version

Summary of OsREG479 (All List)

OrganismOryza sativa  
IDOsREG479  
SequenceAGTTGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1299  

Entry Sequences (1299 entries)

LocusGene modelSequenceDescription
Os01g0139900AK121677GCCCAACTConserved hypothetical protein. 
J033069D19GCCCAACTNONE 
Os01g0158000AK058679AGTTGGGCCACACGNONE 
AK103127AGTTGGGCCACACGImportin alpha-2 subunit. 
D78504AGTTGGGCCACACGNONE 
Os01g0179901J075009I05TGCGGCCCAATTAGGGCCCAACTNONE 
J075058D09TGCGGCCCAATTAGGGCCCAACTNONE 
J075153K16TGCGGCCCAATTAGGGCCCAACTConserved hypothetical protein. 
Os01g0224500AK109225GCAGCCCAGCCCAACTCCCACCTGTConserved hypothetical protein. 
Os01g0247500AK065614GCCCAACTProtein kinase-like domain containing protein. 
J013026J11GCCCAACTNONE 
Os01g0277500AK066984AGTTGGGCTCTTGGGCCTCSimilar to Dof3 gene (Fragment). 
J013074F19AGTTGGGCTCTTGGGCCTCNONE 
J013091E10AGTTGGGCTCTTGGGCCTCNONE 
J023077C19AGTTGGGCTCTTGGGCCTCNONE 
J033068A02AGTTGGGCTCTTGGGCCTCNONE 
J065137O05AGTTGGGCTCTTGGGCCTCNONE 
Os01g0327600AK120216AGTTGGGCTNONE 
AK121799AGTTGGGCTConserved hypothetical protein. 
J065081I07AGTTGGGCTNONE 
J065082D04AGTTGGGCTNONE 
J065082G10AGTTGGGCTNONE 
J065085G24AGTTGGGCTNONE 
J065105J24AGTTGGGCTNONE 
J065128D18AGTTGGGCTNONE 
J065155D13AGTTGGGCTNONE 
J065200C11AGTTGGGCTNONE 
Os01g0358300AK060388TTCGGCCCAACTNONE 
AK072081TTCGGCCCAACTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AGTTGGGCCGAANONE 
006-083-B11AGTTGGGCCGAANONE 
006-083-C09AGTTGGGCCGAANONE 
006-088-H03AGTTGGGCCGAANONE 
006-102-H05AGTTGGGCCGAANONE 
AK061826AGTTGGGCCGAASimilar to 40S ribosomal protein S4. 
J013105M07AGTTGGGCCGAANONE 
J013155A16AGTTGGGCCGAANONE 
J033025C03AGTTGGGCCGAANONE 
J033072L20AGTTGGGCCGAANONE 
J033095I15AGTTGGGCCGAANONE 
J033105E03AGTTGGGCCGAANONE 
J033112G18AGTTGGGCCGAANONE 
J033125D09AGTTGGGCCGAANONE 
J065100L16AGTTGGGCCGAANONE 
J065176I05AGTTGGGCCGAANONE 
J090001C14AGTTGGGCCGAANONE 
J090058E15AGTTGGGCCGAANONE 
J090068F07AGTTGGGCCGAANONE 
Os01g0385400AK064337AGTTGGGCC4-dicarboxylate transporter/malic acid transport protein family protein. 
AK073340AGTTGGGCNONE 
J033028N18AGTTGGGCNONE 
Os01g0512200J013067C10ATCCCCCACAAGCCCAACTNONE 
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE 
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE 
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE 
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1. 
Os01g0590200011-100-E06AGTTGGGCNONE 
012-005-A05AGTTGGGCNONE 
AK063416AGTTGGGCConserved hypothetical protein. 
AK099235AGTTGGGCNONE 
AK105022AGTTGGGCNONE 
J065030D21AGTTGGGCNONE 
J065031C10AGTTGGGCNONE 
J065105A22AGTTGGGCNONE 
J065173M19AGTTGGGCNONE 
J075188F15AGTTGGGCNONE 
J090050C15AGTTGGGCNONE 
J100058K07AGTTGGGCNONE 
Os01g0604100AK099765AAATGGGCCGAGCCCAACTUspA domain containing protein. 
J013094O21AAATGGGCCGAGCCCAACTNONE 
Os01g0620100AK070122ACAGCCCAACTWD40-like domain containing protein. 
J023044A10ACAGCCCAACTNONE 
J033023C13ACAGCCCAACTNONE 
J033045E16ACAGCCCAACTNONE 
J033111H03ACAGCCCAACTNONE 
Os01g0654500013-057-E05GCCCAACTNONE 
AF155333GCCCAACTNONE 
AK061752GCCCAACTSimilar to NADP-isocitrate dehydrogenase. 
D21069GCCCAACTNONE 
Os01g0708600AK111377AGCCCAACTTransport protein particle (TRAPP) component, Bet3 family protein. 
J065006D07AGCCCAACTNONE 
J065007E03AGCCCAACTNONE 
J065015A13AGCCCAACTNONE 
J065093J17AGCCCAACTNONE 
J065116C09AGCCCAACTNONE 
J065120E04AGCCCAACTNONE 
J065197I17AGCCCAACTNONE 
J065208L13AGCCCAACTNONE 
J065213P07AGCCCAACTNONE 
J075056K07AGCCCAACTNONE 
J090036L08AGCCCAACTNONE 
Os01g0734000AK108909GCCCAACTSimilar to WRKY DNA binding protein. 
AY341845GCCCAACTNONE 
AY870607GCCCAACTNONE 
Os01g0742400AK109885AGTTGGGCCTTNONE 
AK119360AGTTGGGCCTTNONE 
AK120741AGTTGGGCCTTProtein kinase-like domain containing protein. 
J023003P18AGTTGGGCCTTNONE 
Os01g0749000AK107255AGTTGGGCProtein of unknown function DUF1264 family protein. 
AK107265AGTTGGGCNONE 
AK107290AGTTGGGCNONE 
J075001C07AGTTGGGCNONE 
Os01g0773700003-115-A05TTGGCCCAACTNONE 
009-016-C08TTGGCCCAACTNONE 
009-027-A08TTGGCCCAACTNONE 
009-038-C02TTGGCCCAACTNONE 
009-087-D04TTGGCCCAACTNONE 
009-119-A01TTGGCCCAACTNONE 
009-125-D06TTGGCCCAACTNONE 
009-129-B06TTGGCCCAACTNONE 
009-136-G07TTGGCCCAACTNONE 
009-141-D09TTGGCCCAACTNONE 
009-149-C06TTGGCCCAACTNONE 
009-149-G03TTGGCCCAACTNONE 
009-149-H06TTGGCCCAACTNONE 
009-151-C05TTGGCCCAACTNONE 
009-153-D08TTGGCCCAACTNONE 
009-154-H12TTGGCCCAACTNONE 
009-181-C03TTGGCCCAACTNONE 
009-181-C06TTGGCCCAACTNONE 
009-181-G02TTGGCCCAACTNONE 
009-183-B06TTGGCCCAACTNONE 
009-187-D09TTGGCCCAACTNONE 
009-194-C07TTGGCCCAACTNONE 
009-194-C10TTGGCCCAACTNONE 
009-195-F10TTGGCCCAACTNONE 
009-199-G07TTGGCCCAACTNONE 
AK060438TTGGCCCAACTNONE 
AK060476TTGGCCCAACTNONE 
AK119161TTGGCCCAACTSimilar to Photosystem II reaction center W protein (PSII 6.1 kDa protein) (Fragment). 
J013132H23TTGGCCCAACTNONE 
J013158C16TTGGCCCAACTNONE 
J023008K22TTGGCCCAACTNONE 
J023012B02TTGGCCCAACTNONE 
J065045L04TTGGCCCAACTNONE 
J065046O07TTGGCCCAACTNONE 
J065048G02TTGGCCCAACTNONE 
J065060H11TTGGCCCAACTNONE 
J065101B04TTGGCCCAACTNONE 
J065148G21TTGGCCCAACTNONE 
J065158L13TTGGCCCAACTNONE 
J065180I22TTGGCCCAACTNONE 
J075007F14TTGGCCCAACTNONE 
J075047L09TTGGCCCAACTNONE 
J075122H09TTGGCCCAACTNONE 
J075175B12TTGGCCCAACTNONE 
J075193A01TTGGCCCAACTNONE 
J080303H08TTGGCCCAACTNONE 
J080305O21TTGGCCCAACTNONE 
J080306M22TTGGCCCAACTNONE 
Os01g0798500006-106-C11AGTTGGGCNONE 
006-106-C11AGTTGGGCTNONE 
AK061244AGTTGGGCNONE 
AK061244AGTTGGGCTNONE 
AK068219AGTTGGGCMalate synthase-like family protein. 
AK068219AGTTGGGCTMalate synthase-like family protein. 
J065199O16AGTTGGGCNONE 
J065199O16AGTTGGGCTNONE 
Os01g0802850013-044-H03AGTTGGGCNONE 
J065116A05AGTTGGGCProtein of unknown function DUF250 domain containing protein. 
Os01g0805600AK111939GCCCAACTSimilar to Cyclin IaZm (Fragment). 
Os01g0825500AK060613AGTTGGGCTGGNONE 
AK072321AGTTGGGCTGGNONE 
AK103941AGTTGGGCTGGNodulin-like domain containing protein. 
J075053A14AGTTGGGCTGGNONE 
J075151J22AGTTGGGCTGGNONE 
J075174K14AGTTGGGCTGGNONE 
Os01g0838300J090017B22CCAAGCCCAACTNONE 
J090061B04CCAAGCCCAACTNONE 
Os01g0929500AK111399AGTTGGGCCTTACTGGGCCGGTSimilar to Carbonyl reductase-like protein. 
AK120263AGTTGGGCCTTACTGGGCCGGTNONE 
Os01g0949200AK102412ACCGGCCCAACTNONE 
J033093A04ACCGGCCCAACTNONE 
J065053P06ACCGGCCCAACTNONE 
J100086D18ACCGGCCCAACTNONE 
Os01g0960400AK111512CCAAGCCCAACTProtein kinase-like domain containing protein. 
Os01g0976100AK069646AGTTGGGCTTGABC transporter, transmembrane region domain containing protein. 
Os02g0129900Os02g0129900TACGGCCCAACTPGAP1-like family protein. 
Os02g0186700AK064492AAAGCCCAACTConserved hypothetical protein. 
J065210K09AAAGCCCAACTNONE 
J075006A17AAAGCCCAACTNONE 
J075108C18AAAGCCCAACTNONE 
J075153E08AAAGCCCAACTNONE 
Os02g0193600AK060499CCAAGCCCAACTMad3/BUB1 homology region 1 domain containing protein. 
Os02g0250600J075143F23AGTTGGGCCGTCLate embryogenesis abundant protein repeat containing protein. 
Os02g0461200012-026-A12CACGGCCCAACTNONE 
AK063459CACGGCCCAACTConserved hypothetical protein. 
J065183F11CACGGCCCAACTNONE 
J075190G18CACGGCCCAACTNONE 
Os02g0554800J075146G19GCCCAACTNONE 
J075146H05GCCCAACTConserved hypothetical protein. 
Os02g0580700AK073664AGTTGGGCTTCConserved hypothetical protein. 
J090060F24AGTTGGGCTTCNONE 
Os02g0625500AK059188AGCCCAACTNONE 
Os02g0638000AK103830ACATGGGCCGAGATCGGCCCAACTNONE 
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein. 
Os02g0651500AK066333ACAGCCCAACTNONE 
AK121865ACAGCCCAACTHypothetical protein. 
J090038J11ACAGCCCAACTNONE 
Os02g0655300006-024-H05TCTGGCCCAACTNONE 
006-032-G04TCTGGCCCAACTNONE 
006-045-F03TCTGGCCCAACTNONE 
006-076-D04TCTGGCCCAACTNONE 
006-086-C09TCTGGCCCAACTNONE 
006-104-C07TCTGGCCCAACTNONE 
AK061544TCTGGCCCAACTNONE 
AK103778TCTGGCCCAACTNONE 
AK106107TCTGGCCCAACTNONE 
AK120006TCTGGCCCAACTNONE 
AY363174TCTGGCCCAACTSimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21TCTGGCCCAACTNONE 
J065021C16TCTGGCCCAACTNONE 
J065182F01TCTGGCCCAACTNONE 
J075063I18TCTGGCCCAACTNONE 
J075151E01TCTGGCCCAACTNONE 
J075198K18TCTGGCCCAACTNONE 
J090026M06TCTGGCCCAACTNONE 
J090081H02TCTGGCCCAACTNONE 
J100061E20TCTGGCCCAACTNONE 
Os02g0672700AK059611AAGGCCCAACAAGCCCAACTDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179AAGGCCCAACAAGCCCAACTNONE 
J023098L23AAGGCCCAACAAGCCCAACTNONE 
J065042J21AAGGCCCAACAAGCCCAACTNONE 
J065187L09AAGGCCCAACAAGCCCAACTNONE 
J065190O10AAGGCCCAACAAGCCCAACTNONE 
J080041G14AAGGCCCAACAAGCCCAACTNONE 
J080078K08AAGGCCCAACAAGCCCAACTNONE 
J080089D20AAGGCCCAACAAGCCCAACTNONE 
J080094D04AAGGCCCAACAAGCCCAACTNONE 
Os02g0688900AK066093GAAGCCCAACTGPI transamidase subunit PIG-U family protein. 
J065007D18GAAGCCCAACTNONE 
J065040G21GAAGCCCAACTNONE 
J065103G03GAAGCCCAACTNONE 
J065175F18GAAGCCCAACTNONE 
J065202A07GAAGCCCAACTNONE 
J075006C01GAAGCCCAACTNONE 
J075178F24GAAGCCCAACTNONE 
Os02g0734300006-027-C05AGTTGGGCTNONE 
006-027-C11AGTTGGGCTNONE 
006-039-E12AGTTGGGCTNONE 
006-095-H04AGTTGGGCTNONE 
009-112-G07AGTTGGGCTNONE 
AK059780AGTTGGGCTSimilar to Nudix hydrolase 18, mitochondrial precursor (EC 3.6.1.-) (AtNUDT18). 
AK104571AGTTGGGCTNONE 
J065079N09AGTTGGGCTNONE 
J065188A17AGTTGGGCTNONE 
J065209B17AGTTGGGCTNONE 
Os02g0755200AK070699AGTTGGGCCATSimilar to FLOWERING LOCUS D (Fragment). 
J023056I20AGTTGGGCCATNONE 
J065048B13AGTTGGGCCATNONE 
J065128H21AGTTGGGCCATNONE 
J065201E09AGTTGGGCCATNONE 
Os02g0760600AK107943AGTTGGGCBTB domain containing protein. 
Os02g0760700Os02g0760700AGTTGGGCHypothetical protein. 
Os02g0782200AK070439AGCCCAACTNONE 
AK101869AGCCCAACTNOT2/NOT3/NOT5 domain containing protein. 
Os02g0791400009-106-F11GCCCAACTNONE 
AK062787GCCCAACTCytochrome oxidase c, subunit VIb family protein. 
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein. 
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE 
Os02g0816700009-132-E07AGTTGGGCCCAATTNONE 
AK059572AGTTGGGCCCAATTConserved hypothetical protein. 
Os02g0816800013-089-A09AATTGGGCCCAACTNONE 
AK102271AATTGGGCCCAACTNAD-dependent epimerase/dehydratase family protein. 
J013105O04AATTGGGCCCAACTNONE 
J013124I08AATTGGGCCCAACTNONE 
J023002E08AATTGGGCCCAACTNONE 
J023025C01AATTGGGCCCAACTNONE 
J023037O12AATTGGGCCCAACTNONE 
J023049N06AATTGGGCCCAACTNONE 
J023069G18AATTGGGCCCAACTNONE 
J033029M02AATTGGGCCCAACTNONE 
J033037L22AATTGGGCCCAACTNONE 
J033089A08AATTGGGCCCAACTNONE 
J033103L07AATTGGGCCCAACTNONE 
J033125L19AATTGGGCCCAACTNONE 
J090008N20AATTGGGCCCAACTNONE 
J090041F23AATTGGGCCCAACTNONE 
J090092H16AATTGGGCCCAACTNONE 
Os02g0823600AK070498AGTTGGGCCGTTGGConserved hypothetical protein. 
J065055C02AGTTGGGCCGTTGGNONE 
J065098A17AGTTGGGCCGTTGGNONE 
J065119B13AGTTGGGCCGTTGGNONE 
J065146F10AGTTGGGCCGTTGGNONE 
J065209G06AGTTGGGCCGTTGGNONE 
J080001K12AGTTGGGCCGTTGGNONE 
J080004O17AGTTGGGCCGTTGGNONE 
J080005P21AGTTGGGCCGTTGGNONE 
J080009M18AGTTGGGCCGTTGGNONE 
J080013O18AGTTGGGCCGTTGGNONE 
J080014B04AGTTGGGCCGTTGGNONE 
J080014O21AGTTGGGCCGTTGGNONE 
J080015B04AGTTGGGCCGTTGGNONE 
J080016B17AGTTGGGCCGTTGGNONE 
J080017G09AGTTGGGCCGTTGGNONE 
J080022A17AGTTGGGCCGTTGGNONE 
J080024M10AGTTGGGCCGTTGGNONE 
J080025F17AGTTGGGCCGTTGGNONE 
J080025O16AGTTGGGCCGTTGGNONE 
J080029H09AGTTGGGCCGTTGGNONE 
J080030G24AGTTGGGCCGTTGGNONE 
J080031E02AGTTGGGCCGTTGGNONE 
J080032A18AGTTGGGCCGTTGGNONE 
J080032G24AGTTGGGCCGTTGGNONE 
J080033C05AGTTGGGCCGTTGGNONE 
J080033N19AGTTGGGCCGTTGGNONE 
J080035H10AGTTGGGCCGTTGGNONE 
J080035L05AGTTGGGCCGTTGGNONE 
J080042N09AGTTGGGCCGTTGGNONE 
J080044C14AGTTGGGCCGTTGGNONE 
J080048K16AGTTGGGCCGTTGGNONE 
J080050L07AGTTGGGCCGTTGGNONE 
J080051L06AGTTGGGCCGTTGGNONE 
J080051P22AGTTGGGCCGTTGGNONE 
J080053D09AGTTGGGCCGTTGGNONE 
J080053J15AGTTGGGCCGTTGGNONE 
J080053O12AGTTGGGCCGTTGGNONE 
J080057L01AGTTGGGCCGTTGGNONE 
J080062E08AGTTGGGCCGTTGGNONE 
J080062I09AGTTGGGCCGTTGGNONE 
J080063A21AGTTGGGCCGTTGGNONE 
J080063E04AGTTGGGCCGTTGGNONE 
J080063E08AGTTGGGCCGTTGGNONE 
J080064D15AGTTGGGCCGTTGGNONE 
J080064N15AGTTGGGCCGTTGGNONE 
J080068F13AGTTGGGCCGTTGGNONE 
J080070L16AGTTGGGCCGTTGGNONE 
J080072O17AGTTGGGCCGTTGGNONE 
J080075A07AGTTGGGCCGTTGGNONE 
J080076H10AGTTGGGCCGTTGGNONE 
J080077K19AGTTGGGCCGTTGGNONE 
J080078E19AGTTGGGCCGTTGGNONE 
J080082A02AGTTGGGCCGTTGGNONE 
J080083O05AGTTGGGCCGTTGGNONE 
J080091I07AGTTGGGCCGTTGGNONE 
J080094K10AGTTGGGCCGTTGGNONE 
J080094N03AGTTGGGCCGTTGGNONE 
J080096F09AGTTGGGCCGTTGGNONE 
J080097O04AGTTGGGCCGTTGGNONE 
J090037B19AGTTGGGCCGTTGGNONE 
J100017A13AGTTGGGCCGTTGGNONE 
J100068N22AGTTGGGCCGTTGGNONE 
J100072C06AGTTGGGCCGTTGGNONE 
Os02g0823800AK120318GCAGCCCATACAACGGGCCCAACTConserved hypothetical protein. 
J075055J16GCAGCCCATACAACGGGCCCAACTNONE 
Os02g0830700AK101172AGGGCCCAGGCCCAACTLeucine rich repeat, N-terminal domain containing protein. 
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein. 
J013047E20CCACGGCCCGGCCCAACTNONE 
J065026F21CCACGGCCCGGCCCAACTNONE 
J065047B03CCACGGCCCGGCCCAACTNONE 
J065054J12CCACGGCCCGGCCCAACTNONE 
J065079M24CCACGGCCCGGCCCAACTNONE 
J065093M07CCACGGCCCGGCCCAACTNONE 
J065153F02CCACGGCCCGGCCCAACTNONE 
J065155E21CCACGGCCCGGCCCAACTNONE 
J065179H15CCACGGCCCGGCCCAACTNONE 
J075019N02CCACGGCCCGGCCCAACTNONE 
J075089E01CCACGGCCCGGCCCAACTNONE 
J090066I18CCACGGCCCGGCCCAACTNONE 
J090087K20CCACGGCCCGGCCCAACTNONE 
J100079F05CCACGGCCCGGCCCAACTNONE 
Os03g0121300AK120047TCAGCCCAACTNONE 
Os03g0138600Os03g0138600AGTTGGGCCGAAGAAGCCCATAProtein of unknown function DUF810 family protein. 
Os03g0151800005-008-F08AGTTGGGCNONE 
J013020F17AGTTGGGCNONE 
J013020O10AGTTGGGCNONE 
J013039A22AGTTGGGCNONE 
J013058J12AGTTGGGCNONE 
J013070C05AGTTGGGCNONE 
J013073E21AGTTGGGCNONE 
J013092C03AGTTGGGCNONE 
J013104L07AGTTGGGCNONE 
J013112K24AGTTGGGCNONE 
J013119F20AGTTGGGCNONE 
J013123N20AGTTGGGCNONE 
J013128P17AGTTGGGCNONE 
J013147L12AGTTGGGCNONE 
J013149A20AGTTGGGCNONE 
J013151E24AGTTGGGCNONE 
J023007D21AGTTGGGCNONE 
J023011F19AGTTGGGCNONE 
J023025B10AGTTGGGCNONE 
J023025I03AGTTGGGCNONE 
J023029M05AGTTGGGCNONE 
J023031O14AGTTGGGCNONE 
J023041F20AGTTGGGCNONE 
J023043J08AGTTGGGCNONE 
J023049L12AGTTGGGCNONE 
J023075M24AGTTGGGCNONE 
J023093E09AGTTGGGCNONE 
J023098B02AGTTGGGCNONE 
J023105L16AGTTGGGCNONE 
J023109N12AGTTGGGCNONE 
J023112B08AGTTGGGCNONE 
J023119J15AGTTGGGCNONE 
J023131E19AGTTGGGCNONE 
J023132M11AGTTGGGCNONE 
J023134G22AGTTGGGCNONE 
J023139A02AGTTGGGCNONE 
J023143N16AGTTGGGCNONE 
J033022K12AGTTGGGCNONE 
J033024P13AGTTGGGCNONE 
J033028D22AGTTGGGCNONE 
J033029O05AGTTGGGCNONE 
J033045N14AGTTGGGCNONE 
J033048P15AGTTGGGCNONE 
J033055F21AGTTGGGCNONE 
J033055H10AGTTGGGCNONE 
J033057M21AGTTGGGCNONE 
J033058E13AGTTGGGCNONE 
J033058J11AGTTGGGCNONE 
J033069O06AGTTGGGCNONE 
J033069P09AGTTGGGCNONE 
J033070F15AGTTGGGCNONE 
J033072O07AGTTGGGCNONE 
J033074M12AGTTGGGCNONE 
J033079K06AGTTGGGCNONE 
J033088K03AGTTGGGCNONE 
J033090P21AGTTGGGCNONE 
J033100F20AGTTGGGCNONE 
J033101F11AGTTGGGCNONE 
J033105G23AGTTGGGCNONE 
J033109A08AGTTGGGCNONE 
J033109L09AGTTGGGCNONE 
J033112I17AGTTGGGCNONE 
J033112J17AGTTGGGCNONE 
J033112M01AGTTGGGCNONE 
J033116F09AGTTGGGCNONE 
J033119P07AGTTGGGCNONE 
J033120J21AGTTGGGCNONE 
J033120M01AGTTGGGCNONE 
J033121I21AGTTGGGCNONE 
J033121K04AGTTGGGCNONE 
J033127P22AGTTGGGCNONE 
J033133J16AGTTGGGCNONE 
J033139A13AGTTGGGCNONE 
J033144M18AGTTGGGCNONE 
J033145M18AGTTGGGCNONE 
J033148F15AGTTGGGCNONE 
J033148H18AGTTGGGCNONE 
J043001M05AGTTGGGCNONE 
J043010J02AGTTGGGCNONE 
J043013J21AGTTGGGCNONE 
J043016F20AGTTGGGCNONE 
J043016K22AGTTGGGCNONE 
J043029H04AGTTGGGCNONE 
J043038D24AGTTGGGCNONE 
J053060B05AGTTGGGCNONE 
J053080M18AGTTGGGCNONE 
J053099P12AGTTGGGCNONE 
J090044E01AGTTGGGCNONE 
J090069I21AGTTGGGCNONE 
J090082J18AGTTGGGCNONE 
J090091C16AGTTGGGCNONE 
Os03g0152800AK066205AGTTGGGCTProtein kinase-like domain containing protein. 
AK100518AGTTGGGCTNONE 
Os03g0160900J065071D24CGGGCCCAACTNONE 
J065132L03CGGGCCCAACTHypothetical protein. 
J075189L19CGGGCCCAACTNONE 
Os03g0161200AK066932GCCCAACTSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0168200AK099530AGTTGGGCCAAConserved hypothetical protein. 
Os03g0172200AK069130AGCCCAACTArmadillo-like helical domain containing protein. 
Os03g0181600AK067807TACGGCCCAACTSimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TACGGCCCAACTNONE 
Os03g0192400009-081-A03AGTTGGGCCGGTNONE 
009-159-B02AGTTGGGCCGGTNONE 
AK070573AGTTGGGCCGGTGRIM-19 family protein. 
J023056B01AGTTGGGCCGGTNONE 
J023075G06AGTTGGGCCGGTNONE 
J033048K16AGTTGGGCCGGTNONE 
J033048L16AGTTGGGCCGGTNONE 
J053031H23AGTTGGGCCGGTNONE 
J065002H14AGTTGGGCCGGTNONE 
J065006G22AGTTGGGCCGGTNONE 
J065032G13AGTTGGGCCGGTNONE 
J065056A09AGTTGGGCCGGTNONE 
J065078I01AGTTGGGCCGGTNONE 
J065095G01AGTTGGGCCGGTNONE 
J065095I18AGTTGGGCCGGTNONE 
J065134M18AGTTGGGCCGGTNONE 
J065158P07AGTTGGGCCGGTNONE 
J065165K17AGTTGGGCCGGTNONE 
J065181J12AGTTGGGCCGGTNONE 
J065189N09AGTTGGGCCGGTNONE 
J065200D13AGTTGGGCCGGTNONE 
J065202H20AGTTGGGCCGGTNONE 
J065215K20AGTTGGGCCGGTNONE 
J075049N19AGTTGGGCCGGTNONE 
J075147J16AGTTGGGCCGGTNONE 
J090081E19AGTTGGGCCGGTNONE 
J100017C16AGTTGGGCCGGTNONE 
J100039M16AGTTGGGCCGGTNONE 
J100043E23AGTTGGGCCGGTNONE 
J100063L12AGTTGGGCCGGTNONE 
J100079F22AGTTGGGCCGGTNONE 
Os03g0198400AK059522CTGGCCCAACTTGGGCCCATCCNONE 
AK103101CTGGCCCAACTTGGGCCCATCCSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19CTGGCCCAACTTGGGCCCATCCNONE 
J075036K08CTGGCCCAACTTGGGCCCATCCNONE 
J075040J23CTGGCCCAACTTGGGCCCATCCNONE 
J075041H18CTGGCCCAACTTGGGCCCATCCNONE 
J075053H18CTGGCCCAACTTGGGCCCATCCNONE 
J075055K15CTGGCCCAACTTGGGCCCATCCNONE 
J075111K03CTGGCCCAACTTGGGCCCATCCNONE 
J075125B22CTGGCCCAACTTGGGCCCATCCNONE 
J075195L10CTGGCCCAACTTGGGCCCATCCNONE 
Os03g0249400009-059-H08AGTTGGGCCGAGANONE 
AK062522AGTTGGGCCGAGASimilar to 40S ribosomal protein S20 (S22) (Fragment). 
J053031I05AGTTGGGCCGAGANONE 
J053052E06AGTTGGGCCGAGANONE 
J053061K22AGTTGGGCCGAGANONE 
J065108I02AGTTGGGCCGAGANONE 
Os03g0278900006-049-H12TGGATGGGCTAATGGGCCCAACTNONE 
006-082-A07TGGATGGGCTAATGGGCCCAACTNONE 
009-169-C04TGGATGGGCTAATGGGCCCAACTNONE 
AK066019TGGATGGGCTAATGGGCCCAACTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TGGATGGGCTAATGGGCCCAACTNONE 
AY224460TGGATGGGCTAATGGGCCCAACTNONE 
J065021K17TGGATGGGCTAATGGGCCCAACTNONE 
J065141H24TGGATGGGCTAATGGGCCCAACTNONE 
J065142J20TGGATGGGCTAATGGGCCCAACTNONE 
J065152J03TGGATGGGCTAATGGGCCCAACTNONE 
J065163A13TGGATGGGCTAATGGGCCCAACTNONE 
J065191I21TGGATGGGCTAATGGGCCCAACTNONE 
J065193K12TGGATGGGCTAATGGGCCCAACTNONE 
J075003D01TGGATGGGCTAATGGGCCCAACTNONE 
J075017D24TGGATGGGCTAATGGGCCCAACTNONE 
J075060F20TGGATGGGCTAATGGGCCCAACTNONE 
J075154C11TGGATGGGCTAATGGGCCCAACTNONE 
J075173F04TGGATGGGCTAATGGGCCCAACTNONE 
Os03g0281500AK100137GCCCAACTSimilar to Resistance protein candidate (Fragment). 
J013135N09GCCCAACTNONE 
J023003E18GCCCAACTNONE 
J023044J15GCCCAACTNONE 
J023067O20GCCCAACTNONE 
J033041I17GCCCAACTNONE 
J033131I17GCCCAACTNONE 
J065210G02GCCCAACTNONE 
J090067A14GCCCAACTNONE 
Os03g0295500009-083-F02TTGGCCCATATAAGGCCCAACTNONE 
J053029J05TTGGCCCATATAAGGCCCAACTNONE 
J053054B07TTGGCCCATATAAGGCCCAACTCHCH domain containing protein. 
J065024G23TTGGCCCATATAAGGCCCAACTNONE 
J065036F08TTGGCCCATATAAGGCCCAACTNONE 
J065066M11TTGGCCCATATAAGGCCCAACTNONE 
J065143G19TTGGCCCATATAAGGCCCAACTNONE 
Os03g0295800006-107-F02CACGTGGGCCCAACTNONE 
AK106050CACGTGGGCCCAACTNONE 
Os03g0339100AK111641AAGGCCCAACTSimilar to PRL1 protein. 
Os03g0340700011-070-H05CGGGCCGAGTTGGGCCTANONE 
AK100470CGGGCCGAGTTGGGCCTATetratricopeptide-like helical domain containing protein. 
J013158I08CGGGCCGAGTTGGGCCTANONE 
J023009H24CGGGCCGAGTTGGGCCTANONE 
J023031L20CGGGCCGAGTTGGGCCTANONE 
J023093E24CGGGCCGAGTTGGGCCTANONE 
J023105J11CGGGCCGAGTTGGGCCTANONE 
J100059O05CGGGCCGAGTTGGGCCTANONE 
J100075G03CGGGCCGAGTTGGGCCTANONE 
J100086J06CGGGCCGAGTTGGGCCTANONE 
Os03g0372700AK064323AGTTGGGCTTANONE 
AK073312AGTTGGGCTTALow temperature viability protein family protein. 
Os03g0390400009-175-E06TTCGGCCCAACTNONE 
013-040-G01TTCGGCCCAACTNONE 
014-050-G05TTCGGCCCAACTNONE 
AB025187TTCGGCCCAACTSimilar to Cytochrome c oxidase subunit 6b. 
AK120174TTCGGCCCAACTNONE 
J013033A17TTCGGCCCAACTNONE 
J023028J08TTCGGCCCAACTNONE 
J023061N05TTCGGCCCAACTNONE 
J023077A03TTCGGCCCAACTNONE 
J023086E01TTCGGCCCAACTNONE 
J033022A08TTCGGCCCAACTNONE 
J033040F24TTCGGCCCAACTNONE 
J075073I24TTCGGCCCAACTNONE 
J075081H01TTCGGCCCAACTNONE 
J075175N19TTCGGCCCAACTNONE 
J100025M03TTCGGCCCAACTNONE 
J100036J06TTCGGCCCAACTNONE 
J100045O18TTCGGCCCAACTNONE 
J100062G15TTCGGCCCAACTNONE 
J100090N19TTCGGCCCAACTNONE 
Os03g0566800AK103270GCAGCCCAACTSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18GCAGCCCAACTNONE 
J023136P06GCAGCCCAACTNONE 
J033081A22GCAGCCCAACTNONE 
J033109N12GCAGCCCAACTNONE 
J033124H10GCAGCCCAACTNONE 
J033141B09GCAGCCCAACTNONE 
J090026G23GCAGCCCAACTNONE 
J090077J20GCAGCCCAACTNONE 
Os03g0588200011-005-E04AGCCCAACTNONE 
AK120221AGCCCAACTFrigida-like family protein. 
J100086E17AGCCCAACTNONE 
Os03g0612600009-073-H01CCAAGCCCAACTNONE 
AK071403CCAAGCCCAACTRibosomal protein L25-like domain containing protein. 
Os03g0626250J075100A11AGTTGGGCTTTNONE 
J075100A11GCCCAACTNONE 
J075134H15AGTTGGGCTTTNONE 
J075134H15GCCCAACTNONE 
J075142J02AGTTGGGCTTTNONE 
J075142J02GCCCAACTNONE 
J075181A14AGTTGGGCTTTNONE 
J075181A14GCCCAACTNONE 
J075192K17AGTTGGGCTTTNONE 
J075192K17GCCCAACTNONE 
J090046B06AGTTGGGCTTTNONE 
J090046B06GCCCAACTNONE 
Os03g0647500015-025-E10AGTTGGGCTGGGCCGTANONE 
AK064308AGTTGGGCTGGGCCGTAConserved hypothetical protein. 
AK103649AGTTGGGCTGGGCCGTANONE 
J033135D01AGTTGGGCTGGGCCGTANONE 
Os03g0668900AK108369AGTTGGGCTConserved hypothetical protein. 
Os03g0725400015-060-D03AAAAGCCCAACTNONE 
AK105499AAAAGCCCAACTSimilar to WD-repeat protein 5 (BMP2-induced 3-kb gene protein) (WD-repeat protein BIG-3). 
AK111860AAAAGCCCAACTNONE 
AK112085AAAAGCCCAACTNONE 
J100068K06AAAAGCCCAACTNONE 
J100073K24AAAAGCCCAACTNONE 
J100084M24AAAAGCCCAACTNONE 
Os03g0727100AK068587GAGGCCCAACTConserved hypothetical protein. 
J013153F04GAGGCCCAACTNONE 
J065165J09GAGGCCCAACTNONE 
Os03g0744700AK071178GTATGGGCCAGGCCCAACTConserved hypothetical protein. 
J075006D24GTATGGGCCAGGCCCAACTNONE 
J075165F21GTATGGGCCAGGCCCAACTNONE 
Os03g0765000AK073918TGCGGCCCAACTSimilar to Serine/threonine-protein kinase 12 (EC 2.7.1.37) (Aurora-B) (Fragment). 
Os03g0766000AK070596AGTTGGGCCGGGNONE 
AK104743AGTTGGGCCGGGNONE 
AK106079AGTTGGGCCGGGNONE 
J013063M09AGTTGGGCCGGGNONE 
J023056A03AGTTGGGCCGGGNONE 
J043038L07AGTTGGGCCGGGNONE 
J053067N16AGTTGGGCCGGGNONE 
J053073G09AGTTGGGCCGGGNONE 
J053075I19AGTTGGGCCGGGNONE 
Os03g0785800AB071806GCCCAACTSimilar to Transcription factor PCF6 (Fragment). 
J090057A17GCCCAACTNONE 
Os03g0786000AK061286AGCCCAACTConserved hypothetical protein. 
AK073187AGCCCAACTNONE 
Os03g0792400AK064808AGTTGGGCCAGPeptidase M50 family protein. 
J013000D19AGTTGGGCCAGNONE 
J013106E22AGTTGGGCCAGNONE 
J075053A21AGTTGGGCCAGNONE 
Os03g0825900AK109694AGTTGGGCCCACAConserved hypothetical protein. 
Os03g0826800006-081-B04AGTTGGGCNONE 
015-050-A02AGTTGGGCNONE 
AK065702AGTTGGGCConserved hypothetical protein. 
AK119789AGTTGGGCNONE 
J013035P06AGTTGGGCNONE 
J023025I11AGTTGGGCNONE 
J065023J15AGTTGGGCNONE 
J065204K04AGTTGGGCNONE 
J075021L07AGTTGGGCNONE 
J075104F02AGTTGGGCNONE 
J075146J05AGTTGGGCNONE 
J100026H04AGTTGGGCNONE 
J100031M07AGTTGGGCNONE 
J100035A06AGTTGGGCNONE 
J100052J05AGTTGGGCNONE 
J100059F12AGTTGGGCNONE 
J100071F10AGTTGGGCNONE 
J100074G08AGTTGGGCNONE 
J100074G24AGTTGGGCNONE 
J100082L21AGTTGGGCNONE 
Os03g0836200009-165-F07CTCGGCCCACAAGCGGCCCAACTNONE 
015-092-G01CTCGGCCCACAAGCGGCCCAACTNONE 
AK058443CTCGGCCCACAAGCGGCCCAACTNONE 
AK067084CTCGGCCCACAAGCGGCCCAACTSimilar to RNA-binding protein RZ-1. 
AK101225CTCGGCCCACAAGCGGCCCAACTNONE 
J013092A03CTCGGCCCACAAGCGGCCCAACTNONE 
J013095N17CTCGGCCCACAAGCGGCCCAACTNONE 
J013147J18CTCGGCCCACAAGCGGCCCAACTNONE 
J023019O10CTCGGCCCACAAGCGGCCCAACTNONE 
J023065N18CTCGGCCCACAAGCGGCCCAACTNONE 
J033113E18CTCGGCCCACAAGCGGCCCAACTNONE 
J033133E03CTCGGCCCACAAGCGGCCCAACTNONE 
J065059J15CTCGGCCCACAAGCGGCCCAACTNONE 
J065075O11CTCGGCCCACAAGCGGCCCAACTNONE 
J065119I07CTCGGCCCACAAGCGGCCCAACTNONE 
J065171J03CTCGGCCCACAAGCGGCCCAACTNONE 
J090016D21CTCGGCCCACAAGCGGCCCAACTNONE 
J090081O03CTCGGCCCACAAGCGGCCCAACTNONE 
J100040G18CTCGGCCCACAAGCGGCCCAACTNONE 
J100040L10CTCGGCCCACAAGCGGCCCAACTNONE 
J100055H13CTCGGCCCACAAGCGGCCCAACTNONE 
J100059I22CTCGGCCCACAAGCGGCCCAACTNONE 
J100078A08CTCGGCCCACAAGCGGCCCAACTNONE 
Os03g0843500AK067985GCCCAACTNONE 
AK101661GCCCAACTSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454GCCCAACTNONE 
J080302L23GCCCAACTNONE 
Os03g0845700009-075-D05AGTTGGGCTGGNONE 
AK062622AGTTGGGCTGGSimilar to RPB17 (Fragment). 
J065068H03AGTTGGGCTGGNONE 
J065075A18AGTTGGGCTGGNONE 
J065118C19AGTTGGGCTGGNONE 
J075001B15AGTTGGGCTGGNONE 
J075048D11AGTTGGGCTGGNONE 
J075056D01AGTTGGGCTGGNONE 
J075092P03AGTTGGGCTGGNONE 
J075111I04AGTTGGGCTGGNONE 
Os03g0847500AK073859AGCCCAACTSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0850600AK067191AGTTGGGCCGGGACGGCCACGTGGCGConserved hypothetical protein. 
J013095N12AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J065214L06AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J075093J10AGTTGGGCCGGGACGGCCACGTGGCGNONE 
Os03g0852900011-012-A12TCCGGGCCCAACTNONE 
AK100660TCCGGGCCCAACTSimilar to Cleavage and polyadenylation specificity factor, 73 kDa subunit (CPSF 73 kDa subunit). 
J013073D18TCCGGGCCCAACTNONE 
J013152K17TCCGGGCCCAACTNONE 
J023111N01TCCGGGCCCAACTNONE 
J065214G07TCCGGGCCCAACTNONE 
J090080E10TCCGGGCCCAACTNONE 
Os04g0305700009-180-E11GCCCAACTNONE 
AK068128GCCCAACTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK105689GCCCAACTNONE 
J065026K17GCCCAACTNONE 
J065122C23GCCCAACTNONE 
Os04g0420900AK064414AGTTGGGCNONE 
AK101902AGTTGGGCSimilar to Receptor-like protein kinase. 
J033071C04AGTTGGGCNONE 
Os04g0480900AK109889AGTTGGGCTTTGGGCCCCAGlycoside hydrolase, family 5 protein. 
Os04g0490000AK108365AGTTGGGCCTTGSimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0492900AK102780AGGGCCCAACTCRS1/YhbY domain containing protein. 
AK120004AGGGCCCAACTNONE 
AK120369AGGGCCCAACTNONE 
Os04g0520900AK068793AGTTGGGCTProtein prenyltransferase domain containing protein. 
AK105606AGTTGGGCTNONE 
Os04g0521800006-043-D11AGTTGGGCTGCNONE 
AK061536AGTTGGGCTGCNONE 
AK102934AGTTGGGCTGCPeptidase M20 family protein. 
AK103369AGTTGGGCTGCNONE 
Os04g0546800014-054-C05GCCCAACTNONE 
015-034-B06GCCCAACTNONE 
015-060-H04GCCCAACTNONE 
015-098-G01GCCCAACTNONE 
015-099-G05GCCCAACTNONE 
016-062-D01GCCCAACTNONE 
016-078-G01GCCCAACTNONE 
J023002C20GCCCAACTPathogenesis-related transcriptional factor and ERF domain containing protein. 
J065038P12GCCCAACTNONE 
J100039E18GCCCAACTNONE 
Os04g0602900AK065982CCTGGGCCCAACTNONE 
AK100414CCTGGGCCCAACTIsoprenylcysteine carboxyl methyltransferase family protein. 
J013045J05CCTGGGCCCAACTNONE 
J065196I21CCTGGGCCCAACTNONE 
J065205B13CCTGGGCCCAACTNONE 
J090017J24CCTGGGCCCAACTNONE 
Os04g0625600AK070994AGTTGGGCCGCTRAF-like domain containing protein. 
J023080H04AGTTGGGCCGCNONE 
J023086H15AGTTGGGCCGCNONE 
J033037L21AGTTGGGCCGCNONE 
J033044P14AGTTGGGCCGCNONE 
J065075C23AGTTGGGCCGCNONE 
J065167C18AGTTGGGCCGCNONE 
J100024E02AGTTGGGCCGCNONE 
J100068N24AGTTGGGCCGCNONE 
J100070G20AGTTGGGCCGCNONE 
Os04g0628400AK066078AGTTGGGCTZinc finger, BED-type predicted domain containing protein. 
AK066646AGTTGGGCTNONE 
AK072594AGTTGGGCTNONE 
AK099285AGTTGGGCTNONE 
J013038N11AGTTGGGCTNONE 
J013050K18AGTTGGGCTNONE 
J013071L19AGTTGGGCTNONE 
J013073C07AGTTGGGCTNONE 
J023010K10AGTTGGGCTNONE 
J023038B03AGTTGGGCTNONE 
J023102J09AGTTGGGCTNONE 
J023125J12AGTTGGGCTNONE 
J023125K02AGTTGGGCTNONE 
J023128I11AGTTGGGCTNONE 
J033023L05AGTTGGGCTNONE 
J033024K18AGTTGGGCTNONE 
J033042O09AGTTGGGCTNONE 
J033067N22AGTTGGGCTNONE 
J033090M03AGTTGGGCTNONE 
J033109I15AGTTGGGCTNONE 
J043005H11AGTTGGGCTNONE 
J043005M07AGTTGGGCTNONE 
J075135F23AGTTGGGCTNONE 
J075146I06AGTTGGGCTNONE 
J090018O03AGTTGGGCTNONE 
J090055C24AGTTGGGCTNONE 
J090060F07AGTTGGGCTNONE 
J090062K21AGTTGGGCTNONE 
J090074G05AGTTGGGCTNONE 
J090079L20AGTTGGGCTNONE 
J090087I23AGTTGGGCTNONE 
Os04g0641300AK071780TAAGCCCAACTGlutaredoxin domain containing protein. 
J023114E02TAAGCCCAACTNONE 
Os04g0661900006-090-F11GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J053077D04GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J090095N01GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
J100039F24GTTGGTGGTCATGGGCCAAAAAGCCCAACTNONE 
Os04g0662400AK108652GCCCAACTAuxin responsive SAUR protein family protein. 
Os04g0665700013-084-D06GAGGCCCAAAGCCCAACTNONE 
AK121951GAGGCCCAAAGCCCAACTZinc finger, CCCH-type domain containing protein. 
J013020L20GAGGCCCAAAGCCCAACTNONE 
J033034K12GAGGCCCAAAGCCCAACTNONE 
J033107K04GAGGCCCAAAGCCCAACTNONE 
J065044C03GAGGCCCAAAGCCCAACTNONE 
J065103I10GAGGCCCAAAGCCCAACTNONE 
J065106P15GAGGCCCAAAGCCCAACTNONE 
J075061O20GAGGCCCAAAGCCCAACTNONE 
J075091P11GAGGCCCAAAGCCCAACTNONE 
J075095A18GAGGCCCAAAGCCCAACTNONE 
J075117C22GAGGCCCAAAGCCCAACTNONE 
J075166B22GAGGCCCAAAGCCCAACTNONE 
J075198L04GAGGCCCAAAGCCCAACTNONE 
J090032K13GAGGCCCAAAGCCCAACTNONE 
J090045E22GAGGCCCAAAGCCCAACTNONE 
Os04g0674100J080097J12AGTTGGGCTThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965AGCCCAACTNONE 
AK103795AGCCCAACTCoenzyme Q biosynthesis Coq4 family protein. 
J033076F14AGCCCAACTNONE 
J065020P20AGCCCAACTNONE 
J065057I21AGCCCAACTNONE 
J065059P11AGCCCAACTNONE 
J065083A22AGCCCAACTNONE 
J065093K10AGCCCAACTNONE 
J065097D03AGCCCAACTNONE 
J065103P05AGCCCAACTNONE 
J065113K09AGCCCAACTNONE 
J065118F23AGCCCAACTNONE 
J065119M06AGCCCAACTNONE 
J065146K17AGCCCAACTNONE 
J065161N12AGCCCAACTNONE 
J065169L02AGCCCAACTNONE 
J065189H12AGCCCAACTNONE 
J065192E24AGCCCAACTNONE 
J065193K17AGCCCAACTNONE 
J065197O21AGCCCAACTNONE 
J065214D09AGCCCAACTNONE 
J065217B11AGCCCAACTNONE 
J075132K07AGCCCAACTNONE 
J100059D14AGCCCAACTNONE 
Os04g0685800AK070891GTGTGGGCCTGGCCCAACTSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345GTGTGGGCCTGGCCCAACTNONE 
J023069G19GTGTGGGCCTGGCCCAACTNONE 
J023097E09GTGTGGGCCTGGCCCAACTNONE 
J065071A01GTGTGGGCCTGGCCCAACTNONE 
J065186F08GTGTGGGCCTGGCCCAACTNONE 
J075044B21GTGTGGGCCTGGCCCAACTNONE 
J075120N18GTGTGGGCCTGGCCCAACTNONE 
J075131B22GTGTGGGCCTGGCCCAACTNONE 
J100041H18GTGTGGGCCTGGCCCAACTNONE 
J100042P13GTGTGGGCCTGGCCCAACTNONE 
Os04g0687800AK107360GCCCAACTProtein of unknown function DUF6, transmembrane domain containing protein. 
Os05g0101400009-126-G06AGTTGGGCTTGGGCCGCNONE 
AK067481AGTTGGGCTTGGGCCGCSimilar to 50S ribosomal protein L28, chloroplast precursor. 
J065124O10AGTTGGGCTTGGGCCGCNONE 
J065186D05AGTTGGGCTTGGGCCGCNONE 
J065193A14AGTTGGGCTTGGGCCGCNONE 
J075082A02AGTTGGGCTTGGGCCGCNONE 
J075100F11AGTTGGGCTTGGGCCGCNONE 
J075111O16AGTTGGGCTTGGGCCGCNONE 
J075172I24AGTTGGGCTTGGGCCGCNONE 
Os05g0122700J065185N19GCCACGTGGCCCAACTNONE 
J065188N05GCCACGTGGCCCAACTNONE 
J065198E09GCCACGTGGCCCAACTNONE 
J065215H08GCCACGTGGCCCAACTSimilar to Low-temperature induced protein lt101.2. 
Os05g0152400Os05g0152400AGTTGGGCCAAGlycosyl transferase, family 14 protein. 
Os05g0152400AGTTGGGCTGlycosyl transferase, family 14 protein. 
Os05g0161400AK105485AAAAGCCCAACTPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0182700003-102-E07CCACTGACATGTGGGCCCAACTNONE 
011-019-D04CCACTGACATGTGGGCCCAACTNONE 
013-068-D09CCACTGACATGTGGGCCCAACTNONE 
014-032-G03CCACTGACATGTGGGCCCAACTNONE 
AK065911CCACTGACATGTGGGCCCAACTProtein of unknown function DUF1664 family protein. 
AK104343CCACTGACATGTGGGCCCAACTNONE 
J013045E01CCACTGACATGTGGGCCCAACTNONE 
J013156L15CCACTGACATGTGGGCCCAACTNONE 
J023029P17CCACTGACATGTGGGCCCAACTNONE 
J023134I24CCACTGACATGTGGGCCCAACTNONE 
J033099A10CCACTGACATGTGGGCCCAACTNONE 
J033115L16CCACTGACATGTGGGCCCAACTNONE 
J090007M24CCACTGACATGTGGGCCCAACTNONE 
J090019F02CCACTGACATGTGGGCCCAACTNONE 
Os05g0227700AK067567AGTTGGGCTTGGACCGGCCCGTTConserved hypothetical protein. 
AK068760AGTTGGGCTTGGACCGGCCCGTTNONE 
J013108C14AGTTGGGCTTGGACCGGCCCGTTNONE 
Os05g0339300AK109898GCCCAACTConserved hypothetical protein. 
J065068I16GCCCAACTNONE 
J065194L19GCCCAACTNONE 
Os05g0347000009-013-E04AGTTGGGCCGGANONE 
AK109444AGTTGGGCCGGATAFII55 protein conserved region domain containing protein. 
J065049M12AGTTGGGCCGGANONE 
J065190K18AGTTGGGCCGGANONE 
J075169G13AGTTGGGCCGGANONE 
Os05g0348100006-028-F04ATCGGACGGCCCATGTAGCCCAACTNONE 
009-036-C03ATCGGACGGCCCATGTAGCCCAACTNONE 
009-040-H02ATCGGACGGCCCATGTAGCCCAACTNONE 
009-173-H12ATCGGACGGCCCATGTAGCCCAACTNONE 
AK061434ATCGGACGGCCCATGTAGCCCAACTConserved hypothetical protein. 
J065137N04ATCGGACGGCCCATGTAGCCCAACTNONE 
J065164C10ATCGGACGGCCCATGTAGCCCAACTNONE 
J065210H22ATCGGACGGCCCATGTAGCCCAACTNONE 
Os05g0365500AK072352CTGGCCCAACTProtein prenyltransferase domain containing protein. 
J043027P13CTGGCCCAACTNONE 
Os05g0377000Os05g0377000GCCCATGAAGTTGGGCTSimilar to Acyl carrier protein (ACP). 
Os05g0386800009-185-E02GAGGCCCAACTNONE 
AK062748GAGGCCCAACTNONE 
Os05g0400600AK072045TCCGGCCCAACTCobalt transport protein family protein. 
Os05g0406800AK062566GCCCAACTGCCACGTGNONE 
AK099640GCCCAACTGCCACGTGLeucine rich repeat, N-terminal domain containing protein. 
J013060B14GCCCAACTGCCACGTGNONE 
J090013F14GCCCAACTGCCACGTGNONE 
J090062E13GCCCAACTGCCACGTGNONE 
J090063D09GCCCAACTGCCACGTGNONE 
J090075H10GCCCAACTGCCACGTGNONE 
J090096E22GCCCAACTGCCACGTGNONE 
Os05g0415400AK107330CAGGTGGGGCCCAACTSimilar to OsNAC6 protein. 
AK119651CAGGTGGGGCCCAACTNONE 
Os05g0443300Os05g0443300AGTTGGGCCGCSec23/Sec24 trunk region domain containing protein. 
Os05g0443300AGTTGGGCTGCSec23/Sec24 trunk region domain containing protein. 
Os05g0486200009-099-B03CCAGCCCAACTNONE 
AK121022CCAGCCCAACTConserved hypothetical protein. 
J023049I09CCAGCCCAACTNONE 
J033029N07CCAGCCCAACTNONE 
J075074I18CCAGCCCAACTNONE 
Os05g0490800J065037L19TCCGGCCCAACTNONE 
Os05g0539300Os05g0539300AGTTGGGCTTAProtein of unknown function DUF295 family protein. 
Os05g0540100AB021666GAGGCCCAACTNONE 
AK060623GAGGCCCAACTNONE 
AK103819GAGGCCCAACTFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0540800AK060731AGTTGGGCCGGCCCAATANONE 
AK071090AGTTGGGCCGGCCCAATAHomeodomain-like containing protein. 
J013095F03AGTTGGGCCGGCCCAATANONE 
J023079C11AGTTGGGCCGGCCCAATANONE 
J033080E08AGTTGGGCCGGCCCAATANONE 
Os05g0565000AK102673TACGGCCCAACTSimilar to 60S ribosomal protein L18a-1. 
J033102C12TACGGCCCAACTNONE 
J033124C13TACGGCCCAACTNONE 
J043003L04TACGGCCCAACTNONE 
J043006N08TACGGCCCAACTNONE 
Os05g0596200009-059-G06AGTTGGGCCCAGGNONE 
AK062521AGTTGGGCCCAGGNONE 
AK107887AGTTGGGCCCAGGConserved hypothetical protein. 
AK108209AGTTGGGCCCAGGNONE 
J065154B01AGTTGGGCCCAGGNONE 
Os06g0101300013-080-G09AGTTGGGCCTAATTGGGCCTGGNONE 
015-006-A01AGTTGGGCCTAATTGGGCCTGGNONE 
015-044-F09AGTTGGGCCTAATTGGGCCTGGNONE 
AK109515AGTTGGGCCTAATTGGGCCTGGZinc finger, RING-type domain containing protein. 
AK121897AGTTGGGCCTAATTGGGCCTGGNONE 
J033084O06AGTTGGGCCTAATTGGGCCTGGNONE 
J033105E24AGTTGGGCCTAATTGGGCCTGGNONE 
J033126H24AGTTGGGCCTAATTGGGCCTGGNONE 
J065001F05AGTTGGGCCTAATTGGGCCTGGNONE 
J065002H03AGTTGGGCCTAATTGGGCCTGGNONE 
J065026B12AGTTGGGCCTAATTGGGCCTGGNONE 
J065093E11AGTTGGGCCTAATTGGGCCTGGNONE 
J065122E04AGTTGGGCCTAATTGGGCCTGGNONE 
J065164O07AGTTGGGCCTAATTGGGCCTGGNONE 
J065182M16AGTTGGGCCTAATTGGGCCTGGNONE 
J065217N11AGTTGGGCCTAATTGGGCCTGGNONE 
J090002P22AGTTGGGCCTAATTGGGCCTGGNONE 
Os06g0113600016-067-E03TTATGGGCCCAACTNONE 
AK062095TTATGGGCCCAACTNONE 
AK101235TTATGGGCCCAACTCyclin-like F-box domain containing protein. 
AK122025TTATGGGCCCAACTNONE 
J013022O19TTATGGGCCCAACTNONE 
J023045P05TTATGGGCCCAACTNONE 
J033031K01TTATGGGCCCAACTNONE 
J033034I09TTATGGGCCCAACTNONE 
J033041O04TTATGGGCCCAACTNONE 
J033071K03TTATGGGCCCAACTNONE 
J033075K16TTATGGGCCCAACTNONE 
J033097M01TTATGGGCCCAACTNONE 
J033099M22TTATGGGCCCAACTNONE 
J033108N15TTATGGGCCCAACTNONE 
J033121D18TTATGGGCCCAACTNONE 
J033125O06TTATGGGCCCAACTNONE 
J033139M16TTATGGGCCCAACTNONE 
J033145P18TTATGGGCCCAACTNONE 
J033149D05TTATGGGCCCAACTNONE 
Os06g0114600015-077-E06AGTTGGGCCCACACNONE 
AK067972AGTTGGGCCCACACConserved hypothetical protein. 
Os06g0143000AB014056GGGGCCCAACTNONE 
AK062073GGGGCCCAACTNONE 
AK071301GGGGCCCAACTIron-superoxide dismutase (EC 1.15.1.1). 
J013043A16GGGGCCCAACTNONE 
J023001M11GGGGCCCAACTNONE 
J023087L08GGGGCCCAACTNONE 
J023145K23GGGGCCCAACTNONE 
J033123L01GGGGCCCAACTNONE 
J065127O08GGGGCCCAACTNONE 
Os06g0156900AK110688AGTTGGGCTGlycosyl transferase, family 31 protein. 
Os06g0157800AK121504AGTTGGGCTSimilar to CG7224 (Fragment). 
J033022L20AGTTGGGCTNONE 
J075033D09AGTTGGGCTNONE 
Os06g0174350J043034B05AGTGGGCCTAGTTGGGCCGGAConserved hypothetical protein. 
Os06g0214300AK108107TACGGCCCAACTEsterase/lipase/thioesterase domain containing protein. 
Os06g0226600006-083-D04AAGGCCCAACTNONE 
AK061806AAGGCCCAACTNONE 
AK102752AAGGCCCAACTTB2/DP1 and HVA22 related protein family protein. 
J013089J11AAGGCCCAACTNONE 
J033106M05AAGGCCCAACTNONE 
J100044M21AAGGCCCAACTNONE 
J100056E06AAGGCCCAACTNONE 
J100059F06AAGGCCCAACTNONE 
Os06g0259000J100050M10AGTTGGGCNONE 
Os06g0317200009-040-D08GCCCAACTNONE 
009-042-C01GCCCAACTNONE 
009-065-D03GCCCAACTNONE 
009-078-B04GCCCAACTNONE 
009-122-F04GCCCAACTNONE 
009-141-F04GCCCAACTNONE 
009-150-F08GCCCAACTNONE 
009-186-F07GCCCAACTNONE 
AK062457GCCCAACTNONE 
AK062964GCCCAACTSimilar to Homeobox protein Hox-D11 (Hox-4.6) (Hox-5.5). 
AK063002GCCCAACTNONE 
AK104925GCCCAACTNONE 
Os06g0343900AK070940CCACGGCCACACGCCTCAGCCCAACTConserved hypothetical protein. 
Os06g0560700011-041-C04AGTTGGGCNONE 
AK063332AGTTGGGCLipolytic enzyme, G-D-S-L family protein. 
Os06g0602600AK121619AGTTGGGCCAGAAlba, DNA/RNA-binding protein family protein. 
J033044O03AGTTGGGCCAGANONE 
J043036G04AGTTGGGCCAGANONE 
J075107E08AGTTGGGCCAGANONE 
J090060N14AGTTGGGCCAGANONE 
J090094K04AGTTGGGCCAGANONE 
Os06g0605900003-114-C06AGTTGGGCNONE 
003-114-H05AGTTGGGCNONE 
003-116-G06AGTTGGGCNONE 
015-003-E02AGTTGGGCNONE 
AK065140AGTTGGGCNONE 
J013002A13AGTTGGGCNONE 
J023108L11AGTTGGGCNONE 
J100031J02AGTTGGGCNONE 
J100046N16AGTTGGGCNONE 
J100053I07AGTTGGGCNONE 
J100060G23AGTTGGGCNONE 
J100066J01AGTTGGGCNONE 
J100077E07AGTTGGGCNONE 
J100084M01AGTTGGGCNONE 
Os06g0644800006-051-A11AGTTGGGCTTCNONE 
006-061-C06AGTTGGGCTTCNONE 
006-086-A03AGTTGGGCTTCNONE 
006-091-B11AGTTGGGCTTCNONE 
AK105643AGTTGGGCTTCNONE 
AK109442AGTTGGGCTTCMannose-6-phosphate receptor, binding domain containing protein. 
J065083E17AGTTGGGCTTCNONE 
Os06g0649500AK072591AGTTGGGCCTGAWD40-like domain containing protein. 
Os06g0670100AK102577AGTTGGGCTGAHypothetical protein. 
Os06g0683200AK060024AGTTGGGCTGGSimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432AGTTGGGCTGGNONE 
J023002B12AGTTGGGCTGGNONE 
J023054E10AGTTGGGCTGGNONE 
J023123F19AGTTGGGCTGGNONE 
J065035K13AGTTGGGCTGGNONE 
J065129P09AGTTGGGCTGGNONE 
J065184B14AGTTGGGCTGGNONE 
Os06g0683400009-047-C07CCAGCCCACGCCCAACTNONE 
009-060-B06CCAGCCCACGCCCAACTNONE 
013-057-F12CCAGCCCACGCCCAACTNONE 
AK111852CCAGCCCACGCCCAACTNONE 
AK111897CCAGCCCACGCCCAACTNONE 
AK112082CCAGCCCACGCCCAACTSimilar to EF-hand Ca2+-binding protein CCD1. 
J065104C07CCAGCCCACGCCCAACTNONE 
J065187J11CCAGCCCACGCCCAACTNONE 
J065197L08CCAGCCCACGCCCAACTNONE 
J100045K14CCAGCCCACGCCCAACTNONE 
J100074M08CCAGCCCACGCCCAACTNONE 
J100088H21CCAGCCCACGCCCAACTNONE 
Os06g0687800AK072593AGTTGGGCSimilar to Pincher (EH-domain containing 4). 
Os06g0688100AK063450TTGGCCCAACTNONE 
AK101144TTGGCCCAACTRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0690600AK107925GACGGCCCAACTConserved hypothetical protein. 
Os06g0714100AK121079TTGGCCCAACTComplex 1 LYR protein family protein. 
J023062M13TTGGCCCAACTNONE 
J043020D18TTGGCCCAACTNONE 
J065073A17TTGGCCCAACTNONE 
J065158D09TTGGCCCAACTNONE 
J065195H04TTGGCCCAACTNONE 
J065214P13TTGGCCCAACTNONE 
J080079I22TTGGCCCAACTNONE 
J100031M06TTGGCCCAACTNONE 
J100036I12TTGGCCCAACTNONE 
Os07g0124500012-092-F01GAGGCCCAACTNONE 
AK070529GAGGCCCAACTSimilar to Eukaryotic translation initiation factor 3 subunit 8 (eIF3 p110) (eIF3c). 
AK101000GAGGCCCAACTNONE 
J090007O11GAGGCCCAACTNONE 
J090010E02GAGGCCCAACTNONE 
J090078C04GAGGCCCAACTNONE 
Os07g0154300009-070-E08CCCAGCCCAACTNONE 
009-077-E01CCCAGCCCAACTNONE 
009-196-F05CCCAGCCCAACTNONE 
AK105386CCCAGCCCAACTConserved hypothetical protein. 
AK122093CCCAGCCCAACTNONE 
J033124K14CCCAGCCCAACTNONE 
J075006I22CCCAGCCCAACTNONE 
J075185G02CCCAGCCCAACTNONE 
J090039C02CCCAGCCCAACTNONE 
Os07g0223100006-044-G07AGTTGGGCNONE 
006-071-E10AGTTGGGCNONE 
006-077-A04AGTTGGGCNONE 
009-162-H05AGTTGGGCNONE 
J023050M10AGTTGGGCNONE 
J023055F05AGTTGGGCNONE 
J023060I11AGTTGGGCNONE 
J023101M01AGTTGGGCNONE 
J065059J21AGTTGGGCNONE 
J065087I18AGTTGGGCNONE 
J065113L17AGTTGGGCNONE 
J065123E19AGTTGGGCNONE 
J065137O04AGTTGGGCNONE 
J065217M03AGTTGGGCNONE 
J090012O14AGTTGGGCNONE 
J090014C13AGTTGGGCNONE 
J090060C24AGTTGGGCNONE 
J100037H14AGTTGGGCNONE 
J100060E10AGTTGGGCNONE 
J100067L04AGTTGGGCNONE 
J100075G09AGTTGGGCNONE 
J100077C15AGTTGGGCNONE 
Os07g0499900AK109745ACATGGGCCAAGTTGGGCCACCyclin-like F-box domain containing protein. 
Os07g0564000AK069806AGTTGGGCCGAGAConserved hypothetical protein. 
AK069806AGTTGGGCCTCConserved hypothetical protein. 
Os07g0570700AK065242AGTTGGGCCCAAGCCCACGTGRibosome recycling factor family protein. 
AK065242TTCGGCCCAACTRibosome recycling factor family protein. 
J013002I12AGTTGGGCCCAAGCCCACGTGNONE 
J013002I12TTCGGCCCAACTNONE 
Os07g0595700003-103-G05AGTTGGGCCGCNONE 
AK108488AGTTGGGCCGCConserved hypothetical protein. 
J065136O05AGTTGGGCCGCNONE 
Os07g0595800011-069-G09GCGGCCCAACTNONE 
AK066349GCGGCCCAACTPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05GCGGCCCAACTNONE 
Os07g0604500009-018-C07AGTTGGGCTGANONE 
009-194-C02AGTTGGGCTGANONE 
011-023-C06AGTTGGGCTGANONE 
015-035-B10AGTTGGGCTGANONE 
AK064312AGTTGGGCTGASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK069085AGTTGGGCTGANONE 
J090050I12AGTTGGGCTGANONE 
J100027C10AGTTGGGCTGANONE 
J100029A05AGTTGGGCTGANONE 
J100031P17AGTTGGGCTGANONE 
J100039E20AGTTGGGCTGANONE 
J100064L15AGTTGGGCTGANONE 
J100066K08AGTTGGGCTGANONE 
Os07g0641600AK068478GTTTGGGCCCAACTSAM (and some other nucleotide) binding motif domain containing protein. 
AK073802GTTTGGGCCCAACTNONE 
Os07g0667400AK073297TCAGCCCAACTSAM (and some other nucleotide) binding motif domain containing protein. 
AK073297TCAGCCCAACTSAM (and some other nucleotide) binding motif domain containing protein. 
J033027J22TCAGCCCAACTNONE 
J033027J22TCAGCCCAACTNONE 
J033122B17TCAGCCCAACTNONE 
J033122B17TCAGCCCAACTNONE 
J065017H12TCAGCCCAACTNONE 
J065017H12TCAGCCCAACTNONE 
J065106D19TCAGCCCAACTNONE 
J065106D19TCAGCCCAACTNONE 
J065196J16TCAGCCCAACTNONE 
J065196J16TCAGCCCAACTNONE 
J090084F01TCAGCCCAACTNONE 
J090084F01TCAGCCCAACTNONE 
Os08g0129200014-040-E08AGTTGGGCCGCNONE 
AK070034AGTTGGGCCGCNONE 
AK101577AGTTGGGCCGCSimilar to Cold shock protein-1. 
J065137A09AGTTGGGCCGCNONE 
J100062K14AGTTGGGCCGCNONE 
Os08g0260600AK108529AGTTGGGCCGAGACD9/CD37/CD63 antigen family protein. 
Os08g0295300AK059095GCCCAACTNONE 
J065042J18GCCCAACTNONE 
J065199O05GCCCAACTNONE 
Os08g0527400AK119389CACGGCCCAACTPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os09g0115900009-055-E06AGTTGGGCCGGGCCNONE 
AK068597AGTTGGGCCGGGCCConserved hypothetical protein. 
J065136F11AGTTGGGCCGGGCCNONE 
J080023D14AGTTGGGCCGGGCCNONE 
Os09g0274100009-112-B02AGTTGGGCCCGCANONE 
AK062823AGTTGGGCCCGCAConserved hypothetical protein. 
Os09g0345700009-020-H05GCCCAACTNONE 
AK073719GCCCAACTConserved hypothetical protein. 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
Os09g0416200AK065807AGTTGGGCSimilar to Glucose transporter (Fragment). 
Os09g0434900AK109104GCCCAACTNONE 
AK120863GCCCAACTZinc finger, RING-type domain containing protein. 
Os09g0454900011-052-B02CCAAGCCCAACTNONE 
016-025-D09CCAAGCCCAACTNONE 
AK102152CCAAGCCCAACTCurculin-like (mannose-binding) lectin domain containing protein. 
J033086D22CCAAGCCCAACTNONE 
Os09g0458400AK070055AGTTGGGCAGCCCACGAAConserved hypothetical protein. 
AK120321AGTTGGGCAGCCCACGAANONE 
J065064N11AGTTGGGCAGCCCACGAANONE 
J065083J06AGTTGGGCAGCCCACGAANONE 
J065121D24AGTTGGGCAGCCCACGAANONE 
J065156I22AGTTGGGCAGCCCACGAANONE 
J065163J24AGTTGGGCAGCCCACGAANONE 
J075001I02AGTTGGGCAGCCCACGAANONE 
J090088O06AGTTGGGCAGCCCACGAANONE 
Os09g0467400AK066610AGTTGGGCCCTProtein of unknown function DUF6, transmembrane domain containing protein. 
Os09g0471900AK073815GCCCGGCCCAACTBacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0475700AK101979AGTTGGGCTGCNONE 
Os09g0482860006-045-G12GCGTGGGCCGCCCAACTNONE 
AK071910GCGTGGGCCGCCCAACTNONE 
AK099026GCGTGGGCCGCCCAACTNONE 
AK105917GCGTGGGCCGCCCAACTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013127L05GCGTGGGCCGCCCAACTNONE 
J065102M20GCGTGGGCCGCCCAACTNONE 
J065119M08GCGTGGGCCGCCCAACTNONE 
Os09g0517800012-034-H10TCCGGCCCAACTNONE 
AK121391TCCGGCCCAACTCyclin-like F-box domain containing protein. 
J023129D04TCCGGCCCAACTNONE 
J043012D11TCCGGCCCAACTNONE 
Os09g0535300AK071211GTGGCCCAACTXAP5 protein family protein. 
Os09g0547200016-021-H03AGTTGGGCCGAGCCGNONE 
AK073078AGTTGGGCCGAGCCGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984AGTTGGGCCGAGCCGNONE 
J065005L05AGTTGGGCCGAGCCGNONE 
J065039C06AGTTGGGCCGAGCCGNONE 
J065116H17AGTTGGGCCGAGCCGNONE 
J100046A17AGTTGGGCCGAGCCGNONE 
Os09g0554000J065123C23ATGGCCCAACTSimilar to Mitochondrial phosphate transporter. 
Os11g0182400016-077-B04AGTTGGGCCGAGNONE 
AK112089AGTTGGGCCGAGCyclin-like F-box domain containing protein. 
Os11g0243400J065155P05AGTTGGGCNONE 
J075178G13AGTTGGGCHypothetical protein. 
Os11g0244200AK107883ATTGGGCCCAACTSimilar to Pisum sativum 17.9 kDa heat shock protein (hsp17.9) (Fragment). 
Os11g0544000AK066017GCCGGCCCAACTCGGCCCAAGConserved hypothetical protein. 
AK071393GCCGGCCCAACTCGGCCCAAGNONE 
J013050C10GCCGGCCCAACTCGGCCCAAGNONE 
J013118O12GCCGGCCCAACTCGGCCCAAGNONE 
Os11g0545000011-025-F09CCCGGCCCAACTCAGCCCAATANONE 
AK058871CCCGGCCCAACTCAGCCCAATAConserved hypothetical protein. 
AK063297CCCGGCCCAACTCAGCCCAATANONE 
AK100607CCCGGCCCAACTCAGCCCAATANONE 
Os11g0549690J065085G07AGTGGGCCGGGCCCAACTConserved hypothetical protein. 
J065218B08AGTGGGCCGGGCCCAACTNONE 
J090036H16AGTGGGCCGGGCCCAACTNONE 
Os11g0557900009-196-H11AGTTGGGCCGGGCNONE 
AK063232AGTTGGGCCGGGCARP2/3 complex 16 kDa subunit (p16-Arc) family protein. 
Os11g0580000AK119421AAGCCCAACTArmadillo-like helical domain containing protein. 
AK121905AAGCCCAACTNONE 
J033105I06AAGCCCAACTNONE 
J090022C10AAGCCCAACTNONE 
J090024J23AAGCCCAACTNONE 
J090044F24AAGCCCAACTNONE 
Os11g0581900AK069449AGCCCAACTProtein of unknown function UPF0005 family protein. 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os11g0619800016-094-C06GCCCAACTNONE 
AK107437GCCCAACTTRAF-like domain containing protein. 
Os12g0109300AK103426GCCCAACTTetratricopeptide-like helical domain containing protein. 
J033128L01GCCCAACTNONE 
Os12g0287200009-067-B11ACAGCCCAACTNONE 
009-130-F06ACAGCCCAACTNONE 
009-185-H10ACAGCCCAACTNONE 
AF338343ACAGCCCAACTNONE 
AK063847ACAGCCCAACTSimilar to Mago nashi protein. 
AK121477ACAGCCCAACTNONE 
J023149H05ACAGCCCAACTNONE 
J065019G18ACAGCCCAACTNONE 
J065049J18ACAGCCCAACTNONE 
J065143C22ACAGCCCAACTNONE 
J075130D23ACAGCCCAACTNONE 
J090014I22ACAGCCCAACTNONE 
J090018A06ACAGCCCAACTNONE 
J090053H11ACAGCCCAACTNONE 
J090080N13ACAGCCCAACTNONE 
J100019H19ACAGCCCAACTNONE 
Os12g0294100AK111535CGGGCCCAACTWD40-like domain containing protein. 
J013030D09CGGGCCCAACTNONE 
J013153J16CGGGCCCAACTNONE 
J033079N17CGGGCCCAACTNONE 
J090002M14CGGGCCCAACTNONE 
J090071M08CGGGCCCAACTNONE 
J090090E07CGGGCCCAACTNONE 
Os12g0481100AK073151GCCGGCCCAACTSimilar to RNA helicase. 
Os12g0508300009-006-G07GAGGCCCAACTNONE 
009-133-E05GAGGCCCAACTNONE 
009-137-F10GAGGCCCAACTNONE 
014-024-A06GAGGCCCAACTNONE 
AK059123GAGGCCCAACTRibosomal protein S14 family protein. 
J100088E22GAGGCCCAACTNONE 
Os12g0599900AK101252CCATGGGCCCAACTTetratricopeptide region domain containing protein. 
J033032F05CCATGGGCCCAACTNONE 
Os12g0624800AK103828AGTTGGGCCATHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.