E07AGGGCCCATCTNONE 
J080071B20AGGGCCCATCTNONE 
J080074L08AGGGCCCATCTNONE 
J080076N08AGGGCCCATCTNONE 
J080081A14AGGGCCCATCTNONE 
J080081J17AGGGCCCATCTNONE 
J080085N14AGGGCCCATCTNONE 
J080090B09AGGGCCCATCTNONE 
J080097L11AGGGCCCATCTNONE 
J080306H13AGGGCCCATCTNONE 
J080307H13AGGGCCCATCTNONE 
J080311F12AGGGCCCATCTNONE 
J080316L23AGGGCCCATCTNONE 
J080318H02AGGGCCCATCTNONE 
J090016L15AGGGCCCATCTNONE 
J090019I02AGGGCCCATCTNONE 
J090031G21AGGGCCCATCTNONE 
J090066C15AGGGCCCATCTNONE 
J100032I02AGGGCCCATCTNONE 
J100032N07AGGGCCCATCTNONE 
J100032N16AGGGCCCATCTNONE 
J100041P21AGGGCCCATCTNONE 
J100048M04AGGGCCCATCTNONE 
J100048M14AGGGCCCATCTNONE 
J100063B08AGGGCCCATCTNONE 
J100088E20AGGGCCCATCTNONE 
J100090I08AGGGCCCATCTNONE 
Os08g0322400AK120116GCGTGGGCCCTNucleotide-binding, alpha-beta plait domain containing protein. 
J013025M20GCGTGGGCCCTNONE 
J013096J15GCGTGGGCCCTNONE 
Os08g0474700AK064878AACTGGGCCCTGGGCCTGGSimilar to COPII subunit Sec23 (Fragment). 
Os08g0504400014-015-C10CCAAGCCCATGGGCCCTNONE 
AK069190CCAAGCCCATGGGCCCTSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089CCAAGCCCATGGGCCCTNONE 
J023006O19CCAAGCCCATGGGCCCTNONE 
J033041C11CCAAGCCCATGGGCCCTNONE 
Os08g0521400006-047-C11AGGGCCCACCTAGTGGGCCCAATTNONE 
016-014-E07AGGGCCCACCTAGTGGGCCCAATTNONE 
AK070148AGGGCCCACCTAGTGGGCCCAATTNONE 
AK101704AGGGCCCACCTAGTGGGCCCAATTZinc finger, RanBP2-type domain containing protein. 
AK105045AGGGCCCACCTAGTGGGCCCAATTNONE 
J013108K14AGGGCCCACCTAGTGGGCCCAATTNONE 
J013129E16AGGGCCCACCTAGTGGGCCCAATTNONE 
J013159M23AGGGCCCACCTAGTGGGCCCAATTNONE 
J023041G22AGGGCCCACCTAGTGGGCCCAATTNONE 
J033060G13AGGGCCCACCTAGTGGGCCCAATTNONE 
J033060J15AGGGCCCACCTAGTGGGCCCAATTNONE 
J065120J24AGGGCCCACCTAGTGGGCCCAATTNONE 
J065160I01AGGGCCCACCTAGTGGGCCCAATTNONE 
J065179A16AGGGCCCACCTAGTGGGCCCAATTNONE 
J065189K04AGGGCCCACCTAGTGGGCCCAATTNONE 
J090032O15AGGGCCCACCTAGTGGGCCCAATTNONE 
J090045A18AGGGCCCACCTAGTGGGCCCAATTNONE 
J090060B21AGGGCCCACCTAGTGGGCCCAATTNONE 
J090086F23AGGGCCCACCTAGTGGGCCCAATTNONE 
J090098O22AGGGCCCACCTAGTGGGCCCAATTNONE 
J100018K20AGGGCCCACCTAGTGGGCCCAATTNONE 
J100048P22AGGGCCCACCTAGTGGGCCCAATTNONE 
J100052I06AGGGCCCACCTAGTGGGCCCAATTNONE 
Os08g0530400AB071966AGGGCCCACANONE 
AK068532AGGGCCCACAMoco containing protein (Moco containing protein(OsMCP)). 
J013072G10AGGGCCCACANONE 
J013153N03AGGGCCCACANONE 
J013155E12AGGGCCCACANONE 
J013162P20AGGGCCCACANONE 
J033024H12AGGGCCCACANONE 
J033072L08AGGGCCCACANONE 
J033073N01AGGGCCCACANONE 
J033144B02AGGGCCCACANONE 
J033145B02AGGGCCCACANONE 
J043037G21AGGGCCCACANONE 
J053073F17AGGGCCCACANONE 
J053086E13AGGGCCCACANONE 
J065058B10AGGGCCCACANONE 
J090008H19AGGGCCCACANONE 
J090071C06AGGGCCCACANONE 
J090082L21AGGGCCCACANONE 
J100044B09AGGGCCCACANONE 
J100051N23AGGGCCCACANONE 
J100075O05AGGGCCCACANONE 
J100085H22AGGGCCCACANONE 
J100086O19AGGGCCCACANONE 
Os08g0545700Os08g0545700AGGGCCCACATraB determinant family protein. 
