version

Summary of OsREG477 (All List)

OrganismOryza sativa  
IDOsREG477  
SequenceAGTGACAC  
Annotation  
PPDB Motif 
PLACE MotifTGAC  "A core of TGAC-containing W-box" of, e.g., Amy32b promoter; Binding site of rice WRKY71, a transcriptional repressor of the gibberellin signaling pathway; Parsley WRKY proteins bind specifically to TGAC-containing W box elements within the Pathogenesis-Related Class10 (PR-10) genes (Eulgem et al., 1999); See S000390 (TTGAC), S000442 (TGACT);  
Total Entry Count722  

Entry Sequences (722 entries)

LocusGene modelSequenceDescription
Os01g0156300AK107993GTGTCACTGACASimilar to Cappuccino protein. 
Os01g0232400AK101990AGTGACACSimilar to VHS1 protein (Fragment). 
AK106519AGTGACACNONE 
Os01g0238700AK121040AGTGACACOligopeptide transporter OPT superfamily protein. 
Os01g0266500009-027-D05CCATGGGCCCCACTTGTCAGTGACACNONE 
AK101084CCATGGGCCCCACTTGTCAGTGACACPhenazine biosynthesis PhzC/PhzF protein family protein. 
Os01g0342800J065046B02AGTGACACNONE 
J065059I08AGTGACACNONE 
J065074A14AGTGACACNONE 
J065147C02AGTGACACNONE 
J065176F09AGTGACACNONE 
J065199J12AGTGACACConserved hypothetical protein. 
Os01g0585600AK064970GTGTCACTProtein of unknown function DUF630 domain containing protein. 
J013001B11GTGTCACTNONE 
J013022O03GTGTCACTNONE 
J013042J20GTGTCACTNONE 
J023054F01GTGTCACTNONE 
J023123A12GTGTCACTNONE 
J023131L21GTGTCACTNONE 
J033034D10GTGTCACTNONE 
J033066H09GTGTCACTNONE 
J033091L15GTGTCACTNONE 
J043024B12GTGTCACTNONE 
J065064L08GTGTCACTNONE 
J065206J15GTGTCACTNONE 
J090036E08GTGTCACTNONE 
J090053B06GTGTCACTNONE 
J090060D05GTGTCACTNONE 
J090085L13GTGTCACTNONE 
Os01g0624700AK111416AGTGACACSimilar to WRKY transcription factor 12. 
AY676924AGTGACACNONE 
AY870601AGTGACACNONE 
Os01g0631200J023080H07AGTGACACNONE 
J023125G17AGTGACACNONE 
J033132A13AGTGACACNONE 
J065179I22AGTGACACNONE 
J090027C06AGTGACACNONE 
Os01g0633200AK069077GTGTCACTSimilar to X1 (Fragment). 
Os01g0694500AK108063GTGTCACTConserved hypothetical protein. 
Os01g0716200AK062106GTGTCACTGACAGIQ calmodulin-binding region domain containing protein. 
AK098920GTGTCACTGACAGNONE 
J013002N06GTGTCACTGACAGNONE 
J013050O19GTGTCACTGACAGNONE 
J013074N19GTGTCACTGACAGNONE 
J013127F17GTGTCACTGACAGNONE 
J013155C17GTGTCACTGACAGNONE 
J013158K07GTGTCACTGACAGNONE 
J053086D01GTGTCACTGACAGNONE 
Os01g0738400AK110661GTGTCACTSimilar to Zn-finger transcription factor. 
Os01g0752600AK100905GTGTCACTGlycosyl transferase, family 19 protein. 
Os01g0761000009-179-C02GTGTCACTNONE 
J065021D10GTGTCACTNONE 
J065031F21GTGTCACTNONE 
J065034O07GTGTCACTNONE 
J065052B16GTGTCACTNONE 
J065091N13GTGTCACTConserved hypothetical protein. 
J065191H14GTGTCACTNONE 
J065193H05GTGTCACTNONE 
J065201J08GTGTCACTNONE 
J075034A10GTGTCACTNONE 
J075042C03GTGTCACTNONE 
J075066L14GTGTCACTNONE 
J075082B03GTGTCACTNONE 
J075133C16GTGTCACTNONE 
J075164B05GTGTCACTNONE 
J090023N23GTGTCACTNONE 
Os01g0770800AK109200GTGTCACTCtr copper transporter family protein. 
Os01g0778700AK064933GTGTCACTConserved hypothetical protein. 
Os01g0847100009-045-C07GTGTCACTNONE 
009-167-C07GTGTCACTNONE 
016-093-C03GTGTCACTNONE 
AK063795GTGTCACTConserved hypothetical protein. 
AK121513GTGTCACTNONE 
J033024P15GTGTCACTNONE 
Os01g0870100AK067564GTGTCACTProtein of unknown function DUF1012 family protein. 
