version

Summary of OsREG478 (All List)

OrganismOryza sativa  
IDOsREG478  
SequenceAGTGGGCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2456  

Entry Sequences (2456 entries)

LocusGene modelSequenceDescription
Os01g0132700J065063N10AGTGGGCCTCSurfeit locus 5 family protein. 
J065164N24AGTGGGCCTCNONE 
J065167H04AGTGGGCCTCNONE 
J065187N12AGTGGGCCTCNONE 
Os01g0132800AK068422AGTGGGCCTAPeptidyl-tRNA hydrolase family protein. 
Os01g0145200J100017K24CAAGTGGGCCCAGTANONE 
Os01g0159800015-032-D03AGTGGGCCCAGGNONE 
AK106292AGTGGGCCCAGGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J053031O06AGTGGGCCCAGGNONE 
J053035H22AGTGGGCCCAGGNONE 
J065095A07AGTGGGCCCAGGNONE 
J100017I21AGTGGGCCCAGGNONE 
Os01g0209000AK103701CAAGTGGGCCTAAlg9-like mannosyltransferase family protein. 
J065104C04CAAGTGGGCCTANONE 
J090083C01CAAGTGGGCCTANONE 
Os01g0219200AK108579CCAGGCCCACTTGTCAGTGConserved hypothetical protein. 
Os01g0246100AK120732CAAGTGGGCCGGCProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0281100AK109672GCGGGCCCACTTGTCAGTGConserved hypothetical protein. 
J065013K07GCGGGCCCACTTGTCAGTGNONE 
J065040E15GCGGGCCCACTTGTCAGTGNONE 
J065127F12GCGGGCCCACTTGTCAGTGNONE 
J075155K23GCGGGCCCACTTGTCAGTGNONE 
Os01g0283000AK073165GAGGCCCACTConserved hypothetical protein. 
J033023G08GAGGCCCACTNONE 
Os01g0283100004-018-B01AGTGGGCCTCNONE 
AK060908AGTGGGCCTCNONE 
AK071713AGTGGGCCTCSimilar to Ferripyochelin-binding protein-like. 
AK104205AGTGGGCCTCNONE 
AK122051AGTGGGCCTCNONE 
J023109L19AGTGGGCCTCNONE 
Os01g0286000AK109824AACGGGCCGTAAGTGGGCCGAGSnf7 family protein. 
Os01g0327500AK107756TGTGGGGCCCACTConserved hypothetical protein. 
Os01g0391100012-001-B05CCTGGGCCCACTTGNONE 
012-053-F01CCTGGGCCCACTTGNONE 
AK063499CCTGGGCCCACTTGNONE 
J065021A04CCTGGGCCCACTTGNONE 
J065076H06CCTGGGCCCACTTGNONE 
J065181E05CCTGGGCCCACTTGNONE 
J065187A05CCTGGGCCCACTTGNONE 
J075036C17CCTGGGCCCACTTGNONE 
J075051C18CCTGGGCCCACTTGNONE 
J075063L16CCTGGGCCCACTTGNONE 
J075079M08CCTGGGCCCACTTGNONE 
J075112H15CCTGGGCCCACTTGNONE 
J075135F10CCTGGGCCCACTTGNONE 
J075164H06CCTGGGCCCACTTGNONE 
J075195N02CCTGGGCCCACTTGNONE 
Os01g0587000AK067605GGGGCCCACTSimilar to Vacuolar ATP synthase subunit d (EC 3.6.3.14) (V-ATPase d subunit) (Vacuolar proton pump d subunit) (V-ATPase 41 KDa accessory protein) (DVA41). 
Os01g0596300016-083-D09AGTGGGCCCAGTNONE 
AK069151AGTGGGCCCAGTCyclin-like F-box domain containing protein. 
J023007D17AGTGGGCCCAGTNONE 
J065141M02AGTGGGCCCAGTNONE 
Os01g0618500011-019-D03GAGGCCCACTACGGCCCACCTNONE 
AK067476GAGGCCCACTACGGCCCACCTSimilar to RNA helicase (Fragment). 
J013020E19GAGGCCCACTACGGCCCACCTNONE 
J033046J12GAGGCCCACTACGGCCCACCTNONE 
J033055D06GAGGCCCACTACGGCCCACCTNONE 
Os01g0626100AK066892TAATGGGCCCACTTGAdaptin, N-terminal domain containing protein. 
J013050G23TAATGGGCCCACTTGNONE 
J013060F03TAATGGGCCCACTTGNONE 
J013088A19TAATGGGCCCACTTGNONE 
J013105M18TAATGGGCCCACTTGNONE 
J013108D15TAATGGGCCCACTTGNONE 
J013118M09TAATGGGCCCACTTGNONE 
J023009J17TAATGGGCCCACTTGNONE 
J023078I22TAATGGGCCCACTTGNONE 
J023103F15TAATGGGCCCACTTGNONE 
J023105B22TAATGGGCCCACTTGNONE 
J033024C18TAATGGGCCCACTTGNONE 
J033032N02TAATGGGCCCACTTGNONE 
J033041E20TAATGGGCCCACTTGNONE 
J033068L19TAATGGGCCCACTTGNONE 
J033076E16TAATGGGCCCACTTGNONE 
J033084J03TAATGGGCCCACTTGNONE 
J033090A13TAATGGGCCCACTTGNONE 
J033106C19TAATGGGCCCACTTGNONE 
J033116N13TAATGGGCCCACTTGNONE 
J033127C24TAATGGGCCCACTTGNONE 
J033129M02TAATGGGCCCACTTGNONE 
J033145J02TAATGGGCCCACTTGNONE 
J043005F08TAATGGGCCCACTTGNONE 
J043007L22TAATGGGCCCACTTGNONE 
J043031E03TAATGGGCCCACTTGNONE 
J043035J19TAATGGGCCCACTTGNONE 
J053027K20TAATGGGCCCACTTGNONE 
J065058I24TAATGGGCCCACTTGNONE 
J065078A06TAATGGGCCCACTTGNONE 
J065085E09TAATGGGCCCACTTGNONE 
J065093L04TAATGGGCCCACTTGNONE 
J065099H07TAATGGGCCCACTTGNONE 
J065102D09TAATGGGCCCACTTGNONE 
J065136J19TAATGGGCCCACTTGNONE 
J065182P21TAATGGGCCCACTTGNONE 
J065200F03TAATGGGCCCACTTGNONE 
J090004E22TAATGGGCCCACTTGNONE 
J090013K22TAATGGGCCCACTTGNONE 
J090019A03TAATGGGCCCACTTGNONE 
J090057B09TAATGGGCCCACTTGNONE 
J090066F19TAATGGGCCCACTTGNONE 
J090071M22TAATGGGCCCACTTGNONE 
J090075E16TAATGGGCCCACTTGNONE 
J090086D23TAATGGGCCCACTTGNONE 
Os01g0654500013-057-E05CAAGTGGGCCCCACGNONE 
AF155333CAAGTGGGCCCCACGNONE 
AK061752CAAGTGGGCCCCACGSimilar to NADP-isocitrate dehydrogenase. 
D21069CAAGTGGGCCCCACGNONE 
Os01g0666500AK102689GGCCGGGCCCACTConserved hypothetical protein. 
Os01g0689900AK064656CGTGTGGCCCACTNONE 
AK102164CGTGTGGCCCACTProtein kinase-like domain containing protein. 
J033043D15CGTGTGGCCCACTNONE 
J033060J20CGTGTGGCCCACTNONE 
J033086H03CGTGTGGCCCACTNONE 
J033117B10CGTGTGGCCCACTNONE 
J053023O03CGTGTGGCCCACTNONE 
J053055P21CGTGTGGCCCACTNONE 
J053078A20CGTGTGGCCCACTNONE 
J053082K03CGTGTGGCCCACTNONE 
J053086A16CGTGTGGCCCACTNONE 
J080027C22CGTGTGGCCCACTNONE 
J080062G19CGTGTGGCCCACTNONE 
J080065M03CGTGTGGCCCACTNONE 
J100068P17CGTGTGGCCCACTNONE 
Os01g0690800AK066430CGTGTGGCCCACTProtein kinase-like domain containing protein. 
AK073248CGTGTGGCCCACTNONE 
J065001D22CGTGTGGCCCACTNONE 
J065116J04CGTGTGGCCCACTNONE 
J100044K03CGTGTGGCCCACTNONE 
Os01g0691500AK073675AGTGGGCCCAGGNONE 
AK107426AGTGGGCCCAGGCytidylyltransferase domain containing protein. 
J013055P17AGTGGGCCCAGGNONE 
J033050M21AGTGGGCCCAGGNONE 
Os01g0691600AK103297CCTGGGCCCACTSimilar to DNA repair helicase XPB2 (EC 3.6.1.-) (XPB homolog 2) (ERCC3 homolog 2) (RAD25 homolog 2) (AtXPB2). 
Os01g0720600016-050-G11AGAGTGGGCCGGTNONE 
AK066808AGAGTGGGCCGGTNONE 
AK100976AGAGTGGGCCGGTNONE 
AK106541AGAGTGGGCCGGTStarch synthase IVa (Glycogen (Starch) synthase-like). 
AY373257AGAGTGGGCCGGTNONE 
J100039H11AGAGTGGGCCGGTNONE 
J100072K02AGAGTGGGCCGGTNONE 
Os01g0730300AK101207GTCAGTGGGCCGTCCHAD-superfamily hydrolase subfamily IIB protein. 
AK109542GTCAGTGGGCCGTCCNONE 
Os01g0757700AK102734CCACTGACAGTGGGCCTCConserved hypothetical protein. 
J033106B06CCACTGACAGTGGGCCTCNONE 
J065025B07CCACTGACAGTGGGCCTCNONE 
J065025B08CCACTGACAGTGGGCCTCNONE 
J065033E12CCACTGACAGTGGGCCTCNONE 
J065197B01CCACTGACAGTGGGCCTCNONE 
Os01g0805000009-045-H11AGTGGGCCTANONE 
009-196-H08AGTGGGCCTANONE 
J013094D22AGTGGGCCTARibosomal protein L34 family protein. 
J013119F23AGTGGGCCTANONE 
J065128B11AGTGGGCCTANONE 
Os01g0835500AK100241GCGGGCCCACTSimilar to Respiratory burst oxidase protein. 
Os01g0838300J090017B22AGTGGGCCGTTGNONE 
J090061B04AGTGGGCCGTTGNONE 
Os01g0839300AK064685GAGGCCCACTGGGCCGAAASimilar to 50S ribosomal protein L17. 
J065060I21GAGGCCCACTGGGCCGAAANONE 
Os01g0861000AK058707TAGGCCCACTConserved hypothetical protein. 
Os01g0865100016-066-A05AGTGGGCCCCACCNONE 
AK065779AGTGGGCCCCACCNONE 
AK071410AGTGGGCCCCACCSimilar to Uricase (Fragment). 
J013039E23AGTGGGCCCCACCNONE 
J023024I07AGTGGGCCCCACCNONE 
J065160J15AGTGGGCCCCACCNONE 
J090052J17AGTGGGCCCCACCNONE 
Os01g0866300006-029-F08GGCCGGGCCCACTNONE 
006-074-E10GGCCGGGCCCACTNONE 
006-079-E11GGCCGGGCCCACTNONE 
009-048-A05GGCCGGGCCCACTNONE 
AK059875GGCCGGGCCCACTNONE 
J043005O17GGCCGGGCCCACTNONE 
Os01g0908100AK072293AGTGGGCCCTRabGAP/TBC domain containing protein. 
J065010B13AGTGGGCCCTNONE 
J065010M12AGTGGGCCCTNONE 
J065047C19AGTGGGCCCTNONE 
J065069B18AGTGGGCCCTNONE 
J065071K24AGTGGGCCCTNONE 
J065142P04AGTGGGCCCTNONE 
J065170E11AGTGGGCCCTNONE 
Os01g0911700012-079-H01AGTGGGCCCAGANONE 
012-088-G05AGTGGGCCCAGANONE 
012-099-A01AGTGGGCCCAGANONE 
015-009-H07AGTGGGCCCAGANONE 
015-035-H12AGTGGGCCCAGANONE 
016-054-G03AGTGGGCCCAGANONE 
AK073805AGTGGGCCCAGASimilar to Regulatory protein viviparous-1. 
AK105441AGTGGGCCCAGANONE 
J033069I02AGTGGGCCCAGANONE 
J033086K01AGTGGGCCCAGANONE 
Os01g0918200009-034-H02GCGGGCCCACTNONE 
AK062434GCGGGCCCACTSimilar to Ubiquitin-like protein SMT3. 
AK103092GCGGGCCCACTNONE 
J065093P18GCGGGCCCACTNONE 
J065137C15GCGGGCCCACTNONE 
J065156G01GCGGGCCCACTNONE 
J065206H16GCGGGCCCACTNONE 
J065209D03GCGGGCCCACTNONE 
J075073K05GCGGGCCCACTNONE 
J075099B17GCGGGCCCACTNONE 
J075166N04GCGGGCCCACTNONE 
Os01g0920000AK069967GAGGCCCACTCBS domain containing protein. 
Os01g0931300012-055-E05AGTGGGCCCGNONE 
AK068196AGTGGGCCCGTafazzin family protein. 
AK099213AGTGGGCCCGNONE 
Os01g0950900AK101121AGTGGGCCGAGProtein of unknown function DUF221 domain containing protein. 
J023036H24AGTGGGCCGAGNONE 
J023084G23AGTGGGCCGAGNONE 
J033025J04AGTGGGCCGAGNONE 
J033139J18AGTGGGCCGAGNONE 
J090006A09AGTGGGCCGAGNONE 
J090036D02AGTGGGCCGAGNONE 
Os01g0951800AK069239TTGGCCCACTProtein prenyltransferase domain containing protein. 
Os01g0953100AK064981AGTGGGCCGTANONE 
AK068882AGTGGGCCGTAProtein of unknown function DUF594 family protein. 
J013001C07AGTGGGCCGTANONE 
J013169K14AGTGGGCCGTANONE 
J033114G07AGTGGGCCGTANONE 
J065035K15AGTGGGCCGTANONE 
J065082E12AGTGGGCCGTANONE 
Os01g0963300AK067544CTGGCCCACGGCCCACTSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os01g0966400AK103064AGTGGGCCCCACALeucine-rich repeat, SDS22 containing protein. 
J023043O12AGTGGGCCCCACANONE 
J053084D04AGTGGGCCCCACANONE 
J090021L08AGTGGGCCCCACANONE 
Os01g0969100AK070623GGAGTGGGCCACNAD-dependent epimerase/dehydratase family protein. 
Os02g0119700AK108777TTGGCCCAAATACGGCCCACTProtein prenyltransferase domain containing protein. 
Os02g0121100012-035-F06CAAGGCCCACTCCCCCACGNONE 
013-031-H05CAAGGCCCACTCCCCCACGNONE 
013-058-E11CAAGGCCCACTCCCCCACGNONE 
014-010-D01CAAGGCCCACTCCCCCACGNONE 
AK070711CAAGGCCCACTCCCCCACGConserved hypothetical protein. 
AK119758CAAGGCCCACTCCCCCACGNONE 
J013033G12CAAGGCCCACTCCCCCACGNONE 
J023007M16CAAGGCCCACTCCCCCACGNONE 
J023020K20CAAGGCCCACTCCCCCACGNONE 
J023061H10CAAGGCCCACTCCCCCACGNONE 
J033027H20CAAGGCCCACTCCCCCACGNONE 
J033051E18CAAGGCCCACTCCCCCACGNONE 
J090005F12CAAGGCCCACTCCCCCACGNONE 
J090017A20CAAGGCCCACTCCCCCACGNONE 
J090018G11CAAGGCCCACTCCCCCACGNONE 
J090062C18CAAGGCCCACTCCCCCACGNONE 
J100027N10CAAGGCCCACTCCCCCACGNONE 
J100032L14CAAGGCCCACTCCCCCACGNONE 
J100045C14CAAGGCCCACTCCCCCACGNONE 
J100061M09CAAGGCCCACTCCCCCACGNONE 
J100062K11CAAGGCCCACTCCCCCACGNONE 
J100064H11CAAGGCCCACTCCCCCACGNONE 
J100074H16CAAGGCCCACTCCCCCACGNONE 
J100082N01CAAGGCCCACTCCCCCACGNONE 
Os02g0148400AK070451GGCCGTGGGGGCCCACTNONE 
AK072039GGCCGTGGGGGCCCACTPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
J075148J10GGCCGTGGGGGCCCACTNONE 
Os02g0158400006-048-F06ATGGCCCACTNONE 
AK061569ATGGCCCACTssDNA-binding transcriptional regulator family protein. 
AK099479ATGGCCCACTNONE 
AK104768ATGGCCCACTNONE 
J013025B22ATGGCCCACTNONE 
J023009C03ATGGCCCACTNONE 
J033115N14ATGGCCCACTNONE 
J065036F05ATGGCCCACTNONE 
J065191K17ATGGCCCACTNONE 
J065202K16ATGGCCCACTNONE 
J075053E14ATGGCCCACTNONE 
J075101E04ATGGCCCACTNONE 
J075111C06ATGGCCCACTNONE 
J075137O04ATGGCCCACTNONE 
J075139E07ATGGCCCACTNONE 
J075143K07ATGGCCCACTNONE 
J075144K15ATGGCCCACTNONE 
J075164L14ATGGCCCACTNONE 
J075199D06ATGGCCCACTNONE 
J090010G24ATGGCCCACTNONE 
J090017C18ATGGCCCACTNONE 
J090066F01ATGGCCCACTNONE 
J090088G01ATGGCCCACTNONE 
Os02g0177700AK119941CAAGTGGGCCCCACCProtein of unknown function DUF588 family protein. 