Os08g0549100004-006-D12AGGGCCCACACGNONE 
006-085-H05AGGGCCCACACGNONE 
006-101-B02AGGGCCCACACGNONE 
AK070842AGGGCCCACACGSimilar to Peroxisome type ascorbate peroxidase. 
AK104490AGGGCCCACACGNONE 
J013095F24AGGGCCCACACGNONE 
J013111D10AGGGCCCACACGNONE 
J023031C15AGGGCCCACACGNONE 
J023067J02AGGGCCCACACGNONE 
J023074O14AGGGCCCACACGNONE 
J033058F18AGGGCCCACACGNONE 
J033101F12AGGGCCCACACGNONE 
J053026B20AGGGCCCACACGNONE 
J065070G12AGGGCCCACACGNONE 
J065196H18AGGGCCCACACGNONE 
J075021N20AGGGCCCACACGNONE 
J075069K22AGGGCCCACACGNONE 
J075093E22AGGGCCCACACGNONE 
J075110D17AGGGCCCACACGNONE 
J075119D06AGGGCCCACACGNONE 
J075181H15AGGGCCCACACGNONE 
J090038O15AGGGCCCACACGNONE 
J090043K23AGGGCCCACACGNONE 
J090082E12AGGGCCCACACGNONE 
J100022M19AGGGCCCACACGNONE 
J100027E06AGGGCCCACACGNONE 
J100028G17AGGGCCCACACGNONE 
J100061I16AGGGCCCACACGNONE 
J100065G23AGGGCCCACACGNONE 
J100087C13AGGGCCCACACGNONE 
Os08g0565200AK108143AGGGCCCACCCPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os09g0127300AK100234AAATGGGCCCTNAD-dependent epimerase/dehydratase family protein. 
J065025J06AAATGGGCCCTNONE 
J065026I05AAATGGGCCCTNONE 
J065042L03AAATGGGCCCTNONE 
J065061B18AAATGGGCCCTNONE 
J065121H13AAATGGGCCCTNONE 
J065183N10AAATGGGCCCTNONE 
Os09g0246700AK121936AGGGCCCACTConserved hypothetical protein. 
Os09g0327300AK059603AGGGCCCAAAASimilar to Plastid 5,10-methylene-tetrahydrofolate dehydrogenase (Fragment). 
J100073E06AGGGCCCAAAANONE 
Os09g0361400006-109-H02AGGGCCCACACGNONE 
006-120-G04AGGGCCCACACGNONE 
AK060652AGGGCCCACACGOuter mitochondrial membrane protein porin (Voltage-dependent anion- selective channel protein) (VDAC). 
AK061261AGGGCCCACACGNONE 
AK072129AGGGCCCACACGNONE 
J023109H05AGGGCCCACACGNONE 
J065052I18AGGGCCCACACGNONE 
J065058M16AGGGCCCACACGNONE 
J065079L08AGGGCCCACACGNONE 
J065107J15AGGGCCCACACGNONE 
J065137A03AGGGCCCACACGNONE 
J090013N18AGGGCCCACACGNONE 
J090064O16AGGGCCCACACGNONE 
J100080N15AGGGCCCACACGNONE 
Y18104AGGGCCCACACGNONE 
Os09g0397900AK101306AGGGCCCATGGGCTSimilar to FEG protein. 
Os09g0406900012-044-F05AGGGCCCAGGNONE 
AK063485AGGGCCCAGGNONE 
AK067460AGGGCCCAGGConserved hypothetical protein. 
Os09g0467400AK066610AGTTGGGCCCTProtein of unknown function DUF6, transmembrane domain containing protein. 
Os09g0495200AK102989CACTGACATATGGGCCCTConserved hypothetical protein. 
J075062H18CACTGACATATGGGCCCTNONE 
J075098G06CACTGACATATGGGCCCTNONE 
Os09g0530700AK058211TGGTGGGCCCTConserved hypothetical protein. 
AK100759TGGTGGGCCCTNONE 
J065039L02TGGTGGGCCCTNONE 
J065043O03TGGTGGGCCCTNONE 
J065070M16TGGTGGGCCCTNONE 
Os11g0111200AK109277TAATGGGCCCTConserved hypothetical protein. 
Os11g0153700AK058576AAAGCCCAATAGGGCCCATATSimilar to Signal recognition particle 54 kDa protein, chloroplast precursor (SRP54) (54 chloroplast protein) (54CP) (FFC). 