AK072312GTGTCACTNONE 
AK103428GTGTCACTNONE 
Os01g0956200006-108-G08CACGTGTCACTNONE 
AK068399CACGTGTCACTProtein of unknown function DUF563 family protein. 
AK106051CACGTGTCACTNONE 
J013149N20CACGTGTCACTNONE 
J023085G19CACGTGTCACTNONE 
J033070C20CACGTGTCACTNONE 
J065080C11CACGTGTCACTNONE 
J090038M06CACGTGTCACTNONE 
J100038I20CACGTGTCACTNONE 
J100039D17CACGTGTCACTNONE 
Os01g0962700006-045-H03GTGTCACTNONE 
006-047-B04GTGTCACTNONE 
006-048-D03GTGTCACTNONE 
006-052-G01GTGTCACTNONE 
006-057-D10GTGTCACTNONE 
006-060-E09GTGTCACTNONE 
006-066-H03GTGTCACTNONE 
006-080-B11GTGTCACTNONE 
006-080-H10GTGTCACTNONE 
006-084-C03GTGTCACTNONE 
006-088-C11GTGTCACTNONE 
006-100-H05GTGTCACTNONE 
006-100-H08GTGTCACTNONE 
006-118-D03GTGTCACTNONE 
006-118-D05GTGTCACTNONE 
006-119-A03GTGTCACTNONE 
009-165-A12GTGTCACTNONE 
009-191-E06GTGTCACTNONE 
013-007-G06GTGTCACTNONE 
013-039-D01GTGTCACTNONE 
014-070-H12GTGTCACTNONE 
AK073009GTGTCACTNONE 
AK104065GTGTCACTNONE 
AK104420GTGTCACTSimilar to Peroxidase 12 precursor (EC 1.11.1.7) (Atperox P12) (PRXR6) (ATP4a). 
AK109340GTGTCACTNONE 
AK119199GTGTCACTNONE 
J023009N24GTGTCACTNONE 
J023145L12GTGTCACTNONE 
J023147D10GTGTCACTNONE 
J065027K02GTGTCACTNONE 
J065119C19GTGTCACTNONE 
Os02g0130300011-005-D07AGTGACACNONE 
011-041-B06AGTGACACNONE 
015-099-D11AGTGACACNONE 
016-049-D06AGTGACACNONE 
AK102708AGTGACACZinc finger, RING-type domain containing protein. 
Os02g0161800AK105544AGTGACACSimilar to Peroxidase precursor (EC 1.11.1.7). 
J065205H23AGTGACACNONE 
Os02g0192500AK102694AGTGACACSimilar to Cellulose synthase-like protein (Fragment). 
Os02g0205400AK101434GTGTCACTGACAWD40-like domain containing protein. 
J043024M20GTGTCACTGACANONE 
Os02g0320300AK067650AGTGACACHypothetical protein. 
Os02g0490000AK106789AGTGACACU box domain containing protein. 
Os02g0510600AK073949GTGTCACTHeavy metal transport/detoxification protein domain containing protein. 
AK120359GTGTCACTNONE 
J013067J06GTGTCACTNONE 
Os02g0608500AK071922AGTGACACNONE 
AK099756AGTGACACSimilar to Ankyrin-kinase protein (Fragment). 
Os02g0611500AK072083AGTGACACSimilar to Eukaryotic initiation factor-like protein. 
Os02g0659100AK107559AGTGACACZinc finger, C2H2-type domain containing protein. 
Os02g0686300AK066567CGCGCGAGTGACACConserved hypothetical protein. 
Os02g0745400AK072229AAAAGCCCCACATGTCAGTGACACGlycosyl transferase, family 8 protein. 
AK108072AAAAGCCCCACATGTCAGTGACACNONE 
Os02g0750500AK101960GTGTCACTGACATGTGGGGCCTGGSAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05GTGTCACTGACATGTGGGGCCTGGNONE 
J065054F02GTGTCACTGACATGTGGGGCCTGGNONE 
J065124N03GTGTCACTGACATGTGGGGCCTGGNONE 
J090001H12GTGTCACTGACATGTGGGGCCTGGNONE 
J100057J01GTGTCACTGACATGTGGGGCCTGGNONE 
J100062F12GTGTCACTGACATGTGGGGCCTGGNONE 
Os02g0752300AK072544CCCACCACGTGTCACTConserved hypothetical protein. 
J023132N16CCCACCACGTGTCACTNONE 
J033069F17CCCACCACGTGTCACTNONE 
Os02g0756600009-128-A01GTGTCACTNONE 
AK062900GTGTCACTSimilar to Phi-1 protein. 
J065039J24GTGTCACTNONE 
Os02g0762600AK103657AGTGACACNONE 
AK110321AGTGACACConserved hypothetical protein. 
J033135G19AGTGACACNONE 
J090004E21AGTGACACNONE 
J100067M04AGTGACACNONE 
Os02g0766700AK072062GTGTCACTSimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 2) (AREB2). 
J100073F09GTGTCACTNONE 
Os02g0778200AK065948GTGTCACTAminoacyl-tRNA synthetase, class I family protein. 
Os03g0158800AK108516AGTGACACACTGACASimilar to P69C protein. 
J065013G11AGTGACACACTGACANONE 
Os03g0212300AK070861GTGTCACTTranscriptional factor B3 family protein. 
Os03g0274000AK119251GTGTCACTNONE 
J080046E19GTGTCACTNONE 
J080050M05GTGTCACTNONE 
J080057N03GTGTCACTNONE 
J080061A16GTGTCACTNONE 
J080094M24GTGTCACTNONE 
J090013O05GTGTCACTNONE 
Os03g0285900AK073348GTGTCACTSimilar to Splicing factor RSZ33. 
J033025D08GTGTCACTNONE 
J033087M12GTGTCACTNONE 
J065008F11GTGTCACTNONE 
J065059C09GTGTCACTNONE 
J065070J11GTGTCACTNONE 
J065076L20GTGTCACTNONE 
J065083M19GTGTCACTNONE 
J065111I06GTGTCACTNONE 
J065112H18GTGTCACTNONE 
J065112J18GTGTCACTNONE 
J065140C08GTGTCACTNONE 
J065180P06GTGTCACTNONE 
J065187G12GTGTCACTNONE 
J065189B14GTGTCACTNONE 
J090042N02GTGTCACTNONE 
J090087M04GTGTCACTNONE 
Os03g0310600AK109731GTGTCACTProtein of unknown function DUF247, plant family protein. 
Os03g0387100AB026559GTGTCACTNONE 
AF022735GTGTCACTNONE 
AK058567GTGTCACTProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195GTGTCACTNONE 
J033030J15GTGTCACTNONE 
J033102N16GTGTCACTNONE 
J065056E08GTGTCACTNONE 
J065112M11GTGTCACTNONE 
J065170H07GTGTCACTNONE 
J075003P17GTGTCACTNONE 
J075074D06GTGTCACTNONE 
J075127F20GTGTCACTNONE 
J075129I01GTGTCACTNONE 
J075178A10GTGTCACTNONE 
J090071P12GTGTCACTNONE 
J100090D18GTGTCACTNONE 
Os03g0722500AK099926AGTGACACGlycoside hydrolase, family 17 protein. 
AK100108AGTGACACNONE 
J023004N24AGTGACACNONE 
J100018K24AGTGACACNONE 
J100032B22AGTGACACNONE 
J100036K14AGTGACACNONE 
J100043B05AGTGACACNONE 
Os03g0780400011-100-D09CCCACCTGTCAGTGACACNONE 
AK061347CCCACCTGTCAGTGACACNONE 
AK073162CCCACCTGTCAGTGACACSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22CCCACCTGTCAGTGACACNONE 
J065045I07CCCACCTGTCAGTGACACNONE 
J090036F17CCCACCTGTCAGTGACACNONE 
J090077M14CCCACCTGTCAGTGACACNONE 
J100055G20CCCACCTGTCAGTGACACNONE 
Os03g0781000AK065910GTGTCACTSimilar to GTP-dependent nucleic acid-binding protein engD. 
Os03g0786800AK059186GTGTCACTSimilar to Cullin-4A (CUL-4A). 
Os03g0817200AK121940GTGTCACTAmino acid/polyamine transporter II family protein. 
J033107D18GTGTCACTNONE 
J065141D04GTGTCACTNONE 
Os03g0818100015-098-A09GGTGACGTGTCACTNONE 
AK064366GGTGACGTGTCACTNONE 
AK121701GGTGACGTGTCACTHistidine acid phosphatase family protein. 
Os03g0838100011-054-D06GTGTCACTNONE 
011-077-A11GTGTCACTNONE 
015-079-D06GTGTCACTNONE 
AK066616GTGTCACTNONE 
AK119863GTGTCACTNONE 
AK119881GTGTCACTNONE 
AK119894GTGTCACTCurculin-like (mannose-binding) lectin domain containing protein. 
J013074M03GTGTCACTNONE 
J033051E08GTGTCACTNONE 
J100060E05GTGTCACTNONE 
Os03g0839900AK067347CTGTCAGTGACACUspA domain containing protein. 
Os04g0266900011-064-A07CACGTGTCACTNONE 
AK069447CACGTGTCACTBacterial transketolase family protein. 
J023019B19CACGTGTCACTNONE 
Os04g0291000Os04g0291000AGTGACACGlucose/ribitol dehydrogenase family protein. 
Os04g0432000AB125308GTGTCACTSerine/threonine-protein kinase SAPK7 (EC 2.7.1.37) (Osmotic stress/abscisic acid-activated protein kinase 7). 
AK122087GTGTCACTNONE 
J065206O17GTGTCACTNONE 
Os04g0451200006-041-H09AGTGACACNONE 
AK061024AGTGACACUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK068176AGTGACACNONE 
J065045M24AGTGACACNONE 
Os04g0456700009-080-F10GTGTCACTNONE 
009-143-C10GTGTCACTNONE 
AK065178GTGTCACTSimilar to TMV induced protein 1-2. 
J013002D12GTGTCACTNONE 
J065027N14GTGTCACTNONE 
J065139E16GTGTCACTNONE 
J065165D09GTGTCACTNONE 
J065179D14GTGTCACTNONE 
J065198C03GTGTCACTNONE 
J065198L22GTGTCACTNONE 
J075139M08GTGTCACTNONE 
J075150D14GTGTCACTNONE 
J075172F01GTGTCACTNONE 
J075197F03GTGTCACTNONE 
J090059E16GTGTCACTNONE 
J100063J01GTGTCACTNONE 
J100085F13GTGTCACTNONE 
J100088O10GTGTCACTNONE 
Os04g0492600AK072226GTGTCACTAnticodon-binding domain containing protein. 
Os04g0514500AK073502AGTGACACNONE 
J090058N12AGTGACACNONE 
Os04g0552400AK069623CACGTGTCACTSimilar to ZPT2-13. 
J023023M18CACGTGTCACTNONE 
J023063H11CACGTGTCACTNONE 
Os04g0585200AK073062AGTGACACNONE 
Os04g0663200006-074-D02GTGTCACTNONE 
AK105958GTGTCACTZinc finger, CCCH-type domain containing protein. 
AK111925GTGTCACTNONE 
Os05g0119300004-011-B09AGTGACACNONE 
006-063-A03AGTGACACNONE 
006-077-E12AGTGACACNONE 
006-079-E12AGTGACACNONE 
006-100-B11AGTGACACNONE 
009-109-A12AGTGACACNONE 
009-123-C07AGTGACACNONE 
009-163-D09AGTGACACNONE 
009-170-D11AGTGACACNONE 
009-173-C01AGTGACACNONE 
009-192-E01AGTGACACNONE 
011-048-G01AGTGACACNONE 
AK060883AGTGACACNONE 
AK068289AGTGACACNONE 
AK071554AGTGACACNONE 
AK099495AGTGACACXYPPX repeat containing protein. 
AY348312AGTGACACNONE 
J013037L16AGTGACACNONE 
J013088P04AGTGACACNONE 
J013099D14AGTGACACNONE 
J013146E19AGTGACACNONE 
J013147E18AGTGACACNONE 
J023104E19AGTGACACNONE 
J023128O20AGTGACACNONE 
J023132D16AGTGACACNONE 
J023143E13AGTGACACNONE 
J033028F15AGTGACACNONE 
J033133D24AGTGACACNONE 
J053091M07AGTGACACNONE 
J075029L15AGTGACACNONE 
J075097M12AGTGACACNONE 
J075103J11AGTGACACNONE 
J075138J10AGTGACACNONE 
J075172K18AGTGACACNONE 
J080001C15AGTGACACNONE 
J080002M13AGTGACACNONE 
J080009K01AGTGACACNONE 
J080010N01AGTGACACNONE 
J080011D23AGTGACACNONE 
J080013C13AGTGACACNONE 
J080013M16AGTGACACNONE 
J080018J02AGTGACACNONE 
J080020F03AGTGACACNONE 
J080020G05AGTGACACNONE 
J080021D05AGTGACACNONE 
J080030A19AGTGACACNONE 
J080031A16AGTGACACNONE 
J080033J23AGTGACACNONE 
J080035H07AGTGACACNONE 
J080039M24AGTGACACNONE 
J080042B16AGTGACACNONE 
J080043B03AGTGACACNONE 
J080045G01AGTGACACNONE 
J080045K17AGTGACACNONE 
J080047A09AGTGACACNONE 
J080047I22AGTGACACNONE 
J080048M14AGTGACACNONE 
J080049J02AGTGACACNONE 
J080052C15AGTGACACNONE 
J080052E11AGTGACACNONE 
J080052M22AGTGACACNONE 
J080056O21AGTGACACNONE 
J080059J04AGTGACACNONE 
J080059O17AGTGACACNONE 
J080064N04AGTGACACNONE 
J080066A03AGTGACACNONE 
J080066I22AGTGACACNONE 
J080069C13AGTGACACNONE 
J080069J03AGTGACACNONE 
J080069N04AGTGACACNONE 
J080071A01AGTGACACNONE 
J080071C03AGTGACACNONE 
J080071J02AGTGACACNONE 
J080080D17AGTGACACNONE 
J080084O06AGTGACACNONE 
J080085O20AGTGACACNONE 
J080086H15AGTGACACNONE 
J080094K06AGTGACACNONE 
J080095C05AGTGACACNONE 
J080095G04AGTGACACNONE 
J080096F03AGTGACACNONE 
J080096F20AGTGACACNONE 
J090004H05AGTGACACNONE 
J090012P10AGTGACACNONE 
J090021B09AGTGACACNONE 
J090034M08AGTGACACNONE 
J090046G21AGTGACACNONE 
J090055K24AGTGACACNONE 
J090055L05AGTGACACNONE 
J090057H17AGTGACACNONE 
J090082K21AGTGACACNONE 
J100022A07AGTGACACNONE 
J100022M02AGTGACACNONE 
J100069K11AGTGACACNONE 
J100086C24AGTGACACNONE 
Os05g0188100009-011-G07AGTGACACGTGGCNONE 
009-015-G06AGTGACACGTGGCNONE 
009-021-B03AGTGACACGTGGCNONE 
009-024-A09AGTGACACGTGGCNONE 
009-025-A03AGTGACACGTGGCNONE 
009-028-G03AGTGACACGTGGCNONE 
009-029-G10AGTGACACGTGGCNONE 
009-034-G12AGTGACACGTGGCNONE 
009-039-D05AGTGACACGTGGCNONE 
009-055-F08AGTGACACGTGGCNONE 
009-064-B05AGTGACACGTGGCNONE 
009-066-H12AGTGACACGTGGCNONE 
009-077-B10AGTGACACGTGGCNONE 
009-102-B06AGTGACACGTGGCNONE 
009-113-F04AGTGACACGTGGCNONE 
009-114-F04AGTGACACGTGGCConserved hypothetical protein. 
009-131-G06AGTGACACGTGGCNONE 
009-137-H11AGTGACACGTGGCNONE 
009-172-H10AGTGACACGTGGCNONE 
009-176-D08AGTGACACGTGGCNONE 
009-182-A01AGTGACACGTGGCNONE 
009-183-A04AGTGACACGTGGCNONE 
009-183-G03AGTGACACGTGGCNONE 
009-185-B10AGTGACACGTGGCNONE 
009-192-F10AGTGACACGTGGCNONE 
009-196-G01AGTGACACGTGGCNONE 
011-005-A09AGTGACACGTGGCNONE 
013-031-B12AGTGACACGTGGCNONE 
013-031-F12AGTGACACGTGGCNONE 
013-032-A08AGTGACACGTGGCNONE 
013-069-H06AGTGACACGTGGCNONE 
013-089-C10AGTGACACGTGGCNONE 
J065123I11AGTGACACGTGGCNONE 
J065124F15AGTGACACGTGGCNONE 
J065155D05AGTGACACGTGGCNONE 
J065181J22AGTGACACGTGGCNONE 
J065185B07AGTGACACGTGGCNONE 
J065186J11AGTGACACGTGGCNONE 
J075183H21AGTGACACGTGGCNONE 
J080003P06AGTGACACGTGGCNONE 
J080068G17AGTGACACGTGGCNONE 
J080069J05AGTGACACGTGGCNONE 
J080080D03AGTGACACGTGGCNONE 
J080080K22AGTGACACGTGGCNONE 
J080090D12AGTGACACGTGGCNONE 
J080092I03AGTGACACGTGGCNONE 
J100039B06AGTGACACGTGGCNONE 
J100047N15AGTGACACGTGGCNONE 
Os05g0195700006-027-E05AGTGACACNONE 
AK061427AGTGACACNONE 
AK065594AGTGACACSimilar to Transcription factor MYBS2. 
J013029P13AGTGACACNONE 
J065048A06AGTGACACNONE 
J065080L03AGTGACACNONE 
J065103D11AGTGACACNONE 
J065106I19AGTGACACNONE 
J065198K16AGTGACACNONE 
Os05g0222200AK068591AGTGACACABC transporter related domain containing protein. 
AK070374AGTGACACNONE 
Os05g0361700AJ575218GTGTCACTNONE 
AK100184GTGTCACTSimilar to EREBP-2 protein (Fragment). 
AK111676GTGTCACTNONE 
J013155B14GTGTCACTNONE 
J065073N01GTGTCACTNONE 
J065161J12GTGTCACTNONE 
J075074A07GTGTCACTNONE 
J100029H13GTGTCACTNONE 
Os05g0406100AK069515GTGTCACTInosine/uridine-preferring nucleoside hydrolase domain containing protein. 
J023019G14GTGTCACTNONE 
Os05g0437800015-045-B10AGTGACACNONE 
AK106328AGTGACACConserved hypothetical protein. 
Os05g0445000AK111423AGTGACACConserved hypothetical protein. 
Os05g0446000AK070640GTGTCACTSimilar to Transcriptional activator DEMETER (DNA glycosylase-related protein DME). 
Os05g0456300006-096-G05GTGTCACTNONE 
006-108-F09GTGTCACTNONE 
AK061843GTGTCACTNONE 
AK068616GTGTCACTSimilar to Aldose reductase. 
J013156J23GTGTCACTNONE 
J023080O21GTGTCACTNONE 
J043031L21GTGTCACTNONE 
Os05g0503300011-013-H12GTGTCACTGACAGTGGGACCCACCACNONE 
012-072-B03GTGTCACTGACAGTGGGACCCACCACNONE 
AK073969GTGTCACTGACAGTGGGACCCACCACSimilar to Sulfite reductase (Fragment). 
AK100773GTGTCACTGACAGTGGGACCCACCACNONE 
AK103289GTGTCACTGACAGTGGGACCCACCACNONE 
J013045K07GTGTCACTGACAGTGGGACCCACCACNONE 
J033075F01GTGTCACTGACAGTGGGACCCACCACNONE 
J033125N07GTGTCACTGACAGTGGGACCCACCACNONE 
J033130G12GTGTCACTGACAGTGGGACCCACCACNONE 
Os05g0567500AK073046AGTGACACNONE 
AK121133AGTGACACDNA glycosylase family protein. 
J023075P20AGTGACACNONE 
Os05g0581800006-040-C10AGTGACACNONE 
AK106199AGTGACACNONE 
Os05g0586600AB096011CCACGTGTCACTPlastid sigma factor SIG5. 
AB096071CCACGTGTCACTNONE 
AK105697CCACGTGTCACTNONE 
Os06g0225400AK109268AGTGACACConserved hypothetical protein. 
Os06g0258900AK067794AGTGACACKetose-bisphosphate aldolase, class-II family protein. 
AK099384AGTGACACNONE 
Os06g0589600AK111758GTGTCACTProtein kinase-like domain containing protein. 
J100032C08GTGTCACTNONE 
J100067P18GTGTCACTNONE 
Os06g0646600AB061818AGTGACACKNOX family class 2 homeodomain protein. 
J023088C09AGTGACACNONE 
J065162G03AGTGACACNONE 
Os06g0681200AK107980AGTGACACCupredoxin domain containing protein. 
Os06g0683600009-130-D10AGTGACACNONE 
009-162-E11AGTGACACNONE 
AK103599AGTGACACConserved hypothetical protein. 
J033133F14AGTGACACNONE 
J065041F11AGTGACACNONE 
J065179G17AGTGACACNONE 
Os06g0698785AJ578494AGTGACACSimilar to Choline monooxygenase, chloroplast precursor (EC 1.14.15.7). 
Os06g0706400AK064899AGTGACACSimilar to Peptide transporter PTR2-B (Histidine transporting protein). 
J013000L13AGTGACACNONE 
J013043C22AGTGACACNONE 
J013073L22AGTGACACNONE 
J033022L23AGTGACACNONE 
J065098I07AGTGACACNONE 
J075074K18AGTGACACNONE 
J090090M23AGTGACACNONE 
J100021C24AGTGACACNONE 
J100042I21AGTGACACNONE 
J100074M14AGTGACACNONE 
Os07g0227700AK120258AGTGACACConserved hypothetical protein. 
J090030H24AGTGACACNONE 
Os07g0503300003-129-C11GTGTCACTNONE 
006-089-D03GTGTCACTNONE 
012-065-H03GTGTCACTNONE 
012-089-D02GTGTCACTNONE 
AK105785GTGTCACTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK106005GTGTCACTNONE 
J033148M01GTGTCACTNONE 
J090008M07GTGTCACTNONE 
J090014K23GTGTCACTNONE 
J090015J19GTGTCACTNONE 
Os07g0579100AK066662AGTGACACConserved hypothetical protein. 
Os07g0600000006-021-B09AGTGACACNONE 
006-028-D09AGTGACACNONE 
013-065-H09AGTGACACNONE 
AK105907AGTGACACConserved hypothetical protein. 
Os07g0603100AK101352AGTGACACNuclear transport factor 2 domain containing protein. 
J023077E09AGTGACACNONE 
J023081N15AGTGACACNONE 
J033022N22AGTGACACNONE 
J033024M18AGTGACACNONE 
J033034P09AGTGACACNONE 
J033046A06AGTGACACNONE 
J033051K01AGTGACACNONE 
J033081P09AGTGACACNONE 
J033091B17AGTGACACNONE 
J033092K23AGTGACACNONE 
J033132J09AGTGACACNONE 
J033144A14AGTGACACNONE 
J033145A14AGTGACACNONE 
J043021B20AGTGACACNONE 
J053024D23AGTGACACNONE 
J065212J10AGTGACACNONE 
J090055M05AGTGACACNONE 
J090065E14AGTGACACNONE 
J090092J06AGTGACACNONE 
Os07g0619800AK067709GTGTCACTSimilar to CDPK-related protein kinase (EC 2.7.1.-) (PK421). 
AK121343GTGTCACTNONE 
Os07g0621201J065152G13GTGTCACTConserved hypothetical protein. 
Os07g0671400AK067933AGTGACACHeavy metal transport/detoxification protein domain containing protein. 
Os08g0110400AK100025AGTGACACATGGGCCCCACCCCACGCGProtein of unknown function DUF266, plant family protein. 
Os08g0113000AK069503AGTGACACSimilar to Peroxidase 47 precursor (EC 1.11.1.7) (Atperox P47) (ATP32). 
J023019J18AGTGACACNONE 
J100038M17AGTGACACNONE 
J100057K08AGTGACACNONE 
Os08g0135100AK108618GTGTCACTSimilar to Phosphate/phosphoenolpyruvate translocator protein-like. 
Os08g0387500AK105106AGTGACACSimilar to Sulfated surface glycoprotein 185 precursor (SSG 185). 
Os08g0484200J075096L14GTGTCACTZinc finger, RING-type domain containing protein. 
Os08g0492500AK065316GTGTCACTRINGv domain containing protein. 
J013002P08GTGTCACTNONE 
Os08g0503800AK101954AGTGACACSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
Os08g0504400014-015-C10GTGTCACTNONE 
AK069190GTGTCACTSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089GTGTCACTNONE 
J023006O19GTGTCACTNONE 
J033041C11GTGTCACTNONE 
Os08g0531000AK072408GTGTCACTSimilar to Diphosphonucleotide phosphatase 1 precursor. 
Os08g0541400003-128-C08AGTGACACGTGGACCNONE 
AK068255AGTGACACGTGGACCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
AK104009AGTGACACGTGGACCNONE 
J013129J12AGTGACACGTGGACCNONE 
J013149F15AGTGACACGTGGACCNONE 
J065187N18AGTGACACGTGGACCNONE 
Os08g0547200AK101130AGTGACACTGACAGGTGGGCCCCACGRabGAP/TBC domain containing protein. 
AK119577AGTGACACTGACAGGTGGGCCCCACGNONE 
Os08g0556900AK072235GTGTCACTSimilar to Cysteine proteinase (EC 3.4.22.-). 
AK099308GTGTCACTNONE 
AK105612GTGTCACTNONE 
J100051D13GTGTCACTNONE 
Os08g0557400006-024-C02AGTGACACNONE 
AK060067AGTGACACProtein tyrosine phosphatase-like protein. 
AY224424AGTGACACNONE 
Os09g0103300009-007-D10GTGTCACTNONE 
AK062317GTGTCACTHypothetical protein. 
Os09g0111800004-013-C09AGTGACACNONE 
006-085-E01AGTGACACNONE 
016-037-E02AGTGACACNONE 
AK060898AGTGACACNONE 
AK069338AGTGACACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013039A09AGTGACACNONE 
J023012N03AGTGACACNONE 
J033029N15AGTGACACNONE 
J033064E17AGTGACACNONE 
J080305G19AGTGACACNONE 
J080305N02AGTGACACNONE 
J080306B09AGTGACACNONE 
J080310C20AGTGACACNONE 
J080311A20AGTGACACNONE 
J080311G17AGTGACACNONE 
J080316J11AGTGACACNONE 
J090054J05AGTGACACNONE 
J090055M10AGTGACACNONE 
J090059H08AGTGACACNONE 
Os09g0414600AK069500GTGTCACTSimilar to ZF-HD homeobox protein (Fragment). 
J023022H01GTGTCACTNONE 
Os09g0467200006-086-D04TGTCAGTGTCACTNONE 
006-093-B03TGTCAGTGTCACTNONE 
006-115-F01TGTCAGTGTCACTNONE 
009-132-H11TGTCAGTGTCACTNONE 
AF402804TGTCAGTGTCACTNONE 
AK060223TGTCAGTGTCACTNONE 
AK061838TGTCAGTGTCACTNONE 
AK099489TGTCAGTGTCACTSimilar to Glutathione S-transferase GST 23 (EC 2.5.1.18) (Fragment). 
J013024P12TGTCAGTGTCACTNONE 
J013026J15TGTCAGTGTCACTNONE 
J013067O05TGTCAGTGTCACTNONE 
J023025K15TGTCAGTGTCACTNONE 
J023038N16TGTCAGTGTCACTNONE 
J033090D10TGTCAGTGTCACTNONE 
J033108J22TGTCAGTGTCACTNONE 
J033132E03TGTCAGTGTCACTNONE 
J043015F15TGTCAGTGTCACTNONE 
J065039I10TGTCAGTGTCACTNONE 
J065041G24TGTCAGTGTCACTNONE 
J065095G11TGTCAGTGTCACTNONE 
J065105A02TGTCAGTGTCACTNONE 
J065163M03TGTCAGTGTCACTNONE 
J065179I01TGTCAGTGTCACTNONE 
J065189F19TGTCAGTGTCACTNONE 
J065218F23TGTCAGTGTCACTNONE 
J075083K12TGTCAGTGTCACTNONE 
J080002H04TGTCAGTGTCACTNONE 
J090098I19TGTCAGTGTCACTNONE 
J100045A04TGTCAGTGTCACTNONE 
J100086O07TGTCAGTGTCACTNONE 
J100090L17TGTCAGTGTCACTNONE 
Os09g0479400AK109596GTGTCACTPhenylalanyl-tRNA synthetase, class IIc family protein. 
Os09g0481600AK108636AGTGACACConserved hypothetical protein. 
Os09g0493700015-091-G11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
AK068501AGCCCACCCTCATGGGCCCAGATGTCAGTGACACSimilar to CUC2. 
AK099237AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J013155B08AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023006E01AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023060K23AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023100B11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033026L19AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033129J12AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033149K09AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065045I06AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065061A10AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065101H05AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065135A03AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065169C16AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047C11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047K07AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
Os09g0519200009-006-A07GTGTCACTNONE 
009-092-E11GTGTCACTNONE 
009-124-A12GTGTCACTNONE 
009-140-E10GTGTCACTNONE 
009-151-A11GTGTCACTNONE 
AK063004GTGTCACTConserved hypothetical protein. 
AK067759GTGTCACTNONE 
J080001K23GTGTCACTNONE 
J080005M03GTGTCACTNONE 
J080010I19GTGTCACTNONE 
J080016E11GTGTCACTNONE 
J080020C09GTGTCACTNONE 
J080021H12GTGTCACTNONE 
J080022D22GTGTCACTNONE 
J080022H06GTGTCACTNONE 
J080028M15GTGTCACTNONE 
J080032J10GTGTCACTNONE 
J080034F22GTGTCACTNONE 
J080040E05GTGTCACTNONE 
J080042G22GTGTCACTNONE 
J080042N10GTGTCACTNONE 
J080050H02GTGTCACTNONE 
J080053L12GTGTCACTNONE 
J080058G15GTGTCACTNONE 
J080062O15GTGTCACTNONE 
J080063B17GTGTCACTNONE 
J080066C10GTGTCACTNONE 
J080066M23GTGTCACTNONE 
J080067L18GTGTCACTNONE 
J080069F06GTGTCACTNONE 
J080069F08GTGTCACTNONE 
J080069P19GTGTCACTNONE 
J080077P18GTGTCACTNONE 
J080079E24GTGTCACTNONE 
J080079J12GTGTCACTNONE 
J080086C03GTGTCACTNONE 
J080089I24GTGTCACTNONE 
J080090I06GTGTCACTNONE 
J080096D06GTGTCACTNONE 
J080096N03GTGTCACTNONE 
Os09g0539800AK058903AGTGACACSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D29690AGTGACACNONE 
Os09g0554200AK108361AGTGACACZinc finger, RING-type domain containing protein. 
Os09g0566100J013035O15AGTGACACNONE 
J013132B07AGTGACACNONE 
J023049I24AGTGACACNONE 
J033033A21AGTGACACNONE 
J033057C14AGTGACACNONE 
Os11g0156600Os11g0156600AGTGACACTB2/DP1 and HVA22 related protein family protein. 
Os11g0216400Os11g0216400AGTGACACProteinase inhibitor, propeptide domain containing protein. 
Os11g0271000AK110686AGTGACACNONE 
Os11g0283500AK101066GTGTCACTNONE 
AK105635GTGTCACTTGF-beta receptor, type I/II extracellular region family protein. 
J033023F23GTGTCACTNONE 
J065072H02GTGTCACTNONE 
J065085N15GTGTCACTNONE 
J065140C05GTGTCACTNONE 
J065168F02GTGTCACTNONE 
J100083G04GTGTCACTNONE 
Os11g0689100AK073759GTGTCACTDisease resistance protein family protein. 
AK108692GTGTCACTNONE 
Os12g0209800AK059152GTGTCACTHypothetical protein. 
Os12g0236801J065054O05GTGTCACTHypothetical protein. 
J065056J10GTGTCACTNONE 
Os12g0242500J065129F10AGTGACACGTGGGCCTCNONE 
J090032G12AGTGACACGTGGGCCTCConserved hypothetical protein. 
Os12g0292900AK067612GTGTCACTGACAConserved hypothetical protein. 
Os12g0477400J100045P07AGTGACACNo apical meristem (NAM) protein domain containing protein. 
J100046N20AGTGACACNONE 
Os12g0485000AK070912AGTGACACPeptidase M22, glycoprotease domain containing protein. 
Os12g0597200AK059486GTGTCACTHypothetical protein. 
J090004E03GTGTCACTNONE 
J090021F01GTGTCACTNONE 
Os12g0618300AK101466TGTCAGTGACACSimilar to GTP-binding protein-like (Fragment). 
Os12g0625000006-117-H03AGTGACACNONE 
AF073695AGTGACACNONE 
AK061993AGTGACACNONE 
AK099598AGTGACACCysteine synthase (EC 2.5.1.47) (O-acetylserine sulfhydrylase) (O- acetylserine (Thiol)-lyase) (CSase) (OAS-TL). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.