Os02g0178400009-151-B08AACTGGGCCCACTNONE 
AK063815AACTGGGCCCACTProtein transport protein SEC61 gamma subunit. 
AK121516AACTGGGCCCACTNONE 
J033026A17AACTGGGCCCACTNONE 
J065011K14AACTGGGCCCACTNONE 
J065056D01AACTGGGCCCACTNONE 
J065061L22AACTGGGCCCACTNONE 
J065076M01AACTGGGCCCACTNONE 
J075092E14AACTGGGCCCACTNONE 
Os02g0186500AK068056AAACGGCCCACTSimilar to Protein kinase-like protein. 
AK099031AAACGGCCCACTNONE 
J013111A12AAACGGCCCACTNONE 
J013127K13AAACGGCCCACTNONE 
J013132O11AAACGGCCCACTNONE 
J023056A11AAACGGCCCACTNONE 
J023078M08AAACGGCCCACTNONE 
J033081F07AAACGGCCCACTNONE 
J090079E24AAACGGCCCACTNONE 
J090097I02AAACGGCCCACTNONE 
Os02g0226900AK064279TTCGGCCCACTProtein prenyltransferase domain containing protein. 
Os02g0435000AK060832TTGGCCCACTNONE 
AK102414TTGGCCCACTTranslocation protein Sec62 family protein. 
Os02g0441000AK108073CTTGGGCCCACTTGConserved hypothetical protein. 
Os02g0510100AK058487CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J053077L04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J065010C11CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J075104O14CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080003G03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080014K05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080026F03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080027O05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080037K15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080039D24CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080043G19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080047P05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080048D22CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080049F23CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080062A21CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080063H20CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080067P15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080068P19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080079J15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080092K19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080096M04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
Os02g0523800AK072296CTGGGGCCCACTInositol polyphosphate kinase family protein. 
J065081E24CTGGGGCCCACTNONE 
Os02g0559300AK100088AGTGGGCCCCACCCCGTCCGANONE 
AK121206AGTGGGCCCCACCCCGTCCGAProtein kinase-like domain containing protein. 
J023003H24AGTGGGCCCCACCCCGTCCGANONE 
J023088A16AGTGGGCCCCACCCCGTCCGANONE 
J023100K01AGTGGGCCCCACCCCGTCCGANONE 
J023127H24AGTGGGCCCCACCCCGTCCGANONE 
Os02g0573400Os02g0573400CAAGTGGGCCCATCGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os02g0578800009-044-A06TGTGGGGCCCACTNONE 
AK070066TGTGGGGCCCACTProtein of unknown function DUF962 family protein. 
Os02g0591800AK060611ACATGGGCTAGGCCCACTBrix domain containing protein. 
AK102534ACATGGGCTAGGCCCACTNONE 
J075057H08ACATGGGCTAGGCCCACTNONE 
J075179P18ACATGGGCTAGGCCCACTNONE 
J080011H01ACATGGGCTAGGCCCACTNONE 
J080018E14ACATGGGCTAGGCCCACTNONE 
J080026N17ACATGGGCTAGGCCCACTNONE 
J080047A13ACATGGGCTAGGCCCACTNONE 
J080049C17ACATGGGCTAGGCCCACTNONE 
J080050G07ACATGGGCTAGGCCCACTNONE 
J080064D10ACATGGGCTAGGCCCACTNONE 
J080080A03ACATGGGCTAGGCCCACTNONE 
J080080G20ACATGGGCTAGGCCCACTNONE 
J080080I03ACATGGGCTAGGCCCACTNONE 
J080081H12ACATGGGCTAGGCCCACTNONE 
J080090K07ACATGGGCTAGGCCCACTNONE 
J080092O06ACATGGGCTAGGCCCACTNONE 
J080096B07ACATGGGCTAGGCCCACTNONE 
J080097M08ACATGGGCTAGGCCCACTNONE 
Os02g0625500011-025-C06AGTGGGCCCCNONE 
AB050624AGTGGGCCCCNONE 
AK059188AGTGGGCCCCNONE 
AK059771AGTGGGCCCCNONE 
AK101791AGTGGGCCCCSimilar to Adenosine kinase-like protein (Fragment). 
AY224510AGTGGGCCCCNONE 
J013152H02AGTGGGCCCCNONE 
J023012P09AGTGGGCCCCNONE 
J023127D16AGTGGGCCCCNONE 
J033024G01AGTGGGCCCCNONE 
J033025L19AGTGGGCCCCNONE 
J033080M04AGTGGGCCCCNONE 
J033101A08AGTGGGCCCCNONE 
J033121L12AGTGGGCCCCNONE 
J043017N15AGTGGGCCCCNONE 
J065207J01AGTGGGCCCCNONE 
J090049G12AGTGGGCCCCNONE 
J100036A07AGTGGGCCCCNONE 
J100076C04AGTGGGCCCCNONE 
J100080N22AGTGGGCCCCNONE 
Os02g0646400AK067828AGTGGGCCGTTSimilar to Glutaredoxin. 
J013120N01AGTGGGCCGTTNONE 
J065021N01AGTGGGCCGTTNONE 
J065021N02AGTGGGCCGTTNONE 
J065053O18AGTGGGCCGTTNONE 
J090067J17AGTGGGCCGTTNONE 
Os02g0651500AK066333GAGGCCCACTNONE 
AK121865GAGGCCCACTHypothetical protein. 
J090038J11GAGGCCCACTNONE 
Os02g0653800J023002B17CAAGTGGGCCTTNONE 
J033067E03CAAGTGGGCCTTSimilar to GTP-binding protein. 
J033105M04CAAGTGGGCCTTNONE 
J053039E15CAAGTGGGCCTTNONE 
J065026L07CAAGTGGGCCTTNONE 
J065038B03CAAGTGGGCCTTNONE 
J065087J15CAAGTGGGCCTTNONE 
J065121B22CAAGTGGGCCTTNONE 
J065128N12CAAGTGGGCCTTNONE 
J065189E19CAAGTGGGCCTTNONE 
J100058B03CAAGTGGGCCTTNONE 
Os02g0656500011-045-C08TCAGGCCCACTNONE 
011-045-E06TCAGGCCCACTNONE 
016-046-A01TCAGGCCCACTNONE 
016-046-B01TCAGGCCCACTNONE 
AK062239TCAGGCCCACTNONE 
AK066420TCAGGCCCACTDnaJ-like protein. 
J013067J21TCAGGCCCACTNONE 
J065047L09TCAGGCCCACTNONE 
J065104M20TCAGGCCCACTNONE 
J065134B04TCAGGCCCACTNONE 
J065152C10TCAGGCCCACTNONE 
J065161O03TCAGGCCCACTNONE 
J065169F18TCAGGCCCACTNONE 
J065210M21TCAGGCCCACTNONE 
J065217B03TCAGGCCCACTNONE 
J065218C10TCAGGCCCACTNONE 
J075041F09TCAGGCCCACTNONE 
J075048A02TCAGGCCCACTNONE 
J075083F21TCAGGCCCACTNONE 
J080005F10TCAGGCCCACTNONE 
J080013P21TCAGGCCCACTNONE 
J080027J09TCAGGCCCACTNONE 
J080037O17TCAGGCCCACTNONE 
J080039F02TCAGGCCCACTNONE 
J080039G01TCAGGCCCACTNONE 
J080041I09TCAGGCCCACTNONE 
J080043M01TCAGGCCCACTNONE 
J080060H17TCAGGCCCACTNONE 
J080062O07TCAGGCCCACTNONE 
J080079F05TCAGGCCCACTNONE 
J080093H04TCAGGCCCACTNONE 
J080096B15TCAGGCCCACTNONE 
J080097H24TCAGGCCCACTNONE 
J090032O11TCAGGCCCACTNONE 
J090044F01TCAGGCCCACTNONE 
J090045E04TCAGGCCCACTNONE 
J090048O03TCAGGCCCACTNONE 
J090049E04TCAGGCCCACTNONE 
J090070E19TCAGGCCCACTNONE 
J090079E13TCAGGCCCACTNONE 
J090089L14TCAGGCCCACTNONE 
J090095K13TCAGGCCCACTNONE 
J090096I19TCAGGCCCACTNONE 
J090098B04TCAGGCCCACTNONE 
J100027P13TCAGGCCCACTNONE 
J100048H06TCAGGCCCACTNONE 
J100060J15TCAGGCCCACTNONE 
J100070K16TCAGGCCCACTNONE 
J100074O22TCAGGCCCACTNONE 
Os02g0677300006-102-D12GAGGCCCAGAGCGGCCCACTNONE 
AK060550GAGGCCCAGAGCGGCCCACTNONE 
AK106041GAGGCCCAGAGCGGCCCACTSimilar to CRT/DRE binding factor 1. 
Os02g0686300AK066567AGAGTGGGCCCGConserved hypothetical protein. 
Os02g0686700AK111294AGGGCCCACTCCProtein of unknown function DUF581 family protein. 
Os02g0725100AK071759ACTGACAGGTGTGGCCCACTNONE 
Os02g0731700AK072346AGTGGGCCCGCSimilar to CONSTANS-like 1 protein. 
AK120314AGTGGGCCCGCNONE 
Os02g0744700AF395537GGTGGGGCCCACTTGNONE 
AJ308110GGTGGGGCCCACTTGNONE 
AK066446GGTGGGGCCCACTTGSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0753000AK121015GCTGGGCCCACTCCSimilar to Trehalose-6-phosphate phosphatase. 
Os02g0771700011-075-D10CTGGCCCACTNONE 
011-086-E10CTGGCCCACTNONE 
AK058571CTGGCCCACTGlycoside hydrolase, family 17 protein. 
AK102185CTGGCCCACTNONE 
J023001D03CTGGCCCACTNONE 
J023041N11CTGGCCCACTNONE 
J033086N13CTGGCCCACTNONE 
J033106K14CTGGCCCACTNONE 
J033125P22CTGGCCCACTNONE 
Os02g0785800005-017-E01TTGGCCCACTNONE 
009-104-F05TTGGCCCACTNONE 
009-149-A09TTGGCCCACTNONE 
009-192-D08TTGGCCCACTNONE 
AK063859TTGGCCCACTNONE 
AK121768TTGGCCCACTSimilar to Ribosomal protein L35A. 
J013037M21TTGGCCCACTNONE 
J023009A11TTGGCCCACTNONE 
J023010P14TTGGCCCACTNONE 
J033092B03TTGGCCCACTNONE 
J065009O06TTGGCCCACTNONE 
J065024K14TTGGCCCACTNONE 
J065053F16TTGGCCCACTNONE 
J065056D18TTGGCCCACTNONE 
J065056N12TTGGCCCACTNONE 
J065071L21TTGGCCCACTNONE 
J065075M21TTGGCCCACTNONE 
J065087D19TTGGCCCACTNONE 
J065111N01TTGGCCCACTNONE 
J065172M05TTGGCCCACTNONE 
J065176E03TTGGCCCACTNONE 
J065184D08TTGGCCCACTNONE 
J065188K21TTGGCCCACTNONE 
J065194I05TTGGCCCACTNONE 
J065196E09TTGGCCCACTNONE 
J065196O21TTGGCCCACTNONE 
J065204O06TTGGCCCACTNONE 
J065212J02TTGGCCCACTNONE 
J075066H03TTGGCCCACTNONE 
J075067C04TTGGCCCACTNONE 
J075070I09TTGGCCCACTNONE 
J075081J03TTGGCCCACTNONE 
J075086I05TTGGCCCACTNONE 
J075092E09TTGGCCCACTNONE 
J075096D13TTGGCCCACTNONE 
J075098A12TTGGCCCACTNONE 
J075110B18TTGGCCCACTNONE 
J075116E14TTGGCCCACTNONE 
J075117J23TTGGCCCACTNONE 
J075117O16TTGGCCCACTNONE 
J075130H10TTGGCCCACTNONE 
J075151B07TTGGCCCACTNONE 
J075156C02TTGGCCCACTNONE 
J075159C07TTGGCCCACTNONE 
J075172O12TTGGCCCACTNONE 
J075181K16TTGGCCCACTNONE 
J075185J05TTGGCCCACTNONE 
J075186D14TTGGCCCACTNONE 
J075187F23TTGGCCCACTNONE 
J075193B15TTGGCCCACTNONE 
J075194P20TTGGCCCACTNONE 
J090002B21TTGGCCCACTNONE 
J090018E03TTGGCCCACTNONE 
J090029I04TTGGCCCACTNONE 
J090065F12TTGGCCCACTNONE 
J090066M05TTGGCCCACTNONE 
J090078A20TTGGCCCACTNONE 
J090084O15TTGGCCCACTNONE 
J090088P20TTGGCCCACTNONE 
J090098L20TTGGCCCACTNONE 
J100025B19TTGGCCCACTNONE 
J100038H15TTGGCCCACTNONE 
J100045H17TTGGCCCACTNONE 
J100058E17TTGGCCCACTNONE 
J100060O16TTGGCCCACTNONE 
J100067I10TTGGCCCACTNONE 
J100082N24TTGGCCCACTNONE 
J100083C17TTGGCCCACTNONE 
J100085I24TTGGCCCACTNONE 
J100087K20TTGGCCCACTNONE 
Os02g0789600AK101046CAAGTGGGCCCTNONE 
AK112100CAAGTGGGCCCTSimilar to DEM2. 
Os02g0798300AK120999AGGGCCCACTConserved hypothetical protein. 
Os02g0800000J100043O08AGTGGGCCAANONE 
J100064O18AGTGGGCCAANONE 
Os02g0824900AK073217AGTGGGCCCATTTNONE 
AK103528AGTGGGCCCATTTConserved hypothetical protein. 
J090069J01AGTGGGCCCATTTNONE 
J090081B04AGTGGGCCCATTTNONE 
Os03g0119100AK069519CAAGTGGGCCCTSimilar to Phospholipase D beta 2. 
J023024E17CAAGTGGGCCCTNONE 
J023122B02CAAGTGGGCCCTNONE 
J090094E15CAAGTGGGCCCTNONE 
Os03g0122000AK101458AGAGTGGGCCCATCGTGTCAGTGProtein kinase-like domain containing protein. 
J013035K10AGAGTGGGCCCATCGTGTCAGTGNONE 
J013050E10AGAGTGGGCCCATCGTGTCAGTGNONE 
J033040C13AGAGTGGGCCCATCGTGTCAGTGNONE 
Os03g0151900009-084-F09GTGGGGCCCACTNONE 
AB032761GTGGGGCCCACTNONE 
AK105389GTGGGGCCCACTNONE 
AK121527GTGGGGCCCACTSimilar to Small GTP-binding protein. 
J075028M03GTGGGGCCCACTNONE 
J075031H15GTGGGGCCCACTNONE 
J075045L24GTGGGGCCCACTNONE 
J075055K14GTGGGGCCCACTNONE 
J075100O08GTGGGGCCCACTNONE 
J075112B20GTGGGGCCCACTNONE 
J075188D21GTGGGGCCCACTNONE 
Os03g0161000AK121425CAAGTGGGCCGGGNONE 
J023135K12CAAGTGGGCCGGGNONE 
Os03g0171700J065192H12CCCGGGCCCACTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0172700AK111307GCCGGCCCACTHypothetical protein. 
Os03g0188200AK058578GGTGGGGCCCACTZinc finger, RING-type domain containing protein. 
Os03g0192400009-081-A03AGTGGGCCCGGCCCNONE 
009-159-B02AGTGGGCCCGGCCCNONE 
AK070573AGTGGGCCCGGCCCGRIM-19 family protein. 
J023056B01AGTGGGCCCGGCCCNONE 
J023075G06AGTGGGCCCGGCCCNONE 
J033048K16AGTGGGCCCGGCCCNONE 
J033048L16AGTGGGCCCGGCCCNONE 
J053031H23AGTGGGCCCGGCCCNONE 
J065002H14AGTGGGCCCGGCCCNONE 
J065006G22AGTGGGCCCGGCCCNONE 
J065032G13AGTGGGCCCGGCCCNONE 
J065056A09AGTGGGCCCGGCCCNONE 
J065078I01AGTGGGCCCGGCCCNONE 
J065095G01AGTGGGCCCGGCCCNONE 
J065095I18AGTGGGCCCGGCCCNONE 
J065134M18AGTGGGCCCGGCCCNONE 
J065158P07AGTGGGCCCGGCCCNONE 
J065165K17AGTGGGCCCGGCCCNONE 
J065181J12AGTGGGCCCGGCCCNONE 
J065189N09AGTGGGCCCGGCCCNONE 
J065200D13AGTGGGCCCGGCCCNONE 
J065202H20AGTGGGCCCGGCCCNONE 
J065215K20AGTGGGCCCGGCCCNONE 
J075049N19AGTGGGCCCGGCCCNONE 
J075147J16AGTGGGCCCGGCCCNONE 
J090081E19AGTGGGCCCGGCCCNONE 
J100017C16AGTGGGCCCGGCCCNONE 
J100039M16AGTGGGCCCGGCCCNONE 
J100043E23AGTGGGCCCGGCCCNONE 
J100063L12AGTGGGCCCGGCCCNONE 
J100079F22AGTGGGCCCGGCCCNONE 
Os03g0195900J065063O15GGAGTGGGCCGGTNONE 
Os03g0200500005-016-A06AGTGGGCCGTCCNONE 
AK069251AGTGGGCCGTCC40S ribosomal protein S3a (CYC07 protein). 
AK104243AGTGGGCCGTCCNONE 
AK104699AGTGGGCCGTCCNONE 
D26060AGTGGGCCGTCCNONE 
J013024H20AGTGGGCCGTCCNONE 
J013029C14AGTGGGCCGTCCNONE 
J013035O17AGTGGGCCGTCCNONE 
J013066B11AGTGGGCCGTCCNONE 
J013066B12AGTGGGCCGTCCNONE 
J013066B13AGTGGGCCGTCCNONE 
J013152M04AGTGGGCCGTCCNONE 
J023001A03AGTGGGCCGTCCNONE 
J023013H23AGTGGGCCGTCCNONE 
J023042L07AGTGGGCCGTCCNONE 
J023081L11AGTGGGCCGTCCNONE 
J023088I23AGTGGGCCGTCCNONE 
J023092N22AGTGGGCCGTCCNONE 
J023126A20AGTGGGCCGTCCNONE 
J023139A17AGTGGGCCGTCCNONE 
J023150G12AGTGGGCCGTCCNONE 
J033026M10AGTGGGCCGTCCNONE 
J033031H24AGTGGGCCGTCCNONE 
J033036C22AGTGGGCCGTCCNONE 
J033037P08AGTGGGCCGTCCNONE 
J033045G14AGTGGGCCGTCCNONE 
J033048A13AGTGGGCCGTCCNONE 
J033048B13AGTGGGCCGTCCNONE 
J033048K11AGTGGGCCGTCCNONE 
J033066A06AGTGGGCCGTCCNONE 
J033072H01AGTGGGCCGTCCNONE 
J033082K07AGTGGGCCGTCCNONE 
J033091G20AGTGGGCCGTCCNONE 
J033095C14AGTGGGCCGTCCNONE 
J033101N24AGTGGGCCGTCCNONE 
J033105L15AGTGGGCCGTCCNONE 
J033107J18AGTGGGCCGTCCNONE 
J033112L02AGTGGGCCGTCCNONE 
J033117I17AGTGGGCCGTCCNONE 
J043003K06AGTGGGCCGTCCNONE 
J043016I20AGTGGGCCGTCCNONE 
J043021A10AGTGGGCCGTCCNONE 
J043034F14AGTGGGCCGTCCNONE 
J065002O17AGTGGGCCGTCCNONE 
J065014B14AGTGGGCCGTCCNONE 
J065054N19AGTGGGCCGTCCNONE 
J065112P18AGTGGGCCGTCCNONE 
J065121B20AGTGGGCCGTCCNONE 
J065170M08AGTGGGCCGTCCNONE 
J065194B05AGTGGGCCGTCCNONE 
J090040F01AGTGGGCCGTCCNONE 
J090078O20AGTGGGCCGTCCNONE 
J090078P21AGTGGGCCGTCCNONE 
J090084E11AGTGGGCCGTCCNONE 
J100080B11AGTGGGCCGTCCNONE 
Os03g0205500Os03g0205500CCCGGGCCCGGCCCACTGGCCCAGTCytochrome b5 domain containing protein. 
Os03g0220700J100064H16TCGGCCCACTNONE 
Os03g0222100AK070688CCCGGGCCCACTSimilar to Topoisomerase-like protein. 
J023057E15CCCGGGCCCACTNONE 
J023099M24CCCGGGCCCACTNONE 
J023147F14CCCGGGCCCACTNONE 
Os03g0244200003-114-A11TAGGCCCACTCTNONE 
015-089-B03TAGGCCCACTCTNONE 
016-048-G01TAGGCCCACTCTNONE 
AK101837TAGGCCCACTCTSimilar to Thaumatin-like protein. 
AK105771TAGGCCCACTCTNONE 
AK107182TAGGCCCACTCTNONE 
J065054I12TAGGCCCACTCTNONE 
J065208F20TAGGCCCACTCTNONE 
J075088F18TAGGCCCACTCTNONE 
J075092G13TAGGCCCACTCTNONE 
J075120G01TAGGCCCACTCTNONE 
J075147M20TAGGCCCACTCTNONE 
J075151J03TAGGCCCACTCTNONE 
J100064H21TAGGCCCACTCTNONE 
Os03g0244700011-100-F11GGGGCCCACTNONE 
015-065-B06GGGGCCCACTNONE 
AK100399GGGGCCCACTNONE 
AK100620GGGGCCCACTArmadillo-like helical domain containing protein. 
J023086N09GGGGCCCACTNONE 
J100032P14GGGGCCCACTNONE 
Os03g0255200AK058212CAGGTGGGGCCCACTCCNONE 
AK071625CAGGTGGGGCCCACTCCHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0275900AK109303GTGGCCCACTNONE 
AK121978GTGGCCCACTSimilar to Spotted leaf protein 11 (Spotted leaf11) (Cell death-related protein SPL11). 
Os03g0298300AK061180AGTGGGCCAGProtein of unknown function DUF588 family protein. 
AK099089AGTGGGCCAGNONE 
Os03g0326600AK107632AGTGGGCCGGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0337600AF119232CAAGTGGGCCCCACCNONE 
AK070859CAAGTGGGCCCCACCSimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18CAAGTGGGCCCCACCNONE 
J013147M17CAAGTGGGCCCCACCNONE 
J065083M01CAAGTGGGCCCCACCNONE 
J065199H24CAAGTGGGCCCCACCNONE 
Os03g0339100AK111641GCGGCCCACTTGSimilar to PRL1 protein. 
Os03g0566800AK103270AGTGGGCCGAGSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18AGTGGGCCGAGNONE 
J023136P06AGTGGGCCGAGNONE 
J033081A22AGTGGGCCGAGNONE 
J033109N12AGTGGGCCGAGNONE 
J033124H10AGTGGGCCGAGNONE 
J033141B09AGTGGGCCGAGNONE 
J090026G23AGTGGGCCGAGNONE 
J090077J20AGTGGGCCGAGNONE 
Os03g0586300AK100442CAAGTGGGCCCCReticulon family protein. 
J023031G06CAAGTGGGCCCCNONE 
J023089N19CAAGTGGGCCCCNONE 
J023099N13CAAGTGGGCCCCNONE 
J065026N17CAAGTGGGCCCCNONE 
J065045N16CAAGTGGGCCCCNONE 
J065163L12CAAGTGGGCCCCNONE 
Os03g0606200009-030-E09CCAGGCCCACTNONE 
009-076-H10CCAGGCCCACTNONE 
009-122-H12CCAGGCCCACTNONE 
009-153-F09CCAGGCCCACTNONE 
AB055076CCAGGCCCACTMitochondrial ATP synthase 6 KD subunit. 
AK072384CCAGGCCCACTNONE 
AK107928CCAGGCCCACTNONE 
J023078E13CCAGGCCCACTNONE 
J053031N01CCAGGCCCACTNONE 
J053046K19CCAGGCCCACTNONE 
J053062P07CCAGGCCCACTNONE 
J053091C23CCAGGCCCACTNONE 
J053099N19CCAGGCCCACTNONE 
J065005E06CCAGGCCCACTNONE 
J065030N03CCAGGCCCACTNONE 
J065138O21CCAGGCCCACTNONE 
J065159K03CCAGGCCCACTNONE 
J075030M08CCAGGCCCACTNONE 
J080006E23CCAGGCCCACTNONE 
J080010D10CCAGGCCCACTNONE 
J080016N17CCAGGCCCACTNONE 
J080024N09CCAGGCCCACTNONE 
J080028E23CCAGGCCCACTNONE 
J080035I11CCAGGCCCACTNONE 
J080038D15CCAGGCCCACTNONE 
J080040H08CCAGGCCCACTNONE 
J080043L04CCAGGCCCACTNONE 
J080047C06CCAGGCCCACTNONE 
J080061G04CCAGGCCCACTNONE 
J080066E10CCAGGCCCACTNONE 
J080067P03CCAGGCCCACTNONE 
J080082D07CCAGGCCCACTNONE 
J080089M13CCAGGCCCACTNONE 
J080094O09CCAGGCCCACTNONE 
J080095C24CCAGGCCCACTNONE 
J080309E21CCAGGCCCACTNONE 
J090016G15CCAGGCCCACTNONE 
J090031C20CCAGGCCCACTNONE 
J090033A15CCAGGCCCACTNONE 
J090037L07CCAGGCCCACTNONE 
J090038I10CCAGGCCCACTNONE 
J090072P19CCAGGCCCACTNONE 
J100040J02CCAGGCCCACTNONE 
J100047N05CCAGGCCCACTNONE 
J100048M10CCAGGCCCACTNONE 
J100076C02CCAGGCCCACTNONE 
J100077G23CCAGGCCCACTNONE 
J100080O08CCAGGCCCACTNONE 
J100085C06CCAGGCCCACTNONE 
J100085F16CCAGGCCCACTNONE 
Os03g0639800AK103237AGTGGGCCGTTSnf7 family protein. 
J023036L02AGTGGGCCGTTNONE 
J033108L13AGTGGGCCGTTNONE 
Os03g0643300AK099445AGTGGGCCCCACCACSimilar to AER123Wp. 
AK099445CAAGTGGGCCCAGASimilar to AER123Wp. 
AK108010AGTGGGCCCCACCACNONE 
AK108010CAAGTGGGCCCAGANONE 
Os03g0666200AK102364GCGGGCCCACTCTPleckstrin homology-type domain containing protein. 
J033097E16GCGGGCCCACTCTNONE 
Os03g0695600006-103-C09ACCGGCCCACTNONE 
014-029-B11ACCGGCCCACTNONE 
AB026566ACCGGCCCACTNONE 
AK061228ACCGGCCCACTProteasome subunit beta type 2 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit beta-4). 
AK099128ACCGGCCCACTNONE 
J023041C17ACCGGCCCACTNONE 
J043030L19ACCGGCCCACTNONE 
J065002E17ACCGGCCCACTNONE 
J065042H23ACCGGCCCACTNONE 
J065110P10ACCGGCCCACTNONE 
J065112D10ACCGGCCCACTNONE 
J065114B21ACCGGCCCACTNONE 
J065124B02ACCGGCCCACTNONE 
J065138P08ACCGGCCCACTNONE 
J065182O20ACCGGCCCACTNONE 
J065216N05ACCGGCCCACTNONE 
J075060D19ACCGGCCCACTNONE 
J075097M03ACCGGCCCACTNONE 
J075098I11ACCGGCCCACTNONE 
J075142I15ACCGGCCCACTNONE 
J090018B21ACCGGCCCACTNONE 
J090034E12ACCGGCCCACTNONE 
J090042N01ACCGGCCCACTNONE 
Os03g0712600015-008-G03CGCGTGGGCCTGGCCCACTNONE 
AK103705CGCGTGGGCCTGGCCCACTHypothetical protein. 
J033136N14CGCGTGGGCCTGGCCCACTNONE 
Os03g0716200Os03g0716200ATGGCCCACCGGAGTGGGCCCCACAConserved hypothetical protein. 
Os03g0725400015-060-D03TTGGCCCACTNONE 
AK105499TTGGCCCACTSimilar to WD-repeat protein 5 (BMP2-induced 3-kb gene protein) (WD-repeat protein BIG-3). 
AK111860TTGGCCCACTNONE 
AK112085TTGGCCCACTNONE 
J100068K06TTGGCCCACTNONE 
J100073K24TTGGCCCACTNONE 
J100084M24TTGGCCCACTNONE 
Os03g0741400AK121838CTGGGGCCCACTSimilar to SUSIBA2. 
J100032E12CTGGGGCCCACTNONE 
Os03g0784900006-053-H11TCCGGCCCACTNONE 
009-165-F11TCCGGCCCACTNONE 
AK060949TCCGGCCCACTConserved hypothetical protein. 
AK099097TCCGGCCCACTNONE 
J023019M19TCCGGCCCACTNONE 
J065024O11TCCGGCCCACTNONE 
J065106D20TCCGGCCCACTNONE 
J065201L15TCCGGCCCACTNONE 
J075031B04TCCGGCCCACTNONE 
J075033C19TCCGGCCCACTNONE 
J075035F11TCCGGCCCACTNONE 
J075074K14TCCGGCCCACTNONE 
J075083A22TCCGGCCCACTNONE 
J075120O10TCCGGCCCACTNONE 
J075153L20TCCGGCCCACTNONE 
J075159G02TCCGGCCCACTNONE 
J080001J18TCCGGCCCACTNONE 
J080015I03TCCGGCCCACTNONE 
J080027E23TCCGGCCCACTNONE 
J080046D24TCCGGCCCACTNONE 
J080053B17TCCGGCCCACTNONE 
J080070P07TCCGGCCCACTNONE 
J080076D18TCCGGCCCACTNONE 
J080078E13TCCGGCCCACTNONE 
J080090H03TCCGGCCCACTNONE 
J100024F19TCCGGCCCACTNONE 
J100052D15TCCGGCCCACTNONE 
J100079B14TCCGGCCCACTNONE 
Os03g0802300AK120564AGTGGGCCTTGGGCCGAGAConserved hypothetical protein. 
AK120687AGTGGGCCTTGGGCCGAGANONE 
Os03g0821900AK070847AGTGGGCCTACCGGGCCAAAGCCCACASimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os03g0835400AK061773TAGGCCCACTTGSimilar to Uvs101. 
AK098986TAGGCCCACTTGNONE 
AK105896TAGGCCCACTTGNONE 
Os03g0843400009-195-F11TTGGCCCACTNONE 
AK061198TTGGCCCACTSimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076TTGGCCCACTNONE 
Os03g0851100AF303468GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
AK102069GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTSimilar to Translational elongation factor EF-TuM. 
J033082G06GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J043036M21GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065158H05GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065192A04GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
Os03g0851200009-035-B01AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-134-F10AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-154-H05AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
AK059425AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCSimilar to CAXIP1 protein. 
J065065D24AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046O19AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075048O04AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075181I09AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J080303G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090086F12AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090088E07AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
Os03g0861700AK066129CAAGTGGGCCGGCCCACCTRhodanese-like domain containing protein. 
J013051M12CAAGTGGGCCGGCCCACCTNONE 
J013104N13CAAGTGGGCCGGCCCACCTNONE 
J065052E12CAAGTGGGCCGGCCCACCTNONE 
Os03g0861800AF358762AGGTGGGCCGGCCCACTTGNONE 
AK068434AGGTGGGCCGGCCCACTTGCyclin-like F-box domain containing protein. 
AK109388AGGTGGGCCGGCCCACTTGNONE 
J013154L15AGGTGGGCCGGCCCACTTGNONE 
J013170I23AGGTGGGCCGGCCCACTTGNONE 
J023031D05AGGTGGGCCGGCCCACTTGNONE 
J023082E07AGGTGGGCCGGCCCACTTGNONE 
J023095M10AGGTGGGCCGGCCCACTTGNONE 
J023127D14AGGTGGGCCGGCCCACTTGNONE 
J023138M15AGGTGGGCCGGCCCACTTGNONE 
J023138M16AGGTGGGCCGGCCCACTTGNONE 
J033060B18AGGTGGGCCGGCCCACTTGNONE 
J033060F13AGGTGGGCCGGCCCACTTGNONE 
J033096J11AGGTGGGCCGGCCCACTTGNONE 
J033122C07AGGTGGGCCGGCCCACTTGNONE 
J053029A10AGGTGGGCCGGCCCACTTGNONE 
J053062O16AGGTGGGCCGGCCCACTTGNONE 
J053064J08AGGTGGGCCGGCCCACTTGNONE 
J053086F22AGGTGGGCCGGCCCACTTGNONE 
J065036C04AGGTGGGCCGGCCCACTTGNONE 
J065072J23AGGTGGGCCGGCCCACTTGNONE 
J065120D04AGGTGGGCCGGCCCACTTGNONE 
J065161D04AGGTGGGCCGGCCCACTTGNONE 
J065172H02AGGTGGGCCGGCCCACTTGNONE 
J065207B01AGGTGGGCCGGCCCACTTGNONE 
J075019H18AGGTGGGCCGGCCCACTTGNONE 
J075082E16AGGTGGGCCGGCCCACTTGNONE 
J075089A10AGGTGGGCCGGCCCACTTGNONE 
J075099G02AGGTGGGCCGGCCCACTTGNONE 
J075134M04AGGTGGGCCGGCCCACTTGNONE 
J075144K19AGGTGGGCCGGCCCACTTGNONE 
J075147F17AGGTGGGCCGGCCCACTTGNONE 
J090004O14AGGTGGGCCGGCCCACTTGNONE 
J090013A07AGGTGGGCCGGCCCACTTGNONE 
J090047K14AGGTGGGCCGGCCCACTTGNONE 
Os04g0115400015-048-B05AGTGGGCCGCANONE 
AK070523AGTGGGCCGCAD111/G-patch domain containing protein. 
Os04g0208400AK069629AGTGGGCCGTGCyclin-like F-box domain containing protein. 
Os04g0321700003-103-G02AGTGGGCCCCACCNONE 
AK068732AGTGGGCCCCACCSimilar to Serine carboxypeptidase I precursor (EC 3.4.16.5) (Carboxypeptidase C). 
AK099397AGTGGGCCCCACCNONE 
Os04g0382300AK071912AGTGGGCCCCACGNONE 
AK101795AGTGGGCCCCACGSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0387600009-148-E01GTGGGGGCCCACTCTNONE 
009-155-A11GTGGGGGCCCACTCTNONE 
009-175-F04GTGGGGGCCCACTCTNONE 
AK063862GTGGGGGCCCACTCTConserved hypothetical protein. 
J065035F12GTGGGGGCCCACTCTNONE 
J065162C13GTGGGGGCCCACTCTNONE 
J065169L19GTGGGGGCCCACTCTNONE 
Os04g0440100AK101324GCTGGGCCCACTCTNONE 
AK105415GCTGGGCCCACTCTNonsense-mediated decay UPF3 domain containing protein. 
Os04g0445200009-034-A06CAAGTGGGCCTCNONE 
AK062427CAAGTGGGCCTCProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720CAAGTGGGCCTCNONE 
J065022E20CAAGTGGGCCTCNONE 
J065062D16CAAGTGGGCCTCNONE 
J065081I02CAAGTGGGCCTCNONE 
J065087C10CAAGTGGGCCTCNONE 
J065116N16CAAGTGGGCCTCNONE 
J065132F10CAAGTGGGCCTCNONE 
J065140F18CAAGTGGGCCTCNONE 
J065143M22CAAGTGGGCCTCNONE 
J065158K17CAAGTGGGCCTCNONE 
J065162D07CAAGTGGGCCTCNONE 
J065207H19CAAGTGGGCCTCNONE 
J075155B20CAAGTGGGCCTCNONE 
J075167E24CAAGTGGGCCTCNONE 
J075178B19CAAGTGGGCCTCNONE 
J080301D22CAAGTGGGCCTCNONE 
J080301J15CAAGTGGGCCTCNONE 
J080308J02CAAGTGGGCCTCNONE 
Os04g0502300009-116-F02TCAGGCCCATCTCGGCCCACTCTNONE 
009-130-H06TCAGGCCCATCTCGGCCCACTCTNONE 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
J013124K01TCAGGCCCATCTCGGCCCACTCTNONE 
J023102F03TCAGGCCCATCTCGGCCCACTCTNONE 
J033094F17TCAGGCCCATCTCGGCCCACTCTNONE 
J053054C22TCAGGCCCATCTCGGCCCACTCTNONE 
J065024N13TCAGGCCCATCTCGGCCCACTCTNONE 
J065083J18TCAGGCCCATCTCGGCCCACTCTNONE 
J065132O14TCAGGCCCATCTCGGCCCACTCTNONE 
J065156M09TCAGGCCCATCTCGGCCCACTCTNONE 
J065176N15TCAGGCCCATCTCGGCCCACTCTNONE 
J065208H08TCAGGCCCATCTCGGCCCACTCTNONE 
J075054B03TCAGGCCCATCTCGGCCCACTCTNONE 
J090053E20TCAGGCCCATCTCGGCCCACTCTNONE 
J100075B09TCAGGCCCATCTCGGCCCACTCTNONE 
J100089H12TCAGGCCCATCTCGGCCCACTCTNONE 
Os04g0521800006-043-D11ATGGCCCACTNONE 
AK061536ATGGCCCACTNONE 
AK102934ATGGCCCACTPeptidase M20 family protein. 
AK103369ATGGCCCACTNONE 
Os04g0584900AK058633AAGGCCCACTNONE 
Os04g0589600011-100-F04CAAGTGGGCCCACCNONE 
AK061833CAAGTGGGCCCACCGlycosyl transferase, group 1 domain containing protein. 
AK098964CAAGTGGGCCCACCNONE 
AK100053CAAGTGGGCCCACCNONE 
Os04g0610500006-115-C07AGTGGGCCAANONE 
AK066289AGTGGGCCAAPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817AGTGGGCCAANONE 
J013096N09AGTGGGCCAANONE 
J023054I11AGTGGGCCAANONE 
J023121P20AGTGGGCCAANONE 
J053039O20AGTGGGCCAANONE 
J053071L20AGTGGGCCAANONE 
J053088H23AGTGGGCCAANONE 
J053096J03AGTGGGCCAANONE 
Os04g0612600AB042115TTGGCCCACTNONE 
AK060707TTGGCCCACTSimilar to Coatomer-like protein, epsilon subunit. 
AK099008TTGGCCCACTNONE 
AK104427TTGGCCCACTNONE 
J023043H02TTGGCCCACTNONE 
J033033I23TTGGCCCACTNONE 
J033067P21TTGGCCCACTNONE 
J033088M21TTGGCCCACTNONE 
J033133M08TTGGCCCACTNONE 
J043030I16TTGGCCCACTNONE 
J075049H08TTGGCCCACTNONE 
Os04g0623600AK068129AAATGGGCCCCAGGCCCACTGTCAGTSimilar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC 1.1.3.15) (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase). 
J013126M17AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J013131A08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J023133N08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
Os04g0637500AK108202AAGGCCCACTMitochodrial transcription termination factor-related family protein. 
J065163A11AAGGCCCACTNONE 
Os04g0649900006-036-D07TACGGCCCACTTGNONE 
013-084-F02TACGGCCCACTTGNONE 
AK061488TACGGCCCACTTGProtein of unknown function DUF579, plant family protein. 
J100036B10TACGGCCCACTTGNONE 
J100058F04TACGGCCCACTTGNONE 
J100065C02TACGGCCCACTTGNONE 
Os04g0654700006-097-D06CAAGTGGGCCAANONE 
013-016-H01CAAGTGGGCCAANONE 
AB055495CAAGTGGGCCAANONE 
AF072849CAAGTGGGCCAANONE 
AK062107CAAGTGGGCCAANONE 
AK099088CAAGTGGGCCAASimilar to COP9 signalosome complex subunit 5b (EC 3.4.-.-) (Signalosome subunit 5b) (Jun activation domain-binding homolog 1). 
J013038I16CAAGTGGGCCAANONE 
J013038J23CAAGTGGGCCAANONE 
J013038L17CAAGTGGGCCAANONE 
J013038N18CAAGTGGGCCAANONE 
J013038O18CAAGTGGGCCAANONE 
J013124A09CAAGTGGGCCAANONE 
J023007N04CAAGTGGGCCAANONE 
J033023C02CAAGTGGGCCAANONE 
J033030M18CAAGTGGGCCAANONE 
J033068I09CAAGTGGGCCAANONE 
J033100E04CAAGTGGGCCAANONE 
J065153E19CAAGTGGGCCAANONE 
J065207I02CAAGTGGGCCAANONE 
J075007A07CAAGTGGGCCAANONE 
J075036M04CAAGTGGGCCAANONE 
J075147I03CAAGTGGGCCAANONE 
J075197L11CAAGTGGGCCAANONE 
Os04g0660600009-113-A11ACATGGGCCCACTTGNONE 
AK120899ACATGGGCCCACTTGATPase, V0 complex, subunit H family protein. 
J023030J05ACATGGGCCCACTTGNONE 
J065068M07ACATGGGCCCACTTGNONE 
J065120G22ACATGGGCCCACTTGNONE 
J065168J18ACATGGGCCCACTTGNONE 
J065211M10ACATGGGCCCACTTGNONE 
J075175E21ACATGGGCCCACTTGNONE 
J090021C06ACATGGGCCCACTTGNONE 
J090032P15ACATGGGCCCACTTGNONE 
J090082E05ACATGGGCCCACTTGNONE 
J100090O11ACATGGGCCCACTTGNONE 
Os04g0674100J080097J12TAGGCCCACTThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965AGTGGGCCTANONE 
AK103795AGTGGGCCTACoenzyme Q biosynthesis Coq4 family protein. 
J033076F14AGTGGGCCTANONE 
J065020P20AGTGGGCCTANONE 
J065057I21AGTGGGCCTANONE 
J065059P11AGTGGGCCTANONE 
J065083A22AGTGGGCCTANONE 
J065093K10AGTGGGCCTANONE 
J065097D03AGTGGGCCTANONE 
J065103P05AGTGGGCCTANONE 
J065113K09AGTGGGCCTANONE 
J065118F23AGTGGGCCTANONE 
J065119M06AGTGGGCCTANONE 
J065146K17AGTGGGCCTANONE 
J065161N12AGTGGGCCTANONE 
J065169L02AGTGGGCCTANONE 
J065189H12AGTGGGCCTANONE 
J065192E24AGTGGGCCTANONE 
J065193K17AGTGGGCCTANONE 
J065197O21AGTGGGCCTANONE 
J065214D09AGTGGGCCTANONE 
J065217B11AGTGGGCCTANONE 
J075132K07AGTGGGCCTANONE 
J100059D14AGTGGGCCTANONE 
Os04g0682100AK070539AGAGTGGGCCATEukaryotic phosphomannomutase family protein. 
J080303K19AGAGTGGGCCATNONE 
J100044E03AGAGTGGGCCATNONE 
J100063H09AGAGTGGGCCATNONE 
J100072L13AGAGTGGGCCATNONE 
J100089H15AGAGTGGGCCATNONE 
Os04g0683500AK071538AGTGGGCCGANONE 
AK105871AGTGGGCCGANONE 
AK106642AGTGGGCCGASimilar to Adenosine deaminase acting on tRNA 1. 
J023095A13AGTGGGCCGANONE 
J023099G11AGTGGGCCGANONE 
J075125A03AGTGGGCCGANONE 
Os05g0110500AK060179TCCGGCCCACTNONE 
AK066175TCCGGCCCACTSimilar to RNA helicase (Fragment). 
J013055E22TCCGGCCCACTNONE 
J090056E03TCCGGCCCACTNONE 
Os05g0110900AK073169AGTGGGCCCCACASimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
Os05g0113000AK067079CAAGTGGGCCCAACCAmino acid-binding ACT domain containing protein. 
Os05g0121000009-181-E02GTTTGGGCCCACTAGGCCCAACCNONE 
AK058867GTTTGGGCCCACTAGGCCCAACCNONE 
AK071341GTTTGGGCCCACTAGGCCCAACCProtein of unknown function DUF1218 family protein. 
J023024H24GTTTGGGCCCACTAGGCCCAACCNONE 
J023090B22GTTTGGGCCCACTAGGCCCAACCNONE 
J023111G15GTTTGGGCCCACTAGGCCCAACCNONE 
J023134K14GTTTGGGCCCACTAGGCCCAACCNONE 
J033057C05GTTTGGGCCCACTAGGCCCAACCNONE 
J033067J15GTTTGGGCCCACTAGGCCCAACCNONE 
J033084L15GTTTGGGCCCACTAGGCCCAACCNONE 
J033088B04GTTTGGGCCCACTAGGCCCAACCNONE 
J043027A08GTTTGGGCCCACTAGGCCCAACCNONE 
J043029L03GTTTGGGCCCACTAGGCCCAACCNONE 
J053031K22GTTTGGGCCCACTAGGCCCAACCNONE 
J053046I01GTTTGGGCCCACTAGGCCCAACCNONE 
J053070B05GTTTGGGCCCACTAGGCCCAACCNONE 
J053072C10GTTTGGGCCCACTAGGCCCAACCNONE 
J065097M22GTTTGGGCCCACTAGGCCCAACCNONE 
J065164I17GTTTGGGCCCACTAGGCCCAACCNONE 
J075058I08GTTTGGGCCCACTAGGCCCAACCNONE 
J075064C09GTTTGGGCCCACTAGGCCCAACCNONE 
J080304C16GTTTGGGCCCACTAGGCCCAACCNONE 
J080304H16GTTTGGGCCCACTAGGCCCAACCNONE 
J080306E17GTTTGGGCCCACTAGGCCCAACCNONE 
J080310L03GTTTGGGCCCACTAGGCCCAACCNONE 
J080316J07GTTTGGGCCCACTAGGCCCAACCNONE 
J080317L23GTTTGGGCCCACTAGGCCCAACCNONE 
J080319A10GTTTGGGCCCACTAGGCCCAACCNONE 
J090060F01GTTTGGGCCCACTAGGCCCAACCNONE 
J100042N16GTTTGGGCCCACTAGGCCCAACCNONE 
J100047F05GTTTGGGCCCACTAGGCCCAACCNONE 
J100075J19GTTTGGGCCCACTAGGCCCAACCNONE 
Os05g0121500006-117-B10TTTCGGCCCACTNONE 
009-059-D04TTTCGGCCCACTNONE 
J065066C12TTTCGGCCCACTConserved hypothetical protein. 
J075013I12TTTCGGCCCACTNONE 
J090046D18TTTCGGCCCACTNONE 
Os05g0122900009-052-C11TCCGGCCCACTNONE 
009-132-C12TCCGGCCCACTNONE 
014-091-G03TCCGGCCCACTNONE 
AB072977TCCGGCCCACTNONE 
AK071296TCCGGCCCACTNONE 
AK099375TCCGGCCCACTNONE 
AK104970TCCGGCCCACTBLE1 protein. 
J065007I09TCCGGCCCACTNONE 
J065081H07TCCGGCCCACTNONE 
J065122B18TCCGGCCCACTNONE 
J065181G15TCCGGCCCACTNONE 
J065182J07TCCGGCCCACTNONE 
J065197D23TCCGGCCCACTNONE 
J065197G08TCCGGCCCACTNONE 
J065201H20TCCGGCCCACTNONE 
J090034E11TCCGGCCCACTNONE 
J100077M04TCCGGCCCACTNONE 
Os05g0150300AK100732AAGGCCCACTSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
Os05g0220600AK073669AGTGGGCCCCCACRhomboid-like protein family protein. 
J033052F18AGTGGGCCCCCACNONE 
J065109N23AGTGGGCCCCCACNONE 
J100037H15AGTGGGCCCCCACNONE 
J100048E14AGTGGGCCCCCACNONE 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0243200009-073-F12TCAGGCCCACTCCNONE 
AK061317TCAGGCCCACTCCSimilar to Ribosomal protein L13. 
J065120F21TCAGGCCCACTCCNONE 
J065185K05TCAGGCCCACTCCNONE 
Os05g0300700014-079-G07TAGGCCCACTGACNONE 
AK063728TAGGCCCACTGACNONE 
AK067846TAGGCCCACTGACConserved hypothetical protein. 
Os05g0391500AK119412TTGGCCCACTCCSimilar to Endo-beta-mannosidase. 
Os05g0397700AK067298GAGGCCCACTGGGCCGTGSecY protein family protein. 
Os05g0414400AK102320CAAGTGGGCCCTNONE 
AK119358CAAGTGGGCCCTProtein of unknown function DUF659 domain containing protein. 
Os05g0437200014-036-D04TCTGGCCCACTNONE 
AK059283TCTGGCCCACTNONE 
AK121867TCTGGCCCACTProtein of unknown function DUF502 family protein. 
Os05g0440100015-006-F06CTCGGCCCACTNONE 
015-076-D04CTCGGCCCACTNONE 
AK073094CTCGGCCCACTNONE 
AK102786CTCGGCCCACTHistone deacetylase superfamily protein. 
J033107M16CTCGGCCCACTNONE 
Os05g0451300AK108341AGTGGGCCACCTCGCCCGGCCCAACCConserved hypothetical protein. 
Os05g0458100006-084-A05AGTGGGCCGTGNONE 
009-091-H05AGTGGGCCGTGNONE 
AJ557547AGTGGGCCGTGNONE 
AK059467AGTGGGCCGTGNONE 
AK061127AGTGGGCCGTGNONE 
AK101652AGTGGGCCGTGSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06AGTGGGCCGTGNONE 
J033057B20AGTGGGCCGTGNONE 
J033087A05AGTGGGCCGTGNONE 
J043009C05AGTGGGCCGTGNONE 
J090009E10AGTGGGCCGTGNONE 
Os05g0480700AK100850AGTGGGCCGGCSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11AGTGGGCCGGCNONE 
Os05g0486200009-099-B03AGTGGGCCCTTCATGGGCCCACGCCACNONE 
AK121022AGTGGGCCCTTCATGGGCCCACGCCACConserved hypothetical protein. 
J023049I09AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J033029N07AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J075074I18AGTGGGCCCTTCATGGGCCCACGCCACNONE 
Os05g0509400AK108053CAAGTGGGCCCCACASimilar to DNA binding protein-like. 
Os05g0520200006-031-F07TACGGCCCACTGGCCCATTANONE 
AK061451TACGGCCCACTGGCCCATTAThioredoxin-related domain containing protein. 
AK099433TACGGCCCACTGGCCCATTANONE 
Os05g0528200009-146-C01AAGGCCCACTNONE 
AK062985AAGGCCCACTSimilar to 50S ribosomal protein L20. 
Os05g0529300AK102648AGTGGGCCCCACGSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06CGTGGGGCCCACTNONE 
AK063846CGTGGGGCCCACTConserved hypothetical protein. 
AK122038CGTGGGGCCCACTNONE 
J033113C01CGTGGGGCCCACTNONE 
Os05g0557800009-156-G05AGGGCCCACTGTCAGTGNONE 
013-049-C12AGGGCCCACTGTCAGTGNONE 
AK068460AGGGCCCACTGTCAGTGSimilar to 50S ribosomal protein L21, mitochondrial precursor. 
AK105327AGGGCCCACTGTCAGTGNONE 
J013153H24AGGGCCCACTGTCAGTGNONE 
J023003F16AGGGCCCACTGTCAGTGNONE 
J065216G02AGGGCCCACTGTCAGTGNONE 
J075037C20AGGGCCCACTGTCAGTGNONE 
J100032H16AGGGCCCACTGTCAGTGNONE 
Os05g0577200AK069756GCCCGGCCCACTCarboxylesterase, type B family protein. 
Os06g0115400AK111656GCGGCCCACTSimilar to Superoxide dismutase [Fe], chloroplast (EC 1.15.1.1) (Fragment). 
Os06g0130000AK064427GTGGCCCACTNONE 
AK070084GTGGCCCACTNONE 
AK119321GTGGCCCACTSimilar to Tobacco mosaic virus helicase domain-binding protein (Fragment). 
Os06g0131100AK112079CCAGGCCCAGCCCTCCGGCCCACTWD40-like domain containing protein. 
J033066L01CCAGGCCCAGCCCTCCGGCCCACTNONE 
J100044P22CCAGGCCCAGCCCTCCGGCCCACTNONE 
Os06g0134000AJ417525AACTGGGCCCACTNONE 
AK062184AACTGGGCCCACTNONE 
AK106717AACTGGGCCCACTSimilar to 40S ribosomal protein S20. 
AK120319AACTGGGCCCACTNONE 
D10402AACTGGGCCCACTNONE 
D12632AACTGGGCCCACTNONE 
J013056N13AACTGGGCCCACTNONE 
J023100G01AACTGGGCCCACTNONE 
J053059F04AACTGGGCCCACTNONE 
J053068M21AACTGGGCCCACTNONE 
J053078H15AACTGGGCCCACTNONE 
J065050O15AACTGGGCCCACTNONE 
J065060G15AACTGGGCCCACTNONE 
J065080K10AACTGGGCCCACTNONE 
J065108G05AACTGGGCCCACTNONE 
J065186K16AACTGGGCCCACTNONE 
J075150J12AACTGGGCCCACTNONE 
J080002I18AACTGGGCCCACTNONE 
J080005H04AACTGGGCCCACTNONE 
J080008I06AACTGGGCCCACTNONE 
J080010G20AACTGGGCCCACTNONE 
J080010N10AACTGGGCCCACTNONE 
J080018H02AACTGGGCCCACTNONE 
J080022O14AACTGGGCCCACTNONE 
J080023F23AACTGGGCCCACTNONE 
J080025D16AACTGGGCCCACTNONE 
J080027L12AACTGGGCCCACTNONE 
J080030F16AACTGGGCCCACTNONE 
J080038N04AACTGGGCCCACTNONE 
J080048O17AACTGGGCCCACTNONE 
J080056B05AACTGGGCCCACTNONE 
J080061D02AACTGGGCCCACTNONE 
J080062H18AACTGGGCCCACTNONE 
J080064E06AACTGGGCCCACTNONE 
J080066D23AACTGGGCCCACTNONE 
J080071F08AACTGGGCCCACTNONE 
J080089E06AACTGGGCCCACTNONE 
J080089K22AACTGGGCCCACTNONE 
J080091C18AACTGGGCCCACTNONE 
J080095G10AACTGGGCCCACTNONE 
J090038G01AACTGGGCCCACTNONE 
J090062K07AACTGGGCCCACTNONE 
J100051G19AACTGGGCCCACTNONE 
Os06g0136700AK065081TCGGCCCACTSteroid nuclear receptor, ligand-binding domain containing protein. 
J013001L08TCGGCCCACTNONE 
J013039I03TCGGCCCACTNONE 
Os06g0137500AK072896CCCGGCCCACTBrix domain containing protein. 
AK121945CCCGGCCCACTNONE 
Os06g0174350J043034B05AGTGGGCCTAGTTGGGCCGGAConserved hypothetical protein. 
J043034B05CCCGGCCCACTConserved hypothetical protein. 
Os06g0194400AK102980CACTGACAAGTGGGCCCACTTranscriptional factor B3 family protein. 
Os06g0225300AK065224AAGGCCCAAATAGGCCCACTNONE 
AK100258AAGGCCCAAATAGGCCCACTSimilar to SERK1 (Fragment). 
J013002G23AAGGCCCAAATAGGCCCACTNONE 
Os06g0246500AK105105TTCGGCCCACTSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0251000J033111L12AGTGGGCCAANONE 
J043001C08AGTGGGCCAAMolybdenum cofactor biosynthesis domain containing protein. 
Os06g0270900011-086-B03CAAGTGGGCCCCACANONE 
012-051-A02CAAGTGGGCCCCACANONE 
016-033-F07CAAGTGGGCCCCACANONE 
AB044537CAAGTGGGCCCCACANONE 
AF162665CAAGTGGGCCCCACANONE 
AK073079CAAGTGGGCCCCACASimilar to RF2 (EC 1.2.1.3) (T cytoplasm male sterility restorer factor 2). 
AK099248CAAGTGGGCCCCACANONE 
AK120296CAAGTGGGCCCCACANONE 
J013151K07CAAGTGGGCCCCACANONE 
J013156A10CAAGTGGGCCCCACANONE 
J023014D24CAAGTGGGCCCCACANONE 
J023148F09CAAGTGGGCCCCACANONE 
J033113C09CAAGTGGGCCCCACANONE 
J065138H22CAAGTGGGCCCCACANONE 
J090037C14CAAGTGGGCCCCACANONE 
J090053A17CAAGTGGGCCCCACANONE 
J090066L02CAAGTGGGCCCCACANONE 
J100017N17CAAGTGGGCCCCACANONE 
J100040I08CAAGTGGGCCCCACANONE 
Os06g0304500AK119441GAAGCCCATTAAGGCCCACTCRS1/YhbY domain containing protein. 
J075143M24GAAGCCCATTAAGGCCCACTNONE 
J075194D03GAAGCCCATTAAGGCCCACTNONE 
Os06g0332400AK058294AGGGCCCACTCTNONE 
AK101738AGGGCCCACTCTVHS domain containing protein. 
J013119B12AGGGCCCACTCTNONE 
J013132G17AGGGCCCACTCTNONE 
J023034E06AGGGCCCACTCTNONE 
J023039I05AGGGCCCACTCTNONE 
J033024E14AGGGCCCACTCTNONE 
J033039N04AGGGCCCACTCTNONE 
J033048P16AGGGCCCACTCTNONE 
J033069F24AGGGCCCACTCTNONE 
J033071D15AGGGCCCACTCTNONE 
J033106D01AGGGCCCACTCTNONE 
J033106D09AGGGCCCACTCTNONE 
J033106F09AGGGCCCACTCTNONE 
J033107K03AGGGCCCACTCTNONE 
J033129G10AGGGCCCACTCTNONE 
J065016B15AGGGCCCACTCTNONE 
J065022H07AGGGCCCACTCTNONE 
J065048E07AGGGCCCACTCTNONE 
J065068B11AGGGCCCACTCTNONE 
J065157C13AGGGCCCACTCTNONE 
J100042J02AGGGCCCACTCTNONE 
Os06g0498500AK099764TACGGCCCACTNONE 
AK103794TACGGCCCACTNucleolar complex-associated family protein. 
AK121899TACGGCCCACTNONE 
Os06g0555500016-056-B08TTGGCCCACTCTNONE 
AK102375TTGGCCCACTCTNONE 
AK106546TTGGCCCACTCTInitiator tRNA phosphoribosyl transferase family protein. 
J033074B08TTGGCCCACTCTNONE 
J033091P04TTGGCCCACTCTNONE 
J090082P16TTGGCCCACTCTNONE 
Os06g0567000009-166-G12CCCACCTGTTGGGCCGGGCCCACTNONE 
AK121337CCCACCTGTTGGGCCGGGCCCACTProtein of unknown function UPF0197 family protein. 
J013122F01CCCACCTGTTGGGCCGGGCCCACTNONE 
J023080N12CCCACCTGTTGGGCCGGGCCCACTNONE 
J023120F03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065013B18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065039P21CCCACCTGTTGGGCCGGGCCCACTNONE 
J065089E06CCCACCTGTTGGGCCGGGCCCACTNONE 
J065095N19CCCACCTGTTGGGCCGGGCCCACTNONE 
J065119H03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065121D18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065149G04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075012J04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075021G13CCCACCTGTTGGGCCGGGCCCACTNONE 
J075106I23CCCACCTGTTGGGCCGGGCCCACTNONE 
J075107F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J075152J22CCCACCTGTTGGGCCGGGCCCACTNONE 
J075186J20CCCACCTGTTGGGCCGGGCCCACTNONE 
J075188F16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080001G06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080002O09CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006E10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006F24CCCACCTGTTGGGCCGGGCCCACTNONE 
J080012L07CCCACCTGTTGGGCCGGGCCCACTNONE 
J080016A10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017D11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080020P06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080024A20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027B10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027E03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027I01CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027K20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080041L12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080043D21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080044K11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080048I08CCCACCTGTTGGGCCGGGCCCACTNONE 
J080049M12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050C14CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050N21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080053F04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080054O16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080058O21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080059M11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080061A11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063B15CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063F22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080066M18CCCACCTGTTGGGCCGGGCCCACTNONE 
J080068D12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080070D22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080071B06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080072B17CCCACCTGTTGGGCCGGGCCCACTNONE 
J080081O04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080089H05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080093K13CCCACCTGTTGGGCCGGGCCCACTNONE 
J080095I05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080097F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304C03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304H11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080308M21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080313O15CCCACCTGTTGGGCCGGGCCCACTNONE 
J090020N23CCCACCTGTTGGGCCGGGCCCACTNONE 
J100023C12CCCACCTGTTGGGCCGGGCCCACTNONE 
Os06g0573600AK102756AGTGGGCCCCACACGTCTCSimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase). 
J023001F23AGTGGGCCCCACACGTCTCNONE 
J033107B05AGTGGGCCCCACACGTCTCNONE 
J090078G02AGTGGGCCCCACACGTCTCNONE 
J090099E09AGTGGGCCCCACACGTCTCNONE 
Os06g0603000AK068856GCGGGCCCACTNONE 
AK104955GCGGGCCCACTSimilar to Heme oxygenase 1 (Fragment). 
Os06g0683200AK060024CAAGTGGGCCAASimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432CAAGTGGGCCAANONE 
J023002B12CAAGTGGGCCAANONE 
J023054E10CAAGTGGGCCAANONE 
J023123F19CAAGTGGGCCAANONE 
J065035K13CAAGTGGGCCAANONE 
J065129P09CAAGTGGGCCAANONE 
J065184B14CAAGTGGGCCAANONE 
Os06g0688100AK063450CAGGCCCACTNONE 
AK101144CAGGCCCACTRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0704300AK107008CTGGCCCACTZinc finger, CCCH-type domain containing protein. 
J065038I12CTGGCCCACTNONE 
J065079E03CTGGCCCACTNONE 
J075035B15CTGGCCCACTNONE 
J090072D21CTGGCCCACTNONE 
Os06g0709300AK108588ATGGCCCACTFAR1 domain containing protein. 
Os06g0725400J065086O07AGTGGGCCTTGSimilar to BLE1 protein. 
J065114J19AGTGGGCCTTGNONE 
Os07g0121000AK072975GGGCCGAAGAGGCCCACTTGProtein of unknown function DUF1719, Oryza sativa family protein. 
J023148M03GGGCCGAAGAGGCCCACTTGNONE 
Os07g0154300009-070-E08AGTGGGCCACNONE 
009-077-E01AGTGGGCCACNONE 
009-196-F05AGTGGGCCACNONE 
AK105386AGTGGGCCACConserved hypothetical protein. 
AK122093AGTGGGCCACNONE 
J033124K14AGTGGGCCACNONE 
J075006I22AGTGGGCCACNONE 
J075185G02AGTGGGCCACNONE 
J090039C02AGTGGGCCACNONE 
Os07g0169600006-027-F04GGGGCCCACTTGNONE 
006-027-F04TGTGGGGCCCACTNONE 
006-043-C10GGGGCCCACTTGNONE 
006-043-C10TGTGGGGCCCACTNONE 
006-070-A04GGGGCCCACTTGNONE 
006-070-A04TGTGGGGCCCACTNONE 
006-081-F03GGGGCCCACTTGNONE 
006-081-F03TGTGGGGCCCACTNONE 
006-104-F02GGGGCCCACTTGNONE 
006-104-F02TGTGGGGCCCACTNONE 
012-006-D12GGGGCCCACTTGNONE 
012-006-D12TGTGGGGCCCACTNONE 
AK060318GGGGCCCACTTGNONE 
AK060318TGTGGGGCCCACTNONE 
AK121818GGGGCCCACTTG2OG-Fe(II) oxygenase domain containing protein. 
AK121818TGTGGGGCCCACT2OG-Fe(II) oxygenase domain containing protein. 
J023065K01GGGGCCCACTTGNONE 
J023065K01TGTGGGGCCCACTNONE 
J023086G17GGGGCCCACTTGNONE 
J023086G17TGTGGGGCCCACTNONE 
J023093G16GGGGCCCACTTGNONE 
J023093G16TGTGGGGCCCACTNONE 
J033024N04GGGGCCCACTTGNONE 
J033024N04TGTGGGGCCCACTNONE 
J033099A15GGGGCCCACTTGNONE 
J033099A15TGTGGGGCCCACTNONE 
J033107B14GGGGCCCACTTGNONE 
J033107B14TGTGGGGCCCACTNONE 
J043026F14GGGGCCCACTTGNONE 
J043026F14TGTGGGGCCCACTNONE 
J065043P20GGGGCCCACTTGNONE 
J065043P20TGTGGGGCCCACTNONE 
J075118L16GGGGCCCACTTGNONE 
J075118L16TGTGGGGCCCACTNONE 
J075162M22GGGGCCCACTTGNONE 
J075162M22TGTGGGGCCCACTNONE 
J080004K13GGGGCCCACTTGNONE 
J080004K13TGTGGGGCCCACTNONE 
J080024D10GGGGCCCACTTGNONE 
J080024D10TGTGGGGCCCACTNONE 
J080037C21GGGGCCCACTTGNONE 
J080037C21TGTGGGGCCCACTNONE 
J080039M17GGGGCCCACTTGNONE 
J080039M17TGTGGGGCCCACTNONE 
J080040A03GGGGCCCACTTGNONE 
J080040A03TGTGGGGCCCACTNONE 
J080044A07GGGGCCCACTTGNONE 
J080044A07TGTGGGGCCCACTNONE 
J080045I07GGGGCCCACTTGNONE 
J080045I07TGTGGGGCCCACTNONE 
J080052L06GGGGCCCACTTGNONE 
J080052L06TGTGGGGCCCACTNONE 
J080053A20GGGGCCCACTTGNONE 
J080053A20TGTGGGGCCCACTNONE 
J080060L15GGGGCCCACTTGNONE 
J080060L15TGTGGGGCCCACTNONE 
J080060N22GGGGCCCACTTGNONE 
J080060N22TGTGGGGCCCACTNONE 
J080062L23GGGGCCCACTTGNONE 
J080062L23TGTGGGGCCCACTNONE 
J080069B19GGGGCCCACTTGNONE 
J080069B19TGTGGGGCCCACTNONE 
J080086K15GGGGCCCACTTGNONE 
J080086K15TGTGGGGCCCACTNONE 
J080089H16GGGGCCCACTTGNONE 
J080089H16TGTGGGGCCCACTNONE 
J080089I23GGGGCCCACTTGNONE 
J080089I23TGTGGGGCCCACTNONE 
J080094P07GGGGCCCACTTGNONE 
J080094P07TGTGGGGCCCACTNONE 
J090032L18GGGGCCCACTTGNONE 
J090032L18TGTGGGGCCCACTNONE 
J100044E09GGGGCCCACTTGNONE 
J100044E09TGTGGGGCCCACTNONE 
J100045O03GGGGCCCACTTGNONE 
J100045O03TGTGGGGCCCACTNONE 
J100066B11GGGGCCCACTTGNONE 
J100066B11TGTGGGGCCCACTNONE 
J100069J24GGGGCCCACTTGNONE 
J100069J24TGTGGGGCCCACTNONE 
Os07g0171200AK071075AGGGCCCACTGalactose-1-phosphate uridyl transferase, class I family protein. 
AK071075AGTGGGCCCCACAGalactose-1-phosphate uridyl transferase, class I family protein. 
AK071075ATGGCCCACTGalactose-1-phosphate uridyl transferase, class I family protein. 
Os07g0224000009-060-E01GACGGCCCACTNONE 
J065042D20GACGGCCCACTNONE 
J065127D14GACGGCCCACTNONE 
J065176C24GACGGCCCACTNONE 
J065188M12GACGGCCCACTNONE 
J065194L14GACGGCCCACTNONE 
J075060P09GACGGCCCACTNONE 
J075134C14GACGGCCCACTRibosomal protein L24E family protein. 
J075192M12GACGGCCCACTNONE 
J100032N01GACGGCCCACTNONE 
Os07g0245100J023048C16CCATGGGCCCACTTGNONE 
J023110L14CCATGGGCCCACTTGNONE 
J053023B18CCATGGGCCCACTTGNONE 
J053031L17CCATGGGCCCACTTGNONE 
J065035I22CCATGGGCCCACTTGNONE 
J065043D21CCATGGGCCCACTTGNONE 
J065072L16CCATGGGCCCACTTGNONE 
J065214I23CCATGGGCCCACTTGNONE 
Os07g0270900015-039-A02AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
AK058966AAATGGGCCTTGAGTGGGCCAAAGCCCATTAMak16 protein family protein. 
AK068904AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J013169N21AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065039I11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065081J11AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
J065162P04AAATGGGCCTTGAGTGGGCCAAAGCCCATTANONE 
Os07g0301200AB110202AGTGGGCCGTGNONE 
AK073463AGTGGGCCGTGSimilar to RNA helicase (Fragment). 
Os07g0459400AK101767GCTGGGCCCACTRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
Os07g0501900AK067791CACTGACAAGTGGGCCCCANONE 
AK120759CACTGACAAGTGGGCCCCANONE 
Os07g0522600AK067405AAGGCCCACTSimilar to Glutamate receptor 3.4 precursor (Ligand-gated ion channel 3.4) (AtGLR4). Splice isoform 2. 
AK103813AAGGCCCACTNONE 
J013106I10AAGGCCCACTNONE 
J023019F16AAGGCCCACTNONE 
J023111D09AAGGCCCACTNONE 
J033147C01AAGGCCCACTNONE 
J090014A07AAGGCCCACTNONE 
J090040K16AAGGCCCACTNONE 
J090087I22AAGGCCCACTNONE 
Os07g0531600015-098-E11AGTGGGCCCACCTGTCNONE 
AK067845AGTGGGCCCACCTGTCPhospholipid/glycerol acyltransferase domain containing protein. 
J013124G01AGTGGGCCCACCTGTCNONE 
J065008E15AGTGGGCCCACCTGTCNONE 
J065052K14AGTGGGCCCACCTGTCNONE 
J065052L13AGTGGGCCCACCTGTCNONE 
J065058M02AGTGGGCCCACCTGTCNONE 
J065069M10AGTGGGCCCACCTGTCNONE 
J065135A14AGTGGGCCCACCTGTCNONE 
J065168O18AGTGGGCCCACCTGTCNONE 
J075070D14AGTGGGCCCACCTGTCNONE 
J075169B16AGTGGGCCCACCTGTCNONE 
Os07g0557500AK101830AGAGTGGGCCCCACGTZinc finger, RING-type domain containing protein. 
J013075M04AGAGTGGGCCCCACGTNONE 
J033068I24AGAGTGGGCCCCACGTNONE 
Os07g0578600AK067155TTCGGCCCGGCCCACTCCSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065TTCGGCCCGGCCCACTCCNONE 
Os07g0604500009-018-C07AGTGGGCCCCACCNONE 
009-018-C07GGGGCCCACTNONE 
009-194-C02AGTGGGCCCCACCNONE 
009-194-C02GGGGCCCACTNONE 
011-023-C06AGTGGGCCCCACCNONE 
011-023-C06GGGGCCCACTNONE 
015-035-B10AGTGGGCCCCACCNONE 
015-035-B10GGGGCCCACTNONE 
AK064312AGTGGGCCCCACCSimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK064312GGGGCCCACTSimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK069085AGTGGGCCCCACCNONE 
AK069085GGGGCCCACTNONE 
J090050I12AGTGGGCCCCACCNONE 
J090050I12GGGGCCCACTNONE 
J100027C10AGTGGGCCCCACCNONE 
J100027C10GGGGCCCACTNONE 
J100029A05AGTGGGCCCCACCNONE 
J100029A05GGGGCCCACTNONE 
J100031P17AGTGGGCCCCACCNONE 
J100031P17GGGGCCCACTNONE 
J100039E20AGTGGGCCCCACCNONE 
J100039E20GGGGCCCACTNONE 
J100064L15AGTGGGCCCCACCNONE 
J100064L15GGGGCCCACTNONE 
J100066K08AGTGGGCCCCACCNONE 
J100066K08GGGGCCCACTNONE 
Os07g0614100AB032062TCTGGGCCCACTCCNONE 
AK058885TCTGGGCCCACTCCNONE 
AK069145TCTGGGCCCACTCCNONE 
AK102448TCTGGGCCCACTCCAlpha 1-2 subunit of 20S proteasome. 
J023007E07TCTGGGCCCACTCCNONE 
J033093O06TCTGGGCCCACTCCNONE 
Os07g0622700AK107120AGTGGGCCGCEpoxide hydrolase family protein. 
Os07g0631900AK061072CACTGACAGTGGGCCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os07g0639800AK074012CAAGTGGGCCCACGAGCCCACCCGSimilar to Eukaryotic translation initiation factor 6 (Fragment). 
AK104592CAAGTGGGCCCACGAGCCCACCCGNONE 
AK104739CAAGTGGGCCCACGAGCCCACCCGNONE 
Os07g0667400AK073297AGTGGGCCTCSAM (and some other nucleotide) binding motif domain containing protein. 
J033027J22AGTGGGCCTCNONE 
J033122B17AGTGGGCCTCNONE 
J065017H12AGTGGGCCTCNONE 
J065106D19AGTGGGCCTCNONE 
J065196J16AGTGGGCCTCNONE 
J090084F01AGTGGGCCTCNONE 
Os07g0669000AK099431GCGGCCCACTSimilar to Catalytic subunit of polymerase zeta. 
J065073M09GCGGCCCACTNONE 
Os07g0670200J075083N20AGTGGGCCCACTC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os07g0680300009-195-E06TCGGCCCACTTAGGCCCATATNONE 
AK063800TCGGCCCACTTAGGCCCATATSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
J065093F19TCGGCCCACTTAGGCCCATATNONE 
J075066A20TCGGCCCACTTAGGCCCATATNONE 
J075088I17TCGGCCCACTTAGGCCCATATNONE 
J075147M19TCGGCCCACTTAGGCCCATATNONE 
J075153L02TCGGCCCACTTAGGCCCATATNONE 
J080013A21TCGGCCCACTTAGGCCCATATNONE 
J080051B13TCGGCCCACTTAGGCCCATATNONE 
J080077I24TCGGCCCACTTAGGCCCATATNONE 
J080302B14TCGGCCCACTTAGGCCCATATNONE 
J080309D22TCGGCCCACTTAGGCCCATATNONE 
J100083B16TCGGCCCACTTAGGCCCATATNONE 
Os07g0688100AK101635GTGGCCCACTProtein prenyltransferase domain containing protein. 
J033055B02GTGGCCCACTNONE 
J090013O08GTGGCCCACTNONE 
J090074A17GTGGCCCACTNONE 
Os08g0126500AK110941GCCCCACGTATGGCCCACTTGProtein of unknown function DUF295 family protein. 
Os08g0129200014-040-E08AGTGGGCCGAGATNONE 
AK070034AGTGGGCCGAGATNONE 
AK101577AGTGGGCCGAGATSimilar to Cold shock protein-1. 
J065137A09AGTGGGCCGAGATNONE 
J100062K14AGTGGGCCGAGATNONE 
Os08g0135900AK072535AGTGGGCCGGCCCATGSimilar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment). 
Os08g0139100006-027-E12GGCCCGGCCCGGCCCGGCCCACTNONE 
006-089-E06GGCCCGGCCCGGCCCGGCCCACTNONE 
006-113-G02GGCCCGGCCCGGCCCGGCCCACTNONE 
AK061429GGCCCGGCCCGGCCCGGCCCACTNONE 
AK099590GGCCCGGCCCGGCCCGGCCCACTSimilar to DAG protein, chloroplast precursor. 
AK104727GGCCCGGCCCGGCCCGGCCCACTNONE 
J013043H11GGCCCGGCCCGGCCCGGCCCACTNONE 
J013049N13GGCCCGGCCCGGCCCGGCCCACTNONE 
J065079F01GGCCCGGCCCGGCCCGGCCCACTNONE 
J065122N24GGCCCGGCCCGGCCCGGCCCACTNONE 
J065142J24GGCCCGGCCCGGCCCGGCCCACTNONE 
J065193N03GGCCCGGCCCGGCCCGGCCCACTNONE 
J075041I21GGCCCGGCCCGGCCCGGCCCACTNONE 
J075145E04GGCCCGGCCCGGCCCGGCCCACTNONE 
Os08g0143500006-072-G06TGGGGCCCACTNONE 
016-053-H02TGGGGCCCACTNONE 
AK061094TGGGGCCCACTNONE 
AK071122TGGGGCCCACTGlycosyl transferase, family 14 protein. 
J023081E17TGGGGCCCACTNONE 
J023106O18TGGGGCCCACTNONE 
J043001N22TGGGGCCCACTNONE 
J065062D05TGGGGCCCACTNONE 
J065099M15TGGGGCCCACTNONE 
J065180K12TGGGGCCCACTNONE 
J090045L23TGGGGCCCACTNONE 
J100088K05TGGGGCCCACTNONE 
Os08g0150800AK101530CTTGGGCCCACTTGSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0192900AK103422AGTGGGCCAGCCCATGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645AGTGGGCCAGCCCATGANONE 
Os08g0319900AK108030CAAGTGGGCCCCPutative cyclase family protein. 
Os08g0397900006-033-G02AGAGTGGGCCCCACGCGNONE 
009-131-F03AGAGTGGGCCCCACGCGNONE 
AK060114AGAGTGGGCCCCACGCGNONE 
AK098973AGAGTGGGCCCCACGCGNONE 
AK109817AGAGTGGGCCCCACGCGConserved hypothetical protein. 
J013089E18AGAGTGGGCCCCACGCGNONE 
J100081N17AGAGTGGGCCCCACGCGNONE 
Os08g0463900AK120178AGTGGGCCAGConserved hypothetical protein. 
J013033H06AGTGGGCCAGNONE 
J075006G17AGTGGGCCAGNONE 
Os08g0492100AK060178AGTGGGCCTANONE 
AK071053AGTGGGCCTAParaneoplastic encephalomyelitis antigen family protein. 
AK100101AGTGGGCCTANONE 
J023004I20AGTGGGCCTANONE 
J023067D13AGTGGGCCTANONE 
J033028G05AGTGGGCCTANONE 
J033060L15AGTGGGCCTANONE 
J033103N12AGTGGGCCTANONE 
J033125B19AGTGGGCCTANONE 
J065132A12AGTGGGCCTANONE 
J065161F02AGTGGGCCTANONE 
J065162L05AGTGGGCCTANONE 
J090093I18AGTGGGCCTANONE 
J100061I05AGTGGGCCTANONE 
J100081G13AGTGGGCCTANONE 
Os08g0494300AK066150AGTGGGCCCATCCAvon Willebrand factor, type A domain containing protein. 
Os08g0511000AK107578AGTGGGCCAGAProtein prenyltransferase domain containing protein. 
Os08g0511800011-007-H01AAGGCCCACTGGGCTGANONE 
AK063264AAGGCCCACTGGGCTGAConserved hypothetical protein. 
Os08g0521400006-047-C11AGGGCCCACCTAGTGGGCCCAATTNONE 
016-014-E07AGGGCCCACCTAGTGGGCCCAATTNONE 
AK070148AGGGCCCACCTAGTGGGCCCAATTNONE 
AK101704AGGGCCCACCTAGTGGGCCCAATTZinc finger, RanBP2-type domain containing protein. 
AK105045AGGGCCCACCTAGTGGGCCCAATTNONE 
J013108K14AGGGCCCACCTAGTGGGCCCAATTNONE 
J013129E16AGGGCCCACCTAGTGGGCCCAATTNONE 
J013159M23AGGGCCCACCTAGTGGGCCCAATTNONE 
J023041G22AGGGCCCACCTAGTGGGCCCAATTNONE 
J033060G13AGGGCCCACCTAGTGGGCCCAATTNONE 
J033060J15AGGGCCCACCTAGTGGGCCCAATTNONE 
J065120J24AGGGCCCACCTAGTGGGCCCAATTNONE 
J065160I01AGGGCCCACCTAGTGGGCCCAATTNONE 
J065179A16AGGGCCCACCTAGTGGGCCCAATTNONE 
J065189K04AGGGCCCACCTAGTGGGCCCAATTNONE 
J090032O15AGGGCCCACCTAGTGGGCCCAATTNONE 
J090045A18AGGGCCCACCTAGTGGGCCCAATTNONE 
J090060B21AGGGCCCACCTAGTGGGCCCAATTNONE 
J090086F23AGGGCCCACCTAGTGGGCCCAATTNONE 
J090098O22AGGGCCCACCTAGTGGGCCCAATTNONE 
J100018K20AGGGCCCACCTAGTGGGCCCAATTNONE 
J100048P22AGGGCCCACCTAGTGGGCCCAATTNONE 
J100052I06AGGGCCCACCTAGTGGGCCCAATTNONE 
Os08g0525000AK103220AGTGGGCCCCACCTGTCAGRas GTPase family protein. 
J033122O18AGTGGGCCCCACCTGTCAGNONE 
J065026M15AGTGGGCCCCACCTGTCAGNONE 
J075007I01AGTGGGCCCCACCTGTCAGNONE 
J075031E01AGTGGGCCCCACCTGTCAGNONE 
J075043N14AGTGGGCCCCACCTGTCAGNONE 
J075074O16AGTGGGCCCCACCTGTCAGNONE 
J075092O04AGTGGGCCCCACCTGTCAGNONE 
J075141D16AGTGGGCCCCACCTGTCAGNONE 
J075172C22AGTGGGCCCCACCTGTCAGNONE 
J075173A05AGTGGGCCCCACCTGTCAGNONE 
Os08g0527400AK119389AGTGGGCCTTPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0531000AK072408AGTGGGCCCCACCTGTCSimilar to Diphosphonucleotide phosphatase 1 precursor. 
Os08g0536300AF358777CTGGCCCACTGACANONE 
AK099722CTGGCCCACTGACASimilar to Hd1. 
J100054G13CTGGCCCACTGACANONE 
Os08g0542100AK058490AAAAGCCCAACAGGCCCACTRibosomal protein L7, eukaryotic form family protein. 
AK101416AAAAGCCCAACAGGCCCACTNONE 
J033037N08AAAAGCCCAACAGGCCCACTNONE 
J033086B16AAAAGCCCAACAGGCCCACTNONE 
J043036J02AAAAGCCCAACAGGCCCACTNONE 
J065137E02AAAAGCCCAACAGGCCCACTNONE 
J090015L07AAAAGCCCAACAGGCCCACTNONE 
J100036D02AAAAGCCCAACAGGCCCACTNONE 
Os08g0544500AK071354CTCGGCCCACTSimilar to ARP2/3 regulatory protein subunit NAPP. 
Os09g0246700AK121936AGGGCCCACTConserved hypothetical protein. 
Os09g0279200009-124-D04GGTGGGGCCCACTNONE 
AK062883GGTGGGGCCCACTConserved hypothetical protein. 
Os09g0319800AK066759AGTGGGCCATTerpenoid cylases/protein prenyltransferase alpha-alpha toroid domain containing protein. 
AK066759AGTGGGCCGATerpenoid cylases/protein prenyltransferase alpha-alpha toroid domain containing protein. 
Os09g0321300AK122141AGAGTGGGCCGGGNONE 
Os09g0330200AK111018AGTGGGCCACConserved hypothetical protein. 
Os09g0360400009-192-H06CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
AK071395CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGConserved hypothetical protein. 
J013045J21CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J023095O09CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J065207K01CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
Os09g0416400J075067A16GTCAGTGGGCCGGAConserved hypothetical protein. 
J075104N21GTCAGTGGGCCGGANONE 
J075106F04GTCAGTGGGCCGGANONE 
J075131F08GTCAGTGGGCCGGANONE 
Os09g0441900009-109-C08GTGGCCCACTNONE 
013-033-G05GTGGCCCACTNONE 
AK062809GTGGCCCACTNONE 
AK064043GTGGCCCACTNONE 
J023131I10GTGGCCCACTNONE 
J033032C18GTGGCCCACTNONE 
J033113E20GTGGCCCACTNONE 
Os09g0446200011-092-H04AGTGGGCCACSpc97/Spc98 family protein. 
Os09g0453800AK119212ATGGCCCACTNONE 
J023081A04ATGGCCCACTNONE 
J065180G14ATGGCCCACTNONE 
J100024A17ATGGCCCACTNONE 
J100030A05ATGGCCCACTNONE 
J100042I11ATGGCCCACTNONE 
J100054N05ATGGCCCACTNONE 
J100075G23ATGGCCCACTNONE 
Os09g0471900AK073815AGTGGGCCCATAABacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0498100015-046-G11AGTGGGCCGGANONE 
AK064108AGTGGGCCGGASimilar to 30S ribosomal protein S16. 
J065040H21AGTGGGCCGGANONE 
J065062F05AGTGGGCCGGANONE 
J065147B17AGTGGGCCGGANONE 
J075098J22AGTGGGCCGGANONE 
Os09g0505700006-050-D06CCACTGACAAGTGGGCCATNONE 
AF189365CCACTGACAAGTGGGCCATNONE 
AK061034CCACTGACAAGTGGGCCATNONE 
AK069451CCACTGACAAGTGGGCCATRibulose-phosphate 3-epimerase, cytoplasmic isoform (EC 5.1.3.1) (Ribulose-5-phosphate-epimerase) (Cyt-RPEase) (RPEcyt) (Pentose-5- phosphate 3-epimerase) (PPE). 
J065081J09CCACTGACAAGTGGGCCATNONE 
J065115A18CCACTGACAAGTGGGCCATNONE 
J065143E16CCACTGACAAGTGGGCCATNONE 
J065146F17CCACTGACAAGTGGGCCATNONE 
J065201H17CCACTGACAAGTGGGCCATNONE 
J075029C13CCACTGACAAGTGGGCCATNONE 
J075049I05CCACTGACAAGTGGGCCATNONE 
J075122G19CCACTGACAAGTGGGCCATNONE 
J075132N08CCACTGACAAGTGGGCCATNONE 
Os09g0535300AK071211AGTGGGCCTCXAP5 protein family protein. 
Os09g0537600006-054-B05AGTGGGCCCAACANONE 
AK061004AGTGGGCCCAACASimilar to Cyclophilin-like protein (Single domain cyclophilin type peptidyl- prolyl cis-trans isomerase). 
J065104J20AGTGGGCCCAACANONE 
J075029H16AGTGGGCCCAACANONE 
Os09g0542200006-092-A09AGTGGGCCTTNONE 
AK064887AGTGGGCCTTThioredoxin fold domain containing protein. 
AK104804AGTGGGCCTTNONE 
J013000K12AGTGGGCCTTNONE 
J013170A19AGTGGGCCTTNONE 
J033103B02AGTGGGCCTTNONE 
J065196J20AGTGGGCCTTNONE 
J075037H17AGTGGGCCTTNONE 
J075069H14AGTGGGCCTTNONE 
J075071C16AGTGGGCCTTNONE 
J075095N02AGTGGGCCTTNONE 
J075136N03AGTGGGCCTTNONE 
J075192L16AGTGGGCCTTNONE 
J100057N23AGTGGGCCTTNONE 
J100060O07AGTGGGCCTTNONE 
J100062F10AGTGGGCCTTNONE 
J100077I08AGTGGGCCTTNONE 
J100086B07AGTGGGCCTTNONE 
J100088L14AGTGGGCCTTNONE 
Os09g0547200016-021-H03GGTGGGGCCCACTCCAACGGNONE 
AK073078GGTGGGGCCCACTCCAACGGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984GGTGGGGCCCACTCCAACGGNONE 
J065005L05GGTGGGGCCCACTCCAACGGNONE 
J065039C06GGTGGGGCCCACTCCAACGGNONE 
J065116H17GGTGGGGCCCACTCCAACGGNONE 
J100046A17GGTGGGGCCCACTCCAACGGNONE 
Os09g0559900AK111842TAATGGGCCGTGTTGGGCCGGCCCACTGACAGProtein kinase-like domain containing protein. 
Os09g0572900AK069270CAAGTGGGCCCCSimilar to Dynamin-related protein 1E (Dynamin-like protein E) (Dynamin-like protein 4) (Dynamin-like protein DLP2). 
Os09g0573000AK073399GGGGCCCACTTGProtein prenyltransferase domain containing protein. 
Os09g0573200J013027J02AGTGGGCCGTGGNONE 
J013034M08AGTGGGCCGTGGNONE 
J013037L03AGTGGGCCGTGGNONE 
J013041D10AGTGGGCCGTGGNONE 
J013042D15AGTGGGCCGTGGNONE 
J013109H17AGTGGGCCGTGGNONE 
J013132A18AGTGGGCCGTGGNONE 
J013160N13AGTGGGCCGTGGNONE 
J013169I09AGTGGGCCGTGGNONE 
J023029F18AGTGGGCCGTGGNONE 
J023041A02AGTGGGCCGTGGNONE 
J023097B14AGTGGGCCGTGGNONE 
J023142I04AGTGGGCCGTGGNONE 
J023142N06AGTGGGCCGTGGNONE 
J033023I21AGTGGGCCGTGGNONE 
J033032G15AGTGGGCCGTGGNONE 
J033042M17AGTGGGCCGTGGNONE 
J033070F09AGTGGGCCGTGGNONE 
J053063L09AGTGGGCCGTGGNONE 
J053064A09AGTGGGCCGTGGNONE 
J065073M19AGTGGGCCGTGGNONE 
J075005H11AGTGGGCCGTGGNONE 
J075026D12AGTGGGCCGTGGNONE 
J075043G07AGTGGGCCGTGGNONE 
J075084N05AGTGGGCCGTGGNONE 
J075092D05AGTGGGCCGTGGNONE 
J075110E24AGTGGGCCGTGGNONE 
J075176I05AGTGGGCCGTGGNONE 
J090009H19AGTGGGCCGTGGNONE 
J090025K11AGTGGGCCGTGGNONE 
J090049E20AGTGGGCCGTGGNONE 
J090070G02AGTGGGCCGTGGNONE 
Os11g0109900011-064-B04CAAGTGGGCCCATCGCTGGGCCTCNONE 
AK063961CAAGTGGGCCCATCGCTGGGCCTCDouble-stranded RNA binding domain containing protein. 
AK121852CAAGTGGGCCCATCGCTGGGCCTCNONE 
J065183M14CAAGTGGGCCCATCGCTGGGCCTCNONE 
Os11g0114700AK065865AGTGGGCCGTGGNONE 
AK066583AGTGGGCCGTGGNONE 
AK070834AGTGGGCCGTGGPAP/25A core domain containing protein. 
AK072543AGTGGGCCGTGGNONE 
Os11g0127700AK103742CTGGGCTTGGGCCGGCCCACTHypothetical protein. 
J090083M11CTGGGCTTGGGCCGGCCCACTNONE 
Os11g0131900AK065240TGTCAGTGGGCCCCSimilar to Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II. 
Os11g0139100009-099-H06TCTCGGCCCACTNONE 
AK121443TCTCGGCCCACTSimilar to 50S ribosomal protein L24. 
J023140O18TCTCGGCCCACTNONE 
J023143M23TCTCGGCCCACTNONE 
J033079G04TCTCGGCCCACTNONE 
J043004D20TCTCGGCCCACTNONE 
J065097F05TCTCGGCCCACTNONE 
Os11g0157100012-010-F03GGAGTGGGCCTGAAACGGGCCNONE 
J013028H01GGAGTGGGCCTGAAACGGGCCNONE 
J013061L19GGAGTGGGCCTGAAACGGGCCNONE 
J033044L03GGAGTGGGCCTGAAACGGGCCNONE 
J033064P09GGAGTGGGCCTGAAACGGGCCNONE 
J033076A10GGAGTGGGCCTGAAACGGGCCNONE 
J033076K22GGAGTGGGCCTGAAACGGGCCNONE 
J033084J05GGAGTGGGCCTGAAACGGGCCNONE 
J033145A22GGAGTGGGCCTGAAACGGGCCNONE 
J033148L19GGAGTGGGCCTGAAACGGGCCNONE 
J065027P20GGAGTGGGCCTGAAACGGGCCNONE 
J065085D16GGAGTGGGCCTGAAACGGGCCNONE 
J065091L03GGAGTGGGCCTGAAACGGGCCNONE 
J065195C18GGAGTGGGCCTGAAACGGGCCNONE 
J090018N23GGAGTGGGCCTGAAACGGGCCNONE 
J090048A10GGAGTGGGCCTGAAACGGGCCNONE 
J090048M03GGAGTGGGCCTGAAACGGGCCNONE 
J090066L11GGAGTGGGCCTGAAACGGGCCNONE 
J090075G16GGAGTGGGCCTGAAACGGGCCNONE 
J090083G23GGAGTGGGCCTGAAACGGGCCNONE 
J090087E24GGAGTGGGCCTGAAACGGGCCNONE 
J090096H16GGAGTGGGCCTGAAACGGGCCNONE 
Os11g0181900011-064-E11AGTGGGCCTGGNONE 
016-031-C07AGTGGGCCTGGNONE 
AK063374AGTGGGCCTGGPrefoldin domain containing protein. 
J065083K20AGTGGGCCTGGNONE 
Os11g0238400009-021-C07AGTGGGCCCCACCNONE 
009-125-D03AGTGGGCCCCACCNONE 
AK105203AGTGGGCCCCACCConserved hypothetical protein. 
Os11g0298400AK068577CAAGTGGGCCAARibulose bisphosphate carboxylase, small chain family protein. 
Os11g0421800015-041-B05AGTGGGCCCCNONE 
AK106317AGTGGGCCCCConserved hypothetical protein. 
Os11g0549690J065085G07AGTGGGCCGGGCCCAACTConserved hypothetical protein. 
J065218B08AGTGGGCCGGGCCCAACTNONE 
J090036H16AGTGGGCCGGGCCCAACTNONE 
Os11g0615700AB026561TGGGGCCCACTNONE 
AK059521TGGGGCCCACTNONE 
AK103487TGGGGCCCACTProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14TGGGGCCCACTNONE 
J065044A11TGGGGCCCACTNONE 
J065090I02TGGGGCCCACTNONE 
J065104I09TGGGGCCCACTNONE 
J065187J10TGGGGCCCACTNONE 
J075024E07TGGGGCCCACTNONE 
J075025O13TGGGGCCCACTNONE 
J090062N12TGGGGCCCACTNONE 
J090087G06TGGGGCCCACTNONE 
J090098K11TGGGGCCCACTNONE 
Os11g0697400J065021C03AGGGCCCACTTGNONE 
J065022A14AGGGCCCACTTGNONE 
J065024I05AGGGCCCACTTGHypothetical protein. 
J065031A20AGGGCCCACTTGNONE 
J065046D17AGGGCCCACTTGNONE 
J065060A09AGGGCCCACTTGNONE 
J065078H18AGGGCCCACTTGNONE 
J065088L16AGGGCCCACTTGNONE 
J065134F20AGGGCCCACTTGNONE 
J065139F22AGGGCCCACTTGNONE 
J065149C20AGGGCCCACTTGNONE 
J065164L09AGGGCCCACTTGNONE 
J065167K11AGGGCCCACTTGNONE 
J065178O09AGGGCCCACTTGNONE 
J065185M03AGGGCCCACTTGNONE 
J065188H02AGGGCCCACTTGNONE 
J065203C12AGGGCCCACTTGNONE 
J075013G16AGGGCCCACTTGNONE 
J075046J24AGGGCCCACTTGNONE 
J075062A07AGGGCCCACTTGNONE 
J075083F01AGGGCCCACTTGNONE 
J075110I16AGGGCCCACTTGNONE 
J075132E17AGGGCCCACTTGNONE 
J075150H03AGGGCCCACTTGNONE 
J075166H11AGGGCCCACTTGNONE 
J080001H24AGGGCCCACTTGNONE 
J080001O03AGGGCCCACTTGNONE 
J080025J03AGGGCCCACTTGNONE 
J080027H04AGGGCCCACTTGNONE 
J080034B17AGGGCCCACTTGNONE 
J080037K21AGGGCCCACTTGNONE 
J080042A08AGGGCCCACTTGNONE 
J080054D03AGGGCCCACTTGNONE 
J080054M18AGGGCCCACTTGNONE 
J080068K02AGGGCCCACTTGNONE 
J080070E24AGGGCCCACTTGNONE 
J080317K04AGGGCCCACTTGNONE 
Os11g0703900011-004-D05GACGGCCCACTTGNONE 
011-014-C03GACGGCCCACTTGNONE 
011-016-C01GACGGCCCACTTGNONE 
011-017-B04GACGGCCCACTTGNONE 
011-017-E09GACGGCCCACTTGNONE 
011-019-E12GACGGCCCACTTGNONE 
011-021-H12GACGGCCCACTTGNONE 
011-025-H02GACGGCCCACTTGNONE 
011-027-B09GACGGCCCACTTGNONE 
011-039-G07GACGGCCCACTTGNONE 
011-044-G07GACGGCCCACTTGNONE 
011-046-F11GACGGCCCACTTGNONE 
011-070-F02GACGGCCCACTTGNONE 
011-071-A07GACGGCCCACTTGNONE 
011-082-A03GACGGCCCACTTGNONE 
011-086-B09GACGGCCCACTTGNONE 
011-092-C04GACGGCCCACTTGNONE 
012-006-F02GACGGCCCACTTGNONE 
012-011-G08GACGGCCCACTTGNONE 
012-026-C06GACGGCCCACTTGNONE 
012-026-G06GACGGCCCACTTGNONE 
012-028-E05GACGGCCCACTTGNONE 
012-040-A05GACGGCCCACTTGNONE 
012-045-C01GACGGCCCACTTGNONE 
012-046-A10GACGGCCCACTTGNONE 
012-047-H09GACGGCCCACTTGNONE 
012-059-A12GACGGCCCACTTGNONE 
012-072-D06GACGGCCCACTTGNONE 
012-073-D05GACGGCCCACTTGNONE 
012-076-D08GACGGCCCACTTGNONE 
012-079-G05GACGGCCCACTTGNONE 
012-080-A04GACGGCCCACTTGNONE 
012-080-E01GACGGCCCACTTGNONE 
012-083-C03GACGGCCCACTTGNONE 
012-083-G06GACGGCCCACTTGNONE 
012-086-G02GACGGCCCACTTGNONE 
012-091-A07GACGGCCCACTTGNONE 
012-094-G10GACGGCCCACTTGNONE 
012-098-A07GACGGCCCACTTGNONE 
012-100-G04GACGGCCCACTTGNONE 
015-001-A11GACGGCCCACTTGNONE 
015-033-E01GACGGCCCACTTGNONE 
015-047-F12GACGGCCCACTTGNONE 
015-054-E05GACGGCCCACTTGNONE 
015-063-H02GACGGCCCACTTGNONE 
015-075-E10GACGGCCCACTTGNONE 
015-086-F05GACGGCCCACTTGNONE 
016-031-A08GACGGCCCACTTGNONE 
016-053-A03GACGGCCCACTTGNONE 
016-054-C09GACGGCCCACTTGNONE 
016-079-C08GACGGCCCACTTGNONE 
AK065431GACGGCCCACTTGHeat shock protein 70. 
AK119255GACGGCCCACTTGNONE 
J013021C12GACGGCCCACTTGNONE 
J013021C17GACGGCCCACTTGNONE 
J023027B08GACGGCCCACTTGNONE 
J023078A21GACGGCCCACTTGNONE 
J023097M06GACGGCCCACTTGNONE 
J023100O04GACGGCCCACTTGNONE 
J023107B17GACGGCCCACTTGNONE 
J023108L24GACGGCCCACTTGNONE 
J023109L05GACGGCCCACTTGNONE 
J033022M22GACGGCCCACTTGNONE 
J033023K21GACGGCCCACTTGNONE 
J033031L11GACGGCCCACTTGNONE 
J033034H10GACGGCCCACTTGNONE 
J033037B16GACGGCCCACTTGNONE 
J033037F16GACGGCCCACTTGNONE 
J033037H07GACGGCCCACTTGNONE 
J033046E22GACGGCCCACTTGNONE 
J033050N12GACGGCCCACTTGNONE 
J033064F10GACGGCCCACTTGNONE 
J033064N10GACGGCCCACTTGNONE 
J033066O09GACGGCCCACTTGNONE 
J033068H01GACGGCCCACTTGNONE 
J033068J07GACGGCCCACTTGNONE 
J033070B10GACGGCCCACTTGNONE 
J033070G13GACGGCCCACTTGNONE 
J033073O13GACGGCCCACTTGNONE 
J033075B07GACGGCCCACTTGNONE 
J033079L15GACGGCCCACTTGNONE 
J033081J06GACGGCCCACTTGNONE 
J033086G13GACGGCCCACTTGNONE 
J033086N07GACGGCCCACTTGNONE 
J033086O05GACGGCCCACTTGNONE 
J033091A15GACGGCCCACTTGNONE 
J033091D05GACGGCCCACTTGNONE 
J033094C12GACGGCCCACTTGNONE 
J033099P03GACGGCCCACTTGNONE 
J033107L09GACGGCCCACTTGNONE 
J033108D16GACGGCCCACTTGNONE 
J033109E12GACGGCCCACTTGNONE 
J033109K14GACGGCCCACTTGNONE 
J033112P22GACGGCCCACTTGNONE 
J033116F12GACGGCCCACTTGNONE 
J033116K01GACGGCCCACTTGNONE 
J033118F19GACGGCCCACTTGNONE 
J033121J10GACGGCCCACTTGNONE 
J033126H04GACGGCCCACTTGNONE 
J033131G17GACGGCCCACTTGNONE 
J033131L05GACGGCCCACTTGNONE 
J033136A08GACGGCCCACTTGNONE 
J033136H22GACGGCCCACTTGNONE 
J033143F01GACGGCCCACTTGNONE 
J065040M10GACGGCCCACTTGNONE 
J065046F17GACGGCCCACTTGNONE 
J065048G20GACGGCCCACTTGNONE 
J065071N06GACGGCCCACTTGNONE 
J065084I24GACGGCCCACTTGNONE 
J065171B01GACGGCCCACTTGNONE 
J065191J21GACGGCCCACTTGNONE 
J065199I20GACGGCCCACTTGNONE 
J075076C02GACGGCCCACTTGNONE 
J090002P12GACGGCCCACTTGNONE 
J090003A11GACGGCCCACTTGNONE 
J090003H11GACGGCCCACTTGNONE 
J090009M22GACGGCCCACTTGNONE 
J090009O11GACGGCCCACTTGNONE 
J090014N09GACGGCCCACTTGNONE 
J090015A18GACGGCCCACTTGNONE 
J090016E16GACGGCCCACTTGNONE 
J090016I07GACGGCCCACTTGNONE 
J090017O07GACGGCCCACTTGNONE 
J090019E10GACGGCCCACTTGNONE 
J090020D24GACGGCCCACTTGNONE 
J090021M16GACGGCCCACTTGNONE 
J090022F13GACGGCCCACTTGNONE 
J090023H03GACGGCCCACTTGNONE 
J090024E15GACGGCCCACTTGNONE 
J090024G19GACGGCCCACTTGNONE 
J090026J19GACGGCCCACTTGNONE 
J090030E20GACGGCCCACTTGNONE 
J090030I15GACGGCCCACTTGNONE 
J090032F04GACGGCCCACTTGNONE 
J090033N22GACGGCCCACTTGNONE 
J090033O19GACGGCCCACTTGNONE 
J090036F08GACGGCCCACTTGNONE 
J090039A13GACGGCCCACTTGNONE 
J090042N07GACGGCCCACTTGNONE 
J090043C15GACGGCCCACTTGNONE 
J090043N09GACGGCCCACTTGNONE 
J090053J10GACGGCCCACTTGNONE 
J090054F14GACGGCCCACTTGNONE 
J090057N12GACGGCCCACTTGNONE 
J090061P13GACGGCCCACTTGNONE 
J090062F17GACGGCCCACTTGNONE 
J090065H15GACGGCCCACTTGNONE 
J090067P11GACGGCCCACTTGNONE 
J090068M09GACGGCCCACTTGNONE 
J090069E24GACGGCCCACTTGNONE 
J090069K16GACGGCCCACTTGNONE 
J090070N07GACGGCCCACTTGNONE 
J090072M09GACGGCCCACTTGNONE 
J090075I24GACGGCCCACTTGNONE 
J090075M04GACGGCCCACTTGNONE 
J090077D24GACGGCCCACTTGNONE 
J090080M17GACGGCCCACTTGNONE 
J090080O14GACGGCCCACTTGNONE 
J090081C12GACGGCCCACTTGNONE 
J090084N21GACGGCCCACTTGNONE 
J090084O21GACGGCCCACTTGNONE 
J090087J18GACGGCCCACTTGNONE 
J090092L17GACGGCCCACTTGNONE 
J090097A08GACGGCCCACTTGNONE 
J100017E24GACGGCCCACTTGNONE 
J100018K11GACGGCCCACTTGNONE 
J100019A16GACGGCCCACTTGNONE 
J100023I23GACGGCCCACTTGNONE 
J100024D07GACGGCCCACTTGNONE 
J100025H12GACGGCCCACTTGNONE 
J100027K19GACGGCCCACTTGNONE 
J100028C23GACGGCCCACTTGNONE 
J100029A14GACGGCCCACTTGNONE 
J100029O19GACGGCCCACTTGNONE 
J100030I09GACGGCCCACTTGNONE 
J100030J16GACGGCCCACTTGNONE 
J100031C01GACGGCCCACTTGNONE 
J100031N06GACGGCCCACTTGNONE 
J100033H04GACGGCCCACTTGNONE 
J100034L20GACGGCCCACTTGNONE 
J100036K13GACGGCCCACTTGNONE 
J100039M02GACGGCCCACTTGNONE 
J100040J01GACGGCCCACTTGNONE 
J100042O21GACGGCCCACTTGNONE 
J100042P20GACGGCCCACTTGNONE 
J100047K22GACGGCCCACTTGNONE 
J100049B16GACGGCCCACTTGNONE 
J100052M10GACGGCCCACTTGNONE 
J100053B05GACGGCCCACTTGNONE 
J100053B20GACGGCCCACTTGNONE 
J100055I11GACGGCCCACTTGNONE 
J100056A13GACGGCCCACTTGNONE 
J100057C08GACGGCCCACTTGNONE 
J100057N11GACGGCCCACTTGNONE 
J100057P07GACGGCCCACTTGNONE 
J100059E16GACGGCCCACTTGNONE 
J100063N14GACGGCCCACTTGNONE 
J100069H01GACGGCCCACTTGNONE 
J100071C17GACGGCCCACTTGNONE 
J100071K09GACGGCCCACTTGNONE 
J100077D07GACGGCCCACTTGNONE 
J100078P22GACGGCCCACTTGNONE 
J100080F11GACGGCCCACTTGNONE 
J100081L07GACGGCCCACTTGNONE 
J100083B10GACGGCCCACTTGNONE 
J100083K17GACGGCCCACTTGNONE 
J100085B22GACGGCCCACTTGNONE 
J100085L21GACGGCCCACTTGNONE 
J100086B11GACGGCCCACTTGNONE 
J100087E06GACGGCCCACTTGNONE 
J100087P07GACGGCCCACTTGNONE 
J100089H24GACGGCCCACTTGNONE 
Os12g0112250J013069O10AGTGGGCCGGCSaposin B domain containing protein. 
J065206G04AGTGGGCCGGCNONE 
J080302C06AGTGGGCCGGCNONE 
J080306K06AGTGGGCCGGCNONE 
J080307O09AGTGGGCCGGCNONE 
J080310J07AGTGGGCCGGCNONE 
J080311G18AGTGGGCCGGCNONE 
J080318C07AGTGGGCCGGCNONE 
Os12g0123900016-031-A06CTTGGGCCGGCCCACTNONE 
AK061862CTTGGGCCGGCCCACTHypothetical protein. 
J013031P10CTTGGGCCGGCCCACTNONE 
J053034P22CTTGGGCCGGCCCACTNONE 
J053046O16CTTGGGCCGGCCCACTNONE 
J053048D20CTTGGGCCGGCCCACTNONE 
J090031I07CTTGGGCCGGCCCACTNONE 
J100025B02CTTGGGCCGGCCCACTNONE 
Os12g0155200AK067300TTGGCCCACTCCSimilar to Rac GTPase activating protein. 
J090050C04TTGGCCCACTCCNONE 
Os12g0285600AK069104AGTGGGCCCATCCCCCCACCCGOxysterol-binding protein family protein. 
Os12g0292400006-063-H05GTGGCCCACTNONE 
006-083-H03GTGGCCCACTNONE 
006-098-B04GTGGCCCACTNONE 
009-006-G02GTGGCCCACTNONE 
009-018-H03GTGGCCCACTNONE 
009-019-F09GTGGCCCACTNONE 
009-023-G12GTGGCCCACTNONE 
009-028-B05GTGGCCCACTNONE 
009-036-E09GTGGCCCACTNONE 
009-041-D03GTGGCCCACTNONE 
009-068-E01GTGGCCCACTNONE 
009-084-A08GTGGCCCACTNONE 
009-110-B10GTGGCCCACTNONE 
009-113-E12GTGGCCCACTNONE 
009-123-F08GTGGCCCACTNONE 
009-136-D11GTGGCCCACTNONE 
009-144-H09GTGGCCCACTNONE 
009-162-D06GTGGCCCACTNONE 
009-172-G02GTGGCCCACTNONE 
009-174-D05GTGGCCCACTNONE 
009-181-A04GTGGCCCACTNONE 
009-181-F10GTGGCCCACTNONE 
009-184-C01GTGGCCCACTNONE 
009-185-A12GTGGCCCACTNONE 
009-186-F01GTGGCCCACTNONE 
009-188-A04GTGGCCCACTNONE 
009-188-H09GTGGCCCACTNONE 
009-194-A02GTGGCCCACTNONE 
009-194-C12GTGGCCCACTNONE 
014-008-D06GTGGCCCACTNONE 
AK068266GTGGCCCACTSimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
AK070257GTGGCCCACTNONE 
J013149A10GTGGCCCACTNONE 
J023042N11GTGGCCCACTNONE 
J065008A06GTGGCCCACTNONE 
J065013C20GTGGCCCACTNONE 
J065013C24GTGGCCCACTNONE 
J065015F19GTGGCCCACTNONE 
J065017A05GTGGCCCACTNONE 
J065017L20GTGGCCCACTNONE 
J065021H14GTGGCCCACTNONE 
J065026K06GTGGCCCACTNONE 
J065028A05GTGGCCCACTNONE 
J065028L01GTGGCCCACTNONE 
J065028P08GTGGCCCACTNONE 
J065029I11GTGGCCCACTNONE 
J065032H19GTGGCCCACTNONE 
J065032K20GTGGCCCACTNONE 
J065035N23GTGGCCCACTNONE 
J065036A21GTGGCCCACTNONE 
J065040B13GTGGCCCACTNONE 
J065043D04GTGGCCCACTNONE 
J065045A20GTGGCCCACTNONE 
J065048G23GTGGCCCACTNONE 
J065049P06GTGGCCCACTNONE 
J065054H13GTGGCCCACTNONE 
J065057M06GTGGCCCACTNONE 
J065058P12GTGGCCCACTNONE 
J065059A12GTGGCCCACTNONE 
J065064J15GTGGCCCACTNONE 
J065066I19GTGGCCCACTNONE 
J065069B20GTGGCCCACTNONE 
J065071O19GTGGCCCACTNONE 
J065073E16GTGGCCCACTNONE 
J065073N04GTGGCCCACTNONE 
J065074L22GTGGCCCACTNONE 
J065075J08GTGGCCCACTNONE 
J065075K04GTGGCCCACTNONE 
J065075L14GTGGCCCACTNONE 
J065078F13GTGGCCCACTNONE 
J065081A10GTGGCCCACTNONE 
J065083H02GTGGCCCACTNONE 
J065083H05GTGGCCCACTNONE 
J065088C07GTGGCCCACTNONE 
J065088D02GTGGCCCACTNONE 
J065096C10GTGGCCCACTNONE 
J065103I09GTGGCCCACTNONE 
J065107N04GTGGCCCACTNONE 
J065108L19GTGGCCCACTNONE 
J065108O06GTGGCCCACTNONE 
J065111D07GTGGCCCACTNONE 
J065112H15GTGGCCCACTNONE 
J065112L15GTGGCCCACTNONE 
J065112M18GTGGCCCACTNONE 
J065113F02GTGGCCCACTNONE 
J065114C11GTGGCCCACTNONE 
J065116E12GTGGCCCACTNONE 
J065119E03GTGGCCCACTNONE 
J065120C19GTGGCCCACTNONE 
J065120H22GTGGCCCACTNONE 
J065121M16GTGGCCCACTNONE 
J065121N17GTGGCCCACTNONE 
J065123E20GTGGCCCACTNONE 
J065127F18GTGGCCCACTNONE 
J065130M04GTGGCCCACTNONE 
J065131N01GTGGCCCACTNONE 
J065134A05GTGGCCCACTNONE 
J065136L05GTGGCCCACTNONE 
J065138D04GTGGCCCACTNONE 
J065138E04GTGGCCCACTNONE 
J065138P10GTGGCCCACTNONE 
J065141E12GTGGCCCACTNONE 
J065142F20GTGGCCCACTNONE 
J065143D19GTGGCCCACTNONE 
J065143N05GTGGCCCACTNONE 
J065146K06GTGGCCCACTNONE 
J065150A10GTGGCCCACTNONE 
J065150J16GTGGCCCACTNONE 
J065151H15GTGGCCCACTNONE 
J065151K19GTGGCCCACTNONE 
J065151P22GTGGCCCACTNONE 
J065154L17GTGGCCCACTNONE 
J065158A20GTGGCCCACTNONE 
J065158C05GTGGCCCACTNONE 
J065161E16GTGGCCCACTNONE 
J065162A22GTGGCCCACTNONE 
J065162K19GTGGCCCACTNONE 
J065165L15GTGGCCCACTNONE 
J065170J09GTGGCCCACTNONE 
J065171J22GTGGCCCACTNONE 
J065172L15GTGGCCCACTNONE 
J065174B07GTGGCCCACTNONE 
J065174D24GTGGCCCACTNONE 
J065175L22GTGGCCCACTNONE 
J065176C04GTGGCCCACTNONE 
J065176K18GTGGCCCACTNONE 
J065180P21GTGGCCCACTNONE 
J065183A09GTGGCCCACTNONE 
J065187E22GTGGCCCACTNONE 
J065192F01GTGGCCCACTNONE 
J065194E23GTGGCCCACTNONE 
J065196A13GTGGCCCACTNONE 
J065196F18GTGGCCCACTNONE 
J065196P03GTGGCCCACTNONE 
J065204P15GTGGCCCACTNONE 
J065207L24GTGGCCCACTNONE 
J065207O18GTGGCCCACTNONE 
J065210B18GTGGCCCACTNONE 
J065210H05GTGGCCCACTNONE 
J065210M24GTGGCCCACTNONE 
J065212F02GTGGCCCACTNONE 
J065219H13GTGGCCCACTNONE 
J075003J22GTGGCCCACTNONE 
J075006N24GTGGCCCACTNONE 
J075007M07GTGGCCCACTNONE 
J075011D05GTGGCCCACTNONE 
J075026I09GTGGCCCACTNONE 
J075030K22GTGGCCCACTNONE 
J075040P09GTGGCCCACTNONE 
J075042L19GTGGCCCACTNONE 
J075043B01GTGGCCCACTNONE 
J075044M04GTGGCCCACTNONE 
J075048H12GTGGCCCACTNONE 
J075049E04GTGGCCCACTNONE 
J075054L07GTGGCCCACTNONE 
J075060D03GTGGCCCACTNONE 
J075064E01GTGGCCCACTNONE 
J075064I24GTGGCCCACTNONE 
J075071L20GTGGCCCACTNONE 
J075075G19GTGGCCCACTNONE 
J075076H14GTGGCCCACTNONE 
J075081E01GTGGCCCACTNONE 
J075089O22GTGGCCCACTNONE 
J075095K19GTGGCCCACTNONE 
J075096L09GTGGCCCACTNONE 
J075105J11GTGGCCCACTNONE 
J075106E16GTGGCCCACTNONE 
J075110A07GTGGCCCACTNONE 
J075116F14GTGGCCCACTNONE 
J075130L19GTGGCCCACTNONE 
J075133I07GTGGCCCACTNONE 
J075137P15GTGGCCCACTNONE 
J075139J03GTGGCCCACTNONE 
J075142L14GTGGCCCACTNONE 
J075144B16GTGGCCCACTNONE 
J075155J18GTGGCCCACTNONE 
J075160O14GTGGCCCACTNONE 
J075161H15GTGGCCCACTNONE 
J075169I05GTGGCCCACTNONE 
J075171J22GTGGCCCACTNONE 
J075179K20GTGGCCCACTNONE 
J075183J01GTGGCCCACTNONE 
J075183O05GTGGCCCACTNONE 
J075184C15GTGGCCCACTNONE 
J075184J21GTGGCCCACTNONE 
J075190G24GTGGCCCACTNONE 
J075196M20GTGGCCCACTNONE 
J080002B08GTGGCCCACTNONE 
J080004M09GTGGCCCACTNONE 
J080008J04GTGGCCCACTNONE 
J080012E01GTGGCCCACTNONE 
J080015L07GTGGCCCACTNONE 
J080017P10GTGGCCCACTNONE 
J080018G20GTGGCCCACTNONE 
J080020F04GTGGCCCACTNONE 
J080021E04GTGGCCCACTNONE 
J080027O08GTGGCCCACTNONE 
J080034C06GTGGCCCACTNONE 
J080034H14GTGGCCCACTNONE 
J080036G10GTGGCCCACTNONE 
J080037C10GTGGCCCACTNONE 
J080038H18GTGGCCCACTNONE 
J080044A19GTGGCCCACTNONE 
J080045I24GTGGCCCACTNONE 
J080050G19GTGGCCCACTNONE 
J080050K24GTGGCCCACTNONE 
J080054F12GTGGCCCACTNONE 
J080059J09GTGGCCCACTNONE 
J080061P18GTGGCCCACTNONE 
J080065O20GTGGCCCACTNONE 
J080068D16GTGGCCCACTNONE 
J080069P21GTGGCCCACTNONE 
J080072D12GTGGCCCACTNONE 
J080079D01GTGGCCCACTNONE 
J080079J23GTGGCCCACTNONE 
J080087B09GTGGCCCACTNONE 
J080091J12GTGGCCCACTNONE 
J080092K11GTGGCCCACTNONE 
J080304A18GTGGCCCACTNONE 
J080309O09GTGGCCCACTNONE 
J080312G11GTGGCCCACTNONE 
J080315B02GTGGCCCACTNONE 
J080315B22GTGGCCCACTNONE 
J080318K05GTGGCCCACTNONE 
J080318M07GTGGCCCACTNONE 
J090003I22GTGGCCCACTNONE 
J090010J03GTGGCCCACTNONE 
J090020J06GTGGCCCACTNONE 
J090032D18GTGGCCCACTNONE 
J090055N15GTGGCCCACTNONE 
J090056P03GTGGCCCACTNONE 
J090057N17GTGGCCCACTNONE 
J090082K17GTGGCCCACTNONE 
J090084M06GTGGCCCACTNONE 
J100039O13GTGGCCCACTNONE 
J100067C07GTGGCCCACTNONE 
J100090J23GTGGCCCACTNONE 
Os12g0477600009-115-E02ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-125-D04ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-152-E11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
013-003-H06ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
AK099534ACCGGGCCCACTGGGCCGGAGGCCCAAAAConserved hypothetical protein. 
J065109J18ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J065115L23ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075002K19ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075034D13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075038B07ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075051A21ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075052J11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075072A08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075080E10ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075101E13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075112F22ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075139O17ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075141K08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075146N01ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075171J24ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
Os12g0498400AK058897AGTGGGCCCCACNONE 
AK070044AGTGGGCCCCACNONE 
AY496951AGTGGGCCCCACSeptum formation topological specificity factor MinE family protein. 
J023038J16AGTGGGCCCCACNONE 
Os12g0507600009-155-B05AGTGGGCCTANONE 
009-155-B05TCCGGCCCACTTGTCGGCCCATGANONE 
AK070613AGTGGGCCTAConserved hypothetical protein. 
AK070613TCCGGCCCACTTGTCGGCCCATGAConserved hypothetical protein. 
J023063G03AGTGGGCCTANONE 
J023063G03TCCGGCCCACTTGTCGGCCCATGANONE 
Os12g0538500006-077-B08AGTGGGCCCAGCCCNONE 
AK059316AGTGGGCCCAGCCCSimilar to PGPD14 protein. 
AK069502AGTGGGCCCAGCCCNONE 
AK104170AGTGGGCCCAGCCCNONE 
AK104287AGTGGGCCCAGCCCNONE 
J023020D18AGTGGGCCCAGCCCNONE 
J090079P08AGTGGGCCCAGCCCNONE 
Os12g0592200Os12g0592200GCCCGGCCCACGGCCCACTConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.