Os11g0216400Os11g0216400AGGGCCCACCCProteinase inhibitor, propeptide domain containing protein. 
Os11g0244800AK103215AGATGGGCCCTSimilar to Alfin-1. 
J065009E13AGATGGGCCCTNONE 
J065027D16AGATGGGCCCTNONE 
J065085B06AGATGGGCCCTNONE 
J065180O17AGATGGGCCCTNONE 
J090010C16AGATGGGCCCTNONE 
J090039K20AGATGGGCCCTNONE 
Os11g0549690J065085G07ATATGGGCCCTConserved hypothetical protein. 
J065218B08ATATGGGCCCTNONE 
J090036H16ATATGGGCCCTNONE 
Os11g0568300016-075-B02AGGGCCCATACNONE 
AK064398AGGGCCCATACHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK103282AGGGCCCATACNONE 
J033124M10AGGGCCCATACNONE 
J065120I21AGGGCCCATACNONE 
J065144H16AGGGCCCATACNONE 
Os11g0697400J065021C03AGGGCCCACTTGNONE 
J065022A14AGGGCCCACTTGNONE 
J065024I05AGGGCCCACTTGHypothetical protein. 
J065031A20AGGGCCCACTTGNONE 
J065046D17AGGGCCCACTTGNONE 
J065060A09AGGGCCCACTTGNONE 
J065078H18AGGGCCCACTTGNONE 
J065088L16AGGGCCCACTTGNONE 
J065134F20AGGGCCCACTTGNONE 
J065139F22AGGGCCCACTTGNONE 
J065149C20AGGGCCCACTTGNONE 
J065164L09AGGGCCCACTTGNONE 
J065167K11AGGGCCCACTTGNONE 
J065178O09AGGGCCCACTTGNONE 
J065185M03AGGGCCCACTTGNONE 
J065188H02AGGGCCCACTTGNONE 
J065203C12AGGGCCCACTTGNONE 
J075013G16AGGGCCCACTTGNONE 
J075046J24AGGGCCCACTTGNONE 
J075062A07AGGGCCCACTTGNONE 
J075083F01AGGGCCCACTTGNONE 
J075110I16AGGGCCCACTTGNONE 
J075132E17AGGGCCCACTTGNONE 
J075150H03AGGGCCCACTTGNONE 
J075166H11AGGGCCCACTTGNONE 
J080001H24AGGGCCCACTTGNONE 
J080001O03AGGGCCCACTTGNONE 
J080025J03AGGGCCCACTTGNONE 
J080027H04AGGGCCCACTTGNONE 
J080034B17AGGGCCCACTTGNONE 
J080037K21AGGGCCCACTTGNONE 
J080042A08AGGGCCCACTTGNONE 
J080054D03AGGGCCCACTTGNONE 
J080054M18AGGGCCCACTTGNONE 
J080068K02AGGGCCCACTTGNONE 
J080070E24AGGGCCCACTTGNONE 
J080317K04AGGGCCCACTTGNONE 
Os12g0102100J013134H02AGGGCCCATATAlcohol dehydrogenase superfamily, zinc-containing protein. 
Os12g0190100AK109819AGGGCCCAATSimilar to Auxin-independent growth promoter-like protein. 
Os12g0244500AK102026CCTGGGCCCTConserved hypothetical protein. 
J023014D06CCTGGGCCCTNONE 
J023060C12CCTGGGCCCTNONE 
J033080M18CCTGGGCCCTNONE 
J090017I22CCTGGGCCCTNONE 
J090023D21CCTGGGCCCTNONE 
J090036J05CCTGGGCCCTNONE 
J090053M19CCTGGGCCCTNONE 
Os12g0472800AK063278AGGGCCCACCTGTCAGB repeat unit of collagen binding surface protein (cna) containing protein. 
Os12g0556400009-129-D04AGGGCCCATTTNONE 
AK062903AGGGCCCATTTNONE 
AK108690AGGGCCCATTTConserved hypothetical protein. 
J080027A03AGGGCCCATTTNONE 
J100074F22AGGGCCCATTTNONE 
Os12g0565800AK072828AGGGCCCAATZinc finger, TTF-type domain containing protein. 
Os12g0566000AK070617TGTGGGCCCTHCO3- transporter, eukaryote family protein. 
AK100510TGTGGGCCCTNONE 
AY339063TGTGGGCCCTNONE 
J023099M11TGTGGGCCCTNONE 
J023110H10TGTGGGCCCTNONE 
Os12g0599900AK101252AAATGGGCCCTTetratricopeptide region domain containing protein. 
J033032F05AAATGGGCCCTNONE 
Os12g0605900AK109696AGGGCCCATGGGCCCTGGCCCATTASimilar to Kinase like protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.