version

Summary of OsREG476 (All List)

OrganismOryza sativa  
IDOsREG476  
SequenceAGGTGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2269  

Entry Sequences (2269 entries)

LocusGene modelSequenceDescription
Os01g0150100J023078H07CTTGGGCCCACCTGTCNONE 
Os01g0157600AK106766GACAGGTGGGCCCATGTAnkyrin repeat containing protein. 
Os01g0158900AK059497GCCCACCTNONE 
Os01g0179000015-092-B11CAGGTGGGCCCCACCTransferase family protein. 
J033107B12CAGGTGGGCCCCACCNONE 
Os01g0186900AK106168TAAGCCCACCTNONE 
J075116O22TAAGCCCACCTNONE 
J100060H12TAAGCCCACCTNONE 
Os01g0191800AK061360AGCCCATAAAGGCCCACCTNONE 
Os01g0200400006-024-C04AGATGGGCCCACCTGTCAGTGGNONE 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK104558AGATGGGCCCACCTGTCAGTGGNONE 
J023043M23AGATGGGCCCACCTGTCAGTGGNONE 
J043001A15AGATGGGCCCACCTGTCAGTGGNONE 
J065155O20AGATGGGCCCACCTGTCAGTGGNONE 
J065183G02AGATGGGCCCACCTGTCAGTGGNONE 
J090007F17AGATGGGCCCACCTGTCAGTGGNONE 
J090034P12AGATGGGCCCACCTGTCAGTGGNONE 
Os01g0212100AK065467AGCCCATCCAAGGTGGGCCCAAATNONE 
AK101456AGCCCATCCAAGGTGGGCCCAAATATP-dependent helicase, DEAH-box family protein. 
Os01g0220300009-063-C12AGGTGGGCTTTNONE 
AK105167AGGTGGGCTTTConserved hypothetical protein. 
J065124E17AGGTGGGCTTTNONE 
J090096L11AGGTGGGCTTTNONE 
Os01g0232400AK101990GCCCACCTSimilar to VHS1 protein (Fragment). 
AK106519GCCCACCTNONE 
Os01g0246500AK058984GGGGCCCACCTGTCSimilar to Minus dominance protein. 
Os01g0257400AK073920GGTGGGGCCCACCTGZinc finger, CCCH-type domain containing protein. 
Os01g0273800AK109645CAGGTGGGCCCCAFAD dependent oxidoreductase family protein. 
Os01g0277700006-081-F10AGGTGGGCCCCACCNONE 
014-013-D02AGGTGGGCCCCACCNONE 
AK061133AGGTGGGCCCCACCConserved hypothetical protein. 
AK099198AGGTGGGCCCCACCNONE 
J023115B14AGGTGGGCCCCACCNONE 
J065017F22AGGTGGGCCCCACCNONE 
J065090C03AGGTGGGCCCCACCNONE 
J065165H07AGGTGGGCCCCACCNONE 
Os01g0314300AK073419GCCCACCTUncharacterized domain 2 containing protein. 
AK104939GCCCACCTNONE 
J033044B03GCCCACCTNONE 
J033060E12GCCCACCTNONE 
J043037E21GCCCACCTNONE 
J065019O18GCCCACCTNONE 
J065025P22GCCCACCTNONE 
J065042P06GCCCACCTNONE 
J065074C19GCCCACCTNONE 
J065074E13GCCCACCTNONE 
J065094E05GCCCACCTNONE 
J065108N08GCCCACCTNONE 
J065134L13GCCCACCTNONE 
J065152N24GCCCACCTNONE 
J065162N24GCCCACCTNONE 
J065170P16GCCCACCTNONE 
J065177M20GCCCACCTNONE 
J065187N01GCCCACCTNONE 
J075012N12GCCCACCTNONE 
J075046C17GCCCACCTNONE 
J075055N06GCCCACCTNONE 
J075141H03GCCCACCTNONE 
J075150M11GCCCACCTNONE 
J090005B16GCCCACCTNONE 
J090079L11GCCCACCTNONE 
J100039F16GCCCACCTNONE 
Os01g0332100AK120720CAGGTGGGCCCAGCSimilar to Neutral invertase-like protein (Fragment). 
AY187621CAGGTGGGCCCAGCNONE 
J080021I24CAGGTGGGCCCAGCNONE 
Os01g0391100012-001-B05GCCCACCTGNONE 
012-053-F01GCCCACCTGNONE 
AK063499GCCCACCTGNONE 
J065021A04GCCCACCTGNONE 
J065076H06GCCCACCTGNONE 
J065181E05GCCCACCTGNONE 
J065187A05GCCCACCTGNONE 
J075036C17GCCCACCTGNONE 
J075051C18GCCCACCTGNONE 
J075063L16GCCCACCTGNONE 
J075079M08GCCCACCTGNONE 
J075112H15GCCCACCTGNONE 
J075135F10GCCCACCTGNONE 
J075164H06GCCCACCTGNONE 
J075195N02GCCCACCTGNONE 
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein. 
Os01g0534800AK072168CTGACAGGTGGGCCCTSimilar to PRLI-interacting factor K (Fragment). 
AK104278CTGACAGGTGGGCCCTNONE 
Os01g0618200AK102319TGTTGGGCCCACCTGACAGGProtein phosphatase 2C family protein. 
Os01g0618500011-019-D03GAGGCCCACTACGGCCCACCTNONE 
AK067476GAGGCCCACTACGGCCCACCTSimilar to RNA helicase (Fragment). 
J013020E19GAGGCCCACTACGGCCCACCTNONE 
J033046J12GAGGCCCACTACGGCCCACCTNONE 
J033055D06GAGGCCCACTACGGCCCACCTNONE 
Os01g0667900013-097-A02GCCCACCTNONE 
014-011-C01GCCCACCTNONE 
AK105335GCCCACCTGlutaredoxin-like, plant II family protein. 
J065156F10GCCCACCTNONE 
J065163D22GCCCACCTNONE 
J065197J04GCCCACCTNONE 
J075122C02GCCCACCTNONE 
J100047L16GCCCACCTNONE 
Os01g0707300AK059962TGCGGGCCCACCTNONE 
AK104463TGCGGGCCCACCTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0725900AK108128TCGGCCCACCTPollen Ole e 1 allergen and extensin domain containing protein. 
J075119G24TCGGCCCACCTNONE 
J075150F06TCGGCCCACCTNONE 
Os01g0730300AK101207CAGGTGGGCCCACGGHAD-superfamily hydrolase subfamily IIB protein. 
AK109542CAGGTGGGCCCACGGNONE 
Os01g0761100AK122112GCCCACCTTesmin/TSO1-like, CXC domain containing protein. 
Os01g0767100AK109493GGGGCCCACCTSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0778700AK064933GCGGGCCCACCTGConserved hypothetical protein. 
Os01g0782300AK109175AGCCCACCTGGCCCAACAConserved hypothetical protein. 
Os01g0801600AY224556GCCCACCTGNONE 
Os01g0812200003-009-E06GGTGGGGCCCACCTNONE 
AK072651GGTGGGGCCCACCTCyclin-like F-box domain containing protein. 
AK104334GGTGGGGCCCACCTNONE 
J013030E13GGTGGGGCCCACCTNONE 
J013169M21GGTGGGGCCCACCTNONE 
J023012J16GGTGGGGCCCACCTNONE 
J023103F22GGTGGGGCCCACCTNONE 
J023123A01GGTGGGGCCCACCTNONE 
J023131F07GGTGGGGCCCACCTNONE 
J023146I01GGTGGGGCCCACCTNONE 
J033040K02GGTGGGGCCCACCTNONE 
J033079F06GGTGGGGCCCACCTNONE 
J033105G06GGTGGGGCCCACCTNONE 
J033117E08GGTGGGGCCCACCTNONE 
J043030C01GGTGGGGCCCACCTNONE 
J053043H16GGTGGGGCCCACCTNONE 
J053061H01GGTGGGGCCCACCTNONE 
J065044A03GGTGGGGCCCACCTNONE 
J065068E12GGTGGGGCCCACCTNONE 
J065069D09GGTGGGGCCCACCTNONE 
J065143M19GGTGGGGCCCACCTNONE 
J065193C10GGTGGGGCCCACCTNONE 
J065209D07GGTGGGGCCCACCTNONE 
J090083C17GGTGGGGCCCACCTNONE 
J090086G06GGTGGGGCCCACCTNONE 
J090093I09GGTGGGGCCCACCTNONE 
J100023G21GGTGGGGCCCACCTNONE 
J100025D15GGTGGGGCCCACCTNONE 
J100034B13GGTGGGGCCCACCTNONE 
J100040F10GGTGGGGCCCACCTNONE 
J100051E15GGTGGGGCCCACCTNONE 
J100056L08GGTGGGGCCCACCTNONE 
J100057H04GGTGGGGCCCACCTNONE 
J100085K20GGTGGGGCCCACCTNONE 
J100088G21GGTGGGGCCCACCTNONE 
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE 
Os01g0870100AK067564GTTGGGCCCACCTGGGCCTGGProtein of unknown function DUF1012 family protein. 
AK072312GTTGGGCCCACCTGGGCCTGGNONE 
AK103428GTTGGGCCCACCTGGGCCTGGNONE 
Os01g0905400012-077-F08CGGGCCCACCTGTCAGTGNONE 
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein. 
Os01g0913800011-060-B02AGGTGGGCTGANONE 
016-088-H02AGGTGGGCTGAProtein prenyltransferase domain containing protein. 
Os01g0926400AK063916GCCCACCTGNONE 
AK073976GCCCACCTGSimilar to Pectin-glucuronyltransferase. 
Os01g0937300AK062872AGGTGGGCCGTCNONE 
J033136K12AGGTGGGCCGTCNONE 
J053048E20AGGTGGGCCGTCNONE 
J053088K08AGGTGGGCCGTCNONE 
J065011G23AGGTGGGCCGTCNONE 
J065202J09AGGTGGGCCGTCNONE 
Os01g0962600009-104-A04AGGTGGGCNONE 
AK073846AGGTGGGCSimilar to 40S ribosomal protein S10-1. 
J033070I05AGGTGGGCNONE 
J065079N18AGGTGGGCNONE 
J065122H12AGGTGGGCNONE 
J065197O14AGGTGGGCNONE 
Os02g0118400012-047-C10AGGTGGGCNONE 
AK064002AGGTGGGCSimilar to CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase (EC 2.4.99.1) (Beta-galactoside alpha-2,6-sialyltransferase) (Alpha 2,6-ST) (Sialyltransferase 1) (ST6Gal I) (B-cell antigen CD75). 
AK101004AGGTGGGCNONE 
J065022L23AGGTGGGCNONE 
J065087F24AGGTGGGCNONE 
Os02g0119400AK060055GTTTGGGCCCGGCCCACCTNONE 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GTTTGGGCCCGGCCCACCTNONE 
J075175F09GTTTGGGCCCGGCCCACCTNONE 
J090011H05GTTTGGGCCCGGCCCACCTNONE 
J090091O05GTTTGGGCCCGGCCCACCTNONE 
Os02g0122800AK062255CAGGTGGGCCCACANONE 
AK121372CAGGTGGGCCCACANucleotide-binding, alpha-beta plait domain containing protein. 
J013056N24CAGGTGGGCCCACANONE 
J023037M12CAGGTGGGCCCACANONE 
J023099B21CAGGTGGGCCCACANONE 
J023126J16CAGGTGGGCCCACANONE 
J033031J05CAGGTGGGCCCACANONE 
J033048L07CAGGTGGGCCCACANONE 
J033052J23CAGGTGGGCCCACANONE 
J033076F24CAGGTGGGCCCACANONE 
J033085F01CAGGTGGGCCCACANONE 
J033101I11CAGGTGGGCCCACANONE 
J033128E01CAGGTGGGCCCACANONE 
J100070N12CAGGTGGGCCCACANONE 
Os02g0123200016-017-F04AGGTGGGCCCCACCTGNONE 
J033057C03AGGTGGGCCCCACCTGNONE 
J033087C11AGGTGGGCCCCACCTGNONE 
J033108J20AGGTGGGCCCCACCTGNONE 
J043015P08AGGTGGGCCCCACCTGNONE 
Os02g0129700AK065610GTGGGGGCCCACCTHypothetical protein. 
J013031M24GTGGGGGCCCACCTNONE 
J075043J08GTGGGGGCCCACCTNONE 
J075142N23GTGGGGGCCCACCTNONE 
Os02g0130300011-005-D07CATGGGCCCACCTNONE 
011-041-B06CATGGGCCCACCTNONE 
015-099-D11CATGGGCCCACCTNONE 
016-049-D06CATGGGCCCACCTNONE 
AK102708CATGGGCCCACCTZinc finger, RING-type domain containing protein. 
Os02g0143200AK070600AGGTGGGCCAGArmadillo-like helical domain containing protein. 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0167700AK069128AAAAGCCCAACCGCCCACCTArmadillo-like helical domain containing protein. 
Os02g0169300006-023-D12GCCCACCTNONE 
006-062-B01GCCCACCTNONE 
015-049-F11GCCCACCTNONE 
015-057-G02GCCCACCTNONE 
015-092-F04GCCCACCTNONE 
015-095-H02GCCCACCTNONE 
015-097-B07GCCCACCTNONE 
AK070041GCCCACCTSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07GCCCACCTNONE 
J013134H23GCCCACCTNONE 
J013134J23GCCCACCTNONE 
J023036N24GCCCACCTNONE 
J023049C06GCCCACCTNONE 
J023077E10GCCCACCTNONE 
J023077F10GCCCACCTNONE 
J023105N12GCCCACCTNONE 
J033036O12GCCCACCTNONE 
J033064P11GCCCACCTNONE 
J033079F01GCCCACCTNONE 
J033123M22GCCCACCTNONE 
J033143E10GCCCACCTNONE 
J075013D12GCCCACCTNONE 
Os02g0215950J090051K07GACAGGTGGGCTGGGCTConserved hypothetical protein. 
Os02g0491300J065205O09GGTGGGGCCCACCTConserved hypothetical protein. 
Os02g0496900AK059542AAGGCCCACACGGCCCACCTConserved hypothetical protein. 
J053031E06AAGGCCCACACGGCCCACCTNONE 
J065195E11AAGGCCCACACGGCCCACCTNONE 
J090008P16AAGGCCCACACGGCCCACCTNONE 
Os02g0527300AK101934GCCCACCTGSimilar to Heat shock transcription factor 31 (Fragment). 
J013047O11GCCCACCTGNONE 
J033073P11GCCCACCTGNONE 
Os02g0528500J053035P18GACAGGTGGGCCATNONE 
J053046L13GACAGGTGGGCCATNONE 
J053099F11GACAGGTGGGCCATNONE 
Os02g0564000AJ486976GGTGGGGCCCACCTGTCNONE 
AK073086GGTGGGGCCCACCTGTCSimilar to Glutathione S-transferase. 
J065021E14GGTGGGGCCCACCTGTCNONE 
J065139E02GGTGGGGCCCACCTGTCNONE 
J065165G05GGTGGGGCCCACCTGTCNONE 
J065181H16GGTGGGGCCCACCTGTCNONE 
J065217K07GGTGGGGCCCACCTGTCNONE 
J065218L13GGTGGGGCCCACCTGTCNONE 
J100082K21GGTGGGGCCCACCTGTCNONE 
J100084K19GGTGGGGCCCACCTGTCNONE 
Os02g0564100006-072-A11GACAGGTGGGCCCCACCNONE 
AK073526GACAGGTGGGCCCCACCSimilar to EL3 protein. 
AK105951GACAGGTGGGCCCCACCNONE 
J100045C15GACAGGTGGGCCCCACCNONE 
Os02g0602300AK065609GCCCGGCCGGCCCACCTGNONE 
AK066929GCCCGGCCGGCCCACCTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GCCCGGCCGGCCCACCTGNONE 
J090040I23GCCCGGCCGGCCCACCTGNONE 
Os02g0626100003-107-B06CAGGTGGGCCACGCGTCGCGNONE 
AK120127CAGGTGGGCCACGCGTCGCGNONE 
Os02g0653400Os02g0653400CCCAGCCCACCTTransferase family protein. 
Os02g0653800J023002B17GCCCACCTNONE 
J033067E03GCCCACCTSimilar to GTP-binding protein. 
J033105M04GCCCACCTNONE 
J053039E15GCCCACCTNONE 
J065026L07GCCCACCTNONE 
J065038B03GCCCACCTNONE 
J065087J15GCCCACCTNONE 
J065121B22GCCCACCTNONE 
J065128N12GCCCACCTNONE 
J065189E19GCCCACCTNONE 
J100058B03GCCCACCTNONE 
Os02g0661300016-077-C09GAGGCCCACCTNONE 
AK106503GAGGCCCACCTConserved hypothetical protein. 
Os02g0671100012-049-H09GCCCACCTNONE 
015-077-A04GCCCACCTNONE 
AK100120GCCCACCTNONE 
AK109758GCCCACCTProtein of unknown function DUF295 family protein. 
J023007K16GCCCACCTNONE 
J065139P07GCCCACCTNONE 
J065181I06GCCCACCTNONE 
J065186I20GCCCACCTNONE 
J075052H09GCCCACCTNONE 
J075065J01GCCCACCTNONE 
J075069J15GCCCACCTNONE 
J100036N09GCCCACCTNONE 
J100054J19GCCCACCTNONE 
J100055A12GCCCACCTNONE 
J100065P09GCCCACCTNONE 
J100074E08GCCCACCTNONE 
J100074N13GCCCACCTNONE 
J100087G18GCCCACCTNONE 
Os02g0672500AK109266CCACGGCCCACCTNONE 
Os02g0686700AK111294CGTGGGGCCCACCTProtein of unknown function DUF581 family protein. 
Os02g0689700AK063776GCCCACCTRibosomal protein L18P/L5E family protein. 
Os02g0700100AK102954GCCCACCTSimilar to WD-repeat protein. 
Os02g0710300AK109662AGCCCACCTSimilar to INDEHISCENT protein. 
Os02g0728600AK063054CTGACAGGTGGGCCTASimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065121P04CTGACAGGTGGGCCTANONE 
Os02g0755900011-077-A03AGGTGGGCCATNONE 
015-066-D06AGGTGGGCCATNONE 
AK073587AGGTGGGCCATNONE 
AK104985AGGTGGGCCATSimilar to Glucosyltransferase (Fragment). 
J033052B15AGGTGGGCCATNONE 
Os02g0767900009-154-G01AGGTGGGCCTAGCCCATCGNONE 
009-154-G01AGGTGGGCCTGGCCCATCANONE 
009-172-H09AGGTGGGCCTAGCCCATCGNONE 
009-172-H09AGGTGGGCCTGGCCCATCANONE 
AK099885AGGTGGGCCTAGCCCATCGGlutaredoxin 2 family protein. 
AK099885AGGTGGGCCTGGCCCATCAGlutaredoxin 2 family protein. 
Os02g0768200006-059-D06AAAGCCCACCTNONE 
AK070007AAAGCCCACCTemp24/gp25L/p24 family protein. 
J033050A21AAAGCCCACCTNONE 
Os02g0768600006-034-F01AGGTGGGCCGGANONE 
006-034-F01GGGTGGGCCCACCTGNONE 
006-046-G07AGGTGGGCCGGANONE 
006-046-G07GGGTGGGCCCACCTGNONE 
006-054-C07AGGTGGGCCGGANONE 
006-054-C07GGGTGGGCCCACCTGNONE 
006-056-F07AGGTGGGCCGGANONE 
006-056-F07GGGTGGGCCCACCTGNONE 
006-100-C02AGGTGGGCCGGANONE 
006-100-C02GGGTGGGCCCACCTGNONE 
AK059725AGGTGGGCCGGANONE 
AK059725GGGTGGGCCCACCTGNONE 
AK098996AGGTGGGCCGGANONE 
AK098996GGGTGGGCCCACCTGNONE 
AK099120AGGTGGGCCGGANONE 
AK099120GGGTGGGCCCACCTGNONE 
AK104659AGGTGGGCCGGANONE 
AK104659GGGTGGGCCCACCTGNONE 
J065043H04AGGTGGGCCGGANONE 
J065043H04GGGTGGGCCCACCTGNONE 
J075034N21AGGTGGGCCGGANONE 
J075034N21GGGTGGGCCCACCTGNONE 
J075145C18AGGTGGGCCGGANONE 
J075145C18GGGTGGGCCCACCTGNONE 
J080016H01AGGTGGGCCGGANONE 
J080016H01GGGTGGGCCCACCTGNONE 
J080040F01AGGTGGGCCGGANONE 
J080040F01GGGTGGGCCCACCTGNONE 
J080047L23AGGTGGGCCGGANONE 
J080047L23GGGTGGGCCCACCTGNONE 
J080049B22AGGTGGGCCGGANONE 
J080049B22GGGTGGGCCCACCTGNONE 
J080062J16AGGTGGGCCGGANONE 
J080062J16GGGTGGGCCCACCTGNONE 
J080064C23AGGTGGGCCGGANONE 
J080064C23GGGTGGGCCCACCTGNONE 
J080064L22AGGTGGGCCGGANONE 
J080064L22GGGTGGGCCCACCTGNONE 
J080077N01AGGTGGGCCGGANONE 
J080077N01GGGTGGGCCCACCTGNONE 
J080097G17AGGTGGGCCGGANONE 
J080097G17GGGTGGGCCCACCTGNONE 
J100065L15AGGTGGGCCGGANONE 
J100065L15GGGTGGGCCCACCTGNONE 
J100066K23AGGTGGGCCGGANONE 
J100066K23GGGTGGGCCCACCTGNONE 
J100088C07AGGTGGGCCGGANONE 
J100088C07GGGTGGGCCCACCTGNONE 
J100090H09AGGTGGGCCGGANONE 
J100090H09GGGTGGGCCCACCTGNONE 
Os02g0782700005-009-B03CTGACAGGTGGGCCCCACCACNONE 
006-065-C12CTGACAGGTGGGCCCCACCACNONE 
011-016-A10CTGACAGGTGGGCCCCACCACNONE 
011-027-G10CTGACAGGTGGGCCCCACCACNONE 
011-078-C10CTGACAGGTGGGCCCCACCACNONE 
012-039-F02CTGACAGGTGGGCCCCACCACNONE 
012-059-F07CTGACAGGTGGGCCCCACCACNONE 
012-088-B06CTGACAGGTGGGCCCCACCACNONE 
012-088-C06CTGACAGGTGGGCCCCACCACNONE 
012-090-F01CTGACAGGTGGGCCCCACCACNONE 
015-002-C09CTGACAGGTGGGCCCCACCACNONE 
015-004-C04CTGACAGGTGGGCCCCACCACNONE 
015-024-F11CTGACAGGTGGGCCCCACCACNONE 
015-038-C01CTGACAGGTGGGCCCCACCACNONE 
015-053-H02CTGACAGGTGGGCCCCACCACNONE 
015-057-G04CTGACAGGTGGGCCCCACCACNONE 
016-010-H02CTGACAGGTGGGCCCCACCACNONE 
016-018-C07CTGACAGGTGGGCCCCACCACNONE 
016-048-B11CTGACAGGTGGGCCCCACCACNONE 
016-062-D03CTGACAGGTGGGCCCCACCACNONE 
016-077-H03CTGACAGGTGGGCCCCACCACNONE 
AF193803CTGACAGGTGGGCCCCACCACNONE 
AK064027CTGACAGGTGGGCCCCACCACNONE 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
AK119643CTGACAGGTGGGCCCCACCACNONE 
AK119885CTGACAGGTGGGCCCCACCACNONE 
J013021I16CTGACAGGTGGGCCCCACCACNONE 
J013049O14CTGACAGGTGGGCCCCACCACNONE 
J013063K17CTGACAGGTGGGCCCCACCACNONE 
J013072M15CTGACAGGTGGGCCCCACCACNONE 
J023027O06CTGACAGGTGGGCCCCACCACNONE 
J023065O13CTGACAGGTGGGCCCCACCACNONE 
J033061L05CTGACAGGTGGGCCCCACCACNONE 
J033071D23CTGACAGGTGGGCCCCACCACNONE 
J033091P12CTGACAGGTGGGCCCCACCACNONE 
J033124J07CTGACAGGTGGGCCCCACCACNONE 
J033144H23CTGACAGGTGGGCCCCACCACNONE 
J033145H23CTGACAGGTGGGCCCCACCACNONE 
J065063N13CTGACAGGTGGGCCCCACCACNONE 
J065186B09CTGACAGGTGGGCCCCACCACNONE 
J075055I18CTGACAGGTGGGCCCCACCACNONE 
J075177O06CTGACAGGTGGGCCCCACCACNONE 
J090008G10CTGACAGGTGGGCCCCACCACNONE 
J090050I24CTGACAGGTGGGCCCCACCACNONE 
J090062F21CTGACAGGTGGGCCCCACCACNONE 
J090071M09CTGACAGGTGGGCCCCACCACNONE 
J090078M03CTGACAGGTGGGCCCCACCACNONE 
J100018N15CTGACAGGTGGGCCCCACCACNONE 
J100035P04CTGACAGGTGGGCCCCACCACNONE 
J100037E03CTGACAGGTGGGCCCCACCACNONE 
J100045D04CTGACAGGTGGGCCCCACCACNONE 
J100062C01CTGACAGGTGGGCCCCACCACNONE 
J100065C13CTGACAGGTGGGCCCCACCACNONE 
J100068N10CTGACAGGTGGGCCCCACCACNONE 
J100074A11CTGACAGGTGGGCCCCACCACNONE 
J100077G20CTGACAGGTGGGCCCCACCACNONE 
Os02g0788800AK066747CCCCCGCGCCCACGCCCACCTAmino acid/polyamine transporter II family protein. 
Os02g0797600004-004-A08GGGGCCCACCTNONE 
006-050-H07GGGGCCCACCTNONE 
006-092-B02GGGGCCCACCTNONE 
006-100-B08GGGGCCCACCTNONE 
013-037-D09GGGGCCCACCTNONE 
013-068-H02GGGGCCCACCTNONE 
AK060857GGGGCCCACCTNONE 
AK098882GGGGCCCACCTNONE 
AK104474GGGGCCCACCTNONE 
AK120644GGGGCCCACCTConserved hypothetical protein. 
J013001F21GGGGCCCACCTNONE 
J013074D07GGGGCCCACCTNONE 
J013096H23GGGGCCCACCTNONE 
J013098H07GGGGCCCACCTNONE 
J013132L13GGGGCCCACCTNONE 
J013134K05GGGGCCCACCTNONE 
J013155B15GGGGCCCACCTNONE 
J023002L17GGGGCCCACCTNONE 
J023013B08GGGGCCCACCTNONE 
J023087I01GGGGCCCACCTNONE 
J033071O04GGGGCCCACCTNONE 
J065161N23GGGGCCCACCTNONE 
J075055G11GGGGCCCACCTNONE 
J075106J02GGGGCCCACCTNONE 
J080009D06GGGGCCCACCTNONE 
J080009N22GGGGCCCACCTNONE 
J080016L03GGGGCCCACCTNONE 
J080023E17GGGGCCCACCTNONE 
J080027A12GGGGCCCACCTNONE 
J080036M24GGGGCCCACCTNONE 
J080038N07GGGGCCCACCTNONE 
J080041A04GGGGCCCACCTNONE 
J080042K11GGGGCCCACCTNONE 
J080050A04GGGGCCCACCTNONE 
J080053G16GGGGCCCACCTNONE 
J080063D03GGGGCCCACCTNONE 
J080063F07GGGGCCCACCTNONE 
J080067H13GGGGCCCACCTNONE 
J080068F12GGGGCCCACCTNONE 
J080072G17GGGGCCCACCTNONE 
J080072I06GGGGCCCACCTNONE 
J080072J24GGGGCCCACCTNONE 
J080076G09GGGGCCCACCTNONE 
J080085H10GGGGCCCACCTNONE 
J080092I17GGGGCCCACCTNONE 
J080092N20GGGGCCCACCTNONE 
J080093G10GGGGCCCACCTNONE 
J090074C23GGGGCCCACCTNONE 
J090083O18GGGGCCCACCTNONE 
J100046M05GGGGCCCACCTNONE 
J100050N16GGGGCCCACCTNONE 
J100054D07GGGGCCCACCTNONE 
J100054O11GGGGCCCACCTNONE 
J100055F04GGGGCCCACCTNONE 
J100055H22GGGGCCCACCTNONE 
J100063A05GGGGCCCACCTNONE 
J100063I24GGGGCCCACCTNONE 
J100067I12GGGGCCCACCTNONE 
J100074A22GGGGCCCACCTNONE 
J100078B22GGGGCCCACCTNONE 
J100079B03GGGGCCCACCTNONE 
Os02g0802400J065054M13AGGTGGGCCTGGNONE 
J065061I04AGGTGGGCCTGGNONE 
J065112M15AGGTGGGCCTGGEF-Hand type domain containing protein. 
J100050L24AGGTGGGCCTGGNONE 
J100059D20AGGTGGGCCTGGNONE 
Os02g0803600AK064750ACAGGTGGGCCCCLongin-like domain containing protein. 
Os02g0805200AK071591CAGGTGGGCCCGProliferating cell nuclear antigen (PCNA) (Cyclin). 
J023105C08CAGGTGGGCCCGNONE 
J033030H07CAGGTGGGCCCGNONE 
J033050M24CAGGTGGGCCCGNONE 
J033069B10CAGGTGGGCCCGNONE 
J033121A16CAGGTGGGCCCGNONE 
J053023M14CAGGTGGGCCCGNONE 
J053033A15CAGGTGGGCCCGNONE 
J053054H14CAGGTGGGCCCGNONE 
J053055H24CAGGTGGGCCCGNONE 
J053082B18CAGGTGGGCCCGNONE 
J065001N03CAGGTGGGCCCGNONE 
J065011O16CAGGTGGGCCCGNONE 
J065026K24CAGGTGGGCCCGNONE 
J065056C09CAGGTGGGCCCGNONE 
J065067H11CAGGTGGGCCCGNONE 
J065097E19CAGGTGGGCCCGNONE 
J065118O11CAGGTGGGCCCGNONE 
J065124N09CAGGTGGGCCCGNONE 
J065143A02CAGGTGGGCCCGNONE 
J065213P06CAGGTGGGCCCGNONE 
J065215E24CAGGTGGGCCCGNONE 
J075051B11CAGGTGGGCCCGNONE 
J075065K05CAGGTGGGCCCGNONE 
J080306E10CAGGTGGGCCCGNONE 
J090042I16CAGGTGGGCCCGNONE 
J090066J24CAGGTGGGCCCGNONE 
J090092K17CAGGTGGGCCCGNONE 
J100029A17CAGGTGGGCCCGNONE 
J100052N08CAGGTGGGCCCGNONE 
J100071I23CAGGTGGGCCCGNONE 
Os02g0805900AK073740AGCCCACGGCCCACCTDcp2, box A domain containing protein. 
J013068E03AGCCCACGGCCCACCTNONE 
J033066K03AGCCCACGGCCCACCTNONE 
J033092C14AGCCCACGGCCCACCTNONE 
J065020G11AGCCCACGGCCCACCTNONE 
J065098E16AGCCCACGGCCCACCTNONE 
J065124L06AGCCCACGGCCCACCTNONE 
J065134M23AGCCCACGGCCCACCTNONE 
J065187M23AGCCCACGGCCCACCTNONE 
J065208G07AGCCCACGGCCCACCTNONE 
J075002G10AGCCCACGGCCCACCTNONE 
J075004L01AGCCCACGGCCCACCTNONE 
J075051K23AGCCCACGGCCCACCTNONE 
J090063C03AGCCCACGGCCCACCTNONE 
J090071J21AGCCCACGGCCCACCTNONE 
J100078K12AGCCCACGGCCCACCTNONE 
Os02g0806000AK072745AGGTGGGCCGTGGGCTGCN5-related N-acetyltransferase domain containing protein. 
J013130C06AGGTGGGCCGTGGGCTNONE 
J013154L12AGGTGGGCCGTGGGCTNONE 
J023135J07AGGTGGGCCGTGGGCTNONE 
J065038E23AGGTGGGCCGTGGGCTNONE 
J065042C10AGGTGGGCCGTGGGCTNONE 
J090075B11AGGTGGGCCGTGGGCTNONE 
J100033J17AGGTGGGCCGTGGGCTNONE 
Os02g0815500AK099733GCCCACCTAlcohol dehydrogenase class III (EC 1.1.1.1) (Glutathione-dependent formaldehyde dehydrogenase) (EC 1.2.1.1) (FDH) (FALDH) (GSH-FDH). 
J013089P19GCCCACCTNONE 
J043022H19GCCCACCTNONE 
J065008L14GCCCACCTNONE 
J065016G09GCCCACCTNONE 
J065023C22GCCCACCTNONE 
J065024K13GCCCACCTNONE 
J065043D14GCCCACCTNONE 
J065052K16GCCCACCTNONE 
J065058D17GCCCACCTNONE 
J065087L03GCCCACCTNONE 
J065107H15GCCCACCTNONE 
J065110E12GCCCACCTNONE 
J065124P14GCCCACCTNONE 
J065131B20GCCCACCTNONE 
J065155I10GCCCACCTNONE 
J065172J02GCCCACCTNONE 
J065184D04GCCCACCTNONE 
J065189D21GCCCACCTNONE 
J065201O14GCCCACCTNONE 
J065203D20GCCCACCTNONE 
J065206M13GCCCACCTNONE 
J065211E14GCCCACCTNONE 
J065217J21GCCCACCTNONE 
J090004A20GCCCACCTNONE 
Os02g0816600AK071389AGCCCACCTNONE 
Os02g0817500AK072707ATGGCCCACCTGTCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK072707GACAGGTGGGCCCCKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135ATGGCCCACCTGTCNONE 
AK104135GACAGGTGGGCCCCNONE 
U46758ATGGCCCACCTGTCNONE 
U46758GACAGGTGGGCCCCNONE 
Os02g0820400AK060511GCCCACCTNONE 
AK100771GCCCACCTTransferase family protein. 
J023120A02GCCCACCTNONE 
Os02g0823000AK122065GCCCACCTPeptidase A22B, minor histocompatibility antigen H13 family protein. 
Os02g0824700009-023-E06CCCAGCCCAGCCCACCTSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18CCCAGCCCAGCCCACCTNONE 
J065017H21CCCAGCCCAGCCCACCTNONE 
J065052N02CCCAGCCCAGCCCACCTNONE 
J065053M01CCCAGCCCAGCCCACCTNONE 
J065064B14CCCAGCCCAGCCCACCTNONE 
J065146K22CCCAGCCCAGCCCACCTNONE 
Os02g0827600AK068455TCCGACGGCCCACCTGConserved hypothetical protein. 
Os02g0829900009-044-G07AGGTGGGCGTGGGCCTGNONE 
AK120917AGGTGGGCGTGGGCCTGSimilar to BRICK1. 
AY224582AGGTGGGCGTGGGCCTGNONE 
J023034L01AGGTGGGCGTGGGCCTGNONE 
J023034M01AGGTGGGCGTGGGCCTGNONE 
J090010G06AGGTGGGCGTGGGCCTGNONE 
J090020D07AGGTGGGCGTGGGCCTGNONE 
J100041L04AGGTGGGCGTGGGCCTGNONE 
J100061D05AGGTGGGCGTGGGCCTGNONE 
J100070L18AGGTGGGCGTGGGCCTGNONE 
Os03g0114100AK108265GCCCACCTGConserved hypothetical protein. 
Os03g0125000006-032-D09AAAGCCCACCTGNONE 
006-033-B05AAAGCCCACCTGNONE 
006-048-G06AAAGCCCACCTGNONE 
006-048-G09AAAGCCCACCTGNONE 
006-052-D09AAAGCCCACCTGNONE 
006-072-A04AAAGCCCACCTGNONE 
006-076-F12AAAGCCCACCTGNONE 
006-080-B03AAAGCCCACCTGNONE 
006-092-H03AAAGCCCACCTGNONE 
006-103-G04AAAGCCCACCTGNONE 
009-079-E01AAAGCCCACCTGNONE 
009-150-F03AAAGCCCACCTGNONE 
AF095708AAAGCCCACCTGNONE 
AK059557AAAGCCCACCTGNONE 
AK070779AAAGCCCACCTGSimilar to 50S ribosomal protein L5, chloroplast. 
AK098999AAAGCCCACCTGNONE 
AK104137AAAGCCCACCTGNONE 
J065002D07AAAGCCCACCTGNONE 
J065167E24AAAGCCCACCTGNONE 
J075199O14AAAGCCCACCTGNONE 
J100083L01AAAGCCCACCTGNONE 
Os03g0146500006-036-F10AAGGCCCACCTNONE 
006-036-F10TTGGCCCACCTGNONE 
006-082-C03AAGGCCCACCTNONE 
006-082-C03TTGGCCCACCTGNONE 
006-098-E04AAGGCCCACCTNONE 
006-098-E04TTGGCCCACCTGNONE 
006-110-C03AAGGCCCACCTNONE 
006-110-C03TTGGCCCACCTGNONE 
009-057-C11AAGGCCCACCTNONE 
009-057-C11TTGGCCCACCTGNONE 
009-182-D02AAGGCCCACCTNONE 
009-182-D02TTGGCCCACCTGNONE 
AK059776AAGGCCCACCTGalactose-binding like domain containing protein. 
AK059776TTGGCCCACCTGGalactose-binding like domain containing protein. 
AK071628AAGGCCCACCTNONE 
AK071628TTGGCCCACCTGNONE 
AK104105AAGGCCCACCTNONE 
AK104105TTGGCCCACCTGNONE 
AK104220AAGGCCCACCTNONE 
AK104220TTGGCCCACCTGNONE 
J065168B02AAGGCCCACCTNONE 
J065168B02TTGGCCCACCTGNONE 
Os03g0154300J065112A07AGGTGGGCCCCACGAAConserved hypothetical protein. 
J065192P15AGGTGGGCCCCACGAANONE 
Os03g0161000AK121425CACTGACAGGTGGGCCGGGGACGGCTNONE 
J023135K12CACTGACAGGTGGGCCGGGGACGGCTNONE 
Os03g0186800AK100356AAAGCCCACCTModifier of rudimentary, Modr family protein. 
Os03g0201600AK067825GGTGGGGCCCACCTGTCNONE 
Os03g0232600AK068218TATGGGCCCACCTU box domain containing protein. 
J013114N10TATGGGCCCACCTNONE 
J013146E12TATGGGCCCACCTNONE 
J023034C23TATGGGCCCACCTNONE 
J033030J03TATGGGCCCACCTNONE 
J033050L03TATGGGCCCACCTNONE 
J033122E16TATGGGCCCACCTNONE 
J090018C20TATGGGCCCACCTNONE 
J090053P15TATGGGCCCACCTNONE 
J090096C17TATGGGCCCACCTNONE 
Os03g0244700011-100-F11CCCACGGGCCCACCTNONE 
015-065-B06CCCACGGGCCCACCTNONE 
AK100399CCCACGGGCCCACCTNONE 
AK100620CCCACGGGCCCACCTArmadillo-like helical domain containing protein. 
J023086N09CCCACGGGCCCACCTNONE 
J100032P14CCCACGGGCCCACCTNONE 
Os03g0255200AK058212AGGGCCCACCTGNONE 
AK071625AGGGCCCACCTGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0275700AK111329GGCCCACCTGTCAGTGConserved hypothetical protein. 
Os03g0294200AK069285GCTGGGCCCACCTSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0302900011-005-H01GGGGCCCACCTNONE 
AK069222GGGGCCCACCTConserved hypothetical protein. 
J023014L15GGGGCCCACCTNONE 
J033023G12GGGGCCCACCTNONE 
J090008H16GGGGCCCACCTNONE 
Os03g0305400009-198-D04GGTGGGGCCCACCTGTCNONE 
013-012-C06GGTGGGGCCCACCTGTCNONE 
014-034-D01GGTGGGGCCCACCTGTCNONE 
AK071397GGTGGGGCCCACCTGTCUniversal stress protein (Usp) family protein. 
J023012O22GGTGGGGCCCACCTGTCNONE 
J023097A13GGTGGGGCCCACCTGTCNONE 
J023107P16GGTGGGGCCCACCTGTCNONE 
J023113C14GGTGGGGCCCACCTGTCNONE 
Os03g0342900006-032-D01AGGTGGGCCACCCCACGTGNONE 
006-032-D01CTGGCCCACCTCGCCCCACGNONE 
006-033-E10AGGTGGGCCACCCCACGTGNONE 
006-033-E10CTGGCCCACCTCGCCCCACGNONE 
006-051-G06AGGTGGGCCACCCCACGTGNONE 
006-051-G06CTGGCCCACCTCGCCCCACGNONE 
006-053-E05AGGTGGGCCACCCCACGTGNONE 
006-053-E05CTGGCCCACCTCGCCCCACGNONE 
006-056-B05AGGTGGGCCACCCCACGTGNONE 
006-056-B05CTGGCCCACCTCGCCCCACGNONE 
006-058-F04AGGTGGGCCACCCCACGTGNONE 
006-058-F04CTGGCCCACCTCGCCCCACGNONE 
006-059-E05AGGTGGGCCACCCCACGTGNONE 
006-059-E05CTGGCCCACCTCGCCCCACGNONE 
006-060-F10AGGTGGGCCACCCCACGTGNONE 
006-060-F10CTGGCCCACCTCGCCCCACGNONE 
006-104-D12AGGTGGGCCACCCCACGTGNONE 
006-104-D12CTGGCCCACCTCGCCCCACGNONE 
009-129-C12AGGTGGGCCACCCCACGTGNONE 
009-129-C12CTGGCCCACCTCGCCCCACGNONE 
AK060136AGGTGGGCCACCCCACGTGNONE 
AK060136CTGGCCCACCTCGCCCCACGNONE 
AK060980AGGTGGGCCACCCCACGTGNONE 
AK060980CTGGCCCACCTCGCCCCACGNONE 
AK064815AGGTGGGCCACCCCACGTGDormancyauxin associated family protein. 
AK064815CTGGCCCACCTCGCCCCACGDormancyauxin associated family protein. 
AK104244AGGTGGGCCACCCCACGTGNONE 
AK104244CTGGCCCACCTCGCCCCACGNONE 
AK104391AGGTGGGCCACCCCACGTGNONE 
AK104391CTGGCCCACCTCGCCCCACGNONE 
AK104590AGGTGGGCCACCCCACGTGNONE 
AK104590CTGGCCCACCTCGCCCCACGNONE 
AK104744AGGTGGGCCACCCCACGTGNONE 
AK104744CTGGCCCACCTCGCCCCACGNONE 
AK106100AGGTGGGCCACCCCACGTGNONE 
AK106100CTGGCCCACCTCGCCCCACGNONE 
J013000E10AGGTGGGCCACCCCACGTGNONE 
J013000E10CTGGCCCACCTCGCCCCACGNONE 
J075027O22AGGTGGGCCACCCCACGTGNONE 
J075027O22CTGGCCCACCTCGCCCCACGNONE 
J075052J03AGGTGGGCCACCCCACGTGNONE 
J075052J03CTGGCCCACCTCGCCCCACGNONE 
J075066E15AGGTGGGCCACCCCACGTGNONE 
J075066E15CTGGCCCACCTCGCCCCACGNONE 
J075095C17AGGTGGGCCACCCCACGTGNONE 
J075095C17CTGGCCCACCTCGCCCCACGNONE 
J075118N05AGGTGGGCCACCCCACGTGNONE 
J075118N05CTGGCCCACCTCGCCCCACGNONE 
J075187K22AGGTGGGCCACCCCACGTGNONE 
J075187K22CTGGCCCACCTCGCCCCACGNONE 
J090026L04AGGTGGGCCACCCCACGTGNONE 
J090026L04CTGGCCCACCTCGCCCCACGNONE 
J090059G16AGGTGGGCCACCCCACGTGNONE 
J090059G16CTGGCCCACCTCGCCCCACGNONE 
J100055P20AGGTGGGCCACCCCACGTGNONE 
J100055P20CTGGCCCACCTCGCCCCACGNONE 
J100062A10AGGTGGGCCACCCCACGTGNONE 
J100062A10CTGGCCCACCTCGCCCCACGNONE 
J100068G20AGGTGGGCCACCCCACGTGNONE 
J100068G20CTGGCCCACCTCGCCCCACGNONE 
Os03g0374400016-027-B12GCGTCGCGCCCACCTNONE 
016-027-B12GGTGGGCCCACCTNONE 
AK069719GCGTCGCGCCCACCTConserved hypothetical protein. 
AK069719GGTGGGCCCACCTConserved hypothetical protein. 
J023020L05GCGTCGCGCCCACCTNONE 
J023020L05GGTGGGCCCACCTNONE 
J023026H16GCGTCGCGCCCACCTNONE 
J023026H16GGTGGGCCCACCTNONE 
J033025P22GCGTCGCGCCCACCTNONE 
J033025P22GGTGGGCCCACCTNONE 
J075016I21GCGTCGCGCCCACCTNONE 
J075016I21GGTGGGCCCACCTNONE 
J090015G21GCGTCGCGCCCACCTNONE 
J090015G21GGTGGGCCCACCTNONE 
Os03g0374500Os03g0374500GCGTCGCGCCCACCTHypothetical protein. 
Os03g0374500GGTGGGCCCACCTHypothetical protein. 
Os03g0379300006-039-F11GACAGGTGGGCCCGTTNONE 
AK061515GACAGGTGGGCCCGTTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704GACAGGTGGGCCCGTTNONE 
J013159M16GACAGGTGGGCCCGTTNONE 
J090067F01GACAGGTGGGCCCGTTNONE 
J090083F21GACAGGTGGGCCCGTTNONE 
J100040M08GACAGGTGGGCCCGTTNONE 
J100048C03GACAGGTGGGCCCGTTNONE 
J100056M07GACAGGTGGGCCCGTTNONE 
J100062N22GACAGGTGGGCCCGTTNONE 
J100086L07GACAGGTGGGCCCGTTNONE 
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like. 
J065009K18TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
J065165P09TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
Os03g0389700AK061085AGGTGGGCNONE 
Os03g0416300AK103650GCCCACCTSimilar to Phytochelatin synthetase (Fragment). 
Os03g0586300AK100442CAGGTGGGCCCCReticulon family protein. 
J023031G06CAGGTGGGCCCCNONE 
J023089N19CAGGTGGGCCCCNONE 
J023099N13CAGGTGGGCCCCNONE 
J065026N17CAGGTGGGCCCCNONE 
J065045N16CAGGTGGGCCCCNONE 
J065163L12CAGGTGGGCCCCNONE 
Os03g0668900AK108369GCCCACCTConserved hypothetical protein. 
Os03g0669200J013037D23CAGGTGGGCCCCACANONE 
J023026K09CAGGTGGGCCCCACANONE 
J075008E21CAGGTGGGCCCCACANONE 
J075061B21CAGGTGGGCCCCACANONE 
J075151B13CAGGTGGGCCCCACANONE 
J075195L02CAGGTGGGCCCCACANONE 
J090061B07CAGGTGGGCCCCACANONE 
Os03g0703300016-074-H01GCAGCCCACCTGNONE 
AK073831GCAGCCCACCTGCalponin-like actin-binding domain containing protein. 
Os03g0713100J013039M09CCCACTCCCTGGGGCCCACCTGNONE 
J023007K01CCCACTCCCTGGGGCCCACCTGNONE 
J023073H01CCCACTCCCTGGGGCCCACCTGNONE 
J023087M20CCCACTCCCTGGGGCCCACCTGNONE 
J023142E01CCCACTCCCTGGGGCCCACCTGNONE 
J033048E03CCCACTCCCTGGGGCCCACCTGNONE 
J033048F03CCCACTCCCTGGGGCCCACCTGSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11CCCACTCCCTGGGGCCCACCTGNONE 
J033074M20CCCACTCCCTGGGGCCCACCTGNONE 
J033084M11CCCACTCCCTGGGGCCCACCTGNONE 
J033091I23CCCACTCCCTGGGGCCCACCTGNONE 
J033100C08CCCACTCCCTGGGGCCCACCTGNONE 
J033123K19CCCACTCCCTGGGGCCCACCTGNONE 
J090006P21CCCACTCCCTGGGGCCCACCTGNONE 
J090045O16CCCACTCCCTGGGGCCCACCTGNONE 
J100087M13CCCACTCCCTGGGGCCCACCTGNONE 
Os03g0716200Os03g0716200GCCCACCTConserved hypothetical protein. 
Os03g0749900006-112-A05CTCGGCCCACCTAGGCCCATTTNONE 
AK061252CTCGGCCCACCTAGGCCCATTTConserved hypothetical protein. 
J023020I01CTCGGCCCACCTAGGCCCATTTNONE 
J033060N21CTCGGCCCACCTAGGCCCATTTNONE 
Os03g0780600AK120180CAGGTGGGCCCCNONE 
D13224CAGGTGGGCCCCTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18CAGGTGGGCCCCNONE 
J033022G05CAGGTGGGCCCCNONE 
J033028A16CAGGTGGGCCCCNONE 
J033050M08CAGGTGGGCCCCNONE 
J090053F04CAGGTGGGCCCCNONE 
J090064E19CAGGTGGGCCCCNONE 
J090083J24CAGGTGGGCCCCNONE 
J100024I23CAGGTGGGCCCCNONE 
Os03g0786000AK061286CCAAGCCCACCTConserved hypothetical protein. 
AK073187CCAAGCCCACCTNONE 
Os03g0788800AK071670CAGGTGGGCCCCZinc finger, RING-type domain containing protein. 
J013090J22CAGGTGGGCCCCNONE 
J023050M06CAGGTGGGCCCCNONE 
J023073A12CAGGTGGGCCCCNONE 
J023075P21CAGGTGGGCCCCNONE 
J023106F04CAGGTGGGCCCCNONE 
J075181H19CAGGTGGGCCCCNONE 
J090009C24CAGGTGGGCCCCNONE 
J100027L24CAGGTGGGCCCCNONE 
J100055F06CAGGTGGGCCCCNONE 
J100081C22CAGGTGGGCCCCNONE 
J100084I21CAGGTGGGCCCCNONE 
Os03g0791800013-037-A12CAGGTGGGCCATNONE 
013-037-A12GACAGGTGGGCCCATGGNONE 
AB079798CAGGTGGGCCATNONE 
AB079798GACAGGTGGGCCCATGGNONE 
AK067703CAGGTGGGCCATRad6 (Ubiquitin carrier protein). 
AK067703GACAGGTGGGCCCATGGRad6 (Ubiquitin carrier protein). 
AK120251CAGGTGGGCCATNONE 
AK120251GACAGGTGGGCCCATGGNONE 
J013045G10CAGGTGGGCCATNONE 
J013045G10GACAGGTGGGCCCATGGNONE 
J023102B18CAGGTGGGCCATNONE 
J023102B18GACAGGTGGGCCCATGGNONE 
J065020J23CAGGTGGGCCATNONE 
J065020J23GACAGGTGGGCCCATGGNONE 
J065127I21CAGGTGGGCCATNONE 
J065127I21GACAGGTGGGCCCATGGNONE 
J065151E11CAGGTGGGCCATNONE 
J065151E11GACAGGTGGGCCCATGGNONE 
J075076B05CAGGTGGGCCATNONE 
J075076B05GACAGGTGGGCCCATGGNONE 
J075116C15CAGGTGGGCCATNONE 
J075116C15GACAGGTGGGCCCATGGNONE 
J075136A07CAGGTGGGCCATNONE 
J075136A07GACAGGTGGGCCCATGGNONE 
J100029G21CAGGTGGGCCATNONE 
J100029G21GACAGGTGGGCCCATGGNONE 
J100030K01CAGGTGGGCCATNONE 
J100030K01GACAGGTGGGCCCATGGNONE 
J100041J02CAGGTGGGCCATNONE 
J100041J02GACAGGTGGGCCCATGGNONE 
J100049C22CAGGTGGGCCATNONE 
J100049C22GACAGGTGGGCCCATGGNONE 
J100057G17CAGGTGGGCCATNONE 
J100057G17GACAGGTGGGCCCATGGNONE 
J100086L12CAGGTGGGCCATNONE 
J100086L12GACAGGTGGGCCCATGGNONE 
Os03g0801900015-081-G06GACAGGTGGGCTCTCCCCCANONE 
AK106415GACAGGTGGGCTCTCCCCCAProtein of unknown function DUF569 family protein. 
J090099L17GACAGGTGGGCTCTCCCCCANONE 
J100024B03GACAGGTGGGCTCTCCCCCANONE 
J100088I08GACAGGTGGGCTCTCCCCCANONE 
Os03g0808100AK069196CAGGTGGGCCCCACCSimilar to Cellulose synthase-5. 
J013059D03CAGGTGGGCCCCACCNONE 
J013099J05CAGGTGGGCCCCACCNONE 
J013106M06CAGGTGGGCCCCACCNONE 
J013151H03CAGGTGGGCCCCACCNONE 
J023003G18CAGGTGGGCCCCACCNONE 
J023038M11CAGGTGGGCCCCACCNONE 
J023056M17CAGGTGGGCCCCACCNONE 
J023105F22CAGGTGGGCCCCACCNONE 
J033023F17CAGGTGGGCCCCACCNONE 
J033028J21CAGGTGGGCCCCACCNONE 
J033131J19CAGGTGGGCCCCACCNONE 
J033132E06CAGGTGGGCCCCACCNONE 
J090007L14CAGGTGGGCCCCACCNONE 
J090011H02CAGGTGGGCCCCACCNONE 
J090026D20CAGGTGGGCCCCACCNONE 
J090029H09CAGGTGGGCCCCACCNONE 
J090033B18CAGGTGGGCCCCACCNONE 
J090039J02CAGGTGGGCCCCACCNONE 
J090050D17CAGGTGGGCCCCACCNONE 
J090050I15CAGGTGGGCCCCACCNONE 
J090063G20CAGGTGGGCCCCACCNONE 
J090064J21CAGGTGGGCCCCACCNONE 
J090071E19CAGGTGGGCCCCACCNONE 
J090075F10CAGGTGGGCCCCACCNONE 
Os03g0811200AK069532TGGGGCCCACCTGTCAGBRCT domain containing protein. 
Os03g0822700005-010-E01AGGTGGGCCCAATNONE 
006-088-H12AGGTGGGCCCAATNONE 
AK061682AGGTGGGCCCAATNONE 
AK101448AGGTGGGCCCAATArmadillo-like helical domain containing protein. 
J023091N05AGGTGGGCCCAATNONE 
Os03g0841100AK120279AGCCCACCTEGF domain containing protein. 
AK120279TATTGGGCCGTGTCGGCCCACCTEGF domain containing protein. 
Os03g0850100AK101126ACGTGGGGCCCACCTGNLI interacting factor domain containing protein. 
Os03g0854000009-186-C03GCGGGCCCACCTNONE 
AK061374GCGGGCCCACCTProtein of unknown function UPF0131 family protein. 
J065138B11GCGGGCCCACCTNONE 
Os03g0859500AK070637AGGTGGGCCCTABC transporter related domain containing protein. 
J023056J01AGGTGGGCCCTNONE 
J043003A05AGGTGGGCCCTNONE 
J065021L12AGGTGGGCCCTNONE 
J065022K11AGGTGGGCCCTNONE 
J065215B13AGGTGGGCCCTNONE 
J075025N20AGGTGGGCCCTNONE 
J075090B03AGGTGGGCCCTNONE 
J075090B04AGGTGGGCCCTNONE 
J075118C07AGGTGGGCCCTNONE 
J090026E21AGGTGGGCCCTNONE 
J090085D18AGGTGGGCCCTNONE 
J100028H06AGGTGGGCCCTNONE 
J100051L23AGGTGGGCCCTNONE 
J100052G02AGGTGGGCCCTNONE 
J100061O13AGGTGGGCCCTNONE 
Os03g0861700AK066129CAAGTGGGCCGGCCCACCTRhodanese-like domain containing protein. 
J013051M12CAAGTGGGCCGGCCCACCTNONE 
J013104N13CAAGTGGGCCGGCCCACCTNONE 
J065052E12CAAGTGGGCCGGCCCACCTNONE 
Os03g0861800AF358762AGGTGGGCCGGCCCACTTGNONE 
AK068434AGGTGGGCCGGCCCACTTGCyclin-like F-box domain containing protein. 
AK109388AGGTGGGCCGGCCCACTTGNONE 
J013154L15AGGTGGGCCGGCCCACTTGNONE 
J013170I23AGGTGGGCCGGCCCACTTGNONE 
J023031D05AGGTGGGCCGGCCCACTTGNONE 
J023082E07AGGTGGGCCGGCCCACTTGNONE 
J023095M10AGGTGGGCCGGCCCACTTGNONE 
J023127D14AGGTGGGCCGGCCCACTTGNONE 
J023138M15AGGTGGGCCGGCCCACTTGNONE 
J023138M16AGGTGGGCCGGCCCACTTGNONE 
J033060B18AGGTGGGCCGGCCCACTTGNONE 
J033060F13AGGTGGGCCGGCCCACTTGNONE 
J033096J11AGGTGGGCCGGCCCACTTGNONE 
J033122C07AGGTGGGCCGGCCCACTTGNONE 
J053029A10AGGTGGGCCGGCCCACTTGNONE 
J053062O16AGGTGGGCCGGCCCACTTGNONE 
J053064J08AGGTGGGCCGGCCCACTTGNONE 
J053086F22AGGTGGGCCGGCCCACTTGNONE 
J065036C04AGGTGGGCCGGCCCACTTGNONE 
J065072J23AGGTGGGCCGGCCCACTTGNONE 
J065120D04AGGTGGGCCGGCCCACTTGNONE 
J065161D04AGGTGGGCCGGCCCACTTGNONE 
J065172H02AGGTGGGCCGGCCCACTTGNONE 
J065207B01AGGTGGGCCGGCCCACTTGNONE 
J075019H18AGGTGGGCCGGCCCACTTGNONE 
J075082E16AGGTGGGCCGGCCCACTTGNONE 
J075089A10AGGTGGGCCGGCCCACTTGNONE 
J075099G02AGGTGGGCCGGCCCACTTGNONE 
J075134M04AGGTGGGCCGGCCCACTTGNONE 
J075144K19AGGTGGGCCGGCCCACTTGNONE 
J075147F17AGGTGGGCCGGCCCACTTGNONE 
J090004O14AGGTGGGCCGGCCCACTTGNONE 
J090013A07AGGTGGGCCGGCCCACTTGNONE 
J090047K14AGGTGGGCCGGCCCACTTGNONE 
Os04g0367400006-079-G12AGGGCCCACCTGTCAGNONE 
AK061121AGGGCCCACCTGTCAGReticulon family protein. 
AK100139AGGGCCCACCTGTCAGNONE 
J065009F13AGGGCCCACCTGTCAGNONE 
J065032N11AGGGCCCACCTGTCAGNONE 
J065039P10AGGGCCCACCTGTCAGNONE 
J065124I05AGGGCCCACCTGTCAGNONE 
J065197E16AGGGCCCACCTGTCAGNONE 
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
Os04g0394200AK068154CACTGACAGGTGGGCCCACCASimilar to 2-oxoglutarate dehydrogenase E2 subunit. 
AK104832CACTGACAGGTGGGCCCACCANONE 
AK121002CACTGACAGGTGGGCCCACCANONE 
J033092H19CACTGACAGGTGGGCCCACCANONE 
Os04g0440000AK073064AGGTGGGCTGTNONE 
AK101691AGGTGGGCTGTConserved hypothetical protein. 
AK102407AGGTGGGCTGTNONE 
Os04g0456700009-080-F10CAGGTGGGCCCCACCCGNONE 
009-143-C10CAGGTGGGCCCCACCCGNONE 
AK065178CAGGTGGGCCCCACCCGSimilar to TMV induced protein 1-2. 
J013002D12CAGGTGGGCCCCACCCGNONE 
J065027N14CAGGTGGGCCCCACCCGNONE 
J065139E16CAGGTGGGCCCCACCCGNONE 
J065165D09CAGGTGGGCCCCACCCGNONE 
J065179D14CAGGTGGGCCCCACCCGNONE 
J065198C03CAGGTGGGCCCCACCCGNONE 
J065198L22CAGGTGGGCCCCACCCGNONE 
J075139M08CAGGTGGGCCCCACCCGNONE 
J075150D14CAGGTGGGCCCCACCCGNONE 
J075172F01CAGGTGGGCCCCACCCGNONE 
J075197F03CAGGTGGGCCCCACCCGNONE 
J090059E16CAGGTGGGCCCCACCCGNONE 
J100063J01CAGGTGGGCCCCACCCGNONE 
J100085F13CAGGTGGGCCCCACCCGNONE 
J100088O10CAGGTGGGCCCCACCCGNONE 
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment). 
Os04g0479800AK121430AGGTGGGCCyclin-like F-box domain containing protein. 
J033099N03AGGTGGGCNONE 
J090035E10AGGTGGGCNONE 
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein. 
J065141K24CCACTGACAGGTGGGCCCGCNONE 
J065144O22CCACTGACAGGTGGGCCCGCNONE 
J065162F11CCACTGACAGGTGGGCCCGCNONE 
Os04g0486500AK111976TCCGGCCCACCTSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
J023097O18CAGGTGGGCCCGGCCCATANONE 
J065100E16CAGGTGGGCCCGGCCCATANONE 
J075022C23CAGGTGGGCCCGGCCCATANONE 
J075023L18CAGGTGGGCCCGGCCCATANONE 
J075040N10CAGGTGGGCCCGGCCCATANONE 
J075061L14CAGGTGGGCCCGGCCCATANONE 
J075069B15CAGGTGGGCCCGGCCCATANONE 
J075106C16CAGGTGGGCCCGGCCCATANONE 
J075138P13CAGGTGGGCCCGGCCCATANONE 
J075139H18CAGGTGGGCCCGGCCCATANONE 
J075139L06CAGGTGGGCCCGGCCCATANONE 
J075149B07CAGGTGGGCCCGGCCCATANONE 
J075177N21CAGGTGGGCCCGGCCCATANONE 
Os04g0599400AK101885AGCCCACCTScramblase family protein. 
Os04g0608300AK111353AGGTGGGCCCCACACGalactokinase family protein. 
Os04g0612600AB042115AAGGCCCAAACAATGGGCCCACCTNONE 
AB042115TCCGACGGGCCCACCTNONE 
AK060707AAGGCCCAAACAATGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK060707TCCGACGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK099008AAGGCCCAAACAATGGGCCCACCTNONE 
AK099008TCCGACGGGCCCACCTNONE 
AK104427AAGGCCCAAACAATGGGCCCACCTNONE 
AK104427TCCGACGGGCCCACCTNONE 
J023043H02AAGGCCCAAACAATGGGCCCACCTNONE 
J023043H02TCCGACGGGCCCACCTNONE 
J033033I23AAGGCCCAAACAATGGGCCCACCTNONE 
J033033I23TCCGACGGGCCCACCTNONE 
J033067P21AAGGCCCAAACAATGGGCCCACCTNONE 
J033067P21TCCGACGGGCCCACCTNONE 
J033088M21AAGGCCCAAACAATGGGCCCACCTNONE 
J033088M21TCCGACGGGCCCACCTNONE 
J033133M08AAGGCCCAAACAATGGGCCCACCTNONE 
J033133M08TCCGACGGGCCCACCTNONE 
J043030I16AAGGCCCAAACAATGGGCCCACCTNONE 
J043030I16TCCGACGGGCCCACCTNONE 
J075049H08AAGGCCCAAACAATGGGCCCACCTNONE 
J075049H08TCCGACGGGCCCACCTNONE 
Os04g0647800AK065350TCCACGCCCACCTSimilar to Glycerol kinase 2 (EC 2.7.1.30). 
AK069876TCCACGCCCACCTNONE 
AK104069TCCACGCCCACCTNONE 
Os04g0652900AK071125AGCCGTTGGGCCCACCTGTCAGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03AGCCGTTGGGCCCACCTGTCAGNONE 
J075142E01AGCCGTTGGGCCCACCTGTCAGNONE 
Os04g0679800AK060662GACAGGTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK099987GACAGGTGGGCCCCACCNONE 
J013130B11GACAGGTGGGCCCCACCNONE 
J065049C17GACAGGTGGGCCCCACCNONE 
J075191N12GACAGGTGGGCCCCACCNONE 
J075191P12GACAGGTGGGCCCCACCNONE 
J100031C07GACAGGTGGGCCCCACCNONE 
Os04g0685800AK070891CGGGCCCACCTGTCAGSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345CGGGCCCACCTGTCAGNONE 
J023069G19CGGGCCCACCTGTCAGNONE 
J023097E09CGGGCCCACCTGTCAGNONE 
J065071A01CGGGCCCACCTGTCAGNONE 
J065186F08CGGGCCCACCTGTCAGNONE 
J075044B21CGGGCCCACCTGTCAGNONE 
J075120N18CGGGCCCACCTGTCAGNONE 
J075131B22CGGGCCCACCTGTCAGNONE 
J100041H18CGGGCCCACCTGTCAGNONE 
J100042P13CGGGCCCACCTGTCAGNONE 
Os05g0101600AK101021AGGTGGGCTTTTCytochrome P450 family protein. 
Os05g0102900006-056-A01AGGTGGGCTGGGNONE 
AK061764AGGTGGGCTGGGNONE 
AK065749AGGTGGGCTGGGSnf7 family protein. 
AK104101AGGTGGGCTGGGNONE 
J013042C01AGGTGGGCTGGGNONE 
J033038P15AGGTGGGCTGGGNONE 
J065032F16AGGTGGGCTGGGNONE 
J065039I22AGGTGGGCTGGGNONE 
J065150F19AGGTGGGCTGGGNONE 
J075079I21AGGTGGGCTGGGNONE 
J075082F14AGGTGGGCTGGGNONE 
J075098G16AGGTGGGCTGGGNONE 
J075167I08AGGTGGGCTGGGNONE 
Os05g0110100009-015-D08AGGTGGGCTTGGNONE 
009-023-C09AGGTGGGCTTGGNONE 
009-031-B11AGGTGGGCTTGGNONE 
009-034-C02AGGTGGGCTTGGNONE 
009-050-B08AGGTGGGCTTGGNONE 
009-065-D12AGGTGGGCTTGGNONE 
009-090-G08AGGTGGGCTTGGNONE 
009-111-H07AGGTGGGCTTGGNONE 
009-136-F12AGGTGGGCTTGGNONE 
009-138-E06AGGTGGGCTTGGNONE 
009-138-G12AGGTGGGCTTGGNONE 
009-141-D08AGGTGGGCTTGGNONE 
009-143-D01AGGTGGGCTTGGNONE 
009-179-D09AGGTGGGCTTGGNONE 
009-179-E03AGGTGGGCTTGGNONE 
009-196-A09AGGTGGGCTTGGNONE 
009-199-F04AGGTGGGCTTGGNONE 
013-021-E05AGGTGGGCTTGGNONE 
013-076-C04AGGTGGGCTTGGNONE 
013-096-F06AGGTGGGCTTGGNONE 
014-071-A05AGGTGGGCTTGGNONE 
014-077-F09AGGTGGGCTTGGNONE 
AK099779AGGTGGGCTTGGNONE 
AK121142AGGTGGGCTTGGConserved hypothetical protein. 
J013095A16AGGTGGGCTTGGNONE 
J013111A17AGGTGGGCTTGGNONE 
J013132G04AGGTGGGCTTGGNONE 
J023077M04AGGTGGGCTTGGNONE 
J065001B11AGGTGGGCTTGGNONE 
J065001E11AGGTGGGCTTGGNONE 
J065057G10AGGTGGGCTTGGNONE 
J065057L08AGGTGGGCTTGGNONE 
J065080E07AGGTGGGCTTGGNONE 
J065087K10AGGTGGGCTTGGNONE 
J065091M15AGGTGGGCTTGGNONE 
J065167A15AGGTGGGCTTGGNONE 
J075018F02AGGTGGGCTTGGNONE 
J075063F20AGGTGGGCTTGGNONE 
J075064F18AGGTGGGCTTGGNONE 
J075066N19AGGTGGGCTTGGNONE 
J075073I02AGGTGGGCTTGGNONE 
J075080P17AGGTGGGCTTGGNONE 
J075081F11AGGTGGGCTTGGNONE 
J075085E03AGGTGGGCTTGGNONE 
J075101G18AGGTGGGCTTGGNONE 
J075149N08AGGTGGGCTTGGNONE 
J075158I21AGGTGGGCTTGGNONE 
J075161M20AGGTGGGCTTGGNONE 
J075190F12AGGTGGGCTTGGNONE 
J075194K16AGGTGGGCTTGGNONE 
J080001E08AGGTGGGCTTGGNONE 
J080001F21AGGTGGGCTTGGNONE 
J080001H19AGGTGGGCTTGGNONE 
J080001O15AGGTGGGCTTGGNONE 
J080005I22AGGTGGGCTTGGNONE 
J080006K23AGGTGGGCTTGGNONE 
J080014D20AGGTGGGCTTGGNONE 
J080014I05AGGTGGGCTTGGNONE 
J080014K21AGGTGGGCTTGGNONE 
J080017I24AGGTGGGCTTGGNONE 
J080017K11AGGTGGGCTTGGNONE 
J080018F11AGGTGGGCTTGGNONE 
J080022L18AGGTGGGCTTGGNONE 
J080024N23AGGTGGGCTTGGNONE 
J080027J23AGGTGGGCTTGGNONE 
J080029B14AGGTGGGCTTGGNONE 
J080032F14AGGTGGGCTTGGNONE 
J080032K19AGGTGGGCTTGGNONE 
J080032O21AGGTGGGCTTGGNONE 
J080033P17AGGTGGGCTTGGNONE 
J080034I06AGGTGGGCTTGGNONE 
J080039F24AGGTGGGCTTGGNONE 
J080040O13AGGTGGGCTTGGNONE 
J080042B02AGGTGGGCTTGGNONE 
J080043E12AGGTGGGCTTGGNONE 
J080043J15AGGTGGGCTTGGNONE 
J080043N09AGGTGGGCTTGGNONE 
J080052J08AGGTGGGCTTGGNONE 
J080053K01AGGTGGGCTTGGNONE 
J080053K19AGGTGGGCTTGGNONE 
J080055J09AGGTGGGCTTGGNONE 
J080058D07AGGTGGGCTTGGNONE 
J080062F11AGGTGGGCTTGGNONE 
J080063J24AGGTGGGCTTGGNONE 
J080066H04AGGTGGGCTTGGNONE 
J080066I09AGGTGGGCTTGGNONE 
J080067B02AGGTGGGCTTGGNONE 
J080067N09AGGTGGGCTTGGNONE 
J080068D22AGGTGGGCTTGGNONE 
J080068K13AGGTGGGCTTGGNONE 
J080069N19AGGTGGGCTTGGNONE 
J080070D07AGGTGGGCTTGGNONE 
J080070E05AGGTGGGCTTGGNONE 
J080071G04AGGTGGGCTTGGNONE 
J080077G05AGGTGGGCTTGGNONE 
J080077O06AGGTGGGCTTGGNONE 
J080085F05AGGTGGGCTTGGNONE 
J080086E07AGGTGGGCTTGGNONE 
J080089G16AGGTGGGCTTGGNONE 
J080092K15AGGTGGGCTTGGNONE 
J080094A08AGGTGGGCTTGGNONE 
J080097A09AGGTGGGCTTGGNONE 
J080097J07AGGTGGGCTTGGNONE 
J090027N01AGGTGGGCTTGGNONE 
J090081J05AGGTGGGCTTGGNONE 
Os05g0115200AK106709CACTGACAAGGTGGGCCCTConserved hypothetical protein. 
Os05g0116600AK109828AGGTGGGCCGCATGGGCTTTF-box associated type 1 domain containing protein. 
Os05g0125900009-168-E11TCGGCCCAGATGCCCACCTNONE 
AK063078TCGGCCCAGATGCCCACCTConserved hypothetical protein. 
AK119230TCGGCCCAGATGCCCACCTNONE 
Os05g0137400AK065206GGTGGGCCCACCTSimilar to Aspartic protease precursor. 
D12777GGTGGGCCCACCTNONE 
J013002F13GGTGGGCCCACCTNONE 
J013029I15GGTGGGCCCACCTNONE 
J013033A10GGTGGGCCCACCTNONE 
J013035H24GGTGGGCCCACCTNONE 
J013051H21GGTGGGCCCACCTNONE 
J013098H05GGTGGGCCCACCTNONE 
J023060B04GGTGGGCCCACCTNONE 
J023130D23GGTGGGCCCACCTNONE 
J033140N08GGTGGGCCCACCTNONE 
J053039L22GGTGGGCCCACCTNONE 
J080007K21GGTGGGCCCACCTNONE 
Os05g0152400Os05g0152400AGGGCCCACCTGlycosyl transferase, family 14 protein. 
Os05g0163700AK071561ACTGACAGGTGGGCCAGASimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0172800AK108688CCTGGGCCCACCTGConserved hypothetical protein. 
J075027E19CCTGGGCCCACCTGNONE 
J075174L13CCTGGGCCCACCTGNONE 
Os05g0208000AK059612CCCACGGGCCCACCTGTCAGTNONE 
AK063666CCCACGGGCCCACCTGTCAGTNONE 
AK071500CCCACGGGCCCACCTGTCAGTSimilar to 2-oxoglutarate/malate translocator. 
Os05g0252000AK068865AGCCCACCTOligopeptide transporter OPT superfamily protein. 
Os05g0354400AK065144CAGGTGGGCCCACCCProtein of unknown function DUF231, plant domain containing protein. 
Os05g0361900006-033-D04ACTGACAGGTGGGCCCAGCCCNONE 
AK060107ACTGACAGGTGGGCCCAGCCCMitochondrial substrate carrier family protein. 
AK104602ACTGACAGGTGGGCCCAGCCCNONE 
AK104747ACTGACAGGTGGGCCCAGCCCNONE 
J033133L03ACTGACAGGTGGGCCCAGCCCNONE 
J080001O06ACTGACAGGTGGGCCCAGCCCNONE 
J080004F05ACTGACAGGTGGGCCCAGCCCNONE 
J080005D12ACTGACAGGTGGGCCCAGCCCNONE 
J080008G19ACTGACAGGTGGGCCCAGCCCNONE 
J080015D10ACTGACAGGTGGGCCCAGCCCNONE 
J080015H22ACTGACAGGTGGGCCCAGCCCNONE 
J080016K15ACTGACAGGTGGGCCCAGCCCNONE 
J080018D12ACTGACAGGTGGGCCCAGCCCNONE 
J080020A01ACTGACAGGTGGGCCCAGCCCNONE 
J080027A09ACTGACAGGTGGGCCCAGCCCNONE 
J080032F05ACTGACAGGTGGGCCCAGCCCNONE 
J080039D09ACTGACAGGTGGGCCCAGCCCNONE 
J080043J19ACTGACAGGTGGGCCCAGCCCNONE 
J080052G22ACTGACAGGTGGGCCCAGCCCNONE 
J080052M15ACTGACAGGTGGGCCCAGCCCNONE 
J080053D22ACTGACAGGTGGGCCCAGCCCNONE 
J080061I18ACTGACAGGTGGGCCCAGCCCNONE 
J080064O14ACTGACAGGTGGGCCCAGCCCNONE 
J080075K01ACTGACAGGTGGGCCCAGCCCNONE 
J080082I02ACTGACAGGTGGGCCCAGCCCNONE 
J080095C14ACTGACAGGTGGGCCCAGCCCNONE 
J100028N14ACTGACAGGTGGGCCCAGCCCNONE 
Os05g0380900AK067214CAGGTGGGCCCCACCTGTCAGSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2). 
AK099962CAGGTGGGCCCCACCTGTCAGNONE 
J065083M07CAGGTGGGCCCCACCTGTCAGNONE 
Os05g0407500AK074026GTGGGGGCCCACCTEsterase/lipase/thioesterase domain containing protein. 
Os05g0423500015-048-C11AGGTGGGCCCCACCTGTCNONE 
015-048-C11CACGTGGGCCCACCTNONE 
AK066000AGGTGGGCCCCACCTGTCProtein kinase-like domain containing protein. 
AK066000CACGTGGGCCCACCTProtein kinase-like domain containing protein. 
J013049L02AGGTGGGCCCCACCTGTCNONE 
J013049L02CACGTGGGCCCACCTNONE 
Os05g0430200J090095K16ACCGGGCCCACCTGTCNONE 
Os05g0441500AK120434ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F13ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F15ACAGCCCAGGCCCACCTGTCAGNONE 
J065152G07ACAGCCCAGGCCCACCTGTCAGNONE 
Os05g0467300006-113-H02GCGGCCCACCTGTCAGTGNONE 
AK061873GCGGCCCACCTGTCAGTGSelT/selW/selH selenoprotein family protein. 
AK098945GCGGCCCACCTGTCAGTGNONE 
J013050H09GCGGCCCACCTGTCAGTGNONE 
J023108B17GCGGCCCACCTGTCAGTGNONE 
J065189J01GCGGCCCACCTGTCAGTGNONE 
J075011H05GCGGCCCACCTGTCAGTGNONE 
J075019G20GCGGCCCACCTGTCAGTGNONE 
Os05g0469900AK109700AGGTGGGCCGAGConserved hypothetical protein. 
Os05g0473300AK102559TGGTGGGCCCACCTGNONE 
AK103822TGGTGGGCCCACCTGNONE 
AK109855TGGTGGGCCCACCTGSimilar to Ethylene response factor 1. 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
Os05g0503300011-013-H12GCCCACCTGNONE 
012-072-B03GCCCACCTGNONE 
AK073969GCCCACCTGSimilar to Sulfite reductase (Fragment). 
AK100773GCCCACCTGNONE 
AK103289GCCCACCTGNONE 
J013045K07GCCCACCTGNONE 
J033075F01GCCCACCTGNONE 
J033125N07GCCCACCTGNONE 
J033130G12GCCCACCTGNONE 
Os05g0543700AK071113TGGTGGGCCCACCTSimilar to Chaperone protein dnaJ. 
AK103912TGGTGGGCCCACCTNONE 
Os05g0549100AK072422CACTGACAGGTGGGCCAASimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os05g0568600009-024-B09GGTGGGGCCCACCTGTCNONE 
009-024-B09GTGGCCCACCTNONE 
AK063781GGTGGGGCCCACCTGTCProtein of unknown function DUF1645 family protein. 
AK063781GTGGCCCACCTProtein of unknown function DUF1645 family protein. 
J080049H14GGTGGGGCCCACCTGTCNONE 
J080049H14GTGGCCCACCTNONE 
J080062M08GGTGGGGCCCACCTGTCNONE 
J080062M08GTGGCCCACCTNONE 
J080064I07GGTGGGGCCCACCTGTCNONE 
J080064I07GTGGCCCACCTNONE 
J080068A12GGTGGGGCCCACCTGTCNONE 
J080068A12GTGGCCCACCTNONE 
J080086J10GGTGGGGCCCACCTGTCNONE 
J080086J10GTGGCCCACCTNONE 
Os05g0568800006-084-D04CAGGTGGGCTTGGGCCGCANONE 
009-009-B11CAGGTGGGCTTGGGCCGCANONE 
009-014-E10CAGGTGGGCTTGGGCCGCANONE 
009-107-C04CAGGTGGGCTTGGGCCGCANONE 
009-133-H08CAGGTGGGCTTGGGCCGCANONE 
AK059883CAGGTGGGCTTGGGCCGCAProtein of unknown function DUF1645 family protein. 
Os05g0579600Os05g0579600GCCCACCTHomeodomain-like containing protein. 
Os05g0585900AK062575GACAGGTGGGCCCCMitochondrial substrate carrier family protein. 
AK098854GACAGGTGGGCCCCNONE 
J013000H16GACAGGTGGGCCCCNONE 
J033118D07GACAGGTGGGCCCCNONE 
Os05g0593100AK061855AGGTGGGCTTANONE 
AK100119AGGTGGGCTTASimilar to Vacuolar ATP synthase subunit C (EC 3.6.3.14) (V-ATPase C subunit) (Vacuolar proton pump C subunit). 
AY224442AGGTGGGCTTANONE 
Os06g0101600AF093636GTGTGGGGGTGGGCCCACCTNONE 
AK070447GTGTGGGGGTGGGCCCACCTPlastocyanin, chloroplast precursor. 
J065001A20GTGTGGGGGTGGGCCCACCTNONE 
J065019M17GTGTGGGGGTGGGCCCACCTNONE 
J065021H18GTGTGGGGGTGGGCCCACCTNONE 
J065061A17GTGTGGGGGTGGGCCCACCTNONE 
J065073L02GTGTGGGGGTGGGCCCACCTNONE 
J065099F17GTGTGGGGGTGGGCCCACCTNONE 
J065101C23GTGTGGGGGTGGGCCCACCTNONE 
J065121E23GTGTGGGGGTGGGCCCACCTNONE 
J065122N04GTGTGGGGGTGGGCCCACCTNONE 
J065141N05GTGTGGGGGTGGGCCCACCTNONE 
J065143N21GTGTGGGGGTGGGCCCACCTNONE 
J065161H09GTGTGGGGGTGGGCCCACCTNONE 
J065161J04GTGTGGGGGTGGGCCCACCTNONE 
J065162P20GTGTGGGGGTGGGCCCACCTNONE 
J065182K10GTGTGGGGGTGGGCCCACCTNONE 
J065184M05GTGTGGGGGTGGGCCCACCTNONE 
J065186H24GTGTGGGGGTGGGCCCACCTNONE 
J065189G21GTGTGGGGGTGGGCCCACCTNONE 
J065190N14GTGTGGGGGTGGGCCCACCTNONE 
J065191H08GTGTGGGGGTGGGCCCACCTNONE 
J065205H17GTGTGGGGGTGGGCCCACCTNONE 
J075001E03GTGTGGGGGTGGGCCCACCTNONE 
J075001H21GTGTGGGGGTGGGCCCACCTNONE 
J075003J23GTGTGGGGGTGGGCCCACCTNONE 
J075003K01GTGTGGGGGTGGGCCCACCTNONE 
J075005I11GTGTGGGGGTGGGCCCACCTNONE 
J075007F16GTGTGGGGGTGGGCCCACCTNONE 
J075017I11GTGTGGGGGTGGGCCCACCTNONE 
J075018O05GTGTGGGGGTGGGCCCACCTNONE 
J075019G24GTGTGGGGGTGGGCCCACCTNONE 
J075032D04GTGTGGGGGTGGGCCCACCTNONE 
J075032N13GTGTGGGGGTGGGCCCACCTNONE 
J075033C09GTGTGGGGGTGGGCCCACCTNONE 
J075033D11GTGTGGGGGTGGGCCCACCTNONE 
J075039A20GTGTGGGGGTGGGCCCACCTNONE 
J075058P12GTGTGGGGGTGGGCCCACCTNONE 
J075062E10GTGTGGGGGTGGGCCCACCTNONE 
J075062P16GTGTGGGGGTGGGCCCACCTNONE 
J075063C17GTGTGGGGGTGGGCCCACCTNONE 
J075066E07GTGTGGGGGTGGGCCCACCTNONE 
J075066I20GTGTGGGGGTGGGCCCACCTNONE 
J075075K21GTGTGGGGGTGGGCCCACCTNONE 
J075078F03GTGTGGGGGTGGGCCCACCTNONE 
J075082F10GTGTGGGGGTGGGCCCACCTNONE 
J075086G16GTGTGGGGGTGGGCCCACCTNONE 
J075087E07GTGTGGGGGTGGGCCCACCTNONE 
J075087K06GTGTGGGGGTGGGCCCACCTNONE 
J075087L04GTGTGGGGGTGGGCCCACCTNONE 
J075088B16GTGTGGGGGTGGGCCCACCTNONE 
J075088D02GTGTGGGGGTGGGCCCACCTNONE 
J075094H21GTGTGGGGGTGGGCCCACCTNONE 
J075094I24GTGTGGGGGTGGGCCCACCTNONE 
J075094K10GTGTGGGGGTGGGCCCACCTNONE 
J075095C18GTGTGGGGGTGGGCCCACCTNONE 
J075097B05GTGTGGGGGTGGGCCCACCTNONE 
J075099C13GTGTGGGGGTGGGCCCACCTNONE 
J075099H22GTGTGGGGGTGGGCCCACCTNONE 
J075099L16GTGTGGGGGTGGGCCCACCTNONE 
J075104K08GTGTGGGGGTGGGCCCACCTNONE 
J075118O06GTGTGGGGGTGGGCCCACCTNONE 
J075119E15GTGTGGGGGTGGGCCCACCTNONE 
J075124N06GTGTGGGGGTGGGCCCACCTNONE 
J075126G02GTGTGGGGGTGGGCCCACCTNONE 
J075127L24GTGTGGGGGTGGGCCCACCTNONE 
J075131E23GTGTGGGGGTGGGCCCACCTNONE 
J075140H06GTGTGGGGGTGGGCCCACCTNONE 
J075146I20GTGTGGGGGTGGGCCCACCTNONE 
J075146N24GTGTGGGGGTGGGCCCACCTNONE 
J075147I19GTGTGGGGGTGGGCCCACCTNONE 
J075155K07GTGTGGGGGTGGGCCCACCTNONE 
J075156C05GTGTGGGGGTGGGCCCACCTNONE 
J075161G07GTGTGGGGGTGGGCCCACCTNONE 
J075164G01GTGTGGGGGTGGGCCCACCTNONE 
J075170J18GTGTGGGGGTGGGCCCACCTNONE 
J075172G17GTGTGGGGGTGGGCCCACCTNONE 
J075176G10GTGTGGGGGTGGGCCCACCTNONE 
J075178C05GTGTGGGGGTGGGCCCACCTNONE 
J075179G01GTGTGGGGGTGGGCCCACCTNONE 
J075181E24GTGTGGGGGTGGGCCCACCTNONE 
J080029D19GTGTGGGGGTGGGCCCACCTNONE 
J080034L11GTGTGGGGGTGGGCCCACCTNONE 
J080039G07GTGTGGGGGTGGGCCCACCTNONE 
J080062M23GTGTGGGGGTGGGCCCACCTNONE 
J080302A01GTGTGGGGGTGGGCCCACCTNONE 
J100042I15GTGTGGGGGTGGGCCCACCTNONE 
J100043G22GTGTGGGGGTGGGCCCACCTNONE 
J100056L12GTGTGGGGGTGGGCCCACCTNONE 
J100061A12GTGTGGGGGTGGGCCCACCTNONE 
J100073O20GTGTGGGGGTGGGCCCACCTNONE 
J100082I08GTGTGGGGGTGGGCCCACCTNONE 
Os06g0112800J090052L21AGGTGGGCTTTNONE 
Os06g0114700AK061552GACAGGTGGGCCCGGGProtein of unknown function DUF1218 family protein. 
AK098848GACAGGTGGGCCCGGGNONE 
AK122142GACAGGTGGGCCCGGGNONE 
J013000D16GACAGGTGGGCCCGGGNONE 
Os06g0128500AK058563GACAGGTGGGCCCGRibosomal protein L47, mitochondrial family protein. 
AK122132GACAGGTGGGCCCGNONE 
J033133F04GACAGGTGGGCCCGNONE 
J065094M24GACAGGTGGGCCCGNONE 
J065122J07GACAGGTGGGCCCGNONE 
J065137G10GACAGGTGGGCCCGNONE 
J065178L09GACAGGTGGGCCCGNONE 
J080011E11GACAGGTGGGCCCGNONE 
J080020G21GACAGGTGGGCCCGNONE 
J080039H03GACAGGTGGGCCCGNONE 
J080039J04GACAGGTGGGCCCGNONE 
Os06g0134000AK102796AGGTGGGCCAANONE 
AK102796GCCCAGCCCACCTNONE 
Os06g0156600006-055-F08AGGTGGGCTNONE 
006-056-B12AGGTGGGCTNONE 
006-098-H12AGGTGGGCTNONE 
AK061497AGGTGGGCTLipolytic enzyme, G-D-S-L family protein. 
AK104394AGGTGGGCTNONE 
AK104883AGGTGGGCTNONE 
AK121780AGGTGGGCTNONE 
Os06g0161800AK064664TGCGGGCCCACCTGTCProtein of unknown function DUF569 family protein. 
Os06g0163000AK069245CCCAGCCCACCTGNONE 
AK069675CCCAGCCCACCTGSimilar to Heat shock protein STI (Stress inducible protein) (GmSTI). 
AK072504CCCAGCCCACCTGNONE 
Os06g0233000009-177-C07CAGGTGGGCCCGCNONE 
AK063118CAGGTGGGCCCGCConserved hypothetical protein. 
Os06g0470150003-107-A03AGGTGGGCNONE 
011-020-C10AGGTGGGCNONE 
J013097N22AGGTGGGCProtein of unknown function DUF563 family protein. 
J013170K19AGGTGGGCNONE 
J023012H23AGGTGGGCNONE 
J023054K22AGGTGGGCNONE 
J023093K13AGGTGGGCNONE 
J023131M10AGGTGGGCNONE 
J033060L20AGGTGGGCNONE 
J033074N20AGGTGGGCNONE 
J043005H03AGGTGGGCNONE 
J043016K21AGGTGGGCNONE 
J043031E18AGGTGGGCNONE 
J065121G15AGGTGGGCNONE 
J065212E04AGGTGGGCNONE 
J090042K16AGGTGGGCNONE 
J100021B22AGGTGGGCNONE 
J100028A08AGGTGGGCNONE 
J100044K13AGGTGGGCNONE 
J100049C08AGGTGGGCNONE 
J100050L15AGGTGGGCNONE 
J100060H21AGGTGGGCNONE 
J100061K14AGGTGGGCNONE 
J100069A10AGGTGGGCNONE 
J100087M16AGGTGGGCNONE 
J100088A21AGGTGGGCNONE 
Os06g0499900J065053E01AGGTGGGCNONE 
J065078C19AGGTGGGCNONE 
J065122P11AGGTGGGCNONE 
J065209B15AGGTGGGCNONE 
J065218E19AGGTGGGCNONE 
Os06g0568200AK060816ATGGCCCACCTNONE 
J013048K13ATGGCCCACCTNONE 
J013050A11ATGGCCCACCTNONE 
J013051L22ATGGCCCACCTNONE 
J013061N20ATGGCCCACCTNONE 
J013065H06ATGGCCCACCTNONE 
J013068P08ATGGCCCACCTNONE 
J013069C22ATGGCCCACCTNONE 
J013070P14ATGGCCCACCTNONE 
J013074I20ATGGCCCACCTNONE 
J013106C16ATGGCCCACCTNONE 
J013122H02ATGGCCCACCTNONE 
J013129N22ATGGCCCACCTNONE 
J013129P06ATGGCCCACCTNONE 
J013147C12ATGGCCCACCTNONE 
J013152K21ATGGCCCACCTNONE 
J013155C14ATGGCCCACCTNONE 
J023001M10ATGGCCCACCTNONE 
J023012G04ATGGCCCACCTNONE 
J023012H22ATGGCCCACCTNONE 
J023012N11ATGGCCCACCTNONE 
J023013I23ATGGCCCACCTNONE 
J023014L11ATGGCCCACCTNONE 
J023022G16ATGGCCCACCTNONE 
J023031K09ATGGCCCACCTNONE 
J023042N15ATGGCCCACCTNONE 
J023044D09ATGGCCCACCTNONE 
J023063L08ATGGCCCACCTNONE 
J023074C24ATGGCCCACCTNONE 
J023079O11ATGGCCCACCTNONE 
J023107B12ATGGCCCACCTNONE 
J023114B10ATGGCCCACCTNONE 
J023120P15ATGGCCCACCTNONE 
J023123D20ATGGCCCACCTNONE 
J023130G12ATGGCCCACCTNONE 
J023131L13ATGGCCCACCTNONE 
J023135O11ATGGCCCACCTNONE 
J023138M14ATGGCCCACCTNONE 
J023149G07ATGGCCCACCTNONE 
J033024F07ATGGCCCACCTNONE 
J033026C20ATGGCCCACCTNONE 
J033036M14ATGGCCCACCTNONE 
J033038A18ATGGCCCACCTNONE 
J033043B18ATGGCCCACCTNONE 
J033043L05ATGGCCCACCTNONE 
J033064A07ATGGCCCACCTNONE 
J033087H21ATGGCCCACCTNONE 
J033087P22ATGGCCCACCTNONE 
J033116O10ATGGCCCACCTNONE 
J033118G23ATGGCCCACCTNONE 
J033120L01ATGGCCCACCTNONE 
J033133F11ATGGCCCACCTNONE 
J033135H12ATGGCCCACCTNONE 
J033141O15ATGGCCCACCTNONE 
J043003A18ATGGCCCACCTNONE 
J043010C07ATGGCCCACCTNONE 
J043010G12ATGGCCCACCTNONE 
J043012A09ATGGCCCACCTNONE 
J043036K01ATGGCCCACCTNONE 
J065005D13ATGGCCCACCTNONE 
J065017L06ATGGCCCACCTNONE 
J065172I06ATGGCCCACCTNONE 
J090003B02ATGGCCCACCTNONE 
J090015L01ATGGCCCACCTNONE 
J090020I04ATGGCCCACCTNONE 
J090021I06ATGGCCCACCTNONE 
J090047D16ATGGCCCACCTNONE 
J090049J19ATGGCCCACCTNONE 
J090050C16ATGGCCCACCTNONE 
J090055L13ATGGCCCACCTNONE 
J090056J22ATGGCCCACCTNONE 
J090058K23ATGGCCCACCTNONE 
J090059N19ATGGCCCACCTNONE 
J090069A06ATGGCCCACCTNONE 
J090071C19ATGGCCCACCTNONE 
J100024L15ATGGCCCACCTNONE 
J100029O03ATGGCCCACCTNONE 
J100064M17ATGGCCCACCTNONE 
J100082D13ATGGCCCACCTNONE 
J100083P16ATGGCCCACCTNONE 
Os06g0603000AK068856TCCGGGCCCACCTGTCNONE 
AK104955TCCGGGCCCACCTGTCSimilar to Heme oxygenase 1 (Fragment). 
Os06g0642900AK073896ATCTGGGCCCACCTGTCUbiquitin system component Cue domain containing protein. 
J033042P11ATCTGGGCCCACCTGTCNONE 
J033072G12ATCTGGGCCCACCTGTCNONE 
J090050C02ATCTGGGCCCACCTGTCNONE 
Os06g0647100009-005-F12CACGGCCCACCTNONE 
009-113-D11CACGGCCCACCTNONE 
009-132-D09CACGGCCCACCTNONE 
009-147-G06CACGGCCCACCTNONE 
AK066837CACGGCCCACCTSimilar to 50S ribosomal protein L35, chloroplast precursor (CL35). 
J065073M03CACGGCCCACCTNONE 
Os06g0649000AK119644GCCCACCTNONE 
Os06g0650100009-016-C02ACCGGCCCACCTNONE 
AK062354ACCGGCCCACCTSimilar to Polyubiquitin gene (Fragment). 
Os06g0654900J100038O05AGGTGGGCNONE 
J100049E07AGGTGGGCNONE 
Os06g0704600AK065784AGGTGGGCNONE 
AK101836AGGTGGGCSimilar to Delta-aminolevulinic acid dehydratase (Fragment). 
AK119551AGGTGGGCNONE 
Os06g0708200J013149K22CTGACAGGTGGGCCACNONE 
J053032C24CTGACAGGTGGGCCACNONE 
J053037F13CTGACAGGTGGGCCACNONE 
J053037L10CTGACAGGTGGGCCACNONE 
J053043J18CTGACAGGTGGGCCACNONE 
J053098E09CTGACAGGTGGGCCACNONE 
J075036L07CTGACAGGTGGGCCACNONE 
J075057O05CTGACAGGTGGGCCACNONE 
J090092L13CTGACAGGTGGGCCACNONE 
Os06g0708500AK060865AGGGCCCACCTGTCAGNONE 
AK072490AGGGCCCACCTGTCAGSimilar to Cyclophilin. 
J013052B11AGGGCCCACCTGTCAGNONE 
J013052B13AGGGCCCACCTGTCAGNONE 
J065214H07AGGGCCCACCTGTCAGNONE 
J075192D20AGGGCCCACCTGTCAGNONE 
J090090C15AGGGCCCACCTGTCAGNONE 
J100051J18AGGGCCCACCTGTCAGNONE 
J100055A07AGGGCCCACCTGTCAGNONE 
J100060B10AGGGCCCACCTGTCAGNONE 
J100061D02AGGGCCCACCTGTCAGNONE 
Os06g0710300AK121344AAGGCCCACCTUncharacterized protein UPF0114 family protein. 
J043016B12AAGGCCCACCTNONE 
J065104H21AAGGCCCACCTNONE 
Os06g0727400AK069558CACTGACAGGTGGGCCCCSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os07g0123300AK108490GGGGCCCACCTGConserved hypothetical protein. 
J065197L01GGGGCCCACCTGNONE 
J065206N07GGGGCCCACCTGNONE 
J080011N05GGGGCCCACCTGNONE 
J080021N11GGGGCCCACCTGNONE 
J080025M24GGGGCCCACCTGNONE 
J080031E13GGGGCCCACCTGNONE 
J080047B07GGGGCCCACCTGNONE 
J080061L03GGGGCCCACCTGNONE 
J080062C18GGGGCCCACCTGNONE 
J080063E20GGGGCCCACCTGNONE 
J080063O12GGGGCCCACCTGNONE 
J080070D20GGGGCCCACCTGNONE 
J080074J17GGGGCCCACCTGNONE 
J080076K17GGGGCCCACCTGNONE 
J080079K21GGGGCCCACCTGNONE 
J080080D02GGGGCCCACCTGNONE 
J080088E12GGGGCCCACCTGNONE 
J080092I18GGGGCCCACCTGNONE 
Os07g0142000AK059877ATGGCCCACCTReticulon family protein. 
AK099414ATGGCCCACCTNONE 
Os07g0150200009-152-C07AGGTGGGCCATNONE 
AK058680AGGTGGGCCATNONE 
AK121635AGGTGGGCCATSimilar to 40S ribosomal protein S12-1. 
J033051C16AGGTGGGCCATNONE 
J033123H15AGGTGGGCCATNONE 
J065093I01AGGTGGGCCATNONE 
J065197C05AGGTGGGCCATNONE 
J075037B11AGGTGGGCCATNONE 
J075114B08AGGTGGGCCATNONE 
J075123N01AGGTGGGCCATNONE 
J075129O04AGGTGGGCCATNONE 
J075160H17AGGTGGGCCATNONE 
J075166H17AGGTGGGCCATNONE 
J080310F11AGGTGGGCCATNONE 
J080315P11AGGTGGGCCATNONE 
J090025A22AGGTGGGCCATNONE 
Os07g0179000AK100008CGGGCCCACCTGNONE 
AK119398CGGGCCCACCTGProtein prenyltransferase domain containing protein. 
AK119505CGGGCCCACCTGNONE 
Os07g0181500AK072431GCCGGGCCCACCTGTCProtein of unknown function DUF506, plant family protein. 
Os07g0185200AK066157CAGGTGGGCCCGCSimilar to Membrane related protein-like. 
AK066157CCACTGACAGGTGGGCCCAGATSimilar to Membrane related protein-like. 
Os07g0240300AK072205AGGTGGGCCCCACGTGConserved hypothetical protein. 
AK098977AGGTGGGCCCCACGTGNONE 
Os07g0258400AK121534CTCGGCCCGGCCCACCTNONE 
L41217CTCGGCCCGGCCCACCTNONE 
S81897CTCGGCCCGGCCCACCTOsNramp1 (Integral membrane protein). 
Os07g0422100013-054-G11GCCCACCTNONE 
AK063592GCCCACCTNONE 
J065165K10GCCCACCTNONE 
J075021B01GCCCACCTNONE 
J075087H22GCCCACCTNONE 
J075118C10GCCCACCTNONE 
J075134N03GCCCACCTNONE 
J075151F23GCCCACCTNONE 
U57639GCCCACCTAWPM-19-like family protein. 
Os07g0486000AK069343AGGTGGGCCCACGTGSimilar to MSH4. 
Os07g0490400AK067941CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGANONE 
Os07g0495000015-070-F12CAAGTGGGGCCCACCTNONE 
015-070-F12CAGGTGGGCNONE 
AK060721CAAGTGGGGCCCACCTNONE 
AK060721CAGGTGGGCNONE 
AK073883CAAGTGGGGCCCACCTCupin, RmlC-type domain containing protein. 
AK073883CAGGTGGGCCupin, RmlC-type domain containing protein. 
AK119204CAAGTGGGGCCCACCTNONE 
AK119204CAGGTGGGCNONE 
J033071H20CAAGTGGGGCCCACCTNONE 
J033071H20CAGGTGGGCNONE 
J090079B04CAAGTGGGGCCCACCTNONE 
J090079B04CAGGTGGGCNONE 
Os07g0496700016-057-A12TGGGGCCCACCTGTCNONE 
AK064235TGGGGCCCACCTGTCPhosphate-induced protein 1 conserved region family protein. 
Os07g0531600015-098-E11AGTGGGCCCACCTGTCNONE 
AK067845AGTGGGCCCACCTGTCPhospholipid/glycerol acyltransferase domain containing protein. 
J013124G01AGTGGGCCCACCTGTCNONE 
J065008E15AGTGGGCCCACCTGTCNONE 
J065052K14AGTGGGCCCACCTGTCNONE 
J065052L13AGTGGGCCCACCTGTCNONE 
J065058M02AGTGGGCCCACCTGTCNONE 
J065069M10AGTGGGCCCACCTGTCNONE 
J065135A14AGTGGGCCCACCTGTCNONE 
J065168O18AGTGGGCCCACCTGTCNONE 
J075070D14AGTGGGCCCACCTGTCNONE 
J075169B16AGTGGGCCCACCTGTCNONE 
Os07g0540100AK101714CAGGTGGGCCCACCProtein of unknown function DUF26 domain containing protein. 
Os07g0546000AF188065CTGACAGGTGGGCCCACCACNONE 
AK061800CTGACAGGTGGGCCCACCACNONE 
AK065871CTGACAGGTGGGCCCACCACSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02CTGACAGGTGGGCCCACCACNONE 
J013035F03CTGACAGGTGGGCCCACCACNONE 
J013044J20CTGACAGGTGGGCCCACCACNONE 
Os07g0556000AK121938CTGACAGGTGGGCCCCACCCyclin-like domain containing protein. 
J065161E07CTGACAGGTGGGCCCCACCNONE 
Os07g0569100013-067-E02CCCGGGCCCACCTNONE 
013-081-C06CCCGGGCCCACCTNONE 
014-030-G06CCCGGGCCCACCTNONE 
014-034-H09CCCGGGCCCACCTNONE 
AK120160CCCGGGCCCACCTRemorin, C-terminal region domain containing protein. 
J090034F20CCCGGGCCCACCTNONE 
Os07g0582400003-104-B09CCTGGGCCCACCTNONE 
AK059423CCTGGGCCCACCTNONE 
AK102676CCTGGGCCCACCTNONE 
J065001F09CCTGGGCCCACCTNONE 
J065005K22CCTGGGCCCACCTNONE 
J065006D10CCTGGGCCCACCTNONE 
J065006P17CCTGGGCCCACCTNONE 
J065015G23CCTGGGCCCACCTNONE 
J065020F21CCTGGGCCCACCTNONE 
J065028I05CCTGGGCCCACCTNONE 
J065042N09CCTGGGCCCACCTNONE 
J065043P03CCTGGGCCCACCTNONE 
J065059E15CCTGGGCCCACCTNONE 
J065090I12CCTGGGCCCACCTNONE 
J065130I02CCTGGGCCCACCTNONE 
J065131P05CCTGGGCCCACCTNONE 
J065163I24CCTGGGCCCACCTNONE 
J065168I21CCTGGGCCCACCTNONE 
J065174A12CCTGGGCCCACCTNONE 
J065178K16CCTGGGCCCACCTNONE 
J065182P03CCTGGGCCCACCTNONE 
J065186B07CCTGGGCCCACCTNONE 
J065189M13CCTGGGCCCACCTNONE 
J065208J22CCTGGGCCCACCTNONE 
J065211E11CCTGGGCCCACCTNONE 
J075054E08CCTGGGCCCACCTNONE 
J075067K14CCTGGGCCCACCTNONE 
J075104E20CCTGGGCCCACCTNONE 
J075152M07CCTGGGCCCACCTNONE 
Os07g0606900011-039-F09GAGGCCCACCTNONE 
011-058-E11GAGGCCCACCTNONE 
012-014-C08GAGGCCCACCTNONE 
012-062-H02GAGGCCCACCTNONE 
012-067-G01GAGGCCCACCTNONE 
015-029-A08GAGGCCCACCTNONE 
015-039-H09GAGGCCCACCTNONE 
015-044-A09GAGGCCCACCTNONE 
015-047-G10GAGGCCCACCTNONE 
015-065-C04GAGGCCCACCTNONE 
015-067-C10GAGGCCCACCTNONE 
015-078-H10GAGGCCCACCTNONE 
015-084-A06GAGGCCCACCTNONE 
016-050-F01GAGGCCCACCTNONE 
016-059-E11GAGGCCCACCTNONE 
016-059-F04GAGGCCCACCTHeavy metal transport/detoxification protein domain containing protein. 
016-062-C02GAGGCCCACCTNONE 
J065170E01GAGGCCCACCTNONE 
J075122G11GAGGCCCACCTNONE 
Os07g0620200AK099859ACTGACAGGTGGGCCCCHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04ACTGACAGGTGGGCCCCNONE 
Os07g0626100009-127-G03GACAGGTGGGCCACNONE 
AK062899GACAGGTGGGCCACSimilar to 50S ribosomal protein L7/L12. 
Os07g0639900J080305F09CAGGTGGGCCGGGCCCATAANONE 
J080305J22CAGGTGGGCCGGGCCCATAAThymidylate kinase domain containing protein. 
J080311G07CAGGTGGGCCGGGCCCATAANONE 
J080315B14CAGGTGGGCCGGGCCCATAANONE 
J080317C02CAGGTGGGCCGGGCCCATAANONE 
Os07g0641700009-030-F09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
014-030-D10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AF009413AAATGGGCCGTGGAGGTGGGCCGGTSimilar to 10 kDa chaperonin (Protein CPN10) (Protein groES). 
AK059154AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK119728AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK122129AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023057A19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023143P09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J033132M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065039D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065062M22AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065071L10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065088N13AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065115D21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065187D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011B03AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075029J17AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075038J07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075065A18AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075083P05AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075101G24AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075127E19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075161K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075175D23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090044M07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065G16AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065J11AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090097M02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090099D02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100056A20AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100063M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
Os07g0647100AK065269TCTGGGCCCACCTGTCAGArmadillo-like helical domain containing protein. 
J013002K24TCTGGGCCCACCTGTCAGNONE 
Os07g0673100AK060100AGCCCACCTNONE 
AK103678AGCCCACCTRibosomal protein S8E family protein. 
AK104794AGCCCACCTNONE 
Os07g0681500AK103662TCCGGGCCCACCTGACAGGNONE 
AK121650TCCGGGCCCACCTGACAGGAnkyrin repeat containing protein. 
Os07g0690300012-048-A07CGGGCCCACCTGNONE 
AK099674CGGGCCCACCTGChromatin SPT2 family protein. 
J013028F12CGGGCCCACCTGNONE 
J013069F21CGGGCCCACCTGNONE 
J013104E17CGGGCCCACCTGNONE 
J013153M16CGGGCCCACCTGNONE 
J023012L09CGGGCCCACCTGNONE 
J023069A08CGGGCCCACCTGNONE 
J023132L23CGGGCCCACCTGNONE 
J033120P19CGGGCCCACCTGNONE 
J065173J03CGGGCCCACCTGNONE 
J075008H06CGGGCCCACCTGNONE 
J075043J15CGGGCCCACCTGNONE 
J075147I12CGGGCCCACCTGNONE 
J090041G07CGGGCCCACCTGNONE 
Os07g0696000AK108592AGGTGGGCHypothetical protein. 
Os08g0113100003-102-G01CAGGTGGGCCCCACCNONE 
011-041-F02CAGGTGGGCCCCACCNONE 
011-063-A09CAGGTGGGCCCCACCNONE 
AB110164CAGGTGGGCCCCACCNONE 
AF429947CAGGTGGGCCCCACCNONE 
AK070120CAGGTGGGCCCCACCSimilar to Fructokinase (Fragment). 
AK099353CAGGTGGGCCCCACCNONE 
J013072L23CAGGTGGGCCCCACCNONE 
J023031J20CAGGTGGGCCCCACCNONE 
J023041C07CAGGTGGGCCCCACCNONE 
J023068B05CAGGTGGGCCCCACCNONE 
J023111H11CAGGTGGGCCCCACCNONE 
J023114G22CAGGTGGGCCCCACCNONE 
J023121E01CAGGTGGGCCCCACCNONE 
J023121G16CAGGTGGGCCCCACCNONE 
J023128D15CAGGTGGGCCCCACCNONE 
J023142I22CAGGTGGGCCCCACCNONE 
J033058M11CAGGTGGGCCCCACCNONE 
J033092F23CAGGTGGGCCCCACCNONE 
J033108M10CAGGTGGGCCCCACCNONE 
J065085D10CAGGTGGGCCCCACCNONE 
J065086I17CAGGTGGGCCCCACCNONE 
J065137I08CAGGTGGGCCCCACCNONE 
J065154L19CAGGTGGGCCCCACCNONE 
J065179C12CAGGTGGGCCCCACCNONE 
J065184K15CAGGTGGGCCCCACCNONE 
J065195G07CAGGTGGGCCCCACCNONE 
J075052K09CAGGTGGGCCCCACCNONE 
J075093D08CAGGTGGGCCCCACCNONE 
J075093L13CAGGTGGGCCCCACCNONE 
J090005F03CAGGTGGGCCCCACCNONE 
J090013F02CAGGTGGGCCCCACCNONE 
J090026L07CAGGTGGGCCCCACCNONE 
J090041P18CAGGTGGGCCCCACCNONE 
J090081E12CAGGTGGGCCCCACCNONE 
J090087F17CAGGTGGGCCCCACCNONE 
J090091C17CAGGTGGGCCCCACCNONE 
J090099P12CAGGTGGGCCCCACCNONE 
J100030P08CAGGTGGGCCCCACCNONE 
J100055E21CAGGTGGGCCCCACCNONE 
J100056N16CAGGTGGGCCCCACCNONE 
J100061I23CAGGTGGGCCCCACCNONE 
J100063L04CAGGTGGGCCCCACCNONE 
J100065A14CAGGTGGGCCCCACCNONE 
J100072A15CAGGTGGGCCCCACCNONE 
J100080A04CAGGTGGGCCCCACCNONE 
J100082K16CAGGTGGGCCCCACCNONE 
J100088C06CAGGTGGGCCCCACCNONE 
J100088L18CAGGTGGGCCCCACCNONE 
Os08g0130500AK062008AGGTGGGCTNONE 
Os08g0138500AK102951GCCCCCACACGCCCACCTSimilar to Helix-loop-helix-like protein (Fragment). 
AY224458GCCCCCACACGCCCACCTNONE 
J033115D14GCCCCCACACGCCCACCTNONE 
J065013F04GCCCCCACACGCCCACCTNONE 
J065050P11GCCCCCACACGCCCACCTNONE 
J065063K18GCCCCCACACGCCCACCTNONE 
J090054H10GCCCCCACACGCCCACCTNONE 
J100083F11GCCCCCACACGCCCACCTNONE 
Os08g0143400015-006-A10AGCCCACCTGNONE 
AK066792AGCCCACCTGNONE 
AK120532AGCCCACCTGSWIRM domain containing protein. 
J100083F02AGCCCACCTGNONE 
Os08g0143500006-072-G06CAGGTGGGCTNONE 
016-053-H02CAGGTGGGCTNONE 
AK061094CAGGTGGGCTNONE 
AK071122CAGGTGGGCTGlycosyl transferase, family 14 protein. 
J023081E17CAGGTGGGCTNONE 
J023106O18CAGGTGGGCTNONE 
J043001N22CAGGTGGGCTNONE 
J065062D05CAGGTGGGCTNONE 
J065099M15CAGGTGGGCTNONE 
J065180K12CAGGTGGGCTNONE 
J090045L23CAGGTGGGCTNONE 
J100088K05CAGGTGGGCTNONE 
Os08g0162500AK121633GACGGCCCACCTGTConserved hypothetical protein. 
J033105E19GACGGCCCACCTGTNONE 
J080012K11GACGGCCCACCTGTNONE 
J080041I12GACGGCCCACCTGTNONE 
J080049G05GACGGCCCACCTGTNONE 
J080050P09GACGGCCCACCTGTNONE 
J080051A10GACGGCCCACCTGTNONE 
J080054G05GACGGCCCACCTGTNONE 
J080058M08GACGGCCCACCTGTNONE 
J080064N23GACGGCCCACCTGTNONE 
J080072L15GACGGCCCACCTGTNONE 
J080096H09GACGGCCCACCTGTNONE 
J100079I08GACGGCCCACCTGTNONE 
Os08g0191900AK067587CTGACAGGTGGGCCCCProtein prenyltransferase domain containing protein. 
AK099016CTGACAGGTGGGCCCCNONE 
J013032I08CTGACAGGTGGGCCCCNONE 
J013050I24CTGACAGGTGGGCCCCNONE 
J013128E05CTGACAGGTGGGCCCCNONE 
Os08g0366100AK061882AGGTGGGCCCCACCTGTCAGNONE 
AK120339AGGTGGGCCCCACCTGTCAGSimilar to Endothelial differentiation-related factor 1 (EDF-1) (Multiprotein bridging factor 1) (MBF1). 
J013060M10AGGTGGGCCCCACCTGTCAGNONE 
J023135H23AGGTGGGCCCCACCTGTCAGNONE 
J033095L23AGGTGGGCCCCACCTGTCAGNONE 
J065010L09AGGTGGGCCCCACCTGTCAGNONE 
J065016A02AGGTGGGCCCCACCTGTCAGNONE 
J065041H14AGGTGGGCCCCACCTGTCAGNONE 
J065043F09AGGTGGGCCCCACCTGTCAGNONE 
J065045E03AGGTGGGCCCCACCTGTCAGNONE 
J065058F23AGGTGGGCCCCACCTGTCAGNONE 
J065075L19AGGTGGGCCCCACCTGTCAGNONE 
J065078N12AGGTGGGCCCCACCTGTCAGNONE 
J065105J19AGGTGGGCCCCACCTGTCAGNONE 
J065162I03AGGTGGGCCCCACCTGTCAGNONE 
J065164D10AGGTGGGCCCCACCTGTCAGNONE 
J065170B05AGGTGGGCCCCACCTGTCAGNONE 
J075039K19AGGTGGGCCCCACCTGTCAGNONE 
J075039M06AGGTGGGCCCCACCTGTCAGNONE 
J075057L17AGGTGGGCCCCACCTGTCAGNONE 
J075059F17AGGTGGGCCCCACCTGTCAGNONE 
J075109J04AGGTGGGCCCCACCTGTCAGNONE 
J075120B14AGGTGGGCCCCACCTGTCAGNONE 
J075153I11AGGTGGGCCCCACCTGTCAGNONE 
J075156C19AGGTGGGCCCCACCTGTCAGNONE 
J075166J20AGGTGGGCCCCACCTGTCAGNONE 
J090052H04AGGTGGGCCCCACCTGTCAGNONE 
J100051E13AGGTGGGCCCCACCTGTCAGNONE 
J100057L03AGGTGGGCCCCACCTGTCAGNONE 
J100059G23AGGTGGGCCCCACCTGTCAGNONE 
Os08g0406500016-001-C06AGGTGGGCCCGTTNONE 
AK064160AGGTGGGCCCGTTTRAF-like domain containing protein. 
Os08g0411200AK120890AGGTGGGCCGAASAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0414200AK102789TCAGCCCACCTBRCT domain containing protein. 
J033048B10TCAGCCCACCTNONE 
J033071G24TCAGCCCACCTNONE 
J033107O17TCAGCCCACCTNONE 
Os08g0431500009-186-D05AGGTGGGCNONE 
AK058993AGGTGGGCNONE 
AK100797AGGTGGGCConserved hypothetical protein. 
J023121F15AGGTGGGCNONE 
Os08g0517600009-066-H05GCGGCCCACCTNONE 
AK073374GCGGCCCACCTNONE 
AK105385GCGGCCCACCTSAM (and some other nucleotide) binding motif domain containing protein. 
J065165P07GCGGCCCACCTNONE 
J075004A12GCGGCCCACCTNONE 
J075062F16GCGGCCCACCTNONE 
J075115K05GCGGCCCACCTNONE 
J075116H09GCGGCCCACCTNONE 
Os08g0517900015-019-D06GAGGCCCACCTNONE 
AK064304GAGGCCCACCTSimilar to 30S ribosomal protein S16. 
Os08g0521400006-047-C11AGGGCCCACCTAGTGGGCCCAATTNONE 
016-014-E07AGGGCCCACCTAGTGGGCCCAATTNONE 
AK070148AGGGCCCACCTAGTGGGCCCAATTNONE 
AK101704AGGGCCCACCTAGTGGGCCCAATTZinc finger, RanBP2-type domain containing protein. 
AK105045AGGGCCCACCTAGTGGGCCCAATTNONE 
J013108K14AGGGCCCACCTAGTGGGCCCAATTNONE 
J013129E16AGGGCCCACCTAGTGGGCCCAATTNONE 
J013159M23AGGGCCCACCTAGTGGGCCCAATTNONE 
J023041G22AGGGCCCACCTAGTGGGCCCAATTNONE 
J033060G13AGGGCCCACCTAGTGGGCCCAATTNONE 
J033060J15AGGGCCCACCTAGTGGGCCCAATTNONE 
J065120J24AGGGCCCACCTAGTGGGCCCAATTNONE 
J065160I01AGGGCCCACCTAGTGGGCCCAATTNONE 
J065179A16AGGGCCCACCTAGTGGGCCCAATTNONE 
J065189K04AGGGCCCACCTAGTGGGCCCAATTNONE 
J090032O15AGGGCCCACCTAGTGGGCCCAATTNONE 
J090045A18AGGGCCCACCTAGTGGGCCCAATTNONE 
J090060B21AGGGCCCACCTAGTGGGCCCAATTNONE 
J090086F23AGGGCCCACCTAGTGGGCCCAATTNONE 
J090098O22AGGGCCCACCTAGTGGGCCCAATTNONE 
J100018K20AGGGCCCACCTAGTGGGCCCAATTNONE 
J100048P22AGGGCCCACCTAGTGGGCCCAATTNONE 
J100052I06AGGGCCCACCTAGTGGGCCCAATTNONE 
Os08g0532300009-122-A05CCTGTCAGTTTGTGGGCCCACCTNONE 
009-129-H05CCTGTCAGTTTGTGGGCCCACCTNONE 
AB011262CCTGTCAGTTTGTGGGCCCACCTNONE 
AK065141CCTGTCAGTTTGTGGGCCCACCTNONE 
AK119730CCTGTCAGTTTGTGGGCCCACCTSimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14CCTGTCAGTTTGTGGGCCCACCTNONE 
J013042K23CCTGTCAGTTTGTGGGCCCACCTNONE 
J023057J08CCTGTCAGTTTGTGGGCCCACCTNONE 
J023057N10CCTGTCAGTTTGTGGGCCCACCTNONE 
J023113C21CCTGTCAGTTTGTGGGCCCACCTNONE 
J053054E03CCTGTCAGTTTGTGGGCCCACCTNONE 
J053062B07CCTGTCAGTTTGTGGGCCCACCTNONE 
J053075O17CCTGTCAGTTTGTGGGCCCACCTNONE 
J053075P09CCTGTCAGTTTGTGGGCCCACCTNONE 
J065024H05CCTGTCAGTTTGTGGGCCCACCTNONE 
J065049F22CCTGTCAGTTTGTGGGCCCACCTNONE 
J065063L03CCTGTCAGTTTGTGGGCCCACCTNONE 
J065102O07CCTGTCAGTTTGTGGGCCCACCTNONE 
J065104M12CCTGTCAGTTTGTGGGCCCACCTNONE 
J065119E04CCTGTCAGTTTGTGGGCCCACCTNONE 
J065153E10CCTGTCAGTTTGTGGGCCCACCTNONE 
J065168M24CCTGTCAGTTTGTGGGCCCACCTNONE 
J065173I10CCTGTCAGTTTGTGGGCCCACCTNONE 
J065181L04CCTGTCAGTTTGTGGGCCCACCTNONE 
J065184I18CCTGTCAGTTTGTGGGCCCACCTNONE 
J065203M15CCTGTCAGTTTGTGGGCCCACCTNONE 
J075004C21CCTGTCAGTTTGTGGGCCCACCTNONE 
J075047B11CCTGTCAGTTTGTGGGCCCACCTNONE 
J075055F18CCTGTCAGTTTGTGGGCCCACCTNONE 
J075065G09CCTGTCAGTTTGTGGGCCCACCTNONE 
J075094O14CCTGTCAGTTTGTGGGCCCACCTNONE 
J075143C22CCTGTCAGTTTGTGGGCCCACCTNONE 
J075153K18CCTGTCAGTTTGTGGGCCCACCTNONE 
J075164N10CCTGTCAGTTTGTGGGCCCACCTNONE 
J075197C11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080001A01CCTGTCAGTTTGTGGGCCCACCTNONE 
J080003B11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080006G17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080007J06CCTGTCAGTTTGTGGGCCCACCTNONE 
J080010H12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080014I01CCTGTCAGTTTGTGGGCCCACCTNONE 
J080015C16CCTGTCAGTTTGTGGGCCCACCTNONE 
J080016P19CCTGTCAGTTTGTGGGCCCACCTNONE 
J080020G24CCTGTCAGTTTGTGGGCCCACCTNONE 
J080021E12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080023I11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080024H24CCTGTCAGTTTGTGGGCCCACCTNONE 
J080025G18CCTGTCAGTTTGTGGGCCCACCTNONE 
J080028H08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080030G08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080031H20CCTGTCAGTTTGTGGGCCCACCTNONE 
J080034C20CCTGTCAGTTTGTGGGCCCACCTNONE 
J080040H13CCTGTCAGTTTGTGGGCCCACCTNONE 
J080044M04CCTGTCAGTTTGTGGGCCCACCTNONE 
J080047D02CCTGTCAGTTTGTGGGCCCACCTNONE 
J080049D17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080049J17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080050A05CCTGTCAGTTTGTGGGCCCACCTNONE 
J080051C11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080051K06CCTGTCAGTTTGTGGGCCCACCTNONE 
J080053A07CCTGTCAGTTTGTGGGCCCACCTNONE 
J080053I08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080056L12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080061I19CCTGTCAGTTTGTGGGCCCACCTNONE 
J080075G09CCTGTCAGTTTGTGGGCCCACCTNONE 
J080078C23CCTGTCAGTTTGTGGGCCCACCTNONE 
J080080I21CCTGTCAGTTTGTGGGCCCACCTNONE 
J080084F04CCTGTCAGTTTGTGGGCCCACCTNONE 
J080085K16CCTGTCAGTTTGTGGGCCCACCTNONE 
J080097A12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080097N01CCTGTCAGTTTGTGGGCCCACCTNONE 
J090027L10CCTGTCAGTTTGTGGGCCCACCTNONE 
J100034N17CCTGTCAGTTTGTGGGCCCACCTNONE 
Os08g0532400AK101608AGGTGGGCCCACAAACTGACAGGSimilar to AT.I.24-7 protein. 
Os08g0547200AK101130AGTGACACTGACAGGTGGGCCCCACGRabGAP/TBC domain containing protein. 
AK119577AGTGACACTGACAGGTGGGCCCCACGNONE 
Os08g0560900AK120366GCCCACCTNONE 
Os09g0103600015-027-H02AGGTGGGCCTNONE 
AK064099AGGTGGGCCTPRP38 family protein. 
J065127H08AGGTGGGCCTNONE 
J065195O10AGGTGGGCCTNONE 
J100057E16AGGTGGGCCTNONE 
J100064I23AGGTGGGCCTNONE 
Os09g0111100AK103499AGGTGGGCCyclin-like domain containing protein. 
J033131B09AGGTGGGCNONE 
Os09g0129600J065058B14AGGTGGGCSite-specific recombinase family protein. 
J065215K24AGGTGGGCNONE 
Os09g0306700J023045A19AAAAGCCCACCTNONE 
Os09g0347900AK071224GGCCGGGCCCACCTGConserved hypothetical protein. 
J023087B12GGCCGGGCCCACCTGNONE 
Os09g0348800AK063411CCACGGCCCACCTGTGGGCCCAAACConserved hypothetical protein. 
Os09g0363700AK103667CTGACAGGTGGGCCCCConserved hypothetical protein. 
J075001L14CTGACAGGTGGGCCCCNONE 
J075049M23CTGACAGGTGGGCCCCNONE 
J075051I04CTGACAGGTGGGCCCCNONE 
J075073L04CTGACAGGTGGGCCCCNONE 
J075077E03CTGACAGGTGGGCCCCNONE 
J075083J11CTGACAGGTGGGCCCCNONE 
J075094J22CTGACAGGTGGGCCCCNONE 
J075112E08CTGACAGGTGGGCCCCNONE 
J075137J23CTGACAGGTGGGCCCCNONE 
J075192E02CTGACAGGTGGGCCCCNONE 
J100039K04CTGACAGGTGGGCCCCNONE 
Os09g0371200J100027I16CAGGTGGGCCCCACGTMajor facilitator superfamily MFS_1 protein. 
Os09g0376000AK119322CAGGTGGGCCCGConserved hypothetical protein. 
Os09g0382500009-117-E11AGGTGGGCNONE 
AK105199AGGTGGGCConserved hypothetical protein. 
Os09g0402100009-119-F11GACAGGTGGGCCCCACTCCNONE 
009-166-C09GACAGGTGGGCCCCACTCCNONE 
AK068506GACAGGTGGGCCCCACTCCPF1 protein. 
J065130I01GACAGGTGGGCCCCACTCCNONE 
L24390GACAGGTGGGCCCCACTCCNONE 
Os09g0416400J075067A16TCGGACGGCGGAGAGGTGGGCCCGGAConserved hypothetical protein. 
J075104N21TCGGACGGCGGAGAGGTGGGCCCGGANONE 
J075106F04TCGGACGGCGGAGAGGTGGGCCCGGANONE 
J075131F08TCGGACGGCGGAGAGGTGGGCCCGGANONE 
Os09g0424600AK073882ACAGGTGGGCCCCACGTGGCHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0465600AB107218CCCGGGCCCACCTNONE 
AK068061CCCGGGCCCACCTSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509CCCGGGCCCACCTNONE 
Os09g0482740006-098-F12CACTGACAGGTGGGCCCGNONE 
AK061852CACTGACAGGTGGGCCCGProtein of unknown function DUF1664 family protein. 
J013032I17CACTGACAGGTGGGCCCGNONE 
J013119L22CACTGACAGGTGGGCCCGNONE 
J065114C06CACTGACAGGTGGGCCCGNONE 
J090059O06CACTGACAGGTGGGCCCGNONE 
J090062K09CACTGACAGGTGGGCCCGNONE 
J100031O03CACTGACAGGTGGGCCCGNONE 
J100038P06CACTGACAGGTGGGCCCGNONE 
J100051M18CACTGACAGGTGGGCCCGNONE 
J100075H20CACTGACAGGTGGGCCCGNONE 
J100077O11CACTGACAGGTGGGCCCGNONE 
Os09g0491660AK108335AGGTGGGCCCCAGHomeodomain-like containing protein. 
Os09g0516600AK070780AGGTGGGCCCCACGGCCCGNONE 
AK103563AGGTGGGCCCCACGGCCCGNONE 
AY054407AGGTGGGCCCCACGGCCCGGlyoxalase II. 
J013058P06AGGTGGGCCCCACGGCCCGNONE 
J013093G04AGGTGGGCCCCACGGCCCGNONE 
J023007G05AGGTGGGCCCCACGGCCCGNONE 
J023091A08AGGTGGGCCCCACGGCCCGNONE 
J023136K23AGGTGGGCCCCACGGCCCGNONE 
J023138D20AGGTGGGCCCCACGGCCCGNONE 
J033022N20AGGTGGGCCCCACGGCCCGNONE 
J033065N15AGGTGGGCCCCACGGCCCGNONE 
J033109L23AGGTGGGCCCCACGGCCCGNONE 
J053073C08AGGTGGGCCCCACGGCCCGNONE 
J075094J24AGGTGGGCCCCACGGCCCGNONE 
J075106P21AGGTGGGCCCCACGGCCCGNONE 
Os09g0528000AK072633GACAGGTGGGCCCCGTGGGNONE 
AK100918GACAGGTGGGCCCCGTGGGKinesin, motor region domain containing protein. 
Os11g0121600009-188-D01AGGTGGGCCCCACANONE 
AK063194AGGTGGGCCCCACANONE 
AK121832AGGTGGGCCCCACAConserved hypothetical protein. 
J065041E23AGGTGGGCCCCACANONE 
J065114N21AGGTGGGCCCCACANONE 
Os11g0131200J065024D18AGGTGGGCCAAMpv17/PMP22 family protein. 
J065206C17AGGTGGGCCAANONE 
Os11g0159000AK065738CAGGTGGGCCCCACGTGConserved hypothetical protein. 
Os11g0216100AK059179CAGGTGGGCCCCACGSimilar to Chaperone protein dnaJ. 
Os11g0216400Os11g0216400GAGGCCCACCTProteinase inhibitor, propeptide domain containing protein. 
Os11g0297900AK067692CAGGTGGGCTTASimilar to Txnl4b protein. 
J013118F01CAGGTGGGCTTANONE 
J023066E22CAGGTGGGCTTANONE 
J023066E24CAGGTGGGCTTANONE 
Os11g0453900AK109096GCCCACCTGDehydrin RAB 16D. 
Os11g0473000AK060156CAGGTGGGCCNONE 
AK065994CAGGTGGGCCSimilar to ER lumen protein retaining receptor (HDEL receptor) (PGP169-12). 
AK104759CAGGTGGGCCNONE 
Os11g0484300AK121422GCCCACCTSimilar to Mcm2-prov protein. 
Os11g0525600AK068415GACAGGTGGGCCCCACCACSimilar to Alpha-mannosidase. 
AK098929GACAGGTGGGCCCCACCACNONE 
J013026M18GACAGGTGGGCCCCACCACNONE 
J013050K16GACAGGTGGGCCCCACCACNONE 
J013156L24GACAGGTGGGCCCCACCACNONE 
J023022H22GACAGGTGGGCCCCACCACNONE 
J023065I09GACAGGTGGGCCCCACCACNONE 
J023084F23GACAGGTGGGCCCCACCACNONE 
J033111G01GACAGGTGGGCCCCACCACNONE 
J053026C09GACAGGTGGGCCCCACCACNONE 
J053027J02GACAGGTGGGCCCCACCACNONE 
J053061N23GACAGGTGGGCCCCACCACNONE 
J053086A13GACAGGTGGGCCCCACCACNONE 
J053094C15GACAGGTGGGCCCCACCACNONE 
J075094C03GACAGGTGGGCCCCACCACNONE 
J075150B17GACAGGTGGGCCCCACCACNONE 
J090097L07GACAGGTGGGCCCCACCACNONE 
J100025O15GACAGGTGGGCCCCACCACNONE 
J100077N15GACAGGTGGGCCCCACCACNONE 
Os11g0549615AK069660TCCGGGCCCACCTGAcid phosphatase, type 5 family protein. 
J023031L04TCCGGGCCCACCTGNONE 
Os11g0549620006-091-C11GTGTGGGGCCCACCTGNONE 
AK061321GTGTGGGGCCCACCTGSimilar to Purple acid phosphatase. 
AK106004GTGTGGGGCCCACCTGNONE 
Os11g0549690J065085G07ATTTGGGCCCACCTGTConserved hypothetical protein. 
J065218B08ATTTGGGCCCACCTGTNONE 
J090036H16ATTTGGGCCCACCTGTNONE 
Os11g0580000AK119421CTGACAGGTGGGCCCCAGArmadillo-like helical domain containing protein. 
AK121905CTGACAGGTGGGCCCCAGNONE 
J033105I06CTGACAGGTGGGCCCCAGNONE 
J090022C10CTGACAGGTGGGCCCCAGNONE 
J090024J23CTGACAGGTGGGCCCCAGNONE 
J090044F24CTGACAGGTGGGCCCCAGNONE 
Os11g0585900AK070793CCAGCCCACCTSimilar to ETO1-like protein 1 (Ethylene overproducer 1-like protein 1). 
Os11g0629200AK065196ATGGCCCACCTSimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os12g0158700J065021C04GGGGCCCACCTNONE 
J090082H20GGGGCCCACCTConserved hypothetical protein. 
Os12g0197400J013068J02CTGGGGCCCACCTGTCAGNONE 
J013074K04CTGGGGCCCACCTGTCAGNONE 
J013089J21CTGGGGCCCACCTGTCAGNONE 
J013170B12CTGGGGCCCACCTGTCAGNONE 
J033029L11CTGGGGCCCACCTGTCAGNONE 
J033051A07CTGGGGCCCACCTGTCAGGTP-binding protein, HSR1-related domain containing protein. 
J033092L18CTGGGGCCCACCTGTCAGNONE 
J065101D01CTGGGGCCCACCTGTCAGNONE 
J065144J23CTGGGGCCCACCTGTCAGNONE 
J065206D18CTGGGGCCCACCTGTCAGNONE 
Os12g0287200009-067-B11AGCCCACCTNONE 
009-130-F06AGCCCACCTNONE 
009-185-H10AGCCCACCTNONE 
AF338343AGCCCACCTNONE 
AK063847AGCCCACCTSimilar to Mago nashi protein. 
AK121477AGCCCACCTNONE 
J023149H05AGCCCACCTNONE 
J065019G18AGCCCACCTNONE 
J065049J18AGCCCACCTNONE 
J065143C22AGCCCACCTNONE 
J075130D23AGCCCACCTNONE 
J090014I22AGCCCACCTNONE 
J090018A06AGCCCACCTNONE 
J090053H11AGCCCACCTNONE 
J090080N13AGCCCACCTNONE 
J100019H19AGCCCACCTNONE 
Os12g0408800AK059660ATGGCCCACCTNONE 
AK068032ATGGCCCACCTNONE 
J013131D11ATGGCCCACCTNONE 
Os12g0442700AK111062AGGTGGGCTTTTHypothetical protein. 
J065080H14AGGTGGGCTTTTNONE 
J075019H22AGGTGGGCTTTTNONE 
J075088M09AGGTGGGCTTTTNONE 
Os12g0472800AK063278AGGGCCCACCTGTCAGB repeat unit of collagen binding surface protein (cna) containing protein. 
Os12g0597500AK101904CAGGTGGGCCTCNONE 
AK103799CAGGTGGGCCTCAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CAGGTGGGCCTCNONE 
J100078O15CAGGTGGGCCTCNONE 
Os12g0599900AK101252ATGGCCCACCTGTCAGTetratricopeptide region domain containing protein. 
J033032F05ATGGCCCACCTGTCAGNONE 
Os12g0605400009-005-G05CTCGGCCCAACCCAGCCCACCTNONE 
016-024-B01CTCGGCCCAACCCAGCCCACCTNONE 
016-043-A11CTCGGCCCAACCCAGCCCACCTNONE 
AK068060CTCGGCCCAACCCAGCCCACCTSimilar to CROC-1-like protein (Fragment). 
J013130B07CTCGGCCCAACCCAGCCCACCTNONE 
J023141C14CTCGGCCCAACCCAGCCCACCTNONE 
J033037O04CTCGGCCCAACCCAGCCCACCTNONE 
J033081L17CTCGGCCCAACCCAGCCCACCTNONE 
J033108C03CTCGGCCCAACCCAGCCCACCTNONE 
J065079G22CTCGGCCCAACCCAGCCCACCTNONE 
J065082D03CTCGGCCCAACCCAGCCCACCTNONE 
J065207O15CTCGGCCCAACCCAGCCCACCTNONE 
J075027C23CTCGGCCCAACCCAGCCCACCTNONE 
J075037A17CTCGGCCCAACCCAGCCCACCTNONE 
J075056D17CTCGGCCCAACCCAGCCCACCTNONE 
J075064O21CTCGGCCCAACCCAGCCCACCTNONE 
J075096E08CTCGGCCCAACCCAGCCCACCTNONE 
J090036I15CTCGGCCCAACCCAGCCCACCTNONE 
J100018P15CTCGGCCCAACCCAGCCCACCTNONE 
J100074O06CTCGGCCCAACCCAGCCCACCTNONE 
Os12g0605900AK109696TCCGGCCCACCTSimilar to Kinase like protein. 
Os12g0638500AK072720TCCACGCCCACCTